CIP 2015 : A01H 4/00 : Reproducción de plantas por técnicas de cultivo de tejidos.

CIP2015AA01A01HA01H 4/00[m] › Reproducción de plantas por técnicas de cultivo de tejidos.

Notas[g] desde A01H 1/00 hasta A01H 4/00: Procedimientos

CIP2015: Invenciones publicadas en esta sección.

SISTEMA DE REACTOR PARA EL CULTIVO IN VITRO DE MATERIAL VEGETAL, KIT PARA TRANSFORMAR UN RECEPTÁCULO EN UN REACTOR APTO PARA DICHO SISTEMA, Y MÉTODO PARA EL CULTIVO IN VITRO DE MATERIAL VEGETAL MEDIANTE DICHO SISTEMA DE REACTOR.

(04/06/2020). Solicitante/s: INSTITUT DE RECERCA I TECNOLOGIA AGROALIMENTARIES. Inventor/es: DOLCET SANJUAN,Ramon J, MENDOZA MORALES,Carlos Rolando.

Comprende un receptáculo para el cultivo del material vegetal, una tapa para cerrar una abertura de dicho receptáculo , y medios para permitir la entrada y/o salida de gas de dicho receptáculo , y se caracteriza por el hecho de que comprende un recipiente para recibir un medio de cultivo líquido en el interior del receptáculo , y medios para sustentar el material vegetal sobre dicho recipiente de recepción, donde dicho recipiente está unido a la tapa del receptáculo en una posición apta para uso, incluyendo dicha tapa al menos un conducto de entrada y/o salida de medio que comunica con el recipiente para poder llenar y/o vaciar dicho recipiente a través de dicho conducto.

Producción de semillas de cereales híbridas.

(03/06/2020). Solicitante/s: Limagrain Europe. Inventor/es: JOLLIFFE,THOMAS, GLEW,MARK, RUSLING,MARK, MURIGNEUX,ALAIN, VARENNE,PIERRICK.

Un procedimiento para limitar la proporción de semillas de cereales autofecundadas macho en un surtido de semillas de un campo que contiene un rodal de plantas polinizadas hembra macho-estériles más bajas con un rodal de plantas macho-fértiles más altas, donde las plantas polinizadas macho-estériles hembra más bajas son plantas enanas, semienanas o doble enanas, el procedimiento comprende pasar una herramienta que se extiende por encima de la altura de las plantas hembra más bajas entre la antesis y la cosecha, la herramienta aplica un herbicida a las plantas macho-fértiles que se encuentran por encima de la altura de las plantas hembra más bajas, por medio del cual se previene o reduce el desarrollo de las plantas macho-fértiles que se encuentran por encima de esta altura y, después de cosechar las semillas, se clasifican las semillas por tamaño o densidad para eliminar semillas macho arrugadas autofecundadas no deseadas.

PDF original: ES-2808688_T3.pdf

SISTEMA DE REACTOR PARA EL CULTIVO IN VITRO DE MATERIAL VEGETAL, KIT PARA TRANSFORMAR UN RECEPTÁCULO EN UN REACTOR APTO PARA DICHO SISTEMA, Y MÉTODO PARA EL CULTIVO IN VITRO DE MATERIAL VEGETAL MEDIANTE DICHO SISTEMA DE REACTOR.

(29/05/2020). Solicitante/s: INSTITUT DE RECERCA I TECNOLOGIA AGROALIMENTARIES. Inventor/es: DOLCET SANJUAN,Ramon J, MENDOZA MORALES,Carlos Rolando.

Sistema de reactor para el cultivo in vitro de material vegetal, kit para transformar un receptáculo en un reactor apto para dicho sistema, y método para el cultivo in vitro de material vegetal mediante dicho sistema de reactor. Comprende un receptáculo para el cultivo del material vegetal, una tapa para cerrar una abertura de dicho receptáculo , y medios para permitir la entrada y/o salida de gas de dicho receptáculo , y se caracteriza por el hecho de que comprende un recipiente para recibir un medio de cultivo líquido en el interior del receptáculo , y medios para sustentar el material vegetal sobre dicho recipiente de recepción, donde dicho recipiente está unido a la tapa del receptáculo en una posición apta para uso, incluyendo dicha tapa al menos un conducto de entrada y/o salida de medio que comunica con el recipiente para poder llenar y/o vaciar dicho recipiente a través de dicho conducto.

