MÉTODO PARA LA DETECCIÓN DE ALELOS MUTANTES COMBINANDO PCR EN TIEMPO REAL Y REMS-PCR.

Método para detectar la presencia o la ausencia de una secuencia de ADN mutante en una muestra,

comprendiendo el método las etapas de: a) poner en contacto a la muestra con un sistema de oligonucleótidos en condiciones de hibridación para formar una mezcla de reacción, incluyendo dicho sistema de oligonucleótidos un cebador inverso y un cebador mutágeno, en el que i) dicho cebador inverso incluye: - una región del extremo 5' que comprende una secuencia de reconocimiento que puede ser cortada por una endonucleasa de restricción resistente a alta temperatura; teniendo dicha región del extremo 5' unido covalentemente en sus extremos un sistema de detección acoplado, de modo que, cuando la secuencia de reconocimiento es escindida por dicha endonucleasa de restricción resistente a alta temperatura, se genera una señal; - una región del extremo 3' capaz de hibridar con una región complementaria cadena abajo de la supuesta secuencia de ADN mutante; ii) dicho cebador mutágeno comprende: - una región del extremo 5' que comprende una primera secuencia de reconocimiento que puede ser cortada por una endonucleasa de restricción resistente a alta temperatura; - una región del extremo 3' capaz de hibridar con una región complementaria del extremo opuesto de la otra cadena de la secuencia de ADN de muestra, dicho cebador mutágeno tiene una secuencia de modo que se crea una segunda secuencia de reconocimiento que puede ser cortada por la endonucleasa de restricción resistente a alta temperatura, solamente cuando dicho cebador se extiende en la secuencia de tipo silvestre de modo que la endonucleasa de restricción digiere el amplicón y suprime la reacción de amplificación; y dicha segunda secuencia de reconocimiento que puede ser cortada por endonucleasa de restricción resistente a alta temperatura no se polimeriza cuando la secuencia mutante está presente en la muestra de ADN; b) añadir con sustratos y cofactores apropiados, en un entorno iónico y de pH adecuado, tanto una ADN polimerasa resistente a temperatura como dicha endonucleasa de restricción resistente a alta temperatura a dicha mezcla de reacción en condiciones de reacción predeterminadas, tales que, si la secuencia de ADN mutante está presente en la muestra, dicho cebador inverso y dicho cebador mutágeno hibridan con la misma y ceban la reacción de ADN polimerasa para obtener un primer producto amplificado específico; c) ciclar la hibridación de dicho sistema de oligonucleótidos de modo que se extiende un segundo producto amplificado específico que comprende la región del extremo 5' del cebador inverso que forma un sitio de reconocimiento de cadena doble para dicha endonucleasa de restricción de modo que la endonucleasa de restricción resistente a alta temperatura corta específicamente en la secuencia de reconocimiento e induce la generación de una señal por el sistema de detección acoplado; d) detectar la señal generada

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2007/060116.

Solicitante: DIASORIN S.P.A.

Nacionalidad solicitante: Italia.

Dirección: VIA CRESCENTINO 13040 SALUGGIA VC ITALIA.

Inventor/es: ADLERSTEIN,Daniel , SHEHI,Erlet , AMICARELLI,Giulia.

Fecha de Publicación: .

Fecha Solicitud PCT: 24 de Septiembre de 2007.

Clasificación Internacional de Patentes:

  • C12Q1/68B2F
  • C12Q1/68B6

Clasificación PCT:

  • C12Q1/68 SECCION C — QUIMICA; METALURGIA.C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12Q PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS QUE INTERVIENEN ENZIMAS O MICROORGANISMOS (ensayos inmunológicos G01N 33/53 ); COMPOSICIONES O PAPELES REACTIVOS PARA ESTE FIN; PROCESOS PARA PREPARAR ESTAS COMPOSICIONES; PROCESOS DE CONTROL SENSIBLES A LAS CONDICIONES DEL MEDIO EN LOS PROCESOS MICROBIOLOGICOS O ENZIMOLOGICOS. › C12Q 1/00 Procesos de medida, investigación o análisis en los que intervienen enzimas o microorganismos (aparatos de medida, investigación o análisis con medios de medida o detección de las condiciones del medio, p. ej. contadores de colonias, C12M 1/34 ); Composiciones para este fin; Procesos para preparar estas composiciones. › en los que intervienen ácidos nucleicos.

