CIP 2015 : A61K 39/29 : Virus de la hepatitis.

CIP2015AA61A61KA61K 39/00A61K 39/29[2] › Virus de la hepatitis.

Notas[t] desde A61 hasta A63: SALUD; SALVAMENTO; DIVERSIONES
Notas[n] desde A61K 31/00 hasta A61K 47/00:
  • Una composición, es decir, una mezcla de dos o más componentes, se clasifica en el último de los grupos A61K 31/00 - A61K 47/00 que cubra al menos uno de estos componentes. Los componentes pueden ser compuestos simples u otros ingredientes simples.
  • Cualquier parte de una composición que, en aplicación de la Nota (1), no esté identificada como tal por una clasificación asignada, pero que por sí misma se considere nueva y no obvia, debe clasificarse también en el último lugar apropiado de los grupos A61K 31/00 - A61K 47/00 . La parte puede ser un componente simple o una composición propiamente dicha.
  • Cualquier parte de una composición que, en aplicación de las Notas (1) ó (2), no esté identificada como tal por una clasificación asignada, pero que se considere que representa información de interés para la búsqueda, puede clasificarse además en el último lugar apropiado de los grupos A61K 31/00 - A61K 47/00 . Este caso puede plantearse cuando se considera de interés facilitar las búsquedas de composiciones utilizando una combinación de símbolos de clasificación. Esta clasificación optativa debería ser dada como "información adicional".

A SECCION A — NECESIDADES CORRIENTES DE LA VIDA.

A61 CIENCIAS MEDICAS O VETERINARIAS; HIGIENE.

A61K PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO (dispositivos o métodos especialmente concebidos para conferir a los productos farmacéuticos una forma física o de administración particular A61J 3/00; aspectos químicos o utilización de substancias químicas para, la desodorización del aire, la desinfección o la esterilización, vendas, apósitos, almohadillas absorbentes o de los artículos para su realización A61L;   composiciones a base de jabón C11D).

A61K 39/00 Preparaciones medicinales que contienen antígenos o anticuerpos (materiales para ensayos inmunológicos G01N 33/53).

A61K 39/29 · · Virus de la hepatitis.

CIP2015: Invenciones publicadas en esta sección.

Vacuna para inducir una reacción inmune mejorada.

(10/10/2018). Solicitante/s: Eyegene, Inc. Inventor/es: LEE, NA-GYONG, CHO, YANG, JE, YOO,WON IL, JANG,JIN-WOOK, KIM,KWANG SUNG.

Una composición de vacuna farmacéutica para uso en vacunación contra un virus de influenza, que comprende: (a) antígeno del virus de la influenza; (b) un lipooligosacárido (LOS), donde el LOS se define como un LPS (lipopolisacárido) modificado de bajo peso molecular que tiene glicocadenas más cortas que los LPS naturales y que tienen un peso molecular en un intervalo de 5,000-10,000 Da antes de la desacilación, donde LOS se deriva de Escherichia coli que tiene un peso molecular en el intervalo de 2.000-4.000 Da después de la desacilación, que se desacila mediante la eliminación de LOS de un ácido graso unido a la glucosamina del lípido A a través de un enlace -C(O)O- que da como resultado una reducción significativa de citotoxicidad en comparación con LOS; y (c) un inmunoadyuvante que es hidróxido de aluminio; (d) un transportador farmacéuticamente aceptable.

PDF original: ES-2685585_T3.pdf

Vacunación tumoral que involucra una respuesta inmunitaria contra la proteína propia CLDN18.2.

(09/05/2018). Solicitante/s: Biontech Protein Therapeutics GmbH. Inventor/es: TURECI, OZLEM, SAHIN, UGUR, KOSLOWSKI,MICHAEL, SCHUMACHER,JENS, KLAMP,THORSTEN, HILLER,THOMAS.

Una proteína que comprende la secuencia de aminoácidos expuesta en la sec. con núm. de ident.: 37.

PDF original: ES-2675825_T3.pdf

Vacuna de ADN.

