CIP 2015 : A61K 39/118 : Chlamydiaceae, p. ej. Chlamydia trachomatis o Chlamydia psittaci.

CIP2015AA61A61KA61K 39/00A61K 39/118[1] › Chlamydiaceae, p. ej. Chlamydia trachomatis o Chlamydia psittaci.

Notas[t] desde A61 hasta A63: SALUD; SALVAMENTO; DIVERSIONES
Notas[n] desde A61K 31/00 hasta A61K 47/00:
  • Una composición, es decir, una mezcla de dos o más componentes, se clasifica en el último de los grupos A61K 31/00 - A61K 47/00 que cubra al menos uno de estos componentes. Los componentes pueden ser compuestos simples u otros ingredientes simples.
  • Cualquier parte de una composición que, en aplicación de la Nota (1), no esté identificada como tal por una clasificación asignada, pero que por sí misma se considere nueva y no obvia, debe clasificarse también en el último lugar apropiado de los grupos A61K 31/00 - A61K 47/00 . La parte puede ser un componente simple o una composición propiamente dicha.
  • Cualquier parte de una composición que, en aplicación de las Notas (1) ó (2), no esté identificada como tal por una clasificación asignada, pero que se considere que representa información de interés para la búsqueda, puede clasificarse además en el último lugar apropiado de los grupos A61K 31/00 - A61K 47/00 . Este caso puede plantearse cuando se considera de interés facilitar las búsquedas de composiciones utilizando una combinación de símbolos de clasificación. Esta clasificación optativa debería ser dada como "información adicional".

A SECCION A — NECESIDADES CORRIENTES DE LA VIDA.

A61 CIENCIAS MEDICAS O VETERINARIAS; HIGIENE.

A61K PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO (dispositivos o métodos especialmente concebidos para conferir a los productos farmacéuticos una forma física o de administración particular A61J 3/00; aspectos químicos o utilización de substancias químicas para, la desodorización del aire, la desinfección o la esterilización, vendas, apósitos, almohadillas absorbentes o de los artículos para su realización A61L;   composiciones a base de jabón C11D).

A61K 39/00 Preparaciones medicinales que contienen antígenos o anticuerpos (materiales para ensayos inmunológicos G01N 33/53).

A61K 39/118 · Chlamydiaceae, p. ej. Chlamydia trachomatis o Chlamydia psittaci.

CIP2015: Invenciones publicadas en esta sección.

Vacunas de VME (vesículas de membrana externa).

(21/02/2018). Solicitante/s: GLAXOSMITHKLINE BIOLOGICALS SA. Inventor/es: GRANDI, GUIDO, GRIFANTINI,RENATA MARIA, FINCO,ORETTA, BARTOLINI,ERIKA.

El uso de una bacteria mutante de ompA en la producción de vesículas de membrana externa que expresan un antígeno heterólogo sobre su superficie, en el que la bacteria es una E. coli que presenta el antígeno heterólogo sobre su superficie, en el que E. coli (a) no expresa la proteína OmpA, (b) expresa la lipoproteína de Braun lpp y (c) produce un aumento en el número de VME en comparación con su respectiva cepa de tipo silvestre que lleva un gen ompA de tipo silvestre.

PDF original: ES-2665044_T3.pdf

Vacunas contra Chlamydia.

(24/01/2018) Una composición que comprende uno o más péptidos, comprendiendo cada uno de dichos péptidos uno o más epítopos seleccionados a partir de la lista constituida por un epítopo de linfocitos B, un epítopo de linfocitos Th2 CD4+, un epítopo de linfocitos Th1 CD4+ y un epítopo de CTL; donde dicha composición comprende al menos un epítopo de linfocitos B, un epítopo de linfocitos Th2 CD4+, un epítopo de linfocitos Th1 CD4+ y un epítopo de CTL; donde los epítopos están ubicados en la proteína principal de la membrana externa (MOMP) de Chlamydia psittaci; donde la composición no comprende la proteína MOMP de Chlamydia psittaci de longitud total, y donde el epítopo de linfocitos B está constituido por una secuencia de aminoácidos seleccionada a partir del grupo constituido por: GTASATT (SEQ ID NO 92), GTDFNN (SEQ ID NO 93) y NPTLLGKA…

Expresión híbrida y en tándem de proteínas procedentes de Neisseria.

