CIP 2015 : C12N 15/54 : Transferasas (2).

CIP2015CC12C12NC12N 15/00C12N 15/54[4] › Transferasas (2).

Notas[t] desde C01 hasta C14: QUIMICA

C SECCION C — QUIMICA; METALURGIA.

C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.

C12N MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN (biocidas, productos que repelen o atraen a los animales nocivos, o reguladores del crecimiento de los vegetales, que contienen microorganismos virus, hongos microscópicos, enzimas, productos de fermentación o sustancias obtenidas por o extraídas de microorganismos o sustancias animales A01N 63/00; preparaciones de uso médico A61K; fertilizantes C05F ); PROPAGACION,CULTIVO O CONSERVACION DE MICROORGANISMOS; TECNICAS DE MUTACION O DE INGENIERIA GENETICA; MEDIOS DE CULTIVO (medios para ensayos microbiológicos C12Q 1/00).

C12N 15/00 Técnicas de mutación o de ingeniería genética; ADN o ARN relacionado con la ingeniería genética, vectores, p. ej. plásmidos, o su aislamiento, su preparación o su purificación; Utilización de huéspedes para ello (mutantes o microorganismos modificados por ingeniería genética C12N 1/00, C12N 5/00, C12N 7/00; nuevas plantas en sí A01H; reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00; nuevas razas animales en sí A01K 67/00; utilización de preparaciones medicinales que contienen material genético que es introducido en células del cuerpo humano para tratar enfermedades genéticas, terapia génica A61K 48/00; péptidos en general C07K).

C12N 15/54 · · · · Transferasas (2).

CIP2015: Invenciones publicadas en esta sección.

Microorganismo con productividad de l-lisina aumentada y procedimiento para producir l-lisina utilizando el mismo.

(27/05/2020). Solicitante/s: CJ CHEILJEDANG CORPORATION. Inventor/es: LEE,KWANG HO, MOON,JUN OK, PARK,SANG HEE.

Una subunidad beta prima (subunidad-β') mutante de la ARN polimerasa, en la que la subunidad beta prima (subunidad-β') mutante de la ARN polimerasa tiene una secuencia de aminoácidos seleccionada del grupo que consiste en las SEQ ID NO: 8, 9, 11, 14, 15, 20, 23, 24, 25 y 26.

PDF original: ES-2802949_T3.pdf

Construcción de nuevas variantes de dextransacarasa DSR-S por ingeniería genética.

(06/05/2020). Solicitante/s: CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE. Inventor/es: MONSAN, PIERRE, REMAUD-SIMEON,MAGALI, POTOCKI-VERONESE,GABRIELLE, MOULIS,CLAIRE.

1. Una dextransacarasa que consiste en una secuencia que tiene el 90 %, el 95 % o el 98 % de similitud de secuencia con una secuencia de aminoácidos seleccionada del fragmento del aminoácido en la posición 125 al aminoácido en la posición 1423 de SEQ ID NO: 6 y como se define en SEQ ID NO: 22, el fragmento del aminoácido en la posición 125 al aminoácido 1335 de SEQ ID NO: 7 y como se define en SEQ ID NO: 23, el fragmento del aminoácido en la posición 125 al aminoácido en la posición 1136 de SEQ ID NO: 8 y como se define en SEQ ID NO: 24, el fragmento del aminoácido en la posición 125 al aminoácido en la posición 1006 de SEQ ID NO: 9 y como se define en la SEQ ID NO: 25, y el fragmento del aminoácido en la posición 125 al aminoácido en la posición 1423 de SEQ ID NO: 10 y como se define en SEQ ID NO: 26, en donde la actividad enzimática de los dextranos que se forman se mantiene y en donde la dextransacarasa conserva su especificidad para sintetizar enlaces alfa-1,6.

PDF original: ES-2800724_T3.pdf

Procedimiento para producir 7-deshidrocolesterol y vitamina D3.

(27/11/2019). Solicitante/s: KYOWA HAKKO BIO CO., LTD. Inventor/es: MITSUHASHI, SATOSHI, UJIHARA,TETSURO.