(04/04/2018). Solicitante/s: OSAKA UNIVERSITY. Inventor/es: MORISHITA, RYUICHI, Koriyama,Hiroshi, NAKAGAMI,HIRONORI, NAKAGAMI,FUTOSHI, YOSHIDA,NATSUKI.

Un vector de expresión que codifica un polipéptido del antígeno de la nucleocápsida del virus de la hepatitis B quimérico insertado con una secuencia de aminoácidos que comprende un epitopo específico de angiotensina II, para su uso en un método para el tratamiento o la mejora de la hipertensión en un mamífero, en el que la secuencia de aminoácidos que comprende el epitopo específico se inserta entre los restos aminoácidos 80 y 81 del polipéptido del antígeno de la nucleocápsida del virus de la hepatitis B, en el que la secuencia de aminoácidos que comprende el epitopo específico es la secuencia de aminoácidos mostrada en SEQ ID NO:16, y en el que el vector de expresión comprende además una secuencia inmunoestimuladora (ISS) que consiste en la secuencia de nucleótidos mostrada en SEQ ID NO:22 incorporada en el vector de expresión y que expresa el polipéptido del antígeno de la nucleocápsida del virus de la hepatitis B quimérico en una célula en el mamífero.

PDF original: ES-2668672_T3.pdf

Composiciones inmunoterapéuticas para el tratamiento o prevención de infección por virus de hepatitis delta.

(21/03/2018). Solicitante/s: GLOBEIMMUNE, INC. Inventor/es: APELIAN,DAVID, KING,THOMAS H.

Una composición inmunoterapéutica que comprende: a) un vehículo de levadura; y b) una proteína de fusión que comprende antígenos de VHD, en la que el antígeno de VHD se selecciona de la SEQ ID NO: 34 o SEQ ID NO: 28; y en la que la composición provoca una respuesta inmunitaria específica de VHD cuando se administra a un sujeto.

PDF original: ES-2671381_T3.pdf

Inhibidores macrocíclicos de virus Flaviviridae.

(07/02/2018) Un compuesto de Fórmula I:**Fórmula** o una sal, un isótopo, un estereoisómero, una mezcla de estereoisómeros, un tautómero o un éster del mismo farmacéuticamente aceptables, en donde: A es un grupo alquileno (C1-C2); A1 es alquileno (C1-C5), alquenileno (C2-C5), alquinileno (C2-C5), arileno, heteroarileno, cicloalquileno, heterocicloalquileno, aril-alquileno (C1-C2), heteroarilalquileno (C1-C2), cicloalquilalquileno (C1-C2) o heterocicloalquilalquileno (C1-C2), en donde un átomo de carbono sp3 de A1 está opcionalmente reemplazado por -O-, -S(O)n-, -NH- o -N(alquilo (C1-C4))-, y en donde un átomo de carbono sp3 o sp2 de A1 está opcionalmente sustituido con uno o más grupos seleccionados entre el grupo que consiste…

Lectina de muérdago recombinante y su uso como adyuvante.

(06/09/2017). Solicitante/s: Melema Pharma GmbH. Inventor/es: LENTZEN, HANS, WITTHOHN, KLAUS.

Vacuna que contiene uno o varios antígenos y al menos un adyuvante seleccionado de una lectina de muérdago recombinante con las secuencias de aminoácidos SEQ ID NO. 1 y SEQ ID NO. 4, no presentando la lectina de muérdago recombinante ninguna glicosilación.

PDF original: ES-2647447_T3.pdf

Producto terapéutico basado en levadura para infección por hepatitis B crónica.

(19/07/2017). Solicitante/s: GLOBEIMMUNE, INC. Inventor/es: GUO,ZHIMIN, APELIAN,DAVID, KING,THOMAS H, COESHOTT,CLAIRE.

Una composición inmunoterapéutica que comprende: a) un vehículo de levadura; y 5 b) una proteína de fusión que comprende antígenos del VHB, en la que los antígenos del VHB consisten en: i) un antígeno X del VHB; ii) un antígeno de superficie del VHB; y iii) un antígeno de núcleo del VHB, en la que la proteína de fusión está expresada por el vehículo de levadura.

PDF original: ES-2643389_T3.pdf

Mutantes de la polimerasa de HBV.