Países PCT: Austria, Bélgica, Suiza, Alemania, Dinamarca, España, Francia, Reino Unido, Grecia, Italia, Liechtensein, Luxemburgo, Países Bajos, Suecia, Mónaco, Portugal, Irlanda, Eslovenia, Finlandia, Rumania, Chipre, Lituania, Letonia, Ex República Yugoslava de Macedonia, Albania.

MÉTODO PARA LA DETECCIÓN DE ALELOS MUTANTES COMBINANDO PCR EN TIEMPO REAL Y REMS-PCR.

Fragmento de la descripción:

INTRODUCCIÓN Las mutaciones somáticas son marcadores útiles para la detección temprana del cáncer (1, 2). Por ejemplo, la mutación Kras (homólogo del oncogén viral de sarcoma de rata Kirsten, v-Ki-ras2) en el codón 12 se produce en diferentes tipos de tumores, tales como adenocarcinoma pancreático, cáncer de pulmón y cáncer 5 colorrectal (3-14). Más adelante se indica la secuencia de Kras (región del exón 1) del número de entrada del Genebank AF285779, McKinzie y Parsons, Mutation Research [Investigación sobre Mutaciones] 517, 209-220, 2002), la secuencia del codón 12 de interés está subrayada: ACTAGGAAAACTGTAACAATAAGAGTGGAGATAGCTGTCAGCAACTTTTGTGAGGGTGTGCTACAGGGTGTAGA10 GCACTGTGAAGTCTCTACATGAGTGAAGTCATGATATGATCCTTTGAGAGCCTTTAGCCGCCGCAGAACAGCAGTCTGGCTATTTAGATAGAACAACTTGATTTTAAGATAAAAGAACTGTCTATGTAGCATTTATGCATTTTTCTTAAGCGTCGATGGAGGAGTTTGTAAATGAAGTACAGTTCATTACGATACACGTCTGCAGTCAACTGGAATTTTCATGATTGAATTTTGTAAGGTATTTTGAAATAATTTTTCATATAAAGGTGAGTTTGTATTAAAAGGTACTGGTGGAGTATTTGATAGTGTATTAACCTTATGTGTGACATGTTCTAATATAGTCACATTTTCATTATTTTTATTATAAGGCCTGCTGAAAAT15 GACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGTGCAGGACCATTCTTTGATACAGATAAAGGTTTCTCTGACCATTTTCATGAGT (SEC ID No 9). La detección de alteraciones génicas de tipo Kras puede representar una herramienta útil para el diagnóstico temprano de neoplasia en muestras clínicas. La detección de dichas mutaciones con fines de cribado de 20 la población, presenta una dificultad debida al gran exceso de ADN de tipo silvestre que se encuentra habitualmente en las muestras clínicas. Este exceso de ADN de tipo silvestre puede agotar reactivos esenciales, enmascarando la señal mutante durante la etapa de detección del ensayo. Por estas razones, las tecnologías habituales utilizadas en este sector presentan una etapa preliminar de supresión del alelo de tipo silvestre (técnica “PCR-clamping” (15)) o enriquecimiento del alelo mutante durante la amplificación (Reacción en cadena de la polimerasa selectiva mediada 25 por endonucleasa de restricción, REMS-PCR (16)), seguida de una etapa de detección para revelar la señal mutante. La mayoría de estos métodos no son convenientes para su utilización en la práctica clínica debido a que el procedimiento con múltiples etapas aumenta el riesgo de contaminaciones y resultados falsos positivos. El documento WO 01/49877 A (JOHNSON & JOHNSON RES PTY LTD [AU]; TODD ALISON VELYIAN [AU]), publicado el 12 de julio de 2001, da a conocer un método para detectar polimorfismos genéticos 30 utilizando una combinación de REMS-PCR y DzyNA PCR. Los documentos CAIRNS J Y OTROS: “Homogeneous real-time detection and quantification of nucleic acid amplification using restriction enzyme digestion” [Detección y cuantificación homogénea en tiempo real de amplificación de ácido nucleico utilizando digestión por enzimas de restricción] BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 318, no 3, publicado el 4 de junio de 2004 y WO 99/28501 A1 35 (SECR DEFENCE [GB]; LEE MARTIN ALAN [GB]), publicado el 10 de junio de 1999, dan a conocer ambos un método para monitorizar la amplificación por PCR utilizando un cebador fluorógeno que tiene una cola 5' con un par fluoróforo-extintor de fluorescencia en sus extremos y un sitio de reconocimiento de endonucleasa de restricción entre ellos. Los autores de la presente invención fueron capaces de establecer una nueva tecnología de 40 amplificación (OCEAN2) que permite la detección y la determinación del genotipo simultáneas de cantidades mínimas del codón 12 mutante de Kras en un gran exceso de ADN de tipo silvestre. La tecnología llamada OCEAN2 (solicitud internacional WO 2007/060707) se refiere a un método para la amplificación y detección simultáneas de ácidos nucleicos. En particular el método para detectar una presencia o una ausencia de una secuencia de ADN objetivo en una muestra, comprende las etapas de: 45 a) poner en contacto a la muestra con un sistema de oligonucleótidos en condiciones de hibridación para formar una mezcla de reacción, incluyendo dicho sistema de oligonucleótidos un primer oligonucleótido y un segundo oligonucleótido, en el que i) como mínimo uno de dichos primer y segundo oligonucleótidos incluye una región del extremo 5' que comprende una secuencia de reconocimiento que puede ser cortada por un agente de 50 escisión resistente a alta temperatura, específico de sitio y de cadena doble, teniendo dicha región del extremo 5' unido covalentemente en sus extremos un sistema de detección acoplado, de modo que, cuando la secuencia de reconocimiento es escindida por dicho agente de escisión resistente a alta temperatura, específico de sitio y de cadena doble, se genera una señal;