Procedimiento para producir 7-deshidrocolesterol (en adelante, "7DHC"), que comprende: cultivar, en un medio, un microorganismo de Labyrinthulea que produce 7DHC en el que la actividad de esterol 24-C-metiltransferasa (en adelante, "actividad de SMT") se pierde en comparación con una cepa madre; permitir que se produzca y acumule 7DHC en el cultivo; y recoger el 7DHC del cultivo.

PDF original: ES-2772650_T3.pdf

ADN polimerasas quiméricas.

(12/06/2019) Una ADN polimerasa quimérica que comprende: una primera secuencia al menos un 90% idéntica a los residuos aminoacídicos 156 a 301 de SEQ IN NO: 11; una segunda secuencia al menos un 90 % idéntica a los residuos aminoacídicos 394 a 563 de SEQ. ID NO: 9; una tercera secuencia al menos un 90 % idéntica a los residuos aminoacídicos 26 a105 de SEQ IN NO: 11; y una cuarta secuencia al menos un 90% idéntica a los residuos aminoacídicos 612 a 749 de SEQ ID NO: 11; en la que ADN polimerasa quimérica se caracteriza por (a) una tasa de error menor de 4,45 x 10 6 mutaciones mutaciones/nt/duplicación, (b) una procesividad mayor de 20 nucleótidos, (c) una tasa de alargamiento de más de 25 nts, (d) una capacidad para mantener la actividad enzimática…

Transaminasa y utilización de la misma.

(15/05/2019). Solicitante/s: Asymchem Laboratories (Tianjin) Co., Ltd. Inventor/es: ZHANG,YAN, GAO,FENG, LI,YANJUN, HONG,HAO, LI,SHAOHE.

Transaminasa o compuesto modificado, o fragmento funcional de la misma, en la/el que una secuencia de aminoácidos de la transaminasa comprende una secuencia seleccionada de entre una de las secuencias siguientes: a) una secuencia de aminoácidos como se muestra en SEC ID nº: 2 o 4; b) una secuencia de aminoácidos adquirida sustituyendo leucina en el sitio 38º de la secuencia de aminoácidos como se muestra en SEC ID nº: 2 por isoleucina, en la/el que el compuesto modificado de la transaminasa es un producto de acilación, alquilación, o PEGilación, que mantiene la actividad de la transaminasa con la actividad catalítica altamente estereoselectiva de configuración R, y el fragmento funcional se refiere a un fragmento proteínico que mantiene la actividad de la transaminasa con la actividad catalítica altamente estereoselectiva de configuración R, en la/el que altamente estereoselectiva se refiere al contenido de uno de los estereoisómeros que es por lo menos 1.1 veces el del otro.

PDF original: ES-2734579_T3.pdf

ADN POLIMERASAS INDEPENDIENTES DE CEBADOR Y SU USO PARA LA SINTESIS DE ADN.

(24/04/2019). Solicitante/s: CONSEJO SUPERIOR DE INVESTIGACIONES CIENTIFICAS. Inventor/es: SALAS FALGUERAS, MARGARITA, REDREJO RODRÍGUEZ,Modesto, KRUPOVIC,Mart, FORTERRE,Patrick.

ADN polimerasas independientes de cebador y su uso para la síntesis de ADN. La presente invención proporciona un péptido aislado de SEQ ID NO: 1, necesario para la actividad primasa, así como nuevas enzimas ADN polimerasas replicativas, preferiblemente la de SEQ ID NO: 2, que comprenden dicho péptido. Por tanto, estas ADN polimerasas están dotadas de actividad primasa y no requieren cebadores proporcionados externamente para iniciar y realizar la amplificación de ADN. Estas polimerasas son capaces de llevar a cabo una síntesis de ADN de novo fiable y procesiva de moldes de ADN en ausencia de cebadores pre-sintetizados. Por lo tanto, estas enzimas actúan como primasas y ADN polimerasas. Asimismo, muestran capacidad de síntesis de translesión, pudiendo ser útiles no solo para la amplificación del genoma completo sino también para la amplificación de ADN dañados. La invención se refiere además a métodos para amplificar ADN moldes que usan estas enzimas.

PDF original: ES-2710321_A1.pdf

Microorganismo que produce O-succinil homoserina y método para producir O-succinil homoserina usando el mismo.

(27/02/2019). Solicitante/s: CJ CHEILJEDANG CORPORATION. Inventor/es: Shin,Yong Uk, KIM,SO-YOUNG, UM,HYE-WON, HEO,IN KYUNG, SEO,CHANG IL, NA,KWANG HO.

Una O-succinilhomoserina que produce un microorganismo de Escherichia sp. que expresa un polipéptido, que tiene una resistencia a la inhibición por retroalimentación por metionina y una actividad de homoserina O-succiniltransferasa, en la que el polipéptido tiene una secuencia de aminoácidos representada por la SEC ID NO: 29.

PDF original: ES-2717939_T3.pdf

Microorganismo productor de diamina y método para producir diamina usando el mismo.

(20/02/2019). Solicitante/s: CJ CHEILJEDANG CORPORATION. Inventor/es: YANG,Young-lyeol, UM,HYE-WON, LEE,KYOUNG MIN, PARK,SU-JIN, JUNG,HEE KYOUNG, LI,HONG XIAN.

Un microorganismo para producir diamina, en el que la actividad de una proteína que tiene una secuencia de aminoácidos seleccionada de la SEQ ID NO: 6, SEQ ID NO: 22 o SEQ ID NO: 24, se introduce o se mejora dentro del microorganismo, en comparación con la actividad endógena.

PDF original: ES-2717600_T3.pdf

Polipéptidos de transaminasa modificados por biocatálisis industrial.

(19/12/2018). Solicitante/s: Codexis, Inc. Inventor/es: SMITH,DEREK, QUINTANAR-AUDELO,MARTINA, EBERHARD,ELLEN, NAZOR,JOVANA, WANG,CUIXIA.

Un polipéptido modificado que tiene actividad transaminasa que comprende una secuencia de aminoácidos que tiene al menos un 80% de identidad de secuencia con la secuencia de referencia de la SEQ ID NO: 2 y diferencias de residuos de aminoácidos en comparación con la SEQ ID NO: 2 de X155T/I/V/K/A/L y X42A/G.

PDF original: ES-2694327_T3.pdf

Antígeno de gliadina desamidada recombinante.

(31/10/2018). Solicitante/s: BIO-RAD LABORATORIES, INC.. Inventor/es: SHAN,DAMING, WALKER,ROGER, LU,YABIN, DESAI,URVEE.

Un antígeno para detectar la enfermedad celíaca que comprende una proteína gliadina desamidada recombinante o sintética que comprende un hexámero de péptidos, en el que cada péptido tiene la secuencia de SEQ ID NO: 1.

PDF original: ES-2688268_T3.pdf

Uso de "policétido sintasas" de tipo III (PKS III) recombinantes de algas pardas marinas.

(25/10/2018) Procedimiento para producir al menos un compuesto polifenólico, en el que: - una policétido sintasa de tipo III (PKSIII) de alga parda se pone en contacto con al menos un sustrato carbonoso en condiciones que permitan la producción mayoritaria de al menos un compuesto polifenólico, caracterizado por que dicha PKSIII comprende o consiste en: - la secuencia de aminoácidos de SEQ ID NO: 1 o una secuencia que tiene al menos un 93 % de identidad con SEQ ID NO: 1, o una secuencia que puede codificarse por la secuencia de nucleótidos SEQ ID NO: 2 o una secuencia que tiene al menos un 85 % de identidad con SEQ ID NO: 2, o - la secuencia de aminoácidos de SEQ ID NO: 3 o una secuencia que tiene al menos un 93 % de identidad…

Moléculas de ácidos nucleicos que codifican una dextrano-sacarasa que cataliza la síntesis de dextrano que porta ramificaciones de tipo alfa-1,2 osídicas.