(26/04/2017). Solicitante/s: TRANSGENE SA. Inventor/es: SILVESTRE, NATHALIE, MARCHAND,JEAN-BAPTISTE, MARTIN,PERRINE.

Polipéptido mutante que comprende un dominio de polimerasa de HBV mutado con una eliminación interior que interrumpe funcionalmente la actividad de la polimerasa, en el que dicha eliminación interior es de a lo sumo 30 residuos de aminoácidos, comprendiendo dicho dominio de polimerasa mutado la secuencia de aminoácidos representada en SEC ID nº: 1, pero que carece de por lo menos el residuo Tyr en la posición 203, el residuo Met en la posición 204, el residuo Asp en la posición 205, el residuo Asp en la posición 206, el residuo Val en la posición 207, el residuo Val en la posición 208 y el residuo Leu en la posición 209, en el que dicho polipéptido mutante comprende además un dominio de RNasaH mutado que comprende una eliminación de por lo menos 8 aminoácidos y de a lo sumo 60 aminoácidos que incluye por lo menos la parte de la SEC ID nº: 3 que se extiende desde el residuo Glu (E) en la posición 39 al residuo Ala (A) en la posición 46.

PDF original: ES-2632497_T3.pdf

Método de vacunación.

(02/11/2016). Solicitante/s: DBV TECHNOLOGIES. Inventor/es: MONDOULET,LUCIE, SIEGRIST,CLAIRE-ANNE.

La preparación de un antígeno específico para un patógeno infeccioso, para su uso en la amplificación de una respuesta inmunitaria preexistente contra dicho patógeno en un sujeto mamífero, en el que dicha respuesta inmunitaria preexistente resulta de la previa inmunización parenteral o vacunación del sujeto contra dicho patógeno, en la que dicha preparación de antígeno es sin adyuvante y se aplica a la piel intacta del sujeto con un dispositivo de parche de piel, y en el que dicha respuesta inmunitaria amplificada está orientada a Th1.

PDF original: ES-2609839_T3.pdf

Uso de un poxvirus modificado para inducción rápida de inmunidad frente a un poxvirus u otros agentes infecciosos.

(05/10/2016). Solicitante/s: BAVARIAN NORDIC A/S. Inventor/es: CHAPLIN, PAUL, MATEO,LUIS.

Un virus de la vacuna modificado Ankara (MVA) para uso en un método para inmunizar un animal, incluyendo un ser humano, para protegerlo frente a infección por viruela en 2-7 días tras la inmunización, en el que se genera una respuesta inmune protectora frente a la viruela en 2-7 días tras la inmunización, y en el que el MVA es MVA-BN.

PDF original: ES-2608627_T3.pdf

Vacuna de VME suplementada contra meningococo.

(08/06/2016). Solicitante/s: GLAXOSMITHKLINE BIOLOGICALS SA. Inventor/es: PIZZA, MARIAGRAZIA, RAPPUOLI, RINO, GIULIANI,Marzia.

Una composición que comprende (a) una preparación de membrana externa del serogrupo B de N. meningitidis y (b) un componente inmunogénico que comprende una proteína que comprende: (i) SEC ID Nº 2944 como se divulga en el documento WO99/57280, o (ii) una secuencia de aminoácidos que tiene más de un 80 % de identidad de secuencia con la SEQ ID NO: 2944 como se divulga en el documento WO99/57280, en el que la SEQ ID NO: 2944 del documento WO99/57280 tiene la siguiente secuencia de aminoácidos:**Fórmula**.

PDF original: ES-2588917_T3.pdf

Composiciones adyuvantes.

(01/06/2016). Solicitante/s: GLAXOSMITHKLINE BIOLOGICALS SA. Inventor/es: O\'HAGAN, DEREK, VALIANTE,Nicholas.

Una composición que comprende: un inductor de interferón de tipo 1; y un sistema de administración de antígeno, en la que el inductor de interferón de tipo 1 es un ARN bicatenario (ARNbc) y el sistema de administración de antígeno comprende una emulsión de aceite en agua submicrométrica o una micropartícula, en la que la composición proporciona una respuesta inmunitaria aumentada para un antígeno coadministrado en comparación con la administración del antígeno y del inductor de interferón de tipo 1 solos sin el sistema de administración de antígeno, y en la que el antígeno coadministrado está presente en dicha composición de forma opcional.

