MÉTODO PARA LA EVALUACIÓN DEL COMPORTAMIENTO ATLÉTICO DE UN SUJETO.

Método para la evaluación del comportamiento atlético de un sujeto.



La presente invención describe un método de predicción del potencial de un sujeto hacia deportes de potencia o de resistencia, basado en el genotipado de marcadores polimórficos de determinados genes asociados con eventos deportivos. Asimismo, también describe un ADN-chip que comprende sondas específicas para los polimorfismos a detectar y un kit con el cual se puede llevar a cabo el método de la invención. Dicho modelo predictivo se puede utilizar para personalizar los programas de entrenamiento de los deportistas.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/ES2010/070402.

Solicitante: PROGENIKA BIOPHARMA, S.A..

Nacionalidad solicitante: España.

Inventor/es: SIMON BUELA,LAUREANO, MARTINEZ MARTINEZ,ANTONIO, TEJEDOR HERNANDEZ,DIEGO, ARTIEDA OSEÑALDE,Marta, BUXENS AZCOAGA,Amaya, ARTETA GARCÍA,David.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • C12Q1/68 SECCION C — QUIMICA; METALURGIA.C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12Q PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS QUE INTERVIENEN ENZIMAS O MICROORGANISMOS (ensayos inmunológicos G01N 33/53 ); COMPOSICIONES O PAPELES REACTIVOS PARA ESTE FIN; PROCESOS PARA PREPARAR ESTAS COMPOSICIONES; PROCESOS DE CONTROL SENSIBLES A LAS CONDICIONES DEL MEDIO EN LOS PROCESOS MICROBIOLOGICOS O ENZIMOLOGICOS. › C12Q 1/00 Procesos de medida, investigación o análisis en los que intervienen enzimas o microorganismos (aparatos de medida, investigación o análisis con medios de medida o detección de las condiciones del medio, p. ej. contadores de colonias, C12M 1/34 ); Composiciones para este fin; Procesos para preparar estas composiciones. › en los que intervienen ácidos nucleicos.

PDF original: ES-2395679_A1.pdf

 


Fragmento de la descripción:

Método para la evaluación del comportamiento atlético de un sujeto.

CAMPO DE LA INVENCIÓN

La presente invención se puede encuadrar en áreas emergentes para desarrollar la investigación en el campo del deporte y del comportamiento basado en una determinada combinación de variantes genéticas. En concreto, describe un método de predicción del potencial de un sujeto hacia deportes de potencia o de resistencia, basado en el genotipado de marcadores polimórficos de determinados genes asociados con eventos deportivos. El modelo predictivo se puede utilizar para personalizar los programas de entrenamiento de los deportistas.

ANTECEDENTES DE LA INVENCIÓN

El potencial deportivo es un rasgo complejo, poligénico y de carácter multifactorial que se caracteriza, además, por una combinación de las capacidades motoras y psicológicas y por unas aptitudes anatomo-fisiológicas que crean, en su conjunto, la posibilidad (potencial) de lograr altos resultados deportivos en un deporte concreto. Los datos existentes en la literatura sobre características asociadas a deportistas de élite se mueven mayoritariamente a nivel fisiológico.

El límite de cada individuo para llevar a cabo un tipo dado de ejercicio depende de la naturaleza del ejercicio y está influido por una variedad de factores, incluyendo la psicología, el ambiente y la genética. Los fenotipos de comportamiento físico para los que se sospecha una base genética incluyen la capacidad de resistencia, el comportamiento muscular y la actitud fisiológica para el entrenamiento. La inclusión de pruebas genéticas en los deportistas, permitiría identificar no solo sujetos con una fisiología y morfología óptimas para la práctica deportiva sino, además, sujetos con mayor capacidad para responder o adaptarse al entrenamiento. Sin embargo, hay que tener en cuenta que la traducción de un genotipo ventajoso a un fenotipo de campeón está aún muy influido por el ambiente y por factores psicológicos y sociológicos.

La capacidad de los científicos deportivos de predecir los atletas dentro de un grupo de élite que se podrían convertir en deportistas de relevancia mundial está limitada, entre otras cosas, a una variación inter-individuo en la capacidad óptima del comportamiento atlético, una característica no sólo de la población general sino también de atletas entrenados (Bouchard C et al. 1993; Exerc. Sport Sci. Rev 20, 27-58) . Los fenotipos de comportamiento físico para los que se ha concluido una base genética, incluyen, entre otros, genes relacionados con la hemodinámica de la respuesta al entrenamiento físico, la actividad física, el metabolismo lipídico y la distribución de la grasa corporal (Rankinen, T et al.2006; Med Sci Sports Exerc 38, 1863-1888) y con la capacidad de respuesta vía defensas antioxidantes. Por tanto, es importante reconocer cómo la genética puede influir en la optimización del ejercicio, incluyendo el conocimiento de los genes involucrados en estos mecanismos.

Aunque se requiere un entrenamiento adecuado para explotar el potencial genético de un individuo, la complejidad subyace en cuantificar cuánto influye la genética en componentes específicos del estado físico y cómo ciertos componentes genéticos posibilitan que un sujeto dado responda mejor al programa de entrenamiento (Williams AG and Folland JP. 2008; J. Physiol 586: 113-121) . Por tanto, mientras que un buen programa de entrenamiento puede mejorar la forma física de un sujeto, independientemente de su perfil genético, parece claro que los límites superiores para la capacidad de buena forma física están unidos a una dotación natural (heredada) (Myburgh K. H. 2003; Comparative Biochemistr y and Physilogy Part A 136 171-190) . La magnitud final del potencial genético dependerá del balance entre estos límites superiores y el resto de los factores particulares no genéticos.

Actualmente, gracias a los conocimientos obtenidos del análisis del genoma humano, se conocen muchos ejemplos de alelos definidos por polimorfismos de único nucleótido o SNPs (del inglés “single nucleotide polymorphism”)

que pueden afectar al buen funcionamiento de un determinado sistema mientras que otros, al contrario, ejercen un efecto beneficioso. Es importante tener presente que muchos de esos genes interaccionan entre sí y, por esa razón, algunos efectos antagónicos suelen compensar mutuamente su expresión, lo que clínicamente se puede traducir en la supresión de un determinado signo o síntoma dentro del cuadro clínico. Asimismo, se pueden asociar ciertos polimorfismos con la mejor predisposición de un individuo para la práctica de determinadas actividades deportivas, por lo que el genotipado puede ser muy útil a la hora de personalizar, por ejemplo, una terapia o, en el caso deportivo, un entrenamiento personalizado.

Tradicionalmente, las maneras de estudiar el comportamiento atlético en deportistas de élite han consistido, entre otras, en:

determinar el consumo de oxígeno: determinando el valor VO2 máximo, que es la capacidad máxima del organismo para transportar/metabolizar el oxígeno por la sangre durante 1 minuto y se suele indicar por peso del deportista; y/o

determinar el límite de lactato (que representa la intensidad de ejercicio en la que el ácido láctico comienza a acumularse en el torrente sanguíneo, lo que ocurre cuando se produce más rápido de lo

que se puede metabolizar) : se trata de una medida útil para decidir la intensidad del ejercicio para el entrenamiento y carrera en deportes de resistencia.

Estas técnicas basadas en parámetros fisiológicos tienen el inconveniente de que los resultados no permiten el diseño de un entrenamiento personalizado para cada sujeto.

Por otro lado, recientemente se ha descrito un nuevo método de predicción del comportamiento atlético (WO 2004/024947) , que consiste en evaluar el genotipo del gen ACTN3, que puede ser combinado con otros factores. Sin embargo, dicho método posee el inconveniente de estar basado en la detección de una variante directamente asociada a músculo esquelético y fuerza muscular (ACTN3) .

Existe, por tanto, la necesidad de desarrollar un método alternativo que suponga una detección más amplia, tal como el método descrito en la invención, que tiene la ventaja de incluir en la detección la combinación de variantes asociadas a tres grupos funcionales: hemodinámica de la respuesta al entrenamiento, distribución de la grasa corporal y la capacidad de respuesta por la vía de defensas antioxidantes, lo que supone una detección más completa.

Asimismo, también existe la necesidad de desarrollar un marcador genético que permita identificar sujetos con mayor predisposición a deportes de resistencia. Hasta el momento no se había identificado el gen ADRB3 con deportes de resistencia y sorprendentemente, los inventores han identificado el polimorfismo W64R de dicho gen ADRB3 como relacionado con el comportamiento atlético de un sujeto y en concreto la presencia del alelo R64 está asociado con deportes de resistencia.

COMPENDIO DE LA INVENCIÓN

La invención se enfrenta al problema de desarrollar un método alternativo para evaluar el comportamiento atlético de un sujeto. La solución proporcionada por los investigadores utiliza la presencia de determinados polimorfismos en genes asociados a deportes para determinar el comportamiento de un sujeto ante deportes de resistencia o potencia.

Los inventores han observado que la presencia o ausencia de dos o más polimorfismos en al menos un gen relacionado con deportes de resistencia y/o potencia, o, alternativamente, la presencia o ausencia de al menos un polimorfismo en cada uno de al menos dos genes relacionados con deportes de resistencia y/o potencia, resulta relevante para evaluar el comportamiento atlético de un sujeto ante eventos deportivos; de forma más concreta, los investigadores han observado que la presencia de unos polimorfismos en, al menos, dos genes seleccionados entre los genes ILE6, NAT2 y NOS3, es especialmente relevante a la hora de evaluar el comportamiento atlético de un sujeto ante eventos deportivos, tal como se pone de manifiesto en el Ejemplo 1. Dicha observación permite desarrollar un método para evaluar eficientemente el comportamiento atlético de un sujeto ante deportes de resistencia o potencia, de manera que permite diseñar y adaptar un programa de entrenamiento óptimo para dicho sujeto.

Además, los investigadores han observado que la presencia o ausencia de uno o más SNPs en el gen ADRB3 de un sujeto permiten evaluar el comportamiento atlético de dicho sujeto ante deportes de resistencia, lo que posibilita diseñar y adaptar un programa de entrenamiento óptimo para dicho... [Seguir leyendo]

 


Reivindicaciones:

1. Método para evaluar el comportamiento atlético de un sujeto, que comprende:

(i) determinar el genotipo de los polimorfismos NOS3 -786T/C, IL6 -174G/C y NAT2 803A/G; y

(ii) evaluar si dicho sujeto tiene mayor predisposición a deportes de resistencia y/o de potencia, a la vista de dicho genotipo.

2. Método según la reivindicación 1, en el que dicha etapa (i) se realiza mediante análisis de ADN-chips, genotipado en micropartículas (array líquido) , análisis RFLP y/o secuenciación génica.

3. Método según cualquiera de las reivindicaciones 1 ó 2, que comprende además determinar la presencia o ausencia de un polimorfismo en un gen seleccionado del grupo formado por los genes ACE, ACTN3, ADRB1, ADRB2, ADRB3, AGT, APOA1, APOB, APOE, DSG2, GNB3, GSTM1, GSTP1, GSTT1, NPY, OGG1, SOD2 y combinaciones de los mismos.

4. Método según la reivindicación 3, en el que los polimorfismos a determinar en dichos genes se seleccionan del grupo listado en la Tabla 1.

5. Método según cualquiera de las reivindicaciones 1 a 4, en el que la presencia del genotipo -786 C/C o del genotipo -786 T/C en el gen NOS3 de dicho sujeto está asociada con un mejor comportamiento atlético en deportes de resistencia, y la presencia del genotipo -786 T/T en el gen NOS3 está asociada con un mejor comportamiento atlético en deportes de potencia.

6. Método según cualquiera de las reivindicaciones 1 a 4, en el que la presencia del genotipo 803A/A en el gen NAT2 de dicho sujeto está asociada con un mejor comportamiento atlético en deportes de resistencia, y la presencia del genotipo 803G/G o del genotipo 803A/G en el gen NAT2 está asociada con un mejor comportamiento atlético en deportes de potencia.

7. Método según cualquiera de las reivindicaciones 1 a 4, en el que la presencia del genotipo -174 C/C o del genotipo -174 G/C en el gen IL6 de dicho sujeto está asociada con un mejor comportamiento atlético en deportes de resistencia, y la presencia del genotipo -174G/G en el gen IL6 está asociada con un mejor comportamiento atlético en deportes de potencia.

8. Método según cualquiera de las reivindicaciones 1 a 7, en el que la determinación del genotipo se lleva a cabo mediante un proceso que comprende: a) proporcionar, por cada genotipo a determinar al menos 2 parejas de oligonucleótidos, en el que:

una de las parejas consiste en las sondas 1 y 2, y la otra pareja de sondas en las sondas 3 y 4;

una de las sondas de cada una de dichas parejas de sondas reconoce de manera específica la variante A del SNP a determinar y la otra reconoce de manera específica la variante B de cada uno de los SNPs a determinar;

cada sonda está presente en réplicas; y

cada réplica de cada sonda está unida a un soporte sólido; b) amplificar enzimáticamente las regiones diana de los genes a analizar que contienen los polimorfismos a detectar y marcar los productos de dicha amplificación que comprenden las regiones diana que contienen los polimorfismos a detectar; c) poner en contacto dichas regiones diana con dichas sondas bajo condiciones que permiten una adecuada hibridación y formación de complejos de hibridación ácido nucleico-sonda; d) determinar la intensidad de marcaje de cada réplica para obtener unos valores brutos de intensidad; e) opcionalmente, corregir los valores brutos de intensidad para obtener un valor corregido para cada réplica; y f) aplicar un algoritmo a los valores brutos de intensidad determinados en la etapa d) , o corregidos en la etapa e) , y determinar el genotipo respecto a cada variante génica, en el que la aplicación del algoritmo implica el cálculo de una intensidad media de cada réplica de cada sonda y en el que el algoritmo emplea funciones lineales que caracterizan cada uno de los posibles genotipos: AA, AB o BB para cada variante génica.

9. Un ADN chip que comprende un soporte sobre el que están depositadas al menos:

(i) un conjunto de sondas formado por las sondas identificadas como SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95 y SEQ ID NO: 96, para la detección del polimorfismo IL6 -174G/C;

(ii) un conjunto de sondas formado por las sondas identificadas como SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119 y SEQ ID NO: 120, para la detección del polimorfismo NAT2 803A/G; y

(iii) un conjunto de sondas formado por las sondas identificadas como SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127 y SEQ ID NO: 128, para la detección del polimorfismo NOS3 -786T/C.

10. Un kit que comprende un ADN chip según la reivindicación 9, y, además, instrucciones para su empleo.

11. Un kit de amplificación mediante PCR que comprende al menos:

(i) la pareja de oligonucleótidos cebadores formada por los oligonucleótidos identificados como SEQ ID NO: 193 y SEQ ID NO: 194, para la amplificación de una región que comprende el polimorfismo del gen IL6 174C/G;

(ii) la pareja de oligonucleótidos cebadores formada por los oligonucleótidos identificados como SEQ ID NO: 205 y SEQ ID NO: 206 para la amplificación de una región que comprende el polimorfismo del gen NAT2 803A/G; y

(iii) la pareja de oligonucleótidos cebadores formada por los oligonucleótidos identificados como SEQ ID NO: 209 y SEQ ID NO: 210 para la amplificación de una región que comprende el polimorfismo del gen NOS3 786 T/C; y,

opcionalmente, instrucciones para su empleo.

FIGURA 1

LISTA DE SECUENCIAS

<110> Progenika Biopharma, S.A.

<120> MÉTODO PARA LA EVALUACIÓN DEL COMPORTAMIENTO ATLÉTICO DE UN SUJETO

<130> P4944ESPC

<140> PCT/ES2010/070402

<141> 2010-06-16

<150> P200901439

<151> 2009-06-17

<160> 216

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Intron 16 ins/del en el gen ACE

<400> 1 gattacaggc gtgatacagt cac 23

<210> 2

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo Intron 16 ins/del en el gen ACE

<400> 2 gtgactgtat cacgcctgta atc 23

<210> 3

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Intron 16 ins/del en el gen ACE

<400> 3 agacctgctg cctatacagt cac 23

<210> 4

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo Intron 16 ins/del en el gen ACE

<400> 4 gtgactgtat aggcagcagg tct 23 <210> 5

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 1 para detectar el polimorfismo R577X en el gen ACTN3

<400> 5 ccgaggctga ccgagagcga ggt 23

<210> 6

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 2 para detectar el polimorfismo R577X en el gen ACTN3

<400> 6 ccgaggctga ctgagagcga ggt 23

<210> 7

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 3 para detectar el polimorfismo R577X en el gen ACTN3

<400> 7 acctcgctct cggtcagcct cgg 23

<210> 8

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 4 para detectar el polimorfismo R577X en el gen ACTN3

<400> 8 acctcgctct cagtcagcct cgg 23

<210> 9

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo ADRB1 G389R en el gen ADRB1

<400> 9 aggccttcca gcgactgctc tgc 23

<210> 10

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo ADRB1 G389R en el gen ADRB1

<400> 10 gcagagcagt cgctggaagg cct 23

<210> 11

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo ADRB1 G389R en el gen ADRB1

<400> 11 aggccttcca gggactgctc tgc 23

<210> 12

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo ADRB1 G389R en el gen ADRB1

<400> 12 gcagagcagt ccctggaagg cct 23

<210> 13

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Q27E en el gen ADRB2

<400> 13 acgtcacgca ggaaagggac gag 23

<210> 14

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo Q27E en el gen ADRB2

<400> 14 cgtcacgcag gaaagggacg a 21

<210> 15

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Q27E en el gen ADRB2

<400> 15 acgtcacgca gcaaagggac gag 23

<210> 16

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo Q27E en el gen ADRB2

<400> 16 cgtcacgcag caaagggacg a 21

<210> 17

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo G16R en el gen ADRB2

<400> 17 tggcacccaa tagaagccat gcg 23

<210> 18

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo G16R en el gen ADRB2

<400> 18 ctggcaccca atagaagcca tgcgc 25

<210> 19

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo G16R en el gen ADRB2

<400> 19 tggcacccaa tggaagccat gcg 23

<210> 20

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo G16R en el gen ADRB2

<400> 20 ctggcaccca atggaagcca tgcgc 25

<210> 21

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo W64R en el gen ADRB3

<400> 21 tggccatcgc ctggactccg aga 23

<210> 22

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo W64R en el gen ADRB3

<400> 22 tctcggagtc caggcgatgg cca 23 <210> 23

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo W64R en el gen ADRB3

<400> 23 tggccatcgc ccggactccg aga 23

<210> 24

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo W64R en el gen ADRB3

<400> 24 tctcggagtc cgggcgatgg cca 23

<210> 25

<211> 27

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo M235T en el gen AGT

<400> 25 ggctgctccc tgacgggagc cagtgtg 27

<210> 26

<211> 27

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo M235T en el gen AGT

<400> 26 cacactggct cccgtcaggg agcagcc 27

<210> 27

<211> 27

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo M235T en el gen AGT

<400> 27 ggctgctccc tgatgggagc cagtgtg 27

<210> 28

<211> 27

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo M235T en el gen AGT

<400> 28 cacactggct cccatcaggg agcagcc 27

<210> 29

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo -75 G>A en el gen APOA1

<400> 29 agcccagccc cggccctgtt g 21

<210> 30

<211> 19

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo -75 G>A en el gen APOA1

<400> 30 gcccagcccc ggccctgtt 19

<210> 31

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo -75 G>A en el gen APOA1

<400> 31 agcccagccc tggccctgtt g 21

<210> 32

<211> 19

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo -75 G>A en el gen APOA1

<400> 32 gcccagccct ggccctgtt 19

<210> 33

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo R3480W en el gen APOB

<400> 33 cggttctttc tcgggaatat tca 23

<210> 34

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo R3480W en el gen APOB

<400> 34 tgaatattcc cgagaaagaa ccg 23

<210> 35

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo R3480W en el gen APOB

<400> 35 cggttctttc ttgggaatat tca 23

<210> 36

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo R3480W en el gen APOB

<400> 36 tgaatattcc caagaaagaa ccg 23

<210> 37

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Arg3500Gln en el gen APOB

<400> 37 caagagcaca cggtcttcag tga 23

<210> 38

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo Arg3500Gln en el gen APOB

<400> 38 tcactgaaga ccgtgtgctc ttg 23

<210> 39

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Arg3500Gln en el gen APOB

<400> 39 caagagcaca cagtcttcag tga 23

<210> 40

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo Arg3500Gln en el gen APOB

<400> 40 tcactgaaga ctgtgtgctc ttg 23

<210> 41

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Arg3531Cys en el gen APOB

<400> 41 ccacactcca acgcatatat tcc 23

<210> 42

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo Arg3531Cys en el gen APOB

<400> 42 ggaatatatg cgttggagtg tgg 23

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Arg3531Cys en el gen APOB

<400> 43 ccacactcca atgcatatat tcc 23

<210> 44

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo Arg3531Cys en el gen APOB

<400> 44 ggaatatatg cattggagtg tgg 23

<210> 45

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Cys112Arg en el gen APOE

<400> 45 atggaggacg tgtgcggccg cctgg 25

<210> 46

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo Cys112Arg en el gen APOE

<400> 46 ccaggcggcc gcacacgtcc tccat 25

<210> 47

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Cys112Arg en el gen APOE

<400> 47 atggaggacg tgcgcggccg cctgg 25

<210> 48

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo Cys112Arg en el gen APOE

<400> 48 ccaggcggcc gcgcacgtcc tccat 25

<210> 49

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Arg158Cys en el gen APOE

<400> 49 gacctgcaga agcgcctggc agtgt 25

<210> 50

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo Arg158Cys en el gen APOE

<400> 50 acactgccag gcgcttctgc aggtc 25

<210> 51

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Arg158Cys en el gen APOE

<400> 51 gacctgcaga agtgcctggc agtgt 25

<210> 52

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo Arg158Cys en el gen APOE

<400> 52 acactgccag gcacttctgc aggtc 25

<210> 53

<211> 21

<212> DNA

<213> artificial

<220>

<223> sonda 1 para detectar el polimorfismo R45Q en el gen DSG2

<400> 53 catttagtgc ggcaaaagcg c 21

<210> 54

<211> 21

<212> DNA

<213> artificial

<220>

<223> sonda 2 para detectar el polimorfismo R45Q en el gen DSG2

<400> 54 catttagtgc agcaaaagcg c 21

<210> 55

<211> 19

<212> DNA

<213> artificial

<220>

<223> sonda 3 para detectar el polimorfismo R45Q en el gen DSG2

<400> 55 atttagtgcg gcaaaagcg 19

<210> 56

<211> 19

<212> DNA

<213> artificial

<220>

<223> sonda 4 para detectar el polimorfismo R45Q en el gen DSG2

<400> 56 atttagtgca gcaaaagcg 19

<210> 57

<211> 21

<212> DNA

<213> artificial

<220>

<223> sonda 1 para detectar el polimorfismo R48H en el gen DSG2

<400> 57 cggcaaaagc gcgcctggat c 21

<210> 58

<211> 21

<212> DNA

<213> artificial

<220>

<223> sonda 2 para detectar el polimorfismo R48H en el gen DSG2

<400> 58 cggcaaaagc acgcctggat c 21

<210> 59

<211> 21

<212> DNA

<213> artificial

<220>

<223> sonda 3 para detectar el polimorfismo R48H en el gen DSG2

<400> 59 gatccaggcg cgcttttgcc g 21

<210> 60

<211> 21

<212> DNA

<213> artificial

<220>

<223> sonda 4 para detectar el polimorfismo R48H en el gen DSG2

<400> 60 gatccaggcg tgcttttgcc g 21

<210> 61

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 1 para detectar el polimorfismo W305X en el gen DSG2

<400> 61 tctgataatt ggctggcaaa ttt 23

<210> 62

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 2 para detectar el polimorfismo W305X en el gen DSG2

<400> 62 tctgataatt gactggcaaa ttt 23

<210> 63

<211> 21

<212> DNA

<213> artificial

<220>

<223> sonda 3 para detectar el polimorfismo W305X en el gen DSG2

<400> 63 ctgataattg gctggcaaat t 21

<210> 64

<211> 21

<212> DNA

<213> artificial

<220>

<223> sonda 4 para detectar el polimorfismo W305X en el gen DSG2

<400> 64 ctgataattg actggcaaat t 21

<210> 65

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 1 para detectar el polimorfismo C506Y en el gen DSG2

<400> 65 gcagacaatc tgtcacgatg cag 23

<210> 66

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 2 para detectar el polimorfismo C506Y en el gen DSG2

<400> 66 gcagacaatc tatcacgatg cag 23

<210> 67

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 3 para detectar el polimorfismo C506Y en el gen DSG2

<400> 67 ctgcatcgtg acagattgtc tgc 23

<210> 68

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 4 para detectar el polimorfismo C506Y en el gen DSG2

<400> 68 ctgcatcgtg atagattgtc tgc 23

<210> 69

<211> 21

<212> DNA

<213> artificial

<220>

<223> sonda 1 para detectar el polimorfismo G811C en el gen DSG2

<400> 69 tgcttctatt ggttgttgca g 21

<210> 70

<211> 21

<212> DNA

<213> artificial

<220>

<223> sonda 2 para detectar el polimorfismo G811C en el gen DSG2

<400> 70 tgcttctatt cgttgttgca g 21

<210> 71

<211> 19

<212> DNA

<213> artificial

<220>

<223> sonda 3 para detectar el polimorfismo G811C en el gen DSG2

<400> 71 gcttctattg gttgttgca 19

<210> 72

<211> 19

<212> DNA

<213> artificial

<220>

<223> sonda 4 para detectar el polimorfismo G811C en el gen DSG2

<400> 72 gcttctattc gttgttgca 19

<210> 73

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo 825 C>T (Ser275Ser) en el gen GNB3

<400> 73 ggcatcacgt ccgtggcctt ctc 23

<210> 74

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo 825 C>T (Ser275Ser) en el gen GNB3

<400> 74 gagaaggcca cggacgtgat gcc 23

<210> 75

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo 825 C>T (Ser275Ser) en el gen GNB3

<400> 75 ggcatcacgt ctgtggcctt ctc 23

<210> 76

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo 825 C>T (Ser275Ser) en el gen GNB3

<400> 76 gagaaggcca cagacgtgat gcc 23

<210> 77

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo GSTM1

<400> 77 cacatattct tggccttctg cagat 25

<210> 78

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo GSTM1

<400> 78 atctgcagaa ggccaagaat atgtg 25

<210> 79

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo GSTM1

<400> 79 cacatattct tgaccttctg cagat 25

<210> 80

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo GSTM1

<400> 80 atctgcagaa ggtcaagaat atgtg 25

<210> 81

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Ile105Val en el gen GSTP1

<400> 81 gctgcaaata catctccctc atc 23

<210> 82

<211> 23

<212> DNA

<213> Artificial <220>

<223> sonda 2 para detectar el polimorfismo Ile105Val en el gen GSTP1

<400> 82 gatgagggag atgtatttgc agc 23

<210> 83

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Ile105Val en el gen GSTP1

<400> 83 gctgcaaata cgtctccctc atc 23

<210> 84

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo Ile105Val en el gen GSTP1

<400> 84 gatgagggag acgtatttgc agc 23

<210> 85

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Ala114Val en el gen GSTP1

<400> 85 ctggcaggag gcgggcaagg atg 23

<210> 86

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo Ala114Val en el gen GSTP1

<400> 86 atccttgccc gcctcctgcc a 21

<210> 87

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Ala114Val en el gen GSTP1

<400> 87 ctggcaggag gtgggcaagg atg 23

<210> 88

<211> 21

<212> DNA

<213> Artificial <220>

<223> sonda 4 para detectar el polimorfismo Ala114Val en el gen GSTP1

<400> 88 atccttgccc acctcctgcc a 21

<210> 89

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo GSTT1

<400> 89 ctgcctagtg ggttcacctg cccac 25

<210> 90

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo GSTT1

<400> 90 gtgggcaggt gaacccacta ggcag 25

<210> 91

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo GSTT1

<400> 91 ctgcctagtg gggtcacctg cccac 25

<210> 92

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo GSTT1

<400> 92 gtgggcaggt gaccccacta ggcag 25

<210> 93

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 1 para detectar el polimorfismo -174 C>G en el gen IL6

<400> 93 ttgtgtcttg cgatgctaaa gga 23

<210> 94

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 2 para detectar el polimorfismo -174 C>G en el gen IL6

<400> 94 tcctttagca tcgcaagaca caa 23

<210> 95

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 3 para detectar el polimorfismo -174 C>G en el gen IL6

<400> 95 ttgtgtcttg ccatgctaaa gga 23

<210> 96

<211> 23

<212> DNA

<213> artificial

<220>

<223> sonda 4 para detectar el polimorfismo -174 C>G en el gen IL6

<400> 96 tcctttagca tggcaagaca caa 23

<210> 97

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo R64Q en el gen NAT2

<400> 97 accacccacc ccggtttctt ctt 23

<210> 98

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo R64Q en el gen NAT2

<400> 98 ccacccaccc cggtttcttc t 21

<210> 99

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo R64Q en el gen NAT2

<400> 99 accacccacc ctggtttctt ctt 23

<210> 100

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo R64Q en el gen NAT2

<400> 100 ccacccaccc tggtttcttc t 21

<210> 101

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo 282 C>T en el gen NAT2

<400> 101 agggtatttt tacatccctc cagtt 25

<210> 102

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo 282 C>T en el gen NAT2

<400> 102 gggtattttt acatccctcc agt 23

<210> 103

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo 282 C>T en el gen NAT2

<400> 103 agggtatttt tatatccctc cagtt 25

<210> 104

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo 282 C>T en el gen NAT2

<400> 104 gggtattttt atatccctcc agt 23

<210> 105

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo I114T en el gen NAT2 <400> 105 gcaggtgacc attgacggca gga 23

<210> 106

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo I114T en el gen NAT2

<400> 106 caggtgacca ttgacggcag g 21

<210> 107

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo I114T en el gen NAT2

<400> 107 gcaggtgacc actgacggca gga 23

<210> 108

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo I114T en el gen NAT2

<400> 108 caggtgacca ctgacggcag g 21

<210> 109

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo 481C>T en el gen NAT2

<400> 109 ggaatctggt acctggacca aatca 25

<210> 110

<211> 27

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo 481C>T en el gen NAT2

<400> 110 aggaatctgg tacctggacc aaatcag 27

<210> 111

<211> 25

<212> DNA

<213> Artificial <220>

<223> sonda 3 para detectar el polimorfismo 481C>T en el gen NAT2

<400> 111 ggaatctggt acttggacca aatca 25

<210> 112

<211> 27

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo 481C>T en el gen NAT2

<400> 112 aggaatctgg tacttggacc aaatcag 27

<210> 113

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo R197Q en el gen NAT2

<400> 113 cgcttgaacc tcgaacaatt gaaga 25

<210> 114

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo R197Q en el gen NAT2

<400> 114 gcttgaacct cgaacaattg aag 23

<210> 115

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo R197Q en el gen NAT2

<400> 115 cgcttgaacc tcaaacaatt gaaga 25

<210> 116

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo R197Q en el gen NAT2

<400> 116 gcttgaacct caaacaattg aag 23

<210> 117

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo K268R en el gen NAT2

<400> