Gen de histidina quinasa de tipo híbrido aislado a partir de arroz índica IR64.

Un procedimiento para el aislamiento del gen de histidina quinasa de tipo híbrido - OsHK3b a partir de arroz índica IR64 para su uso en la mejora de la tolerancia al estrés por salinidad y al estrés por sequía de las plantas de cultivo mediante la sobreexpresión del OsHK3b,

caracterizado por

(i) tratamiento de ADNc aislado de plantas de semillero IR64 con cebador directo OsHk3bF y cebador inverso OsHk3bR mediante reacción en cadena de la polimerasa (PCR) para producir el gen de histidina quinasa de tipo híbrido amplificado aislado - OsHK3b,

(ii) clonación del gen aislado - OsHK3b en el vector TOPO-TA2.1 para producir plásmido recombinante pTOPOOsHK3b,

en el que el gen de histidina quinasa de tipo híbrido - OsHK3b se aísla de su plásmido pTOPO-OSHK3b,

en el que dicho cebador directo OsHk3bF se identifica como 5'ATGACGTTCGCGAGGTACGC3',

en el que dicho cebador inverso OsHk3bF se identifica como 5'CTATTCAACTTGGTCATGATTTTG3',

en el que dicha PCR comprende una etapa de hibridación en PCR llevada a cabo a aproximadamente a 55 °C,

en el que dicho gen - OsHK3b tiene ADNc de 2598 pb,

en el que dicho gen - OsHK3b es como el proporcionado en la figura 2A,

en el que dicha reacción en cadena de la polimerasa (PCR) comprende las etapas de:

i) preparación de la mezcla de reacción de ADNc y el cebador directo OsHk3bF identificado como 5'ATGACGTTCGCGAGGTACGC3' y el cebador inverso OsHk3bR identificado como 5'CTATTCAACTTGGTCATGATTTTG3';

ii) desnaturalización inicial de la mezcla de reacción de la etapa - i) a aproximadamente 94 °C, preferentemente durante aproximadamente 5 minutos;

iii) desnaturalización de la mezcla de reacción de la etapa - ii) a aproximadamente 94 °C, preferentemente durante aproximadamente 1 minuto;

iv) hibridación de la mezcla de reacción de la etapa - iii) a aproximadamente 55 °C, preferentemente durante aproximadamente 1 minuto;

v) extensión de la mezcla de reacción de la etapa - iv) a aproximadamente 72 °C, preferentemente durante aproximadamente 3 minutos; y

vi) extensión final de la mezcla de reacción de la etapa - v) a aproximadamente 72 °C, preferentemente durante aproximadamente 7 minutos,

en el que las etapas de la desnaturalización, la hibridación y la extensión se repiten durante aproximadamente 34 ciclos.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/IN2009/000444.

Solicitante: Pareek, Ashwani.

Nacionalidad solicitante: India.

Dirección: Stress Physiology and Molecular Biology Lab School of Life Sciences Jawaharlal Nehru University (JNU) New Delhi 110 067 INDIA.