PDF original: ES-2588006_T3.pdf

Uso de la chaperonina 60.1 de M. tuberculosis para el tratamiento de la artritis.

(04/05/2016). Solicitante/s: Peptinnovate Limited. Inventor/es: COATES,ANTHONY ROBERT.

Una composición farmacéutica para su uso en la prevención y/o tratamiento de la artritis reumatoide, en la que la composición farmacéutica comprende una molécula de ácido nucleico que comprende (i) la secuencia de nucleótidos de la Figura 1, o (ii) una secuencia que tiene más de 70, por ejemplo, 75 %, preferiblemente más de 80 %, por ejemplo más de 90 o 95 % de identidad con la secuencia (i) o una secuencia que hibrida con la secuencia (i) en condiciones de 2 x SSC, 65 °C (en la que SCC ≥ NaCl 0,15 M, citrato sódico 0,015 M, pH 7,2) que codifica una proteína funcionalmente equivalente a la secuencia codificada por la secuencia de nucleótidos de la Figura 1, o (iii) un fragmento de la secuencia (i) o (ii) que codifica un fragmento de proteína funcionalmente equivalente y un excipiente, diluyente o vehículo farmacéuticamente aceptable.

PDF original: ES-2585641_T3.pdf

Microemulsiones con macropartículas adsorbidas.

(06/04/2016). Solicitante/s: NOVARTIS VACCINES AND DIAGNOSTICS, INC.. Inventor/es: SINGH, MANMOHAN, OTT, GARY, S., BARACKMAN, JOHN, KAZZAZ, JINA, O\'HAGAN, DEREK, DONNELLY, JOHN, UGOZZOLI, MILDRED.

Una microemulsión cargada positivamente que tiene una superficie adsorbente para su uso en inducir una respuesta inmune humoral en un animal huésped, dicha emulsión comprendiendo una emulsión de de gotitas de aceite, en la que al menos un 80% (por número) de las gotitas son menores de 1 μm de diámetro, dicha emulsión de microgotitas comprendiendo: (a) un aceite metabolizable; (b) un agente emulsionante; y (c) una proteína inmunogénica como sustancia antigénica: en la que dicho aceite metabolizable es escualeno, en la que dicho agente emulsionante comprende un detergente catiónico y en la que dicha proteína inmunogénica se adsorbe en la superficie de la microemulsión.

PDF original: ES-2579783_T3.pdf

Oligonucleótidos inmunoestimulantes.

(06/04/2016). Solicitante/s: Coley Pharmaceutical Group, Inc. Inventor/es: DAVIS, HEATHER LYNN, WEERATNA,RISINI DHAMMIKA.

Un antígeno y un oligonucleótido inmunoestimulante que comprende la secuencia de nucleótido 5' TCGTCGTTTTTCGGTGCTTTT 3' (SEQ ID NO: 1), para su uso en un procedimiento para inducir una respuesta inmunitaria específica de antígeno en un sujeto que necesita el mismo, comprendiendo dicho procedimiento la administración a un sujeto de dicho antígeno y dicho oligonucleótido inmunoestimulante en una cantidad eficaz para inducir una respuesta inmunitaria específica de antígeno en dicho sujeto.

PDF original: ES-2572563_T3.pdf

Nuevas proteínas de fusión y su aplicación para la preparación de vacunas contra la hepatitis C.

(23/03/2016) Proteína de fusión inmunogénica que comprende por lo menos los dos péptidos siguientes: a)- en el lado C-terminal, un primer péptido constituido: - por la secuencia de aminoácidos de la proteína S de un aislado del virus humano de la hepatitis B (HBV), estando dicha proteína S delecionada de su dominio transmembranario situado en su extremo N-terminal, conservando dicha secuencia de aminoácidos la capacidad de formar unas partículas sub-virales no infecciosas inmunogénicas frente al virus humano de la hepatitis B, o - por una secuencia de aminoácidos que presenta un porcentaje de identidad de por lo menos un 91%, en particular de por lo menos un 93%, particularmente de por lo menos un 95%, y más particularmente…

Compuestos de polímero de polialquileno y usos de éstos.

(23/03/2016) Un conjugado que tiene la estructura según la Fórmula XXIIa: Fórmula XXIIa:**Fórmula** en la que P es un polímero de polialquilen glicol; X es O; Z es un grupo alquilo o heteroalquilo C1 a C20 de cadena lineal o ramificada, saturado o insaturado, alquilo cíclico o heteroalquilo cíclico C3 a C8 saturado o insaturado, un grupo arilo o heteroarilo sustituido o no sustituido o un alcarilo sustituido o no sustituido en el que el alquilo es un grupo alquilo o heteroalcarilo C1 a C20 saturado o insaturado, en el que los sustituyentes se seleccionan del grupo que consiste en halógeno, hidroxilo, carbonilo, carboxilato, éster, formilo, acilo, tiocarbonilo,…

Procedimientos para preparar vesículas y formulaciones producidas a partir de las mismas.

(02/03/2016). Ver ilustración. Solicitante/s: Variation Biotechnologies Inc. Inventor/es: ANDERSON,DAVID E, OGREL,ANDREI.

Un procedimiento que comprende: proporcionar una mezcla fundida de lípidos formadores de vesículas; y añadir la mezcla fundida a una solución acuosa que comprende un antígeno de modo que se forman vesículas que contienen antígeno.

PDF original: ES-2573427_T9.pdf

PDF original: ES-2573427_T3.pdf

Expresión híbrida y en tándem de proteínas procedentes de Neisseria.

(20/01/2016) Una composición que comprende las siguientes proteínas: NH2-A-[X-L-]n-B-COOH, en la que n≥ 2, X1≥ 287, X2≥ 953 961 NH2-A-[X-L-]n-B-COOH, en la que n≥ 2, X1≥ 936, X2≥ 741, en la que 287 es la SEC ID Nº: 3104 del documento WO99/57280 o una proteína que tiene una identidad de secuencia de un 80 % o más con ella, 953 es la SEC ID Nº: 2918 del documento WO99/57280 o una proteína que tiene una identidad de secuencia de un 80 % o más con ella, 961 es la SEC ID Nº: 940 del documento WO99/57280 o una proteína que tiene una identidad de secuencia de un 80 % o más con ella, 936 es la SEC ID Nº: 2884 del documento WO99/57280 o una proteína que tiene una…

Uso de un adyuvante que induce una respuesta inmune Th1 para mejorar las respuestas inmunes.

(06/01/2016). Solicitante/s: Valneva Austria GmbH. Inventor/es: BUSCHLE, MICHAEL, LINGNAU, KAREN, PRINZ,KARIN, HABEL,ANDRE, FRITZ,JÖRG.

Una vacuna para prevenir infecciones virales que comprende - un antígeno viral, - un péptido con la secuencia de aminoácidos KLKL5KLK, y - una molécula de ácido oligodesoxinucleico inmunoestimulante (ODN), en la que el ODN comprende d(IC)13 como se define por la SEQ ID NO. 2.

PDF original: ES-2562456_T3.pdf

Antígeno del núcleo del virus de la hepatitis B (HBcAg) con codones optimizados.

(23/12/2015). Solicitante/s: ChronTech Pharma AB. Inventor/es: SALLBERG, MATTI, FRELIN,LARS.

1.Un ácido nucleico aislado que codifica una proteína de fusión de un antígeno del núcleo del virus de la hepatitis B (HBcAg) derivado de un virus de la hepatitis aviar unido a un antígeno de un virus de la hepatitis C (VHC), donde el 5 ácido nucleico tiene los codones optimizados para su expresión en seres humanos.

PDF original: ES-2566156_T3.pdf

Quimeras del virus del dengue 2 inmunógenas.

(17/12/2015) Composición de flavivirus inmunógena, que comprende (i) una quimera de ácido nucleico que comprende una primera secuencia de nucleótidos que codifica proteínas no estructurales y una proteína de cápside (C) de un virus del dengue 2, en la que la proteína C no incluye el péptido señal C-terminal de la proteína C del dengue 2, y una segunda secuencia de nucleótidos que codifica el péptido señal C-terminal de la proteína C, una proteína de premembrana (prM) y una proteína de la cubierta (E) de un virus del Nilo occidental, o; (ii) un primer ácido nucleico que comprende una secuencia de nucleótidos que codifica una…

Proteína E1E2 del VHC adyuvantada con MF59 más vector de alfavirus que codifica E1E2 del VHC para provocar linfocitos T específicos del VHC.

(16/11/2015) Una primera composición que comprende un complejo de proteína E1E2 del virus de la hepatitis C (VHC) y un adyuvante MF59, para su uso en un procedimiento de estimulación de una respuesta inmunitaria en un sujeto vertebrado, comprendiendo dicho procedimiento: administrar al menos una vez la primera composición a dicho sujeto vertebrado; y posteriormente administrar al menos una vez una segunda composición que comprende un vector de alfavirus que comprende un ácido nucleico que codifica un complejo de E1E2 del VHC a dicho sujeto vertebrado, por la cual el ácido nucleico que codifica un complejo de E1E2 del VHC se expresa en una o más células del sujeto y se produce el complejo de proteína E1E2.

Vacuna contra Streptococcus pneumoniae.

(15/07/2015) Una composición inmunógena que comprende al menos 2 proteínas de S. pneumoniae en la que una de las proteínas es PhtD y la otra proteína es neumolisina destoxificada (Ply).

Anticuerpos dirigidos contra el complejo E1E2 del virus de la hepatitis C y sus epítopos.

(06/05/2015) Utilización de un péptido que comprende una secuencia definida por SEC ID nº 1, SEC ID nº 2 o SEC ID nº 3, para detectar en el suero de un paciente infectado por VHC la presencia de anticuerpos específicos que pueden reaccionar simultáneamente con las tres regiones de E1 y E2 reconocidas por el anticuerpo monoclonal secretado por el hibridoma depositado en la CNCM (Collection Nationale de Culture de Microorganismes, Institut Pasteur, París, Francia) el 19 de marzo de 2003, bajo el número de acceso CNCM 1-2983, en el que dichas tres regiones de E1 y E2 están constituidas por cada una de las secuencias siguientes: - los aminoácidos 297 a 306 de la proteína E1 del VHC (SEC ID nº 1); - los aminoácidos 480 a 494 de…

Composición para la prevención/el tratamiento de infecciones con HBV y de enfermedades mediadas por HBV.

(06/05/2015) Uso de una composición, que contiene al menos dos antígenos de superficie del virus de hepatitis B (HBsAg's), fragmentos de los mismos, que contienen un epítope de célula T, en cuyo caso los fragmentos de los al menos dos HBsAgs tienen conjuntamente al menos 10 aminoácidos, aunque en se diferencian uno de otro al menos por un aminoácido, y/o estos ácidos nucleicos codificantes, en cuyo caso los HBsAgs se componen de la proteína S (pequeño antígeno de superficie de HBV) y en cuyo caso los HBsAgs se diferencian en el genotipo del virus de hepatitis B (HBV) en la región S de HbsAg, y en cuyo caso la composición no contiene antígeno de núcleo de HBV (HBcAg) o este ácido nucleico codificante, para la producción de un medicamento…

Estabilización de composiciones acuosas de proteínas con tampones de desplazamiento.

(04/03/2015) Un recipiente hermético que contiene una composición acuosa que comprende una proteína y dos tampones de desplazamiento, en la que un tampón de desplazamiento tiene un pKa que es al menos 1 unidad mayor que el pH de la composición, y un tampón de desplazamiento tiene un pKa que es al menos 1 unidad inferior al pH de la composición, fijándose dicho pH de la composición a un valor al que la composición tiene una estabilidad máxima medible con respecto al pH, en la que uno de los tampones es TRIS, con la condición de que dicha composición contenga no más de 2 mM de un tampón convencional con un pKa que esté dentro de una unidad de pH del pH de la composición, y en la que cada tampón de desplazamiento esté presente a una concentración de 2 a 200 mM.

Nuevos lipopéptidos inmunógenos que comprenden epítopos de linfocitos T auxiliares y de linfocitos T citotóxicos (CTL).

(17/12/2014) Un lipopéptido que comprende un polipéptido conjugado a uno o más restos lipídicos, en el que: (i) dicho polipéptido comprende una secuencia de aminoácidos que comprende: (a) la secuencia de aminoácidos de un epítopo de linfocitos T auxiliares (Th) y la secuencia de aminoácidos de un epítopo de linfocitos T citotóxicos (CTL), en el que dichas secuencias de aminoácidos son diferentes; y (b) uno o más restos de lisina interna para la unión covalente de cada uno de dichos restos lipídicos a través del grupo amino en épsilon de dicha lisina; y (ii) cada uno de dicho uno o más restos lipídicos se une covalentemente al polipéptido a través de un grupo amino en épsilon de dicho uno o más restos de lisina interna; en el que el resto de lisina interna al que…

Vacunas contra la malaria.

(03/12/2014) El uso de un antígeno de Plasmodium o un fragmento inmunogénico o fragmentos inmunogénicos del mismo y un adyuvante que comprende 3D-MPL y QS21 en una formulación de liposoma, en la fabricación de un medicamento para inmunizar viajeros a regiones endémicas contra infección productiva por malaria, en el que el antígeno de Plasmodium es la proteína circumsporozoíto (CS) o un fragmento inmunogénico o fragmentos inmunogénicos de la misma capaces de provocar una respuesta inmunitaria contra Plasmodium y en el que la proteína CS o un fragmento de la misma está fusionada con el antígeno de superficie de la hepatitis B (HBsAg).

Fabricación de vacunas amplificadoras que tienen dosis de antígeno reducidas.

(26/11/2014) Un procedimiento de fabricación de una vacuna, en el que la vacuna comprende toxoide diftérico y toxoide tetánico, y en el que el procedimiento comprende las etapas de combinar (i) un primer volumen que comprende toxoide diftérico y toxoide tetánico a una relación de difteria: tétanos entre 2 : 1 y 3 : 1 (medida en unidades Lf) con (ii) un segundo volumen que comprende toxoide tetánico pero no toxoide diftérico.

Vacuna del VHB y procedimiento de preparación de la misma.

(19/11/2014) Una vacuna del VHB que comprende un antígeno de superficie del VHB completo recombinante (L-HBsAg) y antígeno del núcleo del VHB, en la que el antígeno de superficie completo consiste en tres tipos de proteína de superficie (proteína L, proteína M y proteína S) y los antígenos preS producidos que consisten en preS1 y presS2 se localizan en la superficie externa de partículas formadas por enlaces entre antígenos S, y en la que la vacuna comprende alumbre y oro coloidal como un adyuvante

VECTORES RECOMBINANTES BASADOS EN EL VIRUS MODIFICADO DE ANKARA (MVA) COMO VACUNAS PREVENTIVAS Y TERAPÉUTICAS CONTRA LA HEPATITIS C.

(09/10/2014). Ver ilustración. Solicitante/s: CONSEJO SUPERIOR DE INVESTIGACIONES CIENTIFICAS (CSIC). Inventor/es: GOMEZ RODRIGUEZ, CARMEN ELENA, ESTEBAN RODRIGUEZ,MARIANO, PERDIGUERO DE LA TORRE,Beatriz.

Los virus recombinantes de la invención contienen secuencias que se encuentran insertadas en el mismo sitio de inserción del MVA y que permiten la expresión simultáneamente de varios antígenos del VHC, concretamente las proteínas maduras estructurales (Core, E1, E2 y p7) y no estructurales (NS2, NS3, NS4A, NS4B, NS5A más los 201 aminoácidos de la región N-terminal de NS5B). Con ello se consiguen virus recombinantes estables, que permiten el desencadenamiento de una respuesta inmune contra una gran variedad de antígenos del VHC, adecuados para ser utilizados como vacunas preventivas y terapéuticas contra la hepatitis C.

1 · · 3 · 4 · 5 · ››

 

Patentes más consultadas

 

Clasificación Internacional de Patentes 2015