PDF original: ES-2763637_A1.pdf

PDF original: ES-2763637_B2.pdf

Muestreo de embriones para análisis molecular.

(13/05/2020). Solicitante/s: PIONEER HI-BRED INTERNATIONAL, INC.. Inventor/es: HUNTER,CLIFFORD.

Un método para analizar un embrión aislado de una planta monocotiledónea que comprende: a. cortar un trozo de tejido de escutelo de un embrión inmaduro aislado en el que dicha escisión no causa una reducción significativa en el potencial de germinación de dicho embrión aislado; y b. analizar ácidos nucleicos extraídos, y opcionalmente amplificados, del trozo de tejido de escutelo en busca de la presencia o ausencia de una o más características indicativas de al menos un rasgo genético, en el que dicho embrión aislado es capaz de germinar en una planta después de que dicho trozo de tejido es cortado.

PDF original: ES-2795106_T3.pdf

Producción de tapsigarginas por cultivo en suspensión de células de Thapsia.

(06/05/2020). Solicitante/s: PHYTON HOLDINGS, LLC. Inventor/es: HECKENMULLER, HARALD, GORR, GILBERT, ULLISCH,DAVID ALEXANDER, SANKAR-THOMAS,YANTREE DEVI, WILKE,JENS STEFAN.

Método de producción de lactonas sesquiterpénicas de la familia de tapsigargina, comprendiendo el método las etapas de: (a) cultivar células vegetales del género Thapsia en un medio nutriente en un cultivo celular en suspensión, en el que las células vegetales son células no embriogénicas y en el que las células producen una o más lactonas sesquiterpénicas de la familia de tapsigargina, y en el que las células no embriogénicas se seleccionan del grupo de células indiferenciadas, desdiferenciadas y meristemáticas; y (b) recuperar una o más lactonas sesquiterpénicas de la familia de tapsigargina producidas en (a).

PDF original: ES-2806553_T3.pdf

Apoyo para cultivar material biológico.

(08/01/2020). Solicitante/s: ViVi B.V. Inventor/es: BIJL,JACOB JOHANNES.

Recipiente para cultivar material biológico, comprendiendo un sustrato inerte sólido , un medio de crecimiento y material biológico dispuesto en o sobre el sustrato , en donde el recipiente está sustancialmente cerrado, el recipiente es estéril hasta cierto punto de esterilidad necesaria para permitir que crezca el material de siembra, y el material biológico comprende material de siembra, caracterizado por que al menos un lado del recipiente está cerrado con una hoja metálica semipermeable , y el recipiente es un recipiente externo en el que se coloca al menos un subrecipiente , en donde el subrecipiente recibe el sustrato inerte sólido con material de siembra.

PDF original: ES-2781326_T3.pdf

Producción de ingenol, ésteres de ingenol y/o derivados de tiglian-3-ona mediante cultivos en suspensión de células vegetales de Euphorbiaceae.

(18/12/2019). Solicitante/s: PHYTON HOLDINGS, LLC. Inventor/es: HECKENMULLER, HARALD, LEIBOLD, THOMAS, GORR, GILBERT, ULLISCH,DAVID ALEXANDER, SANKAR-THOMAS,YANTREE DEVI, SELGE,THOMAS.

Método para producir ingenol, ésteres de ingenol y/o derivados de tiglian-3-ona, comprendiendo el método las etapas de: (a) cultivar células vegetales obtenidas a partir de una planta seleccionada de la familia Euphorbiaceae en un medio de nutrientes en un cultivo celular en suspensión, en el que las células producen ingenol, uno o más ésteres de ingenol y/o uno o más derivados de tiglian-3-ona; y (b) recuperar el ingenol, el uno o más ésteres de ingenol y/o el uno o más derivados de tiglian-3-ona producidos en (a).

PDF original: ES-2770769_T3.pdf

Biorreactor.