ii) dicho primer oligonucleótido comprende una región del extremo 3' capaz de hibridar con una 55

región complementaria de un extremo de una cadena de la secuencia de ADN objetivo; iii) dicho segundo oligonucleótido comprende una región del extremo 3' capaz de hibridar con una región complementaria del extremo opuesto de la otra cadena de la secuencia de ADN objetivo; b) añadir, con sustratos y cofactores apropiados, en un entorno iónico y de pH adecuado, tanto una ADN polimerasa resistente a la temperatura como dicho agente de escisión resistente a alta temperatura, 5 específico de sitio y de cadena doble a dicha mezcla de reacción en condiciones de reacción predeterminadas, tales que, si la secuencia de ácido nucleico objetivo está presente en la muestra, dichos primer y segundo oligonucleótidos hibridan con la misma y ceban la reacción de la ADN polimerasa para obtener un primer producto amplificado específico; c) ciclar la hibridación de dichos primer y segundo oligonucleótidos con dicho producto de amplificación 10 específico de modo que se extienda un segundo producto amplificado específico que comprende la región del extremo 5' del segundo o el primer oligonucleótido, respectivamente, que forma un sitio de reconocimiento de cadena doble para dicho agente de escisión de modo que el agente de escisión resistente a alta temperatura, específico de sitio y de cadena doble corta específicamente en la secuencia de reconocimiento e induce la generación de una señal por el sistema de detección acoplado; 15 d) detectar la señal generada. El agente de escisión resistente a alta temperatura, específico de sitio y de cadena doble es una endonucleasa de restricción resistente a alta temperatura, más preferentemente PspGI, como alternativa TliI, TfiI, BstNI, Apol, BstBI, BstEII, SmlI, TspRI, Tsp45I o BsoBI. El sistema de detección acoplado es un sistema de fluoróforo-extintor de fluorescencia, que tiene 20 preferentemente el extintor de fluorescencia en el extremo 5' y el fluoróforo en el extremo 3' de la región que comprende la secuencia de reconocimiento; teniendo, como alternativa, el extintor de fluorescencia en el extremo 3' y el fluoróforo en el extremo 5' de la región que comprende la secuencia de reconocimiento. Son ejemplos de fluoróforos: Fluoresceína, Tamra, Rojo Texas, Alexa488 (Molecular Probes), Oyster-556 (Flownamics, DeNovo), Oyster-645 (Flownamics, DeNovo), Cy3 (GE-Amersham), Cy5 (GE-Amersham) y 25 Cal610 (Biosearch). Son ejemplos de extintores de fluorescencia: BHQ1 (Biosearch), BHQ2 (Biosearch), Iowa Black FQ (IDTdna), Iowa Black RQ (IDTdna), Eclipse (Epoch/Nanogen) y la serie Qsy (Molecular Probes). La región del extremo 5' del primer y segundo oligonucleótidos comprende además regiones separadoras en su extremo 5' y/o extremo 3'. 30 La secuencia de ADN objetivo es una secuencia específica para un organismo, preferentemente un organismo patógeno, preferentemente un virus, más preferentemente un virus de las siguientes especies: VHC, VHB, VIH, CMVH, VEB, VPH. La ADN polimerasa resistente a temperatura tiene una actividad endonucleasa en 3' reducida o ausente. Como alternativa, la ADN polimerasa resistente a temperatura es capaz de ejercer su actividad 35 polimerizante solamente a alta temperatura. El sistema de oligonucleótidos de OCEAN2 incluye un primer oligonucleótido y un segundo oligonucleótido, en los que i) como mínimo uno de dichos primer y segundo oligonucleótidos incluye una región del extremo 5' que comprende una secuencia de reconocimiento que puede ser cortada por un agente de 40 escisión resistente a alta temperatura, específico de sitio y de cadena doble, teniendo dicha región del extremo 5' unido covalentemente en sus extremos un sistema de detección acoplado, de modo que, cuando la secuencia de reconocimiento es escindida por dicho agente de escisión resistente a alta temperatura, específico de sitio y de cadena doble, se genera una señal; ii) dicho primer...