(11/04/2018) Utilización de una glucosiltransferasa capaz de formar dextranos que presentan ramificaciones α(1 Utilización de una glucosiltransferasa capaz de formar dextranos que presentan ramificaciones α(1 → 2) a partir de sacarosa, de α-D-fluoro-glucosa, de para-nitrofenil-α-D-glucopiranósido, de α-D-glucopiranósido-αDsorbofuranósido o de 4-O-α-D-galactopiranosilsacarosa, en la fabricación de una composición medicinal con efecto prebiótico destinada a mejorar el tránsito intestinal en animales o en el ser humano, comprendiendo dicha glucosiltransferasa una secuencia señal, una región variable, un primer dominio catalítico, un dominio de unión a glucano y un segundo dominio catalítico en la parte carboxílica de la…

Gen de histidina quinasa de tipo híbrido aislado a partir de arroz índica IR64.

(14/03/2018) Un procedimiento para el aislamiento del gen de histidina quinasa de tipo híbrido - OsHK3b a partir de arroz índica IR64 para su uso en la mejora de la tolerancia al estrés por salinidad y al estrés por sequía de las plantas de cultivo mediante la sobreexpresión del OsHK3b, caracterizado por (i) tratamiento de ADNc aislado de plantas de semillero IR64 con cebador directo OsHk3bF y cebador inverso OsHk3bR mediante reacción en cadena de la polimerasa (PCR) para producir el gen de histidina quinasa de tipo híbrido amplificado aislado - OsHK3b, (ii) clonación del gen aislado - OsHK3b en el vector TOPO-TA2.1 para producir plásmido recombinante pTOPOOsHK3b, en el que el gen de histidina quinasa de tipo híbrido - OsHK3b se aísla de su plásmido pTOPO-OSHK3b, en el que dicho cebador directo OsHk3bF se identifica como 5'ATGACGTTCGCGAGGTACGC3', …

Fermentación de azúcares de pentosa.

(24/01/2018). Solicitante/s: DSM IP ASSETS B.V.. Inventor/es: OP DEN CAMP,HUBERTUS,JOHANNES,MARIE, HARHANGI,HARRY,RAMANOEDJ, VAN DER DRIFT,CHRISTIAAN, PRONK,JACOBUS THOMAS.

Célula huésped eucariótica transformada con un constructo de ácidos nucléicos que comprende una secuencia de nucleótidos, la cual a su vez codifica una xilosa isomerasa que comprende una secuencia de aminoácidos con al menos un 70% de identidad de secuencia con la secuencia de aminoácidos de SEQ ID No. 1, como se determinó usando un algoritmo de Needleman y Wunsch, donde el constructo de ácidos nucléicos en la transformación de la célula huésped confiere a la célula huésped la capacidad de crecer en xilosa como fuente de carbono.

PDF original: ES-2319757_T3.pdf

PDF original: ES-2319757_T5.pdf

Producción de ácido mucónico a partir de microorganismos modificados genéticamente.

(27/12/2017). Solicitante/s: Myriant Corporation. Inventor/es: PERO, JANICE G., YOCUM,R.,Rogers, GONG,WEI, DOLE,SUDHANSHU, SILLERS,RYAN, GANDHI,MEGHAL, SPENCER,MICHELLE.

Un microorganismo modificado genéticamente que produce ácido cis,cis-mucónico a partir de una fuente de carbono no aromático, que comprende un gen que codifica una enzima shikimato deshidrogenasa con pérdida de función parcial, en donde dicha enzima shikimato deshidrogenasa con pérdida de función parcial confiere prototrofia a los aminoácidos aromáticos y vitaminas, pero sin conducir a una secreción significativa de compuestos aromáticos.

PDF original: ES-2663445_T3.pdf

Método para la producción in situ de un emulsionante en un producto alimenticio.

(13/12/2017). Solicitante/s: Dupont Nutrition Biosciences ApS. Inventor/es: MADRID, SUSAN MAMPUSTI, de KREIJ,Arno , MIKKELSEN,Jørn,Dalgaard , SØE,Jørn,Borch .

Un método para la producción in situ de un emulsionante en un producto alimenticio compuesto de 10-98% de agua, en donde el método comprende la etapa de añadir una lípido aciltransferasa al producto alimenticio, y en donde la lípido aciltransferasa comprende una secuencia de aminoácidos que tiene una identidad de 75% o más con una cualquiera de las secuencias mostradas como SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 o SEQ ID NO: 12.

PDF original: ES-2661213_T3.pdf

Prevención y tratamiento de la infección por Mycobacterium.

