Métodos y kits para clasificar linfoma de linfocitos B grande difuso (DLBCL) en GCB-DLBCL o en ABC-DLBCL.

Un método para clasificar un linfoma de linfocitos B grande difuso (DLBCL) de un sujeto en un GCB-DLBCL o en un ABC-DLBCL,

que comprende la etapa de determinar el nivel de expresión de 10 genes en una muestra de tejido tumoral obtenida del sujeto realizando un ensayo de amplificación con sonda dependiente de ligamiento múltiple con retrotranscriptasa (RT-MLPA) en el que los 10 genes son NEK6, IRF4, IGHM, LMO2, F0XP1, TNFRSF9, BCL6, TNFRSF13B, CCND2 y MYBL1,

comprendiendo dicho método las etapas de i) preparar una muestra de ADNc a partir de la muestra de tejido tumoral, ii) incubar la muestra de ADNc de la etapa i) con una mezcla de al menos 10 pares diferentes de sondas específicas de una secuencia de ácido nucleico diana de NEK6, IRF4, IGHM, LMO2, FOXP1, TNFRSF9, BCL6, TNFRSF13B, CCND2 y MYBL1, iii) ligar la primera sonda con la segunda sonda de los partes de sondas, iv) amplificar las sondas ligadas producidas en la etapa iii) y v) detectar y cuantificar los amplicones producidos en la etapa iv), en el que el par de sondas consiste en:

- una primera sonda que tiene

- una región específica de diana (L) complementaria al primer segmento de la secuencia de ácido nucleico diana y

- una región de cola (TL) en el extremo 5' de la región específica de diana (L) que no es complementaria a dicha secuencia de ácido nucleico diana,

- una segunda sonda que tiene

- una región específica de diana (R) complementaria al segundo segmento de la secuencia de ácido nucleico diana y

- una región de cola (TR) en el extremo 3' de la región específica de diana (R) que no es complementaria a dicha secuencia de ácido nucleico diana,

en el que

el par de sondas específicas para NEK6 consiste en una primera sonda que es la SEQ ID NO:54 (GTGCCAGCAAGATCCAATCTAGACCTGTGCATCCTCCTGACCCACAG) y una segunda sonda que es la SEQ ID NO:55 (AGGCATCCCAACACGCTGTCTTTTCCAACCCTTAGGGAACCC);

el par de sondas específicas para IRF4 consiste en una primera sonda que es la SEQ ID NO:56 (GTGCCAGCAAGATCCAATCTAGATCTGCCGAAGCCTTGGCGTTCTCAG) y una segunda sonda que es la SEQ ID NO:57 (ACTGCCGGCTGCACATCTGCCTGTATCCAACCCTTAGGGAACCC);

el par de sondas específicas para IGHM consiste en una primera sonda que es la SEQ ID NO:58 (GTGCCAGCAAGATCCAATCTAGATGCGTCCTCCATGTGTGGCCCCG) y una segunda sonda que es la SEQ ID NO:59 (ATCAAGACACAGCCATCCGGGTCTTCTACTATCCAACCCTTAGGGAACCC);

el par de sondas específicas para LMO2 consiste en una primera sonda que es la SEQ ID NO:62 (GTGCCAGCAAGATCCAATCTAGACGGAAGCTCTGCCGGAGAGACTATCTCAG) y una segunda sonda que es la SEQ ID NO:63 (GCTTTTTGGGCAAGACGGTCTCTGCTACTATCCAACCCTTAGGGAACCC);

el par de sondas específicas para FOXP1 consiste en una primera sonda que es la SEQ ID NO:64 (GTGCCAGCAAGATCCAATCTAGACCCTTCCCCTTCAACCTCTTGCTCAAG) y una segunda sonda que es la SEQ ID NO:65 (GCATGATTCCAACAGAACTGCAGCAGCTACTACTACTCCAACCCTTAGGGAACCC);