 


Reivindicaciones:

1. Método para detectar la presencia o la ausencia de una secuencia de ADN mutante en una muestra, comprendiendo el método las etapas de: a) poner en contacto a la muestra con un sistema de oligonucleótidos en condiciones de hibridación para formar una mezcla de reacción, incluyendo dicho sistema de oligonucleótidos un cebador inverso y un 5 cebador mutágeno, en el que i) dicho cebador inverso incluye: - una región del extremo 5' que comprende una secuencia de reconocimiento que puede ser cortada por una endonucleasa de restricción resistente a alta temperatura; teniendo dicha región del extremo 5' unido covalentemente en sus extremos un sistema de detección acoplado, de modo que, cuando la secuencia de reconocimiento es escindida 10 por dicha endonucleasa de restricción resistente a alta temperatura, se genera una señal; - una región del extremo 3' capaz de hibridar con una región complementaria cadena abajo de la supuesta secuencia de ADN mutante; ii) dicho cebador mutágeno comprende: - una región del extremo 5' que comprende una primera secuencia de reconocimiento que puede ser cortada por una endonucleasa de restricción 15 resistente a alta temperatura; - una región del extremo 3' capaz de hibridar con una región complementaria del extremo opuesto de la otra cadena de la secuencia de ADN de muestra, dicho cebador mutágeno tiene una secuencia de modo que se crea una segunda secuencia de reconocimiento que puede ser cortada por la endonucleasa de restricción resistente a alta temperatura, solamente cuando dicho cebador se extiende en la secuencia de tipo silvestre de 20 modo que la endonucleasa de restricción digiere el amplicón y suprime la reacción de amplificación; y dicha segunda secuencia de reconocimiento que puede ser cortada por endonucleasa de restricción resistente a alta temperatura no se polimeriza cuando la secuencia mutante está presente en la muestra de ADN; b) añadir con sustratos y cofactores apropiados, en un entorno iónico y de pH adecuado, tanto una ADN 25 polimerasa resistente a temperatura como dicha endonucleasa de restricción resistente a alta temperatura a dicha mezcla de reacción en condiciones de reacción predeterminadas, tales que, si la secuencia de ADN mutante está presente en la muestra, dicho cebador inverso y dicho cebador mutágeno hibridan con la misma y ceban la reacción de ADN polimerasa para obtener un primer producto amplificado específico; c) ciclar la hibridación de dicho sistema de oligonucleótidos de modo que se extiende un segundo producto 30 amplificado específico que comprende la región del extremo 5' del cebador inverso que forma un sitio de reconocimiento de cadena doble para dicha endonucleasa de restricción de modo que la endonucleasa de restricción resistente a alta temperatura corta específicamente en la secuencia de reconocimiento e induce la generación de una señal por el sistema de detección acoplado; d) detectar la señal generada. 35 2. Método para detectar una presencia o una ausencia de una secuencia de ADN mutante en una muestra, según la reivindicación 1, en el que la endonucleasa de restricción resistente a alta temperatura es PspGI. 3. Método para detectar una presencia o una ausencia de una secuencia de ADN mutante en una muestra, según la reivindicación 2, en el que la secuencia mutante a detectar está en el gen Kras humano. 4. Método para detectar una presencia o una ausencia de una secuencia de ADN mutante en una 40 muestra, según la reivindicación 2, en el que la mutación de la secuencia del gen Kras humano a detectar está en el codón 12, GGT de la secuencia codificante de tipo silvestre de Kras humano. 5. Método para detectar una presencia o una ausencia de una secuencia de ADN mutante en una muestra, según la reivindicación 1, en el que el sistema de detección acoplado es un sistema de fluoróforo-extintor de fluorescencia. 45 6. Método para detectar una presencia o una ausencia de una secuencia de ADN mutante en una muestra, según la reivindicación 5, en el que el sistema de fluoróforo-extintor de fluorescencia tiene el fluoróforo en el extremo 3' y el extintor de fluorescencia en el extremo 5' de la secuencia de reconocimiento. 7. Método para detectar una presencia o una ausencia de una secuencia de ADN mutante en una muestra, según la reivindicación 5, en el que el sistema de fluoróforo-extintor de fluorescencia tiene el fluoróforo en 50 el extremo 5' y el extintor de fluorescencia en el extremo 3' de la secuencia de reconocimiento.