(20/01/2016) Una composición que comprende las siguientes proteínas: NH2-A-[X-L-]n-B-COOH, en la que n≥ 2, X1≥ 287, X2≥ 953 961 NH2-A-[X-L-]n-B-COOH, en la que n≥ 2, X1≥ 936, X2≥ 741, en la que 287 es la SEC ID Nº: 3104 del documento WO99/57280 o una proteína que tiene una identidad de secuencia de un 80 % o más con ella, 953 es la SEC ID Nº: 2918 del documento WO99/57280 o una proteína que tiene una identidad de secuencia de un 80 % o más con ella, 961 es la SEC ID Nº: 940 del documento WO99/57280 o una proteína que tiene una identidad de secuencia de un 80 % o más con ella, 936 es la SEC ID Nº: 2884 del documento WO99/57280 o una proteína que tiene una…

Procedimiento de desencadenamiento o inducción de una respuesta inmunitaria.

(15/07/2015) Una composición que comprende un antígeno y el adyuvante ISCOMATRIXtm para su uso en un procedimiento para desencadenar una respuesta inmunitaria en un sujeto humano o animal, que comprende administrar a dicho sujeto las composición por vía intrapulmonar.

Expresión híbrida y en tandem de proteínas de Neisseria.

(20/08/2014) Una proteína de N.meningitidis que comprende: (a) la secuencia de aminoácidos de la SEQ ID NO: 19; o (b) una proteína que tiene un 80% o más de identidad de secuencia con la secuencia de aminoácidos de la SEQ ID NO: 19 para su uso en la prevención y/o tratamiento de meningitis bacteriana.

Complejo de péptido antigénico-proteína de choque térmico modificada.

(09/10/2013) Una dosis inyectable de una vacuna, comprendiendo la dosis células recombinantes no proliferativas modificadaspor ingeniería genética para secretar complejos de una proteína de choque térmico gp96 modificada y un antígenoen una cantidad suficiente para provocar la activación de una respuesta de linfocitos T CD8, independientes de CD4,frente al antígeno cuando se administra a un sujeto, en la que la proteína de choque térmico modificada carece deuna secuencia de retención en el retículo endoplásmico

Composición de vacuna para vacunar a los perros contra la enfermedad respiratoria infecciosa canina (ERIC).

(21/08/2013) Una composición de vacuna adecuada para vacunar a perros que comprende un agente capaz de suscitar en unperro una respuesta inmunitaria contra Mycoplasma cynos (M. cynos), en la que dicho agente comprende M. cynosinactivada o atenuada, que adicionalmente comprende uno o más de: un agente capaz de suscitar en un perro una respuesta inmunitaria contra Streptococcus equi subespeciezooepidemicus (S. zooepidemicus), en donde dicho agente comprende S. zooepidemicus inactivado o atenuado, oun fragmento inmunogénico de S. zooepidemicus, o un ácido nucleico que codifica dicho fragmento; un agente capaz de suscitar en un perro una respuesta inmunitaria contra el coronavirus respiratorio canino (CVRC),en donde dicho agente comprende…

Antígenos de Chlamydia trachomatis para uso en vacuna y diagnóstico.

(13/06/2012) Uso de un polipéptido sustancialmente puro, que comprende una secuencia de aminoácidos seleccionada de (a) SEQ ID NO. 1, o (b) una porción inmunógena de la secuencia 5 indicada en (a), o (c) una secuencia de aminoácidos análoga que tiene al menos 90% de identidad de secuencia con unacualquiera de las secuencias en (a) o (b) y es al mismo tiempo inmunógena, o el ácido nucleico codificante delos polipéptidos indicados en (a), (b) o (c), para preparación de una composición farmacéutica paraprevención o tratamiento de infecciones causadas por una bacteria de una especie de Chlamydia, en dondeel polipéptido está fusionado a una pareja de fusión.

Inmunización contra Chlamydia trachomatis.

(23/05/2012) Una proteína para su uso en el tratamiento o la prevención de infección debida a Chlamydia trachomatis, en laque la proteína es (a) una proteína que comprende la secuencia de aminoácidos SEC ID 255, (b) una proteína quecomprende una secuencia de aminoácidos que tiene una identidad de secuencia del 50 % o más con la secuenciade aminoácidos de (a), o (c) una proteína que comprende un fragmento de al menos 7 aminoácidos consecutivos deSEC ID 255.

Oligonucleótidos inmunoestimuladores y sus usos.

(18/05/2012) Un oligonucleótido inmunoestimulador que tiene hasta 100 nucleótidos y que comprende un motivo de secuencia no palindrómica de ácido nucleico que tiene la siguiente fórmula: TCATCATTTTGTCATTTTGTCATT(SEQ ID Nº 2)

Vacunas de polipéptido de fusión de mucina, composiciones y métodos de uso de las mismas.

(28/03/2012) Vacuna purificada que comprende: (a) un polipéptido adyuvante que comprende un primer polipéptido unido a un segundo polipéptido, en la que el primer polipéptido es un polipéptido de mucina y se glicosila por una α1,3-galactosiltransferasay el segundo polipéptido comprende una región Fc de una cadena pesada de inmunoglobulina; y (b) un antígeno, en la que el polipéptido adyuvante se une operativa o covalentemente al antígeno

COMPOSICIÓN DE VACUNA PARA VACUNBAR A LOS PERROS CONTRA LA ENFERMEDAD RESPIRATORIA INFECCIOSA CANINA (ERIC).

(07/04/2011) Una composición de vacuna para la vacunación de perros que comprende: un agente capaz de elevar una respuesta inmune contra Streptococcus equi sub species zooepidemicus (S. zooepidemicus) en un perro, donde dicho agente se compone de S. zooepidemicus inactivado o atenuado o un fragmento inmunológico de S. zooepidemicus, o un ácido nucleico que codifica dicho fragmento; y un agente capaz de elevar una respuesta inmune contra Micoplasma cynos (M. cynos) en un perro, donde dicho agente se compone de M. cynos atenuado o inactivado, o un fragmeno inmunológico de M. cynos, o un ácido nucleico que codifica dicho fragmento

PROCEDIMIENTOS RELACIONADOS CON EL TRATAMIENTO DE LA ATEROESCLEROSIS.

(01/12/2009). Ver ilustración. Solicitante/s: CAMBRIDGE THERANOSTICS LTD. PETYAEV, IVAN MIKHAILOVICH. Inventor/es: PETYAEV,IVAN.

Procedimiento para obtener un inhibidor de oxidación de lípidos mediado con anticuerpos, que comprende: (a) poner en contacto un anticuerpo anti-clamidia de oxidación de líquidos y un compuesto de prueba en presencia de un antígeno de célula clamidial; y (b) determinar la oxidación de los lípidos del antígeno de célula clamidial mediante el anticuerpo anti-clamidia de oxidación de lípidos.

DIAGNOSTICO Y TRATAMIENTO DE LA ATEROSCLEROSIS.

(19/11/2009). Ver ilustración. Solicitante/s: CAMBRIDGE THERANOSTICS LTD. Inventor/es: PETYAEV,IVAN.

Método para evaluar un trastorno aterosclerótico en un individuo que comprende: analizar la capacidad de un anticuerpo de una muestra de suero obtenida del individuo para oxidar lípidos y unirse a un antígeno de células de Chlamydia, siendo la presencia de un anticuerpo en dicha muestra que oxida lípidos y se une a un antígeno de células de Chlamydia indicativa de que el individuo padece o presenta riesgo de padecer un trastorno aterosclerótico.

VACUNA CONTRA BLEB DISEÑADA MEDIANTE INGENIERIA GENETICA.

(16/06/2007). Solicitante/s: SMITHKLINE BEECHAM BIOLOGICALS S.A.. Inventor/es: BERTHET, FRANCOIS-XAVIER JACQUES, DENOEL, PHILIPPE, DALEMANS, WILFRIED L SMITHKLINE BEECHAM BIOL.S.A, DEQUESNE, GUY SMITHKLINE BEECHAM BIOLOGICALS S.A., FERON, CHRISTIANE SMITHKLINE BEECHAM BIO.S.A., LOBET, YVES SMITHKLINE BEECHAM BIO.S.A., POOLMAN, JAN SMITHKLINE BEECHAM BIO.S.A., THIRY, GEORGES SMITHKLINE BEECHAM BIO.S.A., LHONNARD, JOELLE SMITHKLINE BEECHAM BIOL.S.A, VOET, PIERRE SMITHKLINE BEECHAM BIO. S.A.

Una preparación de bleb diseñada mediante ingeniería genética aislada de una cepa de Neisseria meningitidis modificada, caracterizada en que dicha preparación se puede obtener empleando los siguientes procedimientos: a) un procedimiento para reducir la variable inmunodominante o los antígenos no protectores en el interior de la preparación bleb, que comprende las etapas de diseñar mediante ingeniería una cepa bacteriana para producir menos o nada del antígeno PorA, y fabricar blebs a partir de dicha cepa;.

VACUNA CONTRA CLAMIDIAS QUE COMPRENDE ANTICUERPOS ANTIIDIOTIPICOS.

(01/04/2007). Solicitante/s: THE JOHNS HOPKINS UNIVERSITY UNIVERSITY OF MASSACHUSETTS, A PUBLIC INSTITUTION OF HIGHER EDUCATION OF THE COMMONWEALTH OF MASSACH. Inventor/es: MACDONALD, ALEX, AN, LING, STUART, ELIZABETH.

UNA VACUNA DE CLAMIDIA DE GENERO ESPECIFICA, QUE CONSTA DE UN ANTICUERPO ANTI-IDIOTIPICO CAPAZ DE PRODUCIR EN UN ANIMAL UN ANTICUERPO ANTI-ANTI-IDIOTIPICO QUE RECONOCE UN EXOANTIGENO GLICOLIPIDO (GLXA) DE CLAMIDIA. LA VACUNA SE PRODUCE PRODUCIENDO UN ANTICUERPO IDIOTIPICO AL GLXA QUE, A SU VEZ, ES UTILIZADO PARA PRODUCIR EL ANTICUERPO ANTI-IDIOTIPICO QUE INCLUYE LA VACUNA.

PROTEINAS DE CHLAMYDIA PNEUMONIAE EXPUESTAS EN LA SUPERFICIE.

(16/01/2007). Ver ilustración. Solicitante/s: LOKE DIAGNOSTICS APS. Inventor/es: BIRKELUND, SVEND, CHRISTIANSEN, GUNNA, KNUDSEN, KATRINE, HEBSGAARD PEDERSEN, ANNA-SOFIE, MYGIND, PER.

Una proteína que tiene una secuencia de aminoácidos que se selecciona del grupo constituido por SEC. ID. N.º: 2, SEC. ID. N.º: 4, SEC. ID. N.º: 6, SEC. ID. N.º: 8, SEC. ID. N.º: 10, SEC. ID. N.º: 12, SEC. ID. N.º: 14, SEC. ID. N.º: 16, SEC. ID. N.º: 18, SEC. ID. N.º: 20, SEC. ID. N.º: 22 y SEC. ID. N.º: 24; o una subsecuencia de al menos 15 aminoácidos consecutivos de cualquiera de dichas proteínas, siendo dicha subsecuencia capaz de producir un anticuerpo que es monoespecífico contra un antígeno de Chlamydia pneumoniae.

COMPLEJOS PROTEINICOS DE ESTRES-PEPTIDO EN CALIDAD DE VACUNAS PROFILACTICAS Y TERAPEUTICAS CONTRA AGENTES PATOGENOS INTRACELULARES.

(16/07/2005). Solicitante/s: MOUNT SINAI SCHOOL OF MEDICINE OF THE CITY UNIVERSITY OF NEW YORK. Inventor/es: SRIVASTAVA, PRAMOD, K., UDONO, HEIICHIRO, BLACHERE, NATHALIE E.

SE DESCRIBE UNA FAMILIA DE VACUNAS QUE CONTIENE COMPLEJOS PEPTIDO-PROTEINAS DE ESTRES QUE, AL ADMINISTRARSE A UN MAMIFERO, INICIAN UNA RESPUESTA DE LAS CELULAS T CITOTOXICAS CONTRA CELULAS INFECTADAS CON UN PATOGENO INTRACELULAR PRESELECCIONADO. TAMBIEN SE DESCRIBEN LOS METODOS PARA PREPARAR Y ADMINISTRAR VACUNAS QUE CONTIENEN DICHOS COMPLEJOS PEPTIDO-PROTEINAS DE ESTRES.

VACUNAS CONTRA CALMIDIAS Y COMPOSICIONES INMUNOGENICAS QUE CONTIENEN UN ANTIGENO DE MEMBRANA EXTERNA Y METODOS PARA SU PREPARACION.

(01/12/2003). Ver ilustración. Solicitante/s: CONNAUGHT LABORATORIES LIMITED. Inventor/es: MURDIN, ANDREW, D., UNDERDOWN, BRIAN, J.

ESTA INVENCION SE REFIERE A UNAS COMPOSICIONES INMUNOLOGICAS QUE COMPRENDEN UN EXTRACTO ANTIGENO DE MEMBRANA DE UNA CEPA DE CHLAMYDIA Y SON EFICACES EN LA PROTECCION CONTRA LA ENFERMEDAD PROVOCADA POR LA INFECCION DE CHLAMYDIA. LAS COMPOSICIONES INMUNOLOGICAS PUEDEN COMPRENDER LA PROTEINA DE LA MEMBRANA EXTERIOR PRINCIPAL (MOMP) DE CHLAMYDIA, QUE PUEDE TENER UNA FORMA ISOOLIGOMERICA O EN COMPLEJO CON, POR LO MENOS, OTRO ANTIGENO DE CHLAMYDIA. LA COMPOSICION INMUNOLOGICA PUEDE INCLUIR UN COMPLEJO INMUNOESTIMULANTE (ISCOM) Y SE PUEDE INCORPORAR EL ANTIGENO DE MEMBRANA EXTERIOR. DICHAS COMPOSICIONES INMUNOLOGICAS TIENEN UNA UTILIDAD COMO VACUNAS ANTI - CHLAMYDIAE Y PARA CIERTAS APLICACIONES DE DIAGNOSTICO.

VACUNAS DE CHLAMYDIA.

(01/11/2000). Solicitante/s: SMITHKLINE BEECHAM BIOLOGICALS S.A.. Inventor/es: SLAOUI, MONCEF MOHAMED, PRIEELS, JEAN-PAUL, MAISONNEUVE, JEAN-FRANCOIS, UNI. DES SCIENCES, VERLANT, VINCENT, UNI. DES SCIENCES.

SE PRESENTA UNA NUEVA VACUNA PARA LA PREVENCION DE LAS INFECCIONES POR CLAMIDIA EMPLEANDO LA PROTEINA DE MEMBRANA EXTERNA Y DOS INMUNOESTIMULANTES, 3D.

PLASMIDO PCTD AISLADO DE CHLAMYDIA TRACHOMATIS SEROTIPO D, GENES Y PROTEINAS CODIFICADOS POR EL MISMO; PLASMIDOS RECOMBINANTES PARA LA EXPRESION DE DICHOS GENES EN SISTEMAS HETEROLOGOS COMO PROTEINAS RECOMBINANTES DE FUSION, PREPARACION DE DICHAS PROTEINAS RECOMBINANTES Y.

(16/11/1999). Solicitante/s: SCLAVO S.P.A.. Inventor/es: RATTI, GIULIO, COMANDUCCI, MAURIZIO, TECCE, MARIO F., GIULIANI, MARZIA M.

SE DESCRIBE UN PLASMIDO AISLADO DE LA CLAMYDIA TRACHOMATIS QUE CONSTA DE 8 GENES QUE CODIFICAN PROTEINAS UTILES EN LA FORMULACION DE VACUNAS O ANALISIS DIAGNOSTICOS PARA DETERMINAR LA BACTERIA O ANTICUERPOS ESPECIFICOS GENERADOS DURANTE LAS INFECCIONES DE C. TRACHOMATIS; SE DESCRIBE PARTICULARMENTE LA FUSION RECOMBINANTE DE LA PROTEINA MS2-PGP3D QUE CONSTA DE LAS SECUENCIAS POLIPEPTIDICAS CODIFICADAS POR PCT E INMUNOGENICA EN EL CURSO DE LAS INFECCIONES EN EL HOMBRE. TAMBIEN SE DESCRIBE UN METODO PARA PREPARAR PROTEINA MENCIONADA EN E.COLI.

COMPUESTO PARA VACUNA.

(16/06/1996). Solicitante/s: THE UNIVERSITY OF MELBOURNE MEAT RESEARCH CORPORATION. Inventor/es: BRANDON, MALCOLM ROY, MEEUSEN, ELSA NICOLE THERESIA, GORRELL, MARK DOUGLAS, WALKER, JOHN, BOWLES, VERNON MORRISON.

METODO PARA PRODUCIR AL MENOS UN ANTICUERPO CONTRA UN PATOGENO, QUE INCLUYE LOS PASOS DE OBTENER UNA MUESTRA BIOLOGICA DE UN EXTRACTO DEL AGENTE PATOGENO, DE UN ANIMAL INFECTADO E EN PELIGRO DE ESTARLO, AISLANDO CELULAS DE LA MUESTRA BIOLOGICA, CULTIVANDO LAS CELULAS IN VITRO EN UN MEDIO DE CULTIVO ADECUADO, Y CULTIVANDO LOS ANTICUERPOS PRODUCIDOS POR ESTA CELULAS. EL ANIMAL DEL QUE SE TOME LA MUESTRA BIOLOGICA PUEDE SER UN ANIMAL INMUNE, Y LA MUESTRA PUEDE TOMARSE POCO TIEMPO DESPUES DE QUE EL ANIMAL HAYA SIDO ATACADO POR LA INFECCION PATOGENICA.

PROCEDIMIENTO DE EXTRACCION.

(01/10/1994). Solicitante/s: UNILEVER PLC UNILEVER N.V.. Inventor/es: DAVIDSON, IAN WILLIAM, SHEARD, PAUL.

LA EXTRACCION MEJORADA DE ANTIGENOS SOLUBILIZADOS SE OBTIENE DE BACTERIAS COMO POR EJEMPLO CHLAMYDIA Y NEISSERIA MEDIANTE EL USO DE UN TAMPON QUE CONTIENE UN AGENTE ACTIVO DE SUPERFICIE ZWITTERIONICA, ESPECIALMENTE CHAPS O CHAPSO, EN AUSENCIA DE CATIONES DIVALENTES. LA EXTRACCION SE REALIZA A TEMPERATURA ELEVADA, Y PROPORCIONA UNA MUESTRA UTIL EN ANALISIS PARA DETECTAR LA PRESENCIA DE LA BACTERIA.

PROCEDIMIENTO DE OBTENCION DE UNA COMPOSICION DE VACUNA PARA LA INMUNIZACION DE OVEJAS CONTRA EL ABORTO ENZOOTICO.

(16/01/1983). Solicitante/s: RESEARCH CORPORATION.

PROCEDIMIENTO DE OBTENCION DE UNA COMPOSICION DE VACUNA PARA LA INMUNIZACION DE OVEJAS CONTRA EL ABORTO ENZOOTICO. SE PROPAGAN CUERPOS ELEMENTALES CLAMIDIALES SOBRE UN CULTIVO CELULAR, SE INACTIVAN TALES CUERPOS Y SE COMBINAN CON UN VEHICULO PARA LOS MISMOS PARENTERALMENTE ADMINISTRABLE. LOS CUERPOS ELEMENTALES PUEDEN SER CHLAMYDIA SP. PROPAGADO CON FORMALINA Y EL CULTIVO CELULAR CONSISTIR EN CELULAS DE FIBROBLASTO.

 

Patentes más consultadas

 

Clasificación Internacional de Patentes 2015