(04/10/2017). Solicitante/s: THE UNIVERSITY OF SYDNEY. Inventor/es: TRICCAS,JAMES ANTHONY, PINTO-NADANACHANDRAN,RACHEL, BRITTON,WARWICK JOHN.

Una proteína recombinante o sintética que incluye: - una primera región que tiene una secuencia codificada por un gen que codifica un componente de una vía de asimilación de sulfato de Mycobacterium (SAP), en la que el gen es un gen Mycobacterium CysD que tiene al menos un 75% de identidad con la SEQ ID NO: 1; y - una región adicional que tiene una secuencia codificada por un gen de Mycobacterium Ag85B que tiene una secuencia como se muestra en la SEQ ID NO: 5.

PDF original: ES-2655190_T3.pdf

Métodos para modular la conductancia de estomas y las construcciones de expresión de plantas para ejecutarlos.

(06/09/2017). Solicitante/s: The State of Israel, Ministry of Agriculture and Rural Development, Agricultural Research Organisation, Volcani Center. Inventor/es: GRANOT,DAVID, KELLY,GILOR, MOSHELION,MENACHEM.

Una construcción de expresión de planta que comprende una secuencia de ácido nucleico que codifica una hexoquinasa de tipo B bajo un control transcripcional de un elemento regulador que actúa en cis específico de células de guarda.

PDF original: ES-2651244_T3.pdf

Variante de polipéptido que tiene actividad homoserina acetiltransferasa y microorganismo que expresa el mismo.

(06/09/2017). Solicitante/s: CJ CHEILJEDANG CORPORATION. Inventor/es: Shin,Yong Uk, KIM,SO-YOUNG, HEO,IN KYUNG, KIM,HYUN AH, KIM,JU EUN, SEO,CHANG IL, SON,SUNG KWANG, LEE,HAN JIN, NA,KWANG HO.

Un polipéptido modificado que tiene actividad homoserina O-acetiltransferasa que tiene la secuencia de aminoácidos de la SEQ ID NO: 17 o al menos el 95 % de homología con la misma, en la que el aminoácido en la posición 111 a partir del aminoácido inicial metionina, de la secuencia se sustituye con ácido glutámico y el aminoácido en la posición 112 de la secuencia se sustituye con treonina o histidina.

PDF original: ES-2650451_T3.pdf

Método enzimático para aminación (R)-selectiva.

(30/08/2017) Un método para la síntesis enzimática de una (R)-amina enriquecida enantioméricamente de fórmula general [1][c] **Fórmula** a partir de la cetona correspondiente de la fórmula general [1][a] **Fórmula** y un donante amino adecuado, en el que R1 y R2 son diferentes y son independientemente alifáticos lineales o ramificados, aromáticos, heteroaromáticos o forman una estructura cíclica, usando una transaminasa seleccionada del grupo que consiste en a. una proteína que tiene al menos un 90 % de identidad con la secuencia de aminoácidos de la SEQ ID No. 1; b. una proteína que tiene al menos un 90 % de identidad con la secuencia de aminoácidos de la SEQ ID No. 3; c. una proteína que tiene al menos un 90 % de identidad con la secuencia de aminoácidos de la SEQ ID No. 5; d. una proteína que…

Un gen que codifica un mutante de glucoquinasa humana, y usos del mismo en el tratamiento o la prevención de una enfermedad.

(30/08/2017). Solicitante/s: Yiyuan (Shenzhen) Biotech Limited. Inventor/es: HUANG,HAIDONG.

Un gen que codifica glucoquinasa humana aislado, caracterizado porque dicho gen tiene la secuencia de nucleótidos tal como se muestra en la SEQ ID NO: 2.

PDF original: ES-2649021_T3.pdf

Plantas transgénicas que tienen alterada la actividad de la sintetasa DAHP.

(23/08/2017). Solicitante/s: YEDA RESEARCH AND DEVELOPMENT CO. LTD.. Inventor/es: AHARONI,Asaph, GALILI,GAD, TZIN,VERED, MALITSKY,SERGEY, ROGACHEV,ILANA.

