CIP 2015 : A01H 4/00 : Reproducción de plantas por técnicas de cultivo de tejidos.

CIP2015AA01A01HA01H 4/00[m] › Reproducción de plantas por técnicas de cultivo de tejidos.

Notas[g] desde A01H 1/00 hasta A01H 4/00: Procedimientos

CIP2015: Invenciones publicadas en esta sección.

Plantas tolerantes a la sequía.

(05/12/2018). Solicitante/s: The State of Queensland acting through The Department of Agriculture and Fisheries. Inventor/es: BORRELL,ANDREW KENNNETH, JORDAN,DAVID ROBERT, MULLET,JOHN, KLEIN,PATRICIA.

Un método para generar una planta genéticamente modificada que usa agua de forma más eficaz que una planta no modificada genéticamente de la misma especie, comprendiendo el método la introducción mediante ingeniería genética usando medios recombinantes de material genético que codifica una proteína SbPIN4 para conferir un fenotipo de permanencia verde, cuyo fenotipo incluye un cambio en el uso de agua al período de post-antesis o accesibilidad aumentada de agua durante el crecimiento de la cosecha o eficacia de transpiración aumentada resultando en un índice de cosecha aumentado y rendimiento de grano en condiciones con agua limitada, en donde dicha proteína SbPIN4 está codificada por el ID del Gen de Sorgo Sb03g037350 desde pb 65310051 a pb 65313194.

PDF original: ES-2692857_T3.pdf

Método para desarrollar plantas de remolacha azucarera resistentes a herbicidas.

(05/10/2018) Un método para producir una planta de remolacha azucarera mutante que es resistente a uno o más inhibidores de la enzima acetohidroxiácido sintasa (ALS), que comprende las etapas de: - obtener protoplastos a partir de células guardianas en el estoma aisladas de una planta de remolacha azucarera; - aplicar a un cultivo in vitro de dichos protoplastos una composición que comprende uno o más inhibidores de ALS a una concentración que es letal para más del 99% de las células cultivadas in vitro; y - regenerar plantas de remolacha azucarera a partir de las células supervivientes de estas células cultivadas…

Gen de histidina quinasa de tipo híbrido aislado a partir de arroz índica IR64.

(14/03/2018) Un procedimiento para el aislamiento del gen de histidina quinasa de tipo híbrido - OsHK3b a partir de arroz índica IR64 para su uso en la mejora de la tolerancia al estrés por salinidad y al estrés por sequía de las plantas de cultivo mediante la sobreexpresión del OsHK3b, caracterizado por (i) tratamiento de ADNc aislado de plantas de semillero IR64 con cebador directo OsHk3bF y cebador inverso OsHk3bR mediante reacción en cadena de la polimerasa (PCR) para producir el gen de histidina quinasa de tipo híbrido amplificado aislado - OsHK3b, (ii) clonación del gen aislado - OsHK3b en el vector TOPO-TA2.1 para producir plásmido recombinante pTOPOOsHK3b, en el que el gen de histidina quinasa de tipo híbrido - OsHK3b se aísla de su plásmido pTOPO-OSHK3b, en el que dicho cebador directo OsHk3bF se identifica como 5'ATGACGTTCGCGAGGTACGC3', …

Método y medios para la aclimatación de plántulas para la vida al aire libre.

(10/01/2018). Solicitante/s: Valoya Oy. Inventor/es: AIKALA,LARS, KIVIMÄKI,ILKKA.

Un método para tratar plantas, caracterizado por que, - al menos dicha planta de este tipo es una plántula y se aloja en el interior , - dichas plántulas están expuestas a luz artificial en interiores para tratar el choque de trasplante en las plantas en el interior antes de la vida al aire libre , - la luz artificial se produce mediante un dispositivo de iluminación de diodo emisor de luz (LED) y comprende un par de un primer pico de emisión de luz UV artificial y un segundo pico de emisión de luz roja lejana artificial.

PDF original: ES-2663783_T3.pdf

Expresión de angiogenina en plantas.

(09/08/2017). Solicitante/s: AGRICULTURE VICTORIA SERVICES PTY LTD. Inventor/es: SPANGENBERG,GERMAN, MOURADOV,AIDYN, WANG,JIANGHUI, COCKS,BENJAMIN GRAEME, KNIGHT,MATTHEW, MCDONAGH,MATTHEW.

Una célula vegetal, callo vegetal, planta, semilla u otra parte de planta que incluye: una secuencia quimérica que consiste en: - un gen de angiogenina o un fragmento o variante funcionalmente activos del mismo, en el que dicho gen de angiogenina está modificado por eliminación de su péptido de señal del extremo N; - y un péptido de señal de retención en el RE, en la que dicho gen de angiogenina comprende una secuencia que se selecciona de entre el grupo que consiste en: (a) la secuencia que se muestra en la SEQ ID NO: 3; (b) fragmentos funcionalmente activos de la secuencia citada en (a) que tengan un tamaño de al menos 200 nucleótidos; (c) variantes funcionalmente activas que tengan al menos un 95 % de identidad con las secuencias citadas en (a) y (b); y (d) secuencias que codifiquen un polipéptido que comprenda una secuencia que se muestra en SEQ ID NO: 2.

PDF original: ES-2646139_T3.pdf

MÉTODO PARA LA GENERACIÓN DE HAPLOIDES ESTABLES DE JATROPHA CURCAS L.

(29/06/2017). Solicitante/s: AGROINDUSTRIA ALTERNATIVA DEL SURESTE, S.P.R. DE R.L. DE C.V. Inventor/es: GÓNGORA CANUL,Carlos Cecilio, AGUILERA CAUICH,Erick Alberto, MARTÍNEZ SEBASTIÁN,Gregorio, LÓPEZ PUC,Guadalupe, UC VARGUEZ,Alberto, RAMOS DÍAZ,Ana Luisa.

Una metodología para la obtención de plantas haploides del genero Jatropha curcas, que permite obtener individuos saludables a partir de la embriogénesis somática de tejido ovárico procedente de inflorescencias no fecundadas y tratadas de dicha especie, el cual comprende una serie de pasos y medios de cultivo que, de manera específica permiten obtener una gran cantidad de plantas haploides, a partir de una única línea parental, con una alta tasa de éxito y viabilidad.

Método para la generación y cultivo de un bloque de células vegetales.

(21/06/2017) Método para la generación de material de células vegetales en forma de un bloque de células privado de medio, estructurado poroso y multicapa no tejido y para el posterior mantenimiento de dicho bloque de células, que comprende las etapas de (i) proporcionar un bloque de células que tiene una estructura porosa separando las células de un cultivo de células vegetales en suspensión, en el que las células separadas de dicho cultivo de células vegetales en suspensión son nativas o transgénicas y capaces de acumular un producto deseado, y en el que el contenido del líquido comprendido por el bloque de células se reduce y ajusta para corresponderse con una densidad…

Plantas de sandía con resistencia al virus de las venas amarillas del pepino (CVYV).

(13/04/2017). Solicitante/s: Nunhems B.V. Inventor/es: DE GROOT,Erik, VAN DE WAL,Marion, BERENTSEN,Richard Bernard, CHIAPPARINO,Elena, OGUNDIWIN,Ebenezer.

La aplicación se refiere al campo de cultivo de plantas, en particular el cultivo de sandía. Se proporcionan plantas de sandía resistentes al CVYV (y semillas a partir de las cuales se pueden cultivar estas plantas). También se proporciona un QTL para resistencia al CVYV (cyv_3.1) y marcadores y métodos para seleccionar plantas para la presencia del QTL.

PDF original: ES-2667441_R1.pdf

PDF original: ES-2667441_A2.pdf

Método para producir biomasa foliar en cultivo.

(22/03/2017). Solicitante/s: IMPERIAL INNOVATIONS LIMITED. Inventor/es: MCCARTHY,JAMES GERARD, MICHOUX,FRANCK, NIXON,PETER.

Un método para producir biomasa foliar a partir de células vegetales indiferenciadas, comprendiendo el método proporcionar células vegetales indiferenciadas, ponerlas en contacto con un agente que promueve la diferenciación de las células en tejido foliar y cultivar las células en suspensión en un sistema de inmersión temporal en medio de cultivo líquido y en el que el agente está presente en el medio de cultivo del sistema de inmersión temporal en medio de cultivo líquido y en el que el agente es una citoquinina y en el que el agente se añade al medio de cultivo a una concentración de 0,01 a 100 μM y en el que el tiempo de inmersión varía de 1 a 30 minutos cada 2 a 24 horas y en el que el volumen de líquido en el sistema de inmersión temporal en medio de cultivo líquido es de 1 a 10.000 litros.

PDF original: ES-2626281_T3.pdf

Método para producir plantas fértiles a través de inducción de BBM durante la transformación.

(07/09/2016) Un método para producir una planta de pimiento dulce Capsicum annuum transgénica fértil, dicho método comprende: (a) transformar una célula vegetal de pimiento dulce Capsicum annuum con un vector de expresión que codifica una proteína babyboom (BBM), en donde dicho vector de expresión produce una actividad de transcripción nuclear inducible de dicha proteína babyboom (BBM); (b) regenerar dicha célula vegetal de pimiento dulce Capsicum annuum transformada en estructuras tipo brote (SLS) en condiciones inductoras que dan como resultado una actividad de transcripción nuclear de dicha proteína babyboom (BBM), dichas condiciones inductoras comprenden poner en contacto dicha célula…

Métodos y composiciones para aumentar la vida de almacenamiento de la fruta.

(01/06/2016) Un método para aumentar la vida de almacenamiento poscosecha y firmeza de la fruta de una planta de una especie Rosaceae durante, o después, del almacenamiento poscosecha, con respecto a la fruta de una planta de control bajo las mismas condiciones, comprendiendo el método reducir la expresión o actividad en la planta de un polipéptido con la secuencia de aminoácidos de SEQ ID NO: 1, o una variante del polipéptido con al menos el 70 % de identidad con la secuencia de aminoácidos de SEQ ID NO: 1 a lo largo de la longitud entera de SEQ ID NO: 1, en el que el método comprende la etapa de introducir un polinucleótido en una célula de planta, o planta, para efectuar…

Cápsulas que contienen células o tejidos vivos.

(12/08/2015) Cápsula sin costuras que comprende un líquido acuoso en el que está suspendida una célula o tejido vivos, en la que la cápsula está formada mediante un aparato de fabricación de cápsulas sin costuras con una tobera tubular triple, en la que el líquido acuoso que contiene la célula o tejido vivos se suministra en el tubo más interno de la tobera tubular triple, en la que un material lipófilo se suministra al tubo medio de la tobera tubular triple, en la que un material que forma la membrana externa se suministra al tubo más externo de la tobera tubular triple, en la que la célula o tejido puede crecer en el líquido acuoso, caracterizada porque el material lipófilo se selecciona entre el grupo que comprende aceites de fritura por inmersión, aceite para ensalada, vitamina…

Procedimiento y medios de aclimatación de plantones a la vida en el exterior.

(29/04/2015) Un dispositivo de luz de tratamiento de choque de trasplante de plantas, en el que al menos un dispositivo de luz mencionado es un LED UV y está dispuesto para iluminar al menos un plantón de planta en el interior antes de la transferencia del al menos un plantón de planta mencionado para la vida en el exterior, y al menos un fósforo de conversión por elevación de longitud de onda está dispuesto próximo al LED UV.

Dispositivo separador, dispositivo de deposición y sistema para manipular embriones vegetales somáticos.

(01/04/2015) Un procedimiento para separar embriones vegetales suspendidos en fluido de tejido embriogénico inmaduro, que comprende las etapas de: a) proporcionar un contenedor separador adecuado, conteniendo dicho contenedor fluido que tiene una densidad inferior a la de los embriones a separar, teniendo una forma esencialmente cilíndrica, teniendo una pared inferior esencialmente plana y un eje esencialmente vertical; y comprendiendo además un conducto en comunicación con el fluido en el contenedor en la región axial de la pared inferior durante la operación y un medio de inducción de un flujo de rotación axisimétrico que es un objeto en rotación colocado dentro del contenedor ; b) crear un vórtex colector en la región axial de…

Método para preparar pimientos transgénicos utilizando la inducción del callo.

(15/10/2014) Un método para producir plantas de pimiento transgénicas, comprendiendo el método las etapas de: (a) pre-cultivar explantes de pepino en un medio de inducción del callo; (b) co-cultivar los explantes pre-cultivados con Agrobacterium en el que se ha introducido un gen diana; (c) cultivar los explantes co-cultivados en un medio de selección con el fin de formar un callo y seleccionar el callo formado; y (d) cortar el callo y cultivar el callo cortado en un medio de inducción de brotes con el fin de formar brotes.

Métodos para dispersar embriones vegetales somáticos.

(23/07/2014) Un método de dispersión de grupos de embriones vegetales suspendidos en un líquido en embriones vegetales individuales, incluyendo dicho método al menos una secuencia de dispersión, que comprende las siguientes etapas: i) someter los grupos de embriones a fuerzas de dinámica de fluidos que provocan deformación de extensión axial y deformación de compresión radial; ii) someter los grupos de embriones a fuerzas de dinámica de fluidos que provocan deformación de compresión axial y deformación de extensión radial de fuerzas de dinámica de fluidos; repetir dichas etapas en secuencia hasta que los embriones individuales se separan entre sí.

Producción mejorada de tebaína y oripavina mediante Papaver somniferum.

(21/07/2014) Un procedimiento de producción de una planta de amapola que se reproduce establemente de Papaver somniferum que tenga tebaína y oripavina y que constituyan aproximadamente el 50 % en peso o más de la combinación de alcaloides que consiste en morfina, codeína, tebaína y oripavina, comprendiendo el procedimiento las etapas de: a) exponer al menos una semilla de amapola de Papaver somniferum a un agente mutagénico, b) cultivar la al menos una semilla de amapola para producir una planta que lleve una hoja o una cápsula de amapola inmadura, opcionalmente mediante múltiples generaciones autofecundadas, c) muestrear la hoja o cápsula de amapola para la presencia de tebaína, oripavina, morfina y codeína, y d) repetir las etapas a) a c) hasta que se obtenga una planta de amapola de Papaver…

Procedimiento y medios para la aclimatación de plantones a la vida en el exterior.

(26/03/2014) Un procedimiento de tratamiento de plantas, en el que - al menos una de las citadas plantas es un plantón de árbol y está alojado en interior , - los citados plantones de árboles están expuestos a la luz UV artificial en el interior antes de la vida en el exterior , que se caracteriza porque, - la luz UV incidente es producida por diodos emisores de luz (LED) , tanto en las bandas UV - A (- 315- 400 nm) y UV - B para tratar el choque de trasplante en las citadas plantas

Muestreador automático de semillas libre de contaminación y procedimiento de muestreo, evaluación y reagrupamiento de semillas.

(19/02/2014) Un sistema automático muestreador de semillas, que comprende: un sistema de orientación configurado para orientar una semilla; una estación de muestreo configurada para retirar tejido de la semilla orientada; y un subsistema de transporte de semillas capaz de transportar la semilla orientada a la estación de muestreo, caracterizado porque el subsistema de transporte de semillas incluye un portasemillas configurado para mantener la semilla en una orientación deseada

Derivados del Factor VII de coagulación.

(05/12/2013) Polipéptido del factor VII que comprende la secuencia de aminoácidos SEC ID n.º: 1 o una variante de la misma, donde el polipéptido del Factor VII tiene la misma actividad o mayor actividad en comparación con el Factor VIIa recombinante de tipo salvaje humano donde una cisteína se ha añadido al extremo C-terminal de SEC ID n.º: 1 o de la variante de la misma.

TRATAMIENTOS PARA INCREMENTAR EL VIGOR DE PLANTAS LEÑOSAS EN CONDICIONES IN VITRO Y SU MÉTODO DE APLICACIÓN.

(27/05/2013) Tratamientos para incrementar el vigor de plantas leñosas en condiciones in vitro y su método de aplicación. La presente invención proporciona tratamientos eficaces, para aumentar el crecimiento de plantas leñosas (preferentemente melocotonero y ciruelo) en condiciones in vitro. La presente invención muestra como la adición de benzotiodiazol (BTH) o ácido L-2-oxo-4-tiazolidina carboxílico (OTC), a bajas concentraciones, al medio de cultivo para la micropropagación de dichas plantas, actúa promoviendo el crecimiento de los explantos de forma muy significativa. En un aspecto particular la invención se refiere a un método de tratamiento para incrementar el vigor en plantas leñosas en condiciones in vitro que comprende los siguientes pasos, (i) establecimiento de cultivo…

METODO DE CULTIVO IN VITRO DE PLANTAS FANERÓGAMAS MARINAS.

(16/10/2012) Método de cultivo in vitro de plantas fanerógamas marinas. La presente invención se refiere a un método adecuado para cultivar plantas fanerógamas marinas y, más en concreto la especie Posidonia oceánica que controla la inducción, mantenimiento y maduración de cultivos celulares hasta alcanzar estadios pre-embrionarios. El método incluye extraer explantos seleccionados de la zona distal del ápice meristemático foliar de una plántula de fanerógama marina de la especie Posidonia oceánica, cultivar los explantos obtenidos en un medio de cultivo líquido, obtener células libres mediante el empleo de técnicas de digestión celular, establecer cultivos celulares induciendo la formación de masas pre-embriogenética (PEM),…

MÉTODO DE PRODUCCIÓN DE CISTACEAS MICORRIZADAS CON TRUFA DE DESIERTO.

(10/09/2012) Método de producción de plantas de la familia Cistaceae micorrizadas con las diferentes especies de trufa de desierto. El método se sirve del cultivo de semillas/explantos en condiciones fotoautotróficas. El material vegetal se somete a una adaptación progresiva a una humedad relativa decreciente hasta valores ambientales. La inoculación del hongo micorrícico es a base de esporas y/o micelio. El inóculo se elabora a temperatura ambiente o en frío para favorecer la adhesión de los propágulos a la matriz porosa inerte tras su homogenización. La aplicación del inóculo se lleva a cabo durante la fase de trasplante a maceta. La fase de aclimatación es de 7 a 12 días. Se obtienen valores de supervivencia del 95 %. De 30 a 40 días después…

MÉTODO DE PRODUCCIÓN DE CISTACEAS MICORRIZADAS CON TRUFA DE DESIERTO.

(23/08/2012). Ver ilustración. Solicitante/s: THADER BIOTHECHNOLOGY S.L. Inventor/es: HONRUBIA GARCIA, MARIO, ANDRINO DE LA FUENTE,Alberto, MORTE GÓMEZ,Asunción.