8. Método para detectar una presencia o una ausencia de una secuencia de ADN mutante en una muestra, según la reivindicación 1, en el que la región del extremo 5' del primer y segundo oligonucleótidos

comprende además regiones separadoras en su extremo 5'. 9. Método para identificar una secuencia de ADN mutada específica en una muestra, comprendiendo el método las etapas de: a) poner en contacto a la muestra con un sistema de oligonucleótidos en condiciones de hibridación para formar una mezcla de reacción, incluyendo dicho sistema de oligonucleótidos un cebador inverso y un 5 cebador mutágeno en el que i) dicho cebador inverso incluye: - una región del extremo 5' que comprende una secuencia de reconocimiento que puede ser cortada por una endonucleasa de restricción resistente a alta temperatura; teniendo dicha región del extremo 5' unido covalentemente en sus extremos un sistema de detección acoplado, de modo que, cuando la secuencia de reconocimiento es escindida 10 por dicha endonucleasa de restricción resistente a alta temperatura, se genera una señal; - una región del extremo 3' capaz de hibridar con una región complementaria cadena abajo de la supuesta secuencia de ADN mutante; ii) dicho cebador mutágeno comprende: una región del extremo 5' que comprende una primera secuencia de reconocimiento que puede ser cortada por una endonucleasa de restricción 15 resistente a alta temperatura; - una región del extremo 3' capaz de hibridar con una región complementaria del extremo opuesto de la otra cadena de la secuencia de ADN de muestra, dicho cebador mutágeno tiene una secuencia de modo que una segunda secuencia de reconocimiento que puede ser cortada por la endonucleasa de restricción resistente a alta temperatura se crea solamente cuando dicho cebador se extiende en la secuencia de tipo silvestre de modo que la 20 endonucleasa de restricción digiere el amplicón y suprime la reacción de amplificación; y la secuencia de reconocimiento que puede ser cortada por la endonucleasa de restricción resistente a alta temperatura no se polimeriza cuando la secuencia mutante está presente en la muestra de ADN; y que comprende además un oligonucleótido modificado que tiene una secuencia complementaria 25 a la secuencia de ADN mutada específica a identificar y que es capaz de unirse a dicha secuencia de ADN mutada específica con una mayor afinidad de unión con respecto al oligonucleótido no modificado; b) añadir con sustratos y cofactores apropiados, en un entorno iónico y de pH adecuado, tanto una ADN polimerasa resistente a temperatura como dicha endonucleasa de restricción resistente a alta temperatura a 30 dicha mezcla de reacción en condiciones de reacción predeterminadas, tales que: i) si la secuencia de ADN mutada específica está presente en la muestra, dicho oligonucleótido modificado hibrida con ella y no permite que hibride el cebador mutágeno, bloqueando de este modo la reacción de amplificación; ii) si la secuencia mutada específica no está presente en la muestra, dicho cebador inverso y dicho 35 cebador mutágeno hibridan con la secuencia de ADN permitiendo la reacción como en la reivindicación 1. 10. Método para identificar una secuencia de ADN mutada específica en una muestra, según la reivindicación 9, en el que el oligonucleótido modificado es un ácido nucleico peptídico (ANP). 11. Método para identificar una secuencia de ADN mutada específica en una muestra, según la 40 reivindicación 10, en el que el ANP comprende una secuencia complementaria a la mutación del gen Kras. 12. Método para identificar una secuencia de ADN mutada específica en una muestra, según la reivindicación 11, en el que el ANP comprende una secuencia complementaria a una mutación del codón 12 del gen Kras. 13. Método para identificar una secuencia de ADN mutada específica en una muestra, según la 45 reivindicación 12, en el que el ANP comprende una de las siguientes secuencias: GTT, GAT o TGT.