Una planta transgénica que comprende al menos una célula vegetal que comprende un polinucleótido exógeno que codifica sintasa de 3-desoxi-D-arabino-heptulosonato-7-fosfato (DAHPS) que tiene al menos una mutación puntual en una posición seleccionada del grupo que consiste de posición 150, 175, 179 y 209 del tipo salvaje de E. coli AroG DAHPS que tiene la secuencia de aminoácidos expuesta en la SEQ ID NO: 1, donde dicha al menos una mutación puntual reduce la sensibilidad a la inhibición por retroalimentación por fenilalanina, y en la que la planta transgénica comprende una cantidad incrementada de dicha fenilalanina en comparación con una planta no transgénica correspondiente.

PDF original: ES-2648259_T3.pdf

Genes que producen hidrocarburos y métodos para su uso.

(02/08/2017). Solicitante/s: REG Life Sciences, LLC. Inventor/es: FRIEDMAN,LISA, DA COSTA,BERNARDO.

Célula modificada genéticamente para expresar una secuencia de ácido nucleico aislada que codifica para un polipéptido de OleA que comprende una secuencia de aminoácidos que tiene una identidad de secuencia de al menos el 85% con SEQ ID NO: 2, en la que la célula es una célula de levadura, una célula fúngica, una célula de animal no humano, una célula de insecto, una célula bacteriana o una célula de algas, y en la que el polipéptido de OleA está implicado en la biosíntesis de cetonas alifáticas u olefinas.

PDF original: ES-2646815_T3.pdf

Preparaciones médicas para el tratamiento de deficiencia de alfa-galactosidasa A.

(31/05/2017). Solicitante/s: Shire Human Genetic Therapies, Inc. Inventor/es: SELDEN, RICHARD, F., BOROWSKI, MARIANNE, KINOSHITA, CAROL, M., TRECO, DOUGLAS, A., WILLIAMS, MELANIE, D., SCHUETZ, THOMAS J., DANIEL,PETER FRANCIS.

Una preparación de α-Gal A glicosilada humana que tiene una carga de oligosacáridos aumentada, en donde entre el 35% y el 85% de los oligosacáridos se cargan por la adición de : (i) uno a cuatro residuos de ácido siálico en glicanos complejos, (ii) uno a dos restos de fosfato en glicanos alta-manosa, o (iii) un único fosfato y un único ácido siálico en glicanos híbridos, para su uso en el tratamiento de deficiencia de α-Gal A a una dosis semanal o bisemanal de entre 0,05 mg a 5,0 mg de la preparación de α-Gal A por kg de peso corporal de un sujeto.

PDF original: ES-2634317_T3.pdf

Método y medios de modulación de la muerte celular programada en células eucariotas.

(24/05/2017) Un método de producción de una planta con resistencia potenciada a condiciones adversas, comprendiendo dicho método introducir un gen quimérico en dicha célula de planta o planta por transformación, en el que dicho gen quimérico comprende las siguientes regiones de ADN operativamente unidas: a) un promotor expresable en plantas; b) una región de ADN, que cuando se transcribe da una molécula de ARN, en la que dicha molécula de ARN cuando está siendo traducida en un péptido o proteína inhibe PARP de clase NAP o ZAP o ambas en células de dicha planta, en la que dicha molécula de ARN codifica un mutante de PARP negativo dominante que cuando se expresa en células de dicha planta reduce la actividad aparente de la proteína PARP codificada por un gen PARP endógeno, en la…

Glucosiltransferasa de hámster chino y métodos relacionados.

(14/09/2016). Solicitante/s: MOMENTA PHARMACEUTICALS, INC. Inventor/es: MEADOR III,JAMES W.

Una molécula de ácido nucleico aislada que codifica un polipéptido que produce estructuras de Gal-alfa-Gal, en la que la molécula de ácido nucleico aislada está seleccionado del grupo que consiste en: (i) una molécula de ácido nucleico aislada que comprende una secuencia de nucleótidos que tiene al menos el 90 % de identidad de secuencias con (a) una molécula de ADN que tiene una secuencia que codifica la secuencia de restos de aminoácidos de SEQ ID NO: 2, o SEQ ID NO: 4 o SEQ ID NO: 7 o (b) el complemento de la molécula de ADN de (a); y (ii) una molécula de ácido nucleico aislada que tiene al menos el 90 % de identidad de secuencias con la secuencia de SEQ ID NO: 1 o SEQ ID NO: 3 o SEQ ID NO: 5 o SEQ ID NO: 6, o un complemento de la misma.

PDF original: ES-2605677_T3.pdf

Microorganismo con productividad potenciada de L-lisina y procedimiento de producción de L-lisina usando el mismo.

(24/08/2016). Solicitante/s: CJ CHEILJEDANG CORPORATION. Inventor/es: LIM,SANG JO, MOON,JUN OK, KIM,HYUNG JOON, JANG,JAE WOO, CHO,JAE YONG.

Un procedimiento de producción de L-lisina, que comprende las etapas de: 1) cultivar un microorganismo productor de L-lisina que pertenece a Corynebacterium spp., que tiene la actividad de una gluconato quinasa (GntK) debilitada en comparación con la actividad endógena de la misma en Corynebacterium spp. de tipo silvestre, en el que la GntK tiene la secuencia de aminoácidos de la SEQ ID NO: 2, para obtener un cultivo celular; y 2) recoger L-lisina del cultivo celular o el microorganismo, en el que la actividad GntK está debilitada por deleción completa o parcial, sustitución o inserción parcial: - en un gen cromosómico que codifica gluconato quinasa o - en un elemento regulador para un gen cromosómico que codifica gluconato quinasa.

PDF original: ES-2603128_T3.pdf

Producción modificada de glicoproteínas en plantas.

(10/08/2016) Un método para sintetizar una proteína de interés con una reducción de fucosilación y xilosilación que comprende, introducir en una planta, una porción de una planta, o una célula vegetal, una secuencia nucleotídica que comprende del 80 % al 100 % de identidad con una secuencia nucleotídica definida por la SEQ ID NO: 17 y que codifica una proteína híbrida que comprende una cola citoplásmatica, un dominio transmembrana, una región tallo (dominio CTS) de N-acetilglucosaminil transferasa (GNT1) fusionada a un dominio catalítico de beta-1,4galactosiltransferasa (GalT), la primera secuencia nucleotídica unida operativamente con una primera región reguladora que está activa en la planta, y una segunda…

Vacunas que comprenden transgenes sensibles al calor.

(29/06/2016). Solicitante/s: UVic Industry Partnerships Inc. Inventor/es: NANO,FRANCIS E.

Una bacteria sensible a la temperatura (TS), donde la bacteria sensible a la temperatura es una bacteria mesófila que comprende una o más secuencias codificantes de ácidos nucleicos esenciales que codifican un polipéptido a partir de una bacteria psicrófila, donde dichas secuencias codificantes de ácidos nucleicos se insertan en el genoma de dicha bacteria mesófila por recombinación homóloga sustituyendo así funcionalmente el homólogo de la bacteria mesófila del polinucleótido esencial TS y donde dicha bacteria sensible a la temperatura mesófila es para su uso en la producción de una respuesta inmunitaria a la bacteria sensible a la temperatura mesófila en un sujeto.

PDF original: ES-2594485_T3.pdf

Construcciones de fusión y uso de las mismas para producir anticuerpos con mayor afinidad de unión al receptor de Fc y función efectora.

(20/04/2016). Solicitante/s: ROCHE GLYCART AG. Inventor/es: UMANA,PABLO, FERRARA KOLLER,CLAUDIA, SUTER,TOBIAS, BRUENKER,PETER.

Un ácido nucleico aislado que comprende una secuencia que codifica un polipéptido de fusión, en el que dicho polipéptido de fusión: tiene actividad 7 -N-acetilglucosaminiltransferasa III (GnT III) o actividad 7 -galactosiltransferasa (GalT); y comprende el dominio de localización en Golgi de una 7 -N-acetilglucosaminiltransferasa I (GnT I) humana.

PDF original: ES-2574993_T3.pdf

1 · · 3 · 4 · 5 · 6 · 7 · ››
Utilizamos cookies para mejorar nuestros servicios y mostrarle publicidad relevante. Si continua navegando, consideramos que acepta su uso. Puede obtener más información aquí. .