(27/05/2019) Un biorreactor de inmersión temporal para la producción in vitro de biomasa vegetal diferenciada que comprende: una cámara de crecimiento que tiene una o más paredes laterales transparentes y un fondo de malla , definiendo el fondo de malla una pluralidad de poros para recibir material vegetal; una bolsa flexible formada a partir de un material transparente, teniendo la bolsa flexible una abertura sellable y estando dimensionada para recibir la cámara de crecimiento junto con un medio líquido ; una cámara externa que tiene una o más paredes laterales transparentes , estando formada la cámara externa para corresponder en forma a la cámara de crecimiento y estando dimensionada para…

Propagación de plantas.

(12/02/2019) Un procedimiento para aumentar la formación de yemas en mini rizomas o mini esquejes de tallo, que comprende las etapas de: (i) micropropagación del material vegetal a partir de una planta de reproducción vegetativa seguida de multiplicación para producir plántulas; (ii) poner en contacto las plántulas o una parte de las mismas de la etapa (i) con al menos una hormona vegetal; (iii) exponer las plántulas, después de la etapa (ii) anterior, a un estrés abiótico y mecánico temporal, en el que dicho estrés temporal comprende una exposición no continua a uno cualquiera o más estreses en períodos intermitentes entre periodos sin estrés y en el que dicho estrés abiótico comprende uno cualquiera o más de entre: (a) un estrés osmótico; (b) un estrés por temperatura; (c) un estrés nutricional o (d) un estrés…

Procedimiento para aumentar la biomasa vegetal.

(06/02/2019). Solicitante/s: BioMass Booster, S.L. Inventor/es: MARTINEZ RAMIREZ,Alfredo, ARENAS VIDAL,JORGE CONRADO.

Un procedimiento para aumentar la biomasa de un organismo fotosintético que comprende cultivar dicho organismo fotosintético en presencia de un péptido que comprende: i. la secuencia de aminoácidos que se muestra en la SEQ ID NO: 3; o ii. Una variante funcional del péptido definido en (i), en el que dicha variante es un péptido cuya secuencia de aminoácidos tiene un grado de identidad con respecto a la secuencia de aminoácidos que se muestra en la SEQ ID NO: 3 de al menos el 70 % y mantiene su capacidad para aumentar la biomasa de un organismo fotosintético, y en el que dicha variante comprende la secuencia de aminoácidos Cys-Xaa1-Xaa2-Xaa3-Xaa4-Cys [SEQ ID NO 1] en la que Xaa1, Xaa2, Xaa3 y Xaa4, representan independientemente un aminoácido, y los restos de cisteína de la secuencia de aminoácidos que se muestra en la SEQ ID NO: 1 forman un puente disulfuro entre ellos, en el que dicho péptido está presente en una concentración entre 10-8 M y 10-16 M.

PDF original: ES-2698835_T3.pdf

Plantas tolerantes a la sequía.

(05/12/2018). Solicitante/s: The State of Queensland acting through The Department of Agriculture and Fisheries. Inventor/es: BORRELL,ANDREW KENNNETH, JORDAN,DAVID ROBERT, MULLET,JOHN, KLEIN,PATRICIA.

Un método para generar una planta genéticamente modificada que usa agua de forma más eficaz que una planta no modificada genéticamente de la misma especie, comprendiendo el método la introducción mediante ingeniería genética usando medios recombinantes de material genético que codifica una proteína SbPIN4 para conferir un fenotipo de permanencia verde, cuyo fenotipo incluye un cambio en el uso de agua al período de post-antesis o accesibilidad aumentada de agua durante el crecimiento de la cosecha o eficacia de transpiración aumentada resultando en un índice de cosecha aumentado y rendimiento de grano en condiciones con agua limitada, en donde dicha proteína SbPIN4 está codificada por el ID del Gen de Sorgo Sb03g037350 desde pb 65310051 a pb 65313194.

PDF original: ES-2692857_T3.pdf

Método para desarrollar plantas de remolacha azucarera resistentes a herbicidas.