 

Patentes similares o relacionadas:

INFIDELIDAD DE LA TRANSCRIPCIÓN, SU DETECCIÓN Y SUS USOS, del 3 de Febrero de 2012, de TRANSMEDI SA: Un método para detectar la predisposición o la etapa de un cáncer en un sujeto mamífero, comprendiendo dicho método evaluar in vitro o ex vivo la presencia o la […]

Imagen de 'ANÁLISIS CROMOSÓMICO DE CARIOTIPADO MOLECULAR'ANÁLISIS CROMOSÓMICO DE CARIOTIPADO MOLECULAR, del 31 de Mayo de 2011, de BlueGnome Limited: Un procedimiento de cariotipado de una célula diana humana para detectar desequilibrio cromosómico en la misma, comprendiendo el procedimiento: […]

Imagen de 'CONJUNTO DE CEBADORES, SONDAS, PROCEDIMIENTO Y KIT PARA EL GENOTIPADODEL…'CONJUNTO DE CEBADORES, SONDAS, PROCEDIMIENTO Y KIT PARA EL GENOTIPADODEL POLIMORFISMO GENETICO S19W DEL GEN APO A5, del 30 de Mayo de 2011, de UNIVERSIDAD DE MALAGA: Conjunto de cebadores, sondas, procedimiento y kit para el genotipado del polimorfismo genético S19W del gen APO A5.La presente invención se refiere […]

Imagen de 'PROCEDIMIENTO PARA EL ANÁLISIS DE ÁCIDOS NUCLEICOS AMPLIFICADOS'PROCEDIMIENTO PARA EL ANÁLISIS DE ÁCIDOS NUCLEICOS AMPLIFICADOS, del 19 de Mayo de 2011, de SIEMENS AKTIENGESELLSCHAFT: Procedimiento para el análisis de ácidos nucleicos en un dispositivo microfluídico, cuyo procedimiento presenta las etapas siguientes: a) la […]

Imagen de 'MÉTODO PARA LA DETERMINACIÓN DEL GENOTIPO DE ANTÍGENOS DE CÉLULAS…'MÉTODO PARA LA DETERMINACIÓN DEL GENOTIPO DE ANTÍGENOS DE CÉLULAS DE LA SANGRE Y KIT ADECUADO PARA LA DETERMINACIÓN DEL GENOTIPO DE ANTÍGENOS DE CÉLULAS DE LA SANGRE, del 24 de Febrero de 2011, de STICHTING SANQUIN BLOEDVOORZIENING: Método de determinación del genotipo de antígenos de células de la sangre que comprende someter al ADN de un individuo de una especie de mamífero a […]

Imagen de 'MÉTODO PARA LA DETECCIÓN DE UNA ALTERACIÓN EN UN ÁCIDO NUCLÉICO'MÉTODO PARA LA DETECCIÓN DE UNA ALTERACIÓN EN UN ÁCIDO NUCLÉICO, del 18 de Febrero de 2011, de GENZYME CORPORATION: Un método para detectar una alteración en un ácido nucleico diana que se sospecha que está en una muestra biológica, comprendiendo el método las etapas […]

METODO PARA LA DETECCION DEL RIESGO DE DESARROLLAR VITREORRETINOPATIAPROLIFERANTE (VRP), del 24 de Enero de 2011, de UNIVERSIDADE DE SANTIAGO DE COMPOSTELA UNIVERSIDAD DE VALLADOLID: Método para la detección del riesgo de desarrollar vitreorretinopatía proliferante (VRP).La presente invención se refiere a un método que permite identificar […]

Imagen de 'APARATO PARA LLEVAR A CABO LA PCR Y MONITORIZACIÓN DE LA REACCIÓN…'APARATO PARA LLEVAR A CABO LA PCR Y MONITORIZACIÓN DE LA REACCIÓN EN TIEMPO REAL DURANTE CICLOS DE TEMPERATURA, del 21 de Marzo de 2011, de UNIVERSITY OF UTAH RESEARCH FOUNDATION: Aparato para llevar a cabo la PCR y control de la reacción en tiempo real durante los ciclos de temperatura que comprende: una serie de recipientes […]

Utilizamos cookies para mejorar nuestros servicios y mostrarle publicidad relevante. Si continua navegando, consideramos que acepta su uso. Puede obtener más información aquí. .