Método de producción de plantas de la familia Cistaceae micorrizadas con las diferentes especies de trufa de desierto. El método se sirve del cultivo de semillas/explantos en condiciones fotoautotróficas. El material vegetal se somete a una adaptación progresiva a una humedad relativa decreciente hasta valores ambientales. La inoculación del hongo micorrícico es a base de esporas y/o micelio. El inoculo se elabora a temperatura ambiente o en frío para favorecer la adhesión de los propágulos a la matriz porosa inerte tras su homogenización. La aplicación del inoculo se lleva a cabo durante la fase de trasplante a maceta. La fase de aclimatación es de 7 a 12 días. Se obtienen valores de supervivencia del 95 %. De 30 a 40 días después de la aclimatación el porcentaje de micorrización se establece en valores del 70 al 80 %.

Muestreador automatizado de semillas libres de contaminación y procedimiento de toma de muestras.

(01/08/2012) Un sistema muestreador automatizado de semillas, que comprende: una estación de carga de semillas para aislar una semilla de una pluralidad de semillas; un sistema de orientación para recibir la semilla separada de la estación de carga de semillas yorientar la semilla; y una estación de toma de muestras para extraer una muestra de tejido que comprende material de lasemilla de la semilla orientada, caracterizado porque el sistema de orientación incluye un accionador basculante configurado para colocar la semilla en una orientación deseada.

Método para la micropropagación de monocotiledóneas basado en cultivos celulares totipotentes continuos.

(11/07/2012) Procedimiento para incrementar la velocidad de crecimiento de una masa celular embriogénica de un cultivocelular embriogénico totipotente de una familia de hierba monocotiledónea o de una planta de junco en operacionesa escala industrial, que comprende: (a) cultivar un explante de tejido del ápice caulinar de la planta monocotiledónea en un medio primario, en el queel explante se había tratado previamente con una temperatura fría y el medio primario comprende auxina oauxina y citocinina, para producir un cultivo celular embriogénico totipotente; (b) tratar el cultivo celular embrionario totipotente con una temperatura fría para incrementar la velocidad decrecimiento de la masa del cultivo celular embrionario totipotente continuo en comparación con un control, en elque el tratamiento…

TERMO-FOTO-BIOREACTOR Y MÉTODO DE CULTIVO V MICROPROPAGACIÓN MASIVA IN VITRO DE DESCHAMPSIA ANTÁRCTICA.

(18/05/2012). Ver ilustración. Solicitante/s: UNIVERSIDAD DE SANTIAGO DE CHILE. Inventor/es: ZUÑIGA NAVARRO,Gustavo Emilio, SEQUEIDA HONORATO,Alvaro Eduardo, CASTRO OYARZUN,Alvaro Gonzalo, TAPIA RODRIGUEZ,Eduardo Andres, PRIETO ENCALADA,Humberto Godofredo, ZAMORA CANTILLANA,Pablo Andres.

La presente invención se relaciona con un termo-foto-bioreactor y método de cultivo y micropropagación in vitro de Deschampsia antárctica comprendido por un reactor de inmersión discontinuo para la micropropagación de biomasa que comprende medios para la incorporación de agentes inductores químicos (sal, metales, compuestos orgánicos, etc.) y medios de iluminación o luminiscencia interna (radiación UV y temperatura) para proporcionar dichos inductores químicos y/o iluminación durante cualquier fase de crecimiento de la material vegetal o planta (multiplicación o propagación y/o mantención). La presente invención tiene la ventaja que permite combinar la propiedad de desarrollar importantes cantidades de biomasa de la especie antártica antes referida de forma de proporcionar condiciones adecuadas para que dicha planta produzca metabolitos de utilidad para la salud humana y cuidado personal.

METODO PARA LA DETECCION PRECOZ DE PATRONES DE FRUTALES TOLERANTES ALESTRES SALINO.

(20/04/2012) Método para la detección precoz de patrones de frutales tolerantes al estrés salino. La presente invención se refiere a un método para determinar la respuesta al estrés salino de patrones frutales que reduce el tiempo de selección clásica convencional y que se puede llevar a cabo en laboratorio mediante el crecimiento de raíces aisladas in vitro en presencia de concentraciones estresantes de cloruro sódico (NaCl). Este método aúna rapidez en la respuesta y un modelo experimental simplificado.

PROCEDIMIENTO PARA LA PROPAGACION IN VITRO DEL ESPARRAGO.

(20/04/2012) Procedimiento para la propagación in vitro del espárrago. Procedimiento de propagación de espárrago (del género Asparagus) mediante técnicas de cultivo de tejidos vegetales. Se describe un procedimiento de propagación in vitro del espárrago enfocado hacia el acortamiento del proceso de micropropagación conforme y hacia la obtención de un método eficaz y consistente, que nos permita obtener unos altos porcentajes de éxito en la clonación para una mayoría de genotipos, y reducir el tiempo necesario para la obtención de copias clónales de genotipos agronómicamente interesantes. El procedimiento de propagación in vitro del espárrago objeto de la presente invención consiste en el cultivo y desarrollo de estructuras gemantes ya preexistentes en el rizoma, cultivándose yemas axilares que ofrecen por ello una mejor garantía de estabilidad somacional, asimismo…

Procedimiento de transformación y regeneración altamente eficiente de células vegetales en suspensión.

(11/04/2012) Un procedimiento para producir una planta transgénica de algodón, comprendiendo dicho procedimiento: (a) proporcionar una célula proembriogénica de algodón; (b) cultivar la célula proembriogénica en un medio líquido para producir un cultivo de células en suspensión; (c) proporcionar un cultivo de Agrobacterium tumefaciens que alberga un vector que comprende un gen exógeno y un marcador seleccionable, siendo el Agrobacterium capaz de efectuar la transferencia estable del gen exógeno y el marcador seleccionable al genoma de una célula vegetal, en el que el Agrobacterium tiene una virulencia pre-inducida; (d) co-cultivar una mezcla del cultivo de la suspensión celular y el cultivo de Agrobacterium sobre un soporte sólido poroso bajo una luz continua, generando de este modo una población de células, algunas de las cuales han sido transformadas…

Procedimiento de producción de biomasa usando cultivos mixtos de algas fotosintéticas.

(14/03/2012) Procedimiento de cultivo masivo de cultivos mixtos de bacterias/algas exclusivamente planctónicas en tanques redondos planos abiertos provistos de equipos rascadores de fango con aportación periférica de soluciones nutrientes y con un cono invertido central de extracción con tres puntos de extracción, en el que para el cultivo de cultivos mixtos de bacterias/algas a través de un tubo central de rebose se extraen periódicamente componentes flotantes, a través de un punto de extracción inferior a la altura del fondo del cono invertido se extraen fracciones que se sedimentan y a través de un punto de extracción medio que está situado entre el rebose y el punto de extracción inferior se extrae del agua libre la fracción de bacterias/algas planctónicas y se la conduce de regreso a la periferia del tanque

GEN DE RESISTENCIA DERIVADO DE PLANTA.

(07/03/2012) Molécula de ácido nucleico que codifica para un polipéptido que puede conferir resistencia frente a un patógeno en una planta en la que dicho polipéptido se expresa, comprendiendo o consistiendo dicha molécula de ácido nucleico en una secuencia de nucleótidos seleccionada del grupo que consiste en: (a) una secuencia de nucleótidos que codifica para al menos la forma madura de una proteína (R1) que comprende la secuencia de aminoácidos facilitada en SEQ ID NO: 2; (b) una secuencia de nucleótidos que comprende las regiones codificantes de la secuencia de ADN facilitada en SEQ ID NO: 1; (c) una secuencia de nucleótidos que se hibrida con la cadena complementaria de una secuencia de nucleótidos definida en (a) o (b) en condiciones de hibridación rigurosas, en la que dicha secuencia de nucleótidos es homóloga en al menos el 80% con las secuencias…

1 · · ››