(05/10/2018) Un método para producir una planta de remolacha azucarera mutante que es resistente a uno o más inhibidores de la enzima acetohidroxiácido sintasa (ALS), que comprende las etapas de: - obtener protoplastos a partir de células guardianas en el estoma aisladas de una planta de remolacha azucarera; - aplicar a un cultivo in vitro de dichos protoplastos una composición que comprende uno o más inhibidores de ALS a una concentración que es letal para más del 99% de las células cultivadas in vitro; y - regenerar plantas de remolacha azucarera a partir de las células supervivientes de estas células cultivadas…

Gen de histidina quinasa de tipo híbrido aislado a partir de arroz índica IR64.

(14/03/2018) Un procedimiento para el aislamiento del gen de histidina quinasa de tipo híbrido - OsHK3b a partir de arroz índica IR64 para su uso en la mejora de la tolerancia al estrés por salinidad y al estrés por sequía de las plantas de cultivo mediante la sobreexpresión del OsHK3b, caracterizado por (i) tratamiento de ADNc aislado de plantas de semillero IR64 con cebador directo OsHk3bF y cebador inverso OsHk3bR mediante reacción en cadena de la polimerasa (PCR) para producir el gen de histidina quinasa de tipo híbrido amplificado aislado - OsHK3b, (ii) clonación del gen aislado - OsHK3b en el vector TOPO-TA2.1 para producir plásmido recombinante pTOPOOsHK3b, en el que el gen de histidina quinasa de tipo híbrido - OsHK3b se aísla de su plásmido pTOPO-OSHK3b, en el que dicho cebador directo OsHk3bF se identifica como 5'ATGACGTTCGCGAGGTACGC3', …

Método y medios para la aclimatación de plántulas para la vida al aire libre.

(10/01/2018). Solicitante/s: Valoya Oy. Inventor/es: AIKALA,LARS, KIVIMÄKI,ILKKA.

Un método para tratar plantas, caracterizado por que, - al menos dicha planta de este tipo es una plántula y se aloja en el interior , - dichas plántulas están expuestas a luz artificial en interiores para tratar el choque de trasplante en las plantas en el interior antes de la vida al aire libre , - la luz artificial se produce mediante un dispositivo de iluminación de diodo emisor de luz (LED) y comprende un par de un primer pico de emisión de luz UV artificial y un segundo pico de emisión de luz roja lejana artificial.

PDF original: ES-2663783_T3.pdf

Expresión de angiogenina en plantas.

(09/08/2017). Solicitante/s: AGRICULTURE VICTORIA SERVICES PTY LTD. Inventor/es: SPANGENBERG,GERMAN, MOURADOV,AIDYN, WANG,JIANGHUI, COCKS,BENJAMIN GRAEME, KNIGHT,MATTHEW, MCDONAGH,MATTHEW.

Una célula vegetal, callo vegetal, planta, semilla u otra parte de planta que incluye: una secuencia quimérica que consiste en: - un gen de angiogenina o un fragmento o variante funcionalmente activos del mismo, en el que dicho gen de angiogenina está modificado por eliminación de su péptido de señal del extremo N; - y un péptido de señal de retención en el RE, en la que dicho gen de angiogenina comprende una secuencia que se selecciona de entre el grupo que consiste en: (a) la secuencia que se muestra en la SEQ ID NO: 3; (b) fragmentos funcionalmente activos de la secuencia citada en (a) que tengan un tamaño de al menos 200 nucleótidos; (c) variantes funcionalmente activas que tengan al menos un 95 % de identidad con las secuencias citadas en (a) y (b); y (d) secuencias que codifiquen un polipéptido que comprenda una secuencia que se muestra en SEQ ID NO: 2.

PDF original: ES-2646139_T3.pdf

MÉTODO PARA LA GENERACIÓN DE HAPLOIDES ESTABLES DE JATROPHA CURCAS L.

(29/06/2017). Solicitante/s: AGROINDUSTRIA ALTERNATIVA DEL SURESTE, S.P.R. DE R.L. DE C.V. Inventor/es: GÓNGORA CANUL,Carlos Cecilio, AGUILERA CAUICH,Erick Alberto, MARTÍNEZ SEBASTIÁN,Gregorio, LÓPEZ PUC,Guadalupe, UC VARGUEZ,Alberto, RAMOS DÍAZ,Ana Luisa.

Una metodología para la obtención de plantas haploides del genero Jatropha curcas, que permite obtener individuos saludables a partir de la embriogénesis somática de tejido ovárico procedente de inflorescencias no fecundadas y tratadas de dicha especie, el cual comprende una serie de pasos y medios de cultivo que, de manera específica permiten obtener una gran cantidad de plantas haploides, a partir de una única línea parental, con una alta tasa de éxito y viabilidad.

Método para la generación y cultivo de un bloque de células vegetales.

(21/06/2017) Método para la generación de material de células vegetales en forma de un bloque de células privado de medio, estructurado poroso y multicapa no tejido y para el posterior mantenimiento de dicho bloque de células, que comprende las etapas de (i) proporcionar un bloque de células que tiene una estructura porosa separando las células de un cultivo de células vegetales en suspensión, en el que las células separadas de dicho cultivo de células vegetales en suspensión son nativas o transgénicas y capaces de acumular un producto deseado, y en el que el contenido del líquido comprendido por el bloque de células se reduce y ajusta para corresponderse con una densidad…

Plantas de sandía con resistencia al virus de las venas amarillas del pepino (CVYV).

(13/04/2017). Solicitante/s: Nunhems B.V. Inventor/es: DE GROOT,Erik, VAN DE WAL,Marion, BERENTSEN,Richard Bernard, CHIAPPARINO,Elena, OGUNDIWIN,Ebenezer.

La aplicación se refiere al campo de cultivo de plantas, en particular el cultivo de sandía. Se proporcionan plantas de sandía resistentes al CVYV (y semillas a partir de las cuales se pueden cultivar estas plantas). También se proporciona un QTL para resistencia al CVYV (cyv_3.1) y marcadores y métodos para seleccionar plantas para la presencia del QTL.

PDF original: ES-2667441_R1.pdf

PDF original: ES-2667441_A2.pdf

Método para producir biomasa foliar en cultivo.

(22/03/2017). Solicitante/s: IMPERIAL INNOVATIONS LIMITED. Inventor/es: MCCARTHY,JAMES GERARD, MICHOUX,FRANCK, NIXON,PETER.

Un método para producir biomasa foliar a partir de células vegetales indiferenciadas, comprendiendo el método proporcionar células vegetales indiferenciadas, ponerlas en contacto con un agente que promueve la diferenciación de las células en tejido foliar y cultivar las células en suspensión en un sistema de inmersión temporal en medio de cultivo líquido y en el que el agente está presente en el medio de cultivo del sistema de inmersión temporal en medio de cultivo líquido y en el que el agente es una citoquinina y en el que el agente se añade al medio de cultivo a una concentración de 0,01 a 100 μM y en el que el tiempo de inmersión varía de 1 a 30 minutos cada 2 a 24 horas y en el que el volumen de líquido en el sistema de inmersión temporal en medio de cultivo líquido es de 1 a 10.000 litros.

PDF original: ES-2626281_T3.pdf

Método para producir plantas fértiles a través de inducción de BBM durante la transformación.

(07/09/2016) Un método para producir una planta de pimiento dulce Capsicum annuum transgénica fértil, dicho método comprende: (a) transformar una célula vegetal de pimiento dulce Capsicum annuum con un vector de expresión que codifica una proteína babyboom (BBM), en donde dicho vector de expresión produce una actividad de transcripción nuclear inducible de dicha proteína babyboom (BBM); (b) regenerar dicha célula vegetal de pimiento dulce Capsicum annuum transformada en estructuras tipo brote (SLS) en condiciones inductoras que dan como resultado una actividad de transcripción nuclear de dicha proteína babyboom (BBM), dichas condiciones inductoras comprenden poner en contacto dicha célula…

Métodos y composiciones para aumentar la vida de almacenamiento de la fruta.