Inventor/es: KARAN,RATNA, ROY,GAUTAM KUMAR, SINGLA-PAREEK,SNEH LATA.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • A01H4/00 SECCION A — NECESIDADES CORRIENTES DE LA VIDA.A01 AGRICULTURA; SILVICULTURA; CRIA; CAZA; CAPTURA; PESCA.A01H NOVEDADES VEGETALES O PROCEDIMIENTOS PARA SU OBTENCION; REPRODUCCION DE PLANTAS POR TECNICAS DE CULTIVO DE TEJIDOS.Reproducción de plantas por técnicas de cultivo de tejidos.
  • A01H5/00 A01H […] › Plantas con flores, es decir, angiospermas.
  • C12N15/29 SECCION C — QUIMICA; METALURGIA.C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12N MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN (biocidas, productos que repelen o atraen a los animales nocivos, o reguladores del crecimiento de los vegetales, que contienen microorganismos virus, hongos microscópicos, enzimas, productos de fermentación o sustancias obtenidas por o extraídas de microorganismos o sustancias animales A01N 63/00; preparaciones de uso médico A61K; fertilizantes C05F ); PROPAGACION,CULTIVO O CONSERVACION DE MICROORGANISMOS; TECNICAS DE MUTACION O DE INGENIERIA GENETICA; MEDIOS DE CULTIVO (medios para ensayos microbiológicos C12Q 1/00). › C12N 15/00 Técnicas de mutación o de ingeniería genética; ADN o ARN relacionado con la ingeniería genética, vectores, p. ej. plásmidos, o su aislamiento, su preparación o su purificación; Utilización de huéspedes para ello (mutantes o microorganismos modificados por ingeniería genética C12N 1/00, C12N 5/00, C12N 7/00; nuevas plantas en sí A01H; reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00; nuevas razas animales en sí A01K 67/00; utilización de preparaciones medicinales que contienen material genético que es introducido en células del cuerpo humano para tratar enfermedades genéticas, terapia génica A61K 48/00; péptidos en general C07K). › Genes que codifican proteínas vegetales, p. ej. taumatina.
  • C12N15/54 C12N 15/00 […] › Transferasas (2).
  • C12N15/81 C12N 15/00 […] › para levaduras.
  • C12N15/82 C12N 15/00 […] › para células vegetales.
  • C12N5/14 C12N […] › C12N 5/00 Células no diferenciadas humanas, animales o vegetales, p. ej. líneas celulares; Tejidos; Su cultivo o conservación; Medios de cultivo para este fin (reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00). › Células vegetales.

PDF original: ES-2668998_T3.pdf

 

  • Fb
  • Twitter
  • G+
  • 📞

Patentes similares o relacionadas:

Composiciones y métodos para combatir plagas de insectos, del 3 de Diciembre de 2018, de E.I. DU PONT DE NEMOURS AND COMPANY: Un polinucleótido aislado que comprende una secuencia de nucleótidos que codifica un elemento de silenciamiento, en donde el elemento de silenciamiento comprende un ARN bicatenario, […]

Vacuna de toxinas bacterianas, del 29 de Noviembre de 2018, de IDEMITSU KOSAN CO., LTD.: Una proteína híbrida que comprende dos proteínas toxinas seleccionadas del grupo que consiste en proteína toxina Shiga (Stx), proteína toxina del cólera (CT) y […]

Genes de protoporfirinógeno oxidasa (PPX) mutado, del 31 de Octubre de 2018, de Cibus US LLC: Una planta resistente a uno o más herbicidas inhibidores de PPX, comprendiendo dicha planta un gen de protoporfirinógeno IX oxidasa (PPX) mutado, en la que […]

Vacuna de toxinas bacterianas, del 19 de Octubre de 2018, de IDEMITSU KOSAN CO., LTD.: Una proteína híbrida que comprende (a) dos proteínas toxinas seleccionadas del grupo que consiste en proteína toxina Shiga (Stx), proteína […]

Treonina sintasa de nicotiana tabacum y métodos y usos de esta, del 11 de Octubre de 2018, de PHILIP MORRIS PRODUCTS S.A.: Un método para aumentar la concentración de metionina libre en al menos una parte de una planta de tabaco, que comprende las etapas de: (a) reducir la […]

PLANTAS DE SOYA QUE COMPRENDEN EL EVENTO TRANSGENICO CIGBDT-DEF1 O CIGBIS-DEF5, del 4 de Octubre de 2018, de CENTRO DE INGENIERIA GENETICA Y BIOTECNOLOGIA: La invención revela una planta de soya, o una parte de dicha planta, que comprende el evento transgénico CIGBDt-Def1 o el evento transgénico […]

Genes reguladores de la ramificación de plantas, promotores, construcciones genéticas que los contienen y usos, del 27 de Septiembre de 2018, de CONSEJO SUPERIOR DE INVESTIGACIONES CIENTIFICAS (CSIC): La presente invención se refiere a genes que codifican para factores de transcripción de la familia TCP y que tienen un papel biológico en el desarrollo […]

Patatas con endulzamiento inducido en frío reducido, del 2 de Mayo de 2018, de CELLECTIS: Una planta, parte de planta, o célula de planta de Solanum tuberosum que comprende una deleción en al menos dos alelos de VInv endógenos para dicha planta, […]