el par de sondas específicas para TNFRSF9 consiste en una primera sonda que es la SEQ ID NO:66 (GTGCCAGCAAGATCCAATCTAGATACGGACCTGTGACATATGCAGGCAGTGTAAAG) y una segunda sonda que es la SEQ ID NO:67 (GTGTTTTCAGGACCAGGAAGGAGTGTTCCTACTCCAACCCTTAGGGAACCC); el par de sondas específicas para BCL6 consiste en una primera sonda que es la SEQ ID NO:68 (GTGCCAGCAAGATCCAATCTAGATACTACTCATAAAACGGTCCTCATGGCCTGCAG) y una segunda sonda que es la SEQ ID NO:69 (TGGCCTGTTCTATAGCATCTTTACAGACCAGTTGTCCAACCCTTAGGGAACCC); el par de sondas específicas para TNFRSF13B consiste en una primera sonda que es la SEQ ID NO:70 (GTGCCAGCAAGATCCAATCTAGATACTACTACTAGCGCACCTGTGCAGCCTTCTGCA) y una segunda sonda que es la SEQ ID NO:71 (GGTCACTCAGCTGCCGCAAGGAGCTACTACTACTACTCCAACCCTTAGGGAACCC); el par de sondas específicas para CCND2 consiste en una primera sonda que es la SEQ ID NO:72 (GTGCCAGCAAGATCCAATCTAGATACTACTGACCTTCATTGCTCTGTGTGCCACCG) y una segunda sonda que es la SEQ ID NO:73 (ACTTTAAGTTTGCCATGTACCCACCGTCGATACTACTATCCAACCCTTAGGGAACCC); y el par de sondas específicas para MYBL1 consiste en una primera sonda que es la SEQ ID NO:76 (GTGCCAGCAAGATCCAATCTAGACCAGAATTTGCAGAGACTCTAGAACTTATTGAAT CT) y una segunda sonda que es la SEQ ID NO:77 (GATCCTGTAGCATGGAGTGACGTTACCAGTTTTTACTACTTCCAACCCTTAGGGAACC C).

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2015/054952.

Solicitante: INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE (INSERM).

Nacionalidad solicitante: Francia.

Dirección: 101, RUE DE TOLBIAC 75013 PARIS FRANCIA.

Inventor/es: RUMINY,PHILIPPE, MARCHAND,VINCIANE, JARDIN,FABRICE, MARESCHAL,SYLVAIN, BAGACEAN,CRISTINA.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • C12Q1/6886

PDF original: ES-2804308_T3.pdf

 

Patentes similares o relacionadas:

Distintivos de expresión génica predictivos de la respuesta de un sujeto a un inhibidor multicinasa y métodos de uso de los mismos, del 29 de Julio de 2020, de Crown Bioscience, Inc. (Taicang): Un método de determinación de la sensibilidad de un sujeto a un inhibidor multicinasa que comprende medir el perfil de expresión de un […]

Biosondas y métodos de uso de las mismas, del 15 de Julio de 2020, de THE GOVERNING COUNCIL OF THE UNIVERSITY OF TORONTO: Una primera biosonda inmovilizada sobre una superficie, comprendiendo la primera biosonda: una secuencia de ANP capaz de hibridarse con un nucleótido […]

Marcadores de metilación de ADN no sesgados que definen un defecto de campo amplio en tejidos de próstata histológicamente normales asociados al cáncer de próstata: nuevos biomarcadores para hombres con cáncer de próstata, del 15 de Julio de 2020, de WISCONSIN ALUMNI RESEARCH FOUNDATION: Un método para diagnosticar cáncer de próstata en un sujeto humano que comprende cuantificar la metilación en el ADN genómico obtenido del sujeto humano en al menos una región […]

Métodos y sistemas para detectar variantes genéticas, del 15 de Julio de 2020, de Guardant Health, Inc: Un método para determinar una medida cuantitativa indicativa de una serie de moléculas de ácido desoxirribonucleico (ADN) de cadena doble individuales en una muestra, […]

Predicción de pronóstico para el melanoma de cáncer, del 8 de Julio de 2020, de Pacific Edge Limited: Un método para determinar el pronóstico de melanoma en un paciente con melanoma en estadio IIIB o en estadio IIIC, que comprende las etapas de: (i) determinar el […]

MÉTODO DE DETECCIÓN TEMPRANA DE CÁNCER GASTRICO POR DETERMINACIÓN DE IncRNA KCNQ1OT1, del 18 de Junio de 2020, de PONTIFICIA UNIVERSIDAD CATÓLICA DE CHILE: Método de detección no invasiva de cáncer gástrico basada en la detección de un nuevo marcador molecular en sangre. Particularmente, a través de la detección en sangre periférica […]

Método de deducción de un valor de positividad de biomarcador en porcentaje para células seleccionadas presentes en un campo de visión, del 10 de Junio de 2020, de NOVARTIS AG: Método de deducción de un valor para el % de positividad de biomarcador (PBP) para todas las células u, opcionalmente, uno o más subconjuntos de las […]

Metilación del promotor de PD-L1 en cáncer, del 10 de Junio de 2020, de F. HOFFMANN-LA ROCHE AG: Un anticuerpo anti-PD-L1 para su uso en el tratamiento del cáncer en un sujeto siempre que se haya encontrado que el sujeto tiene un nivel medio […]

Utilizamos cookies para mejorar nuestros servicios y mostrarle publicidad relevante. Si continua navegando, consideramos que acepta su uso. Puede obtener más información aquí. .