(01/06/2016) Un método para aumentar la vida de almacenamiento poscosecha y firmeza de la fruta de una planta de una especie Rosaceae durante, o después, del almacenamiento poscosecha, con respecto a la fruta de una planta de control bajo las mismas condiciones, comprendiendo el método reducir la expresión o actividad en la planta de un polipéptido con la secuencia de aminoácidos de SEQ ID NO: 1, o una variante del polipéptido con al menos el 70 % de identidad con la secuencia de aminoácidos de SEQ ID NO: 1 a lo largo de la longitud entera de SEQ ID NO: 1, en el que el método comprende la etapa de introducir un polinucleótido en una célula de planta, o planta, para efectuar…

Cápsulas que contienen células o tejidos vivos.

(12/08/2015) Cápsula sin costuras que comprende un líquido acuoso en el que está suspendida una célula o tejido vivos, en la que la cápsula está formada mediante un aparato de fabricación de cápsulas sin costuras con una tobera tubular triple, en la que el líquido acuoso que contiene la célula o tejido vivos se suministra en el tubo más interno de la tobera tubular triple, en la que un material lipófilo se suministra al tubo medio de la tobera tubular triple, en la que un material que forma la membrana externa se suministra al tubo más externo de la tobera tubular triple, en la que la célula o tejido puede crecer en el líquido acuoso, caracterizada porque el material lipófilo se selecciona entre el grupo que comprende aceites de fritura por inmersión, aceite para ensalada, vitamina…

Procedimiento y medios de aclimatación de plantones a la vida en el exterior.

(29/04/2015) Un dispositivo de luz de tratamiento de choque de trasplante de plantas, en el que al menos un dispositivo de luz mencionado es un LED UV y está dispuesto para iluminar al menos un plantón de planta en el interior antes de la transferencia del al menos un plantón de planta mencionado para la vida en el exterior, y al menos un fósforo de conversión por elevación de longitud de onda está dispuesto próximo al LED UV.

Dispositivo separador, dispositivo de deposición y sistema para manipular embriones vegetales somáticos.

(01/04/2015) Un procedimiento para separar embriones vegetales suspendidos en fluido de tejido embriogénico inmaduro, que comprende las etapas de: a) proporcionar un contenedor separador adecuado, conteniendo dicho contenedor fluido que tiene una densidad inferior a la de los embriones a separar, teniendo una forma esencialmente cilíndrica, teniendo una pared inferior esencialmente plana y un eje esencialmente vertical; y comprendiendo además un conducto en comunicación con el fluido en el contenedor en la región axial de la pared inferior durante la operación y un medio de inducción de un flujo de rotación axisimétrico que es un objeto en rotación colocado dentro del contenedor ; b) crear un vórtex colector en la región axial de…

Método para preparar pimientos transgénicos utilizando la inducción del callo.

(15/10/2014) Un método para producir plantas de pimiento transgénicas, comprendiendo el método las etapas de: (a) pre-cultivar explantes de pepino en un medio de inducción del callo; (b) co-cultivar los explantes pre-cultivados con Agrobacterium en el que se ha introducido un gen diana; (c) cultivar los explantes co-cultivados en un medio de selección con el fin de formar un callo y seleccionar el callo formado; y (d) cortar el callo y cultivar el callo cortado en un medio de inducción de brotes con el fin de formar brotes.

Métodos para dispersar embriones vegetales somáticos.

(23/07/2014) Un método de dispersión de grupos de embriones vegetales suspendidos en un líquido en embriones vegetales individuales, incluyendo dicho método al menos una secuencia de dispersión, que comprende las siguientes etapas: i) someter los grupos de embriones a fuerzas de dinámica de fluidos que provocan deformación de extensión axial y deformación de compresión radial; ii) someter los grupos de embriones a fuerzas de dinámica de fluidos que provocan deformación de compresión axial y deformación de extensión radial de fuerzas de dinámica de fluidos; repetir dichas etapas en secuencia hasta que los embriones individuales se separan entre sí.

Producción mejorada de tebaína y oripavina mediante Papaver somniferum.

(21/07/2014) Un procedimiento de producción de una planta de amapola que se reproduce establemente de Papaver somniferum que tenga tebaína y oripavina y que constituyan aproximadamente el 50 % en peso o más de la combinación de alcaloides que consiste en morfina, codeína, tebaína y oripavina, comprendiendo el procedimiento las etapas de: a) exponer al menos una semilla de amapola de Papaver somniferum a un agente mutagénico, b) cultivar la al menos una semilla de amapola para producir una planta que lleve una hoja o una cápsula de amapola inmadura, opcionalmente mediante múltiples generaciones autofecundadas, c) muestrear la hoja o cápsula de amapola para la presencia de tebaína, oripavina, morfina y codeína, y d) repetir las etapas a) a c) hasta que se obtenga una planta de amapola de Papaver…

Procedimiento y medios para la aclimatación de plantones a la vida en el exterior.

(26/03/2014) Un procedimiento de tratamiento de plantas, en el que - al menos una de las citadas plantas es un plantón de árbol y está alojado en interior , - los citados plantones de árboles están expuestos a la luz UV artificial en el interior antes de la vida en el exterior , que se caracteriza porque, - la luz UV incidente es producida por diodos emisores de luz (LED) , tanto en las bandas UV - A (- 315- 400 nm) y UV - B para tratar el choque de trasplante en las citadas plantas

Muestreador automático de semillas libre de contaminación y procedimiento de muestreo, evaluación y reagrupamiento de semillas.

(19/02/2014) Un sistema automático muestreador de semillas, que comprende: un sistema de orientación configurado para orientar una semilla; una estación de muestreo configurada para retirar tejido de la semilla orientada; y un subsistema de transporte de semillas capaz de transportar la semilla orientada a la estación de muestreo, caracterizado porque el subsistema de transporte de semillas incluye un portasemillas configurado para mantener la semilla en una orientación deseada

Derivados del Factor VII de coagulación.

(05/12/2013) Polipéptido del factor VII que comprende la secuencia de aminoácidos SEC ID n.º: 1 o una variante de la misma, donde el polipéptido del Factor VII tiene la misma actividad o mayor actividad en comparación con el Factor VIIa recombinante de tipo salvaje humano donde una cisteína se ha añadido al extremo C-terminal de SEC ID n.º: 1 o de la variante de la misma.

TRATAMIENTOS PARA INCREMENTAR EL VIGOR DE PLANTAS LEÑOSAS EN CONDICIONES IN VITRO Y SU MÉTODO DE APLICACIÓN.

(27/05/2013) Tratamientos para incrementar el vigor de plantas leñosas en condiciones in vitro y su método de aplicación. La presente invención proporciona tratamientos eficaces, para aumentar el crecimiento de plantas leñosas (preferentemente melocotonero y ciruelo) en condiciones in vitro. La presente invención muestra como la adición de benzotiodiazol (BTH) o ácido L-2-oxo-4-tiazolidina carboxílico (OTC), a bajas concentraciones, al medio de cultivo para la micropropagación de dichas plantas, actúa promoviendo el crecimiento de los explantos de forma muy significativa. En un aspecto particular la invención se refiere a un método de tratamiento para incrementar el vigor en plantas leñosas en condiciones in vitro que comprende los siguientes pasos, (i) establecimiento de cultivo…

METODO DE CULTIVO IN VITRO DE PLANTAS FANERÓGAMAS MARINAS.

(16/10/2012) Método de cultivo in vitro de plantas fanerógamas marinas. La presente invención se refiere a un método adecuado para cultivar plantas fanerógamas marinas y, más en concreto la especie Posidonia oceánica que controla la inducción, mantenimiento y maduración de cultivos celulares hasta alcanzar estadios pre-embrionarios. El método incluye extraer explantos seleccionados de la zona distal del ápice meristemático foliar de una plántula de fanerógama marina de la especie Posidonia oceánica, cultivar los explantos obtenidos en un medio de cultivo líquido, obtener células libres mediante el empleo de técnicas de digestión celular, establecer cultivos celulares induciendo la formación de masas pre-embriogenética (PEM),…

1 · · ››
Utilizamos cookies para mejorar nuestros servicios y mostrarle publicidad relevante. Si continua navegando, consideramos que acepta su uso. Puede obtener más información aquí. .