CIP 2015 : A61K 39/38 : Antígenos de serpientes.

CIP2015AA61A61KA61K 39/00A61K 39/38[1] › Antígenos de serpientes.

Notas[t] desde A61 hasta A63: SALUD; SALVAMENTO; DIVERSIONES
Notas[n] desde A61K 31/00 hasta A61K 47/00:
  • Una composición, es decir, una mezcla de dos o más componentes, se clasifica en el último de los grupos A61K 31/00 - A61K 47/00 que cubra al menos uno de estos componentes. Los componentes pueden ser compuestos simples u otros ingredientes simples.
  • Cualquier parte de una composición que, en aplicación de la Nota (1), no esté identificada como tal por una clasificación asignada, pero que por sí misma se considere nueva y no obvia, debe clasificarse también en el último lugar apropiado de los grupos A61K 31/00 - A61K 47/00 . La parte puede ser un componente simple o una composición propiamente dicha.
  • Cualquier parte de una composición que, en aplicación de las Notas (1) ó (2), no esté identificada como tal por una clasificación asignada, pero que se considere que representa información de interés para la búsqueda, puede clasificarse además en el último lugar apropiado de los grupos A61K 31/00 - A61K 47/00 . Este caso puede plantearse cuando se considera de interés facilitar las búsquedas de composiciones utilizando una combinación de símbolos de clasificación. Esta clasificación optativa debería ser dada como "información adicional".

A SECCION A — NECESIDADES CORRIENTES DE LA VIDA.

A61 CIENCIAS MEDICAS O VETERINARIAS; HIGIENE.

A61K PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO (dispositivos o métodos especialmente concebidos para conferir a los productos farmacéuticos una forma física o de administración particular A61J 3/00; aspectos químicos o utilización de substancias químicas para, la desodorización del aire, la desinfección o la esterilización, vendas, apósitos, almohadillas absorbentes o de los artículos para su realización A61L;   composiciones a base de jabón C11D).

A61K 39/00 Preparaciones medicinales que contienen antígenos o anticuerpos (materiales para ensayos inmunológicos G01N 33/53).

A61K 39/38 · Antígenos de serpientes.

CIP2015: Invenciones publicadas en esta sección.

Formulación de inmunoglobulina y procedimiento de preparación de la misma.

(17/06/2020). Solicitante/s: Biogen MA Inc. Inventor/es: BURKE, DAVID J., LEHRMAN, SHERWOOD, RUSS, PHILLIPS,CHRISTOPHER, CALLAWAY,JAMES, BUCKLEY,SHAUN E, O'CONNOR,BARBARA HORSEY.

Una formulación acuosa estable que comprende natalizumab en una concentración de 15 mg/mL a 50 mg/mL, un tampón fosfato, polisorbato 80 en una concentración de aproximadamente el 0,001 % a aproximadamente el 2,0 %(p/v) y cloruro sódico, donde la formulación es estable durante al menos seis meses a una temperatura de 5 a 8 °C.

PDF original: ES-2819011_T3.pdf

Composiciones y métodos terapéuticos.

(06/05/2020). Solicitante/s: INSTITUT PASTEUR. Inventor/es: THEZE,JACQUES, ROSE,THIERRY, BUGAULT,FLORENCE.

Un compuesto para su uso en un método para tratar una inmunodeficiencia de células T CD4 en un sujeto que lo necesita, en el que el compuesto es un inhibidor de la fosfolipasa A2 del grupo IB segregada (PLA2GIB) seleccionada de un anticuerpo anti-PLA2GIB o un receptor de PLA2GIB soluble, en el que la PLA2GIB es una proteína que comprende los restos aminoácidos 23-148 de SEQ ID NO:2, o uno de sus variantes naturales.

PDF original: ES-2812542_T3.pdf

Nanoportadores sintéticos tolerogénicos para reducir las respuestas de anticuerpos.

(01/04/2020). Solicitante/s: Selecta Biosciences, Inc. Inventor/es: KISHIMOTO,TAKASHI KEI, FRASER,CHRISTOPHER, MALDONADO,ROBERTO A.

Una composición para usar en un método que promueve una respuesta inmunitaria tolerogénica a un antígeno que de otro modo causaría una respuesta inmunitaria no deseada cuando se administra a un sujeto, en donde: (a) la composición comprende nanoportadores sintéticos acoplados a: rapamicina o un análogo de rapamicina con una carga de no más de 25% (p/p); y epítopos restringidos por MHC de clase II de dicho antígeno con una carga de no más de 25% (p/p); y (b) la composición está en una cantidad efectiva para reducir la producción de anticuerpos específicos para dicho antígeno en el sujeto, y en donde la composición no comprende epítopos de células B que generan una respuesta humoral no deseada contra dicho antígeno.

PDF original: ES-2806268_T3.pdf

Composiciones y procedimientos para identificar especies de Ehrlichia.

(18/03/2020) Un procedimiento de identificación de las especies de Ehrlichia que infectan a un sujeto, si están presentes, comprendiendo el procedimiento: poner en contacto una muestra del sujeto con una primera población de péptidos aislados que comprende al menos tres péptidos diferentes, comprendiendo cada uno una secuencia de S-X2-K-E-X5-K-Q-X8-T-X10-X11-X12-X13-G-LK- Q-X18-W-X20-G-X22-X23-X24-X25-X26-G-G-G-G-G-N-F-S-A-K-E-E-X39-A-E-T-R-X44-T-F-G-L-X49-K-Q-Y-D-G-A-X56- I-X58-E-N-Q-V-Q-N-K-F-T-I-S-N-C (SEQ ID NO: 1), en la que X2 es un aminoácido seleccionado del grupo que consiste en A y V, X5 es un aminoácido seleccionado del grupo que consiste en E y D, X8 es un aminoácido seleccionado del grupo que consiste en T y P, X10 es un aminoácido seleccionado del grupo que consiste en T y V, X11 es un aminoácido seleccionado…

Composiciones de vacunas y adyuvantes y métodos para el tratamiento de infecciones del tracto urinario.

(10/06/2019). Solicitante/s: Sequoia Vaccines, Inc. Inventor/es: ELDRIDGE,GARY, MARTIN,STEVEN.

Una composición que comprende disacárido de hexaacilo fosforilado (PHAD), al menos una fosfatidilcolina y un tampón citrato de 10 mM a 50 mM; en donde la fosfatidilcolina se selecciona del grupo que consiste en 1,2-dimiristoil-sn-glicero-3-fosfocolina (DMPC), 1,2-dipalmitoil-sn-glicero-3-fosfocolina (DPPC), 1,2-diestearoil-sn-glicero-3-fosfocolina (DSPC), 1,2-dioleoil-sn-glicero- 3-fosfocolina (DOPC) y 1-palmitoil-2-oleoil-sn-glicero-3-fosfocolina (POPC); y en donde la relación molar entre la al menos una fosfatidilcolina y PHAD está comprendida entre 1:1 y 40:1 (fosfatidilcolina:PHAD).

PDF original: ES-2716124_T3.pdf

Empleo de una composición que comprende un prebiótico para disminuir el proceso inflamatorio y activación anormal de parámetros inmunológicos no específicos.

(13/05/2019). Solicitante/s: SOCIETE DES PRODUITS NESTLE S.A.. Inventor/es: SCHIFFRIN, EDUARDO, ROCHAT, FLORENCE, GUIGOZ, YVES.

Empleo de por lo menos un prebiótico en la elaboración de un medicamento o un alimento o una composición para pienso de animales domésticos, para la disminución de un proceso inflamatorio en un humano anciano o un animal doméstico viejo.

PDF original: ES-2278021_T5.pdf

PDF original: ES-2278021_T3.pdf

Vacunas de filovirus basadas en un vector adenovírico de chimpancé.

(06/05/2019). Solicitante/s: THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTMENT OF HEALTH AND HUMAN SERVICES. Inventor/es: NICOSIA, ALFREDO, CORTESE, RICCARDO, NABEL, GARY, J., COLLOCA,STEFANO, CHENG,CHENG, SULLIVAN,NANCY J, ASIEDU,CLEMENT, AMMENDOLA,VIRGINIA.

Un vector de adenovirus de chimpancé recombinante de serotipo ChAd3 que comprende un ácido nucleico que codifica una glicoproteína del virus Ébola, o una composición inmunogénica del mismo que incluye opcionalmente un adyuvante, para su uso en un método de inducción de una respuesta inmunitaria contra un antígeno de glicoproteína del virus Ébola en un sujeto.

PDF original: ES-2711613_T3.pdf

Composiciones vacunales con una matriz proteica que incluye policationes.

(27/03/2019). Solicitante/s: Matrivax, Inc. Inventor/es: KILLEEN,KEVIN P, CARTEE,ROBERT T.

Un método para producir una composición inmunógena que lleva un antígeno útil atrapado en la matriz de proteína transportadora/policatión, el cual está unido de forma no covalente a dicha matriz de proteína transportadora/ policatión; dicho método consiste en (i) mezclar un antígeno útil - elegido del grupo formado por un polisacárido, un polialcohol como forma hidrogenada de un carbohidrato, en el cual un grupo carbonilo se ha reducido a un grupo hidroxilo primario o secundario, y un homopolímero de aminoácido - con una proteína transportadora y un policatión para formar una mezcla; (ii) añadir un conector que reticule dicha proteína transportadora y dicho policatión mediante los grupos sulfhidrilo, amino o carboxilo de la proteína transportadora y del policatión, y (iii) reticular dicha proteína transportadora y dicho policatión para formar una matriz de proteína transportadora/ policatión.

PDF original: ES-2728653_T3.pdf

Procedimiento para el tratamiento de la artritis reumatoide, temblores/enfermedad de Parkinson, esclerosis múltiple y cánceres de origen no viral.

(15/03/2017). Solicitante/s: Honor C.W. M.D., LLC. Inventor/es: NELSON,GEORGE.

Una composición que comprende un agente estimulante de la inmunidad y un activador de antígeno bacteriano, en donde el agente estimulante de la inmunidad comprende una vacuna antipoliomielítica inactivada y en donde el activador de antígeno bacteriano comprende toxoide tetánico y typhim VI.

PDF original: ES-2622863_T3.pdf

Composición TNFR-FC estabilizada que comprende arginina.

(18/01/2017). Solicitante/s: IMMUNEX CORPORATION. Inventor/es: GOMBOTZ, WAYNE, R., REMMELE,RICHARD,L.,JR.

Una composición farmacéutica que es una formulación acuosa estable que comprende una forma soluble del receptor p75 TNF fusionada a un dominio Fc y un inhibidor de agregación, en el que el inhibidor de agregación es Larginina.

PDF original: ES-2618832_T3.pdf

Materiales y procedimientos para el desarrollo de un estado de no respuesta inmune específica de antígeno.

(16/11/2016). Solicitante/s: A & G Pharmaceutical, Inc. Inventor/es: HAYASHI,JUN.

Compuesto**Fórmula** o **Fórmula** para su uso en un procedimiento de inducción de anergia en un sujeto y hacer que dicho sujeto no responda a uno o más antígenos, en el que el compuesto es para administración al sujeto antes de, simultáneamente con, o después de la administración del uno o más antígenos al sujeto, en el que el compuesto es para su uso en el tratamiento de una enfermedad autoinmune en el sujeto, y en el que el antígeno es un antígeno autoinmune.

PDF original: ES-2616086_T3.pdf

Proteínas de fusión con LLO no hemolítica y métodos para utilizar las mismas.

(02/11/2016) Una proteína recombinante que comprende una proteína listeriolisina O (LLO), en donde dicha proteína LLO comprende una mutación dentro del dominio de unión al colesterol (CBD) que se ubica en los residuos 483-493 de dicha proteína LLO como se expone en la sec. con núm. de ident.: 37, en donde dicha mutación consiste en una sustitución de los residuos de aminoácidos en las posiciones 484-492 como se expone en la sec. con núm. de ident.: 37 con un péptido diferente de LLO de 8-50 residuos de aminoácidos que comprenden una porción inmunogénica de un péptido antigénico, en donde dicho péptido antigénico es un antígeno E7 del virus del papiloma humano (HPV), un antígeno E6 de HPV, un antígeno NY-ESO-1,…

Composiciones de proteína A y procedimientos de utilización.

(04/05/2016). Solicitante/s: Protalex, Inc. Inventor/es: MANN, PAUL.

Composición que comprende una cantidad eficaz de proteína A monomérica (PA) suficiente para tratar un trastorno autoinmunitario para su utilización en el tratamiento del trastorno autoinmunitario en un sujeto con o con riesgo del trastorno autoinmunitario.

PDF original: ES-2586120_T3.pdf

Conjugación de polisacárido con enterotoxina termolábil (LT) de E. coli desintoxicada usada como vacuna.

(12/11/2015) Un conjugado covalente de un polisacárido y una enterotoxina termolábil (LT) de E. coli desintoxicada, en el que la LT es una holotoxina y es una proteína mutante LTS61K que tiene una sustitución de lisina en la posición correspondiente a la posición 61 de SEC ID Nº: 5.

Conjugados transportadores de péptidos inmunogénicos y métodos para producirlos.

(03/06/2015) Método para conjugar un inmunógeno peptídico mediante un grupo reactivo de un resto aminoacídico del inmunógeno peptídico con un transportador proteico/polipeptídico que tiene uno o más grupos funcionales, comprendiendo el método las etapas de: (a) derivatizar uno o más de los grupos funcionales del transportador proteico/polipeptídico para generar un transportador derivatizado con sitios reactivos, en el que el transportador está seleccionado del grupo que consiste en CRM197, ORF1224 de Streptococcus pyogenes, ORF1664 de Streptococcus pyogenes, ORF2452 de Streptococcus pyogenes y ORF T858 de Chlamydia pneumoniae; (b) hacer reaccionar el transportador…

Secuencias consenso, antígenos y transgenes del VIH-1 del clado A.

(26/11/2014) Una composición inmunogénica o de vacuna que comprende un polinucleótido que codifica un antígeno Env del VIH-1 del Clado A, en el que el antígeno Env tiene la secuencia de aminoácidos ilustrada en la Fig. 17 y está codificada por la secuencia de nucleótidos ilustrada en la Fig. 17.

Métodos y kits para diagnosticar tumorigenicidad y determinar resistencia a los efectos antineoplásicos de la terapia antiestrógeno.

(26/11/2014) Un método para diagnosticar la tumorigenicidad del cáncer de mama en un paciente humano, que comprende: i. detectar GP88 en células de una muestra biológica obtenida de un paciente; ii. determinar el número de células positivas para GP88 en dicha muestra; y iii. determinar la proporción de células positivas para GP88 respecto al número total de células en dicha muestra biológica, en el que dicha proporción es indicativa de la tumorigenicidad del cáncer de mama, y en el que la muestra biológica que contiene las células de dicho paciente es una muestra de tejido de mama; GP88 en dichas células de dicho tejido de mama se detecta por inmunotinción con anticuerpo anti-GP88 humano; el número de células positivas para GP88 en…

Composiciones terapéuticas basadas en Spongilla para tratar y prevenir el acné.

(12/02/2014) Una composición para usar en el tratamiento terapéutico del acné provocado por Propionibacterium acnes que comprende de 0, 1% a 100% de polvo de Spongilla lacustris, en donde la Spongilla lacustris se ha limpiado y purificado antes de la formación del polvo para eliminar todos los contaminantes e impurezas para dejar solo Spongilla lacustris esencialmente puro.

Vacuna para la prevención de la recaida del cáncer de mama.

(06/11/2013) Una composición que comprende una vehículo farmacéuticamente eficaz y un péptido que tiene una secuenciade aminoácidos SEC ID Nº 2 para su utilización en la inducción de una inmunidad terapéutica o protectora contrala recurrencia del cáncer de mama en un sujeto, en el que el sujeto tiene una puntuación inmunoquímica (IHC)de 1+ o 2+ para la expresión de la proteína HER2 / neu y una puntuación de hibridación fluorescente in situ (FISH)menor a 2,0 ± 20 % para la expresión del gen HER2 / neu.

Vacunas de células T autólogas contra la esclerosis múltiple.

(14/08/2013) Procedimiento para la preparación de una vacuna de células T autólogas para el tratamiento de la esclerosis múltiple, comprendiendo el procedimiento: (a) la estimulación primaria in vitro de células T de un paciente a tratar con la vacuna con una combinación de fragmentos de uno o más antígenos asociados con la esclerosis múltiple, (b) estimular las células T obtenidas en la etapa (a) con células presentadoras de antígenos (APC) y la combinación de fragmentos, y (c) repetir la etapa (b) una o más veces; en el que el antígeno asociado a la esclerosis múltiple se selecciona del grupo que consiste en proteína básica de mielina, proteína de proteolípido y glicoproteína…

Regulación de células T.

(14/08/2013) Composición, que comprende: anticuerpos que se unen específicamente a CD223 y bloquean su capacidad para funcionar; y una vacunacontra el cáncer que comprende antígenos tumorales aislados o polipéptidos aislados que comprenden unoo más epítopos de antígenos tumorales.

Secuencias consenso, antígenos y transgenes del VIH-1 del clado A.

(01/03/2013) Un polinucleótido que codifica una proteína de fusión del VIH-1 del clado A, donde la proteína de fusióncomprende Gag, Pol y Ne fdel VIH-1 del clado A y donde la proteína de fusión contiene la secuencia de aminoácidosde la figura 16.

Casetes de inmunización de ADN de vif atenuados para vacunas genéticas.

(27/06/2012) Una proteína vif no funcional, atenuada y aislada que comprende la secuencia de aminoácidos de SEC ID Nº: 5.

Sistema de suministro de inmunógeno sintético estabilizado.

(18/06/2012) Un complejo microparticulado inmunoestimulatorio estabilizado que comprende un inmunógeno de péptido catiónico en donde el inmunógeno de péptido comprende un antígeno de célula B objetivo o un epítopo CTL y un epítopo de célula cooperador T y un oligonucleótido CpG aniónico en donde el inmunógeno de péptido catiónico tiene una carga positiva neta a un pH en el rango de 5.0 a 8.0 calculado al asignar un carga +1 para cada lisina (K), arginina (R) o histidina (H), una carga -1 para cada ácido aspártico (D) o ácido glutámico (E) y una carga de 0 para todos los otros aminoácidos en el inmunógeno de péptido y en donde el oligonucleótido CpG aniónico tiene una carga negativa neta a un pH en el rango de 5.0-8.0 y es un ADN de hebra sencilla que comprende 8 a 64 bases de nucleótido con una repetición de un motivo de citosina-guanidina y el número de repeticiones…

Tratamiento del dolor facial crónico y cefalea relacionados con la sinusitis con toxina botulínica.

(23/05/2012) Uso de la toxina botulínica para la fabricación de un medicamento para el tratamiento de la cefalea y el dolor facial asociados con la sinusitis recurrente aguda o crónica.

Oligonucleótidos inmunoestimuladores y sus usos.

(18/05/2012) Un oligonucleótido inmunoestimulador que tiene hasta 100 nucleótidos y que comprende un motivo de secuencia no palindrómica de ácido nucleico que tiene la siguiente fórmula: TCATCATTTTGTCATTTTGTCATT(SEQ ID Nº 2)

MUTANTES ATENUADOS DE SALMONELA QUE EXPRESAN DE MANERA CONSTITUTIVA EL ANTIGENO VI.

(16/03/2007). Ver ilustración. Solicitante/s: THE UNIVERSITY OF MARYLAND AT BALTIMORE. Inventor/es: NORIEGA, FERNANDO, R., SZTEIN, MARCELO, LEVINE, MYRON, M.

Mutante de salmonela atenuado, en el que dicho mutante expresa de manera constitutiva el antígeno vi, y en el que en dicho mutante, se sustituye el promotor vipR por un promotor constitutivo, de manera que se provoca una expresión constitutiva de viaB.

VACUNAS CONTRA LA TOXINA DE LA DIFTERIA QUE TIENEN UN DOMINIO R MUTADO.

(01/09/2006). Solicitante/s: PRESIDENT AND FELLOWS OF HARVARD COLLEGE THE REGENTS OF THE UNIVERSITY OF CALIFORNIA. Inventor/es: COLLIER, R.JOHN, SHEN, WEI HAI, EISENBERG, DAVID, CHOE, SEUNGHYON.

POLIPEPTIDOS DE LA TOXINA DE LA DIFTERIA QUE INCLUYEN UN DOMINIO DE UNION R MUTANTE MUESTRAN UN ENLACE CELULAR DE DESTINO REDUCIDO Y PUEDEN USARSE COMO VACUNAS PARA INMUNIZAR A UN MAMIFERO CONTRA LA INFECCION POR CORINEBACTERIUM DIPHTHERIA.

VACUNACION DE ADN PARA EL TRATAMIENTO DE ENFERMEDADES AUTOINMUNES.

(16/05/2006). Ver ilustración. Solicitante/s: THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY. Inventor/es: STEINMAN, LAWRENCE, STANFORD UNI. SCHOOL OF MEDIC., RUIZ, PEDRO JOSE, STANFORD UNI. SCHOOL OF MEDICIN., GARREN, HIDEKI, DEPT. OF NEUROLOGY AND NEUROL. SCS.

Uso de un casete de expresión de ADN que está compuesto por una región de inicio de la transcripción, una secuencia que codifique un autoantígeno, que codifica al menos una porción de autoantígeno de proteína de mielina y una región de fin de la transcripción, estando asociado el autoantígeno de proteína de mielina con una respuesta linfocítica T de tipo Th1 proinflamatoria, estando la región de inicio de la transcripción bajo el control de un promotor que se activa en un huésped humano con una enfermedad autoinmune, para fabricar un medicamento para su uso en el tratamiento mediante una inyección intramuscular de un enfermedad autoinmune desmielinizante en el huésped humano.

PROTEINAS NUCLEO DE LA HEPATITIS B ESTRATEGICAMENTE MODIFICAS Y SUS DERIVADOS.

(16/05/2004). Ver ilustración. Solicitante/s: IMMUNE COMPLEX, CORPORATION. Inventor/es: BIRKETT, ASHLEY, J.

Un conjugado de una proteína del núcleo central de la hepatitis B modificada que contiene una proteína del núcleo central de la hepatitis B modificada unida de manera colgante a un hapteno, en el que la proteína del núcleo central de la hepatitis B modificada contiene una secuencia de aminoácidos correspondiente a la secuencia de aminoácidos de la proteína del núcleo central de la hepatitis B de SEC ID N?: 2, incluyendo los residuos de aminoácidos numerados como 10 a 140 y teniendo adicionalmente un inserto de una secuencia de aminoácidos en la región correspondiente a los residuos de aminoácidos numerados como 50 a 100, teniendo dicho inserto (i) de 1 a 40 residuos de aminoácidos de longitud y (ii) conteniendo dicho inserto un residuo de aminoácido químicamente reactivo, estando dicho hapteno unido de manera colgante al residuo de aminoácido químicamente reactivo en dicha proteína del núcleo central de la hepatitis B modificada.

VACUNA PARA MORAXELLA CATARRHALIS.

(01/04/2004) SE DESCRIBEN COMPOSICIONES QUE INCLUYEN LA MEMBRANA EXTERIOR DE LA PROTEINA "E", Y PEPTIDOS Y POLIPEPTIDOS DE LA ANTERIOR, DE LA MORAXELLA CATARRHALIS. ADICIONALMENTE, SE MUESTRAN SECUENCIAS DE NUCLEOTIDOS QUE CODIFICAN LA PROTEINA, EL PEPTIDO O EL POLIPETIDO, ASI COMO VECTORES RECOMBINANTES QUE CONTIENEN ESAS SECUENCIAS. LA PROTEINA, EL PEPTIDO O OLIGOPEPTIDO PUEDEN PRODUCIRSE A PARTIR DE LOS SISTEMAS CELULARES DEL RECEPTOR QUE CONTIENEN ESOS VECTORES RECOMBINANTES. LOS PEPTIDOS Y OLIGOPEPTIDOS PUEDEN TAMBIEN SINTETIZARSE QUIMICAMENTE. SE MUESTRAN LOS USOS DE LA PROTEINA, PEPTIDOS Y OLIGOPEPTIDOS, COMO ANTIGENOS PARA FORMULAS DE VACUNAS, Y COMO ANTIGENOS EN ENSAYOS INMUNOLOGICOS DE DIAGNOSTICO.…

Utilizamos cookies para mejorar nuestros servicios y mostrarle publicidad relevante. Si continua navegando, consideramos que acepta su uso. Puede obtener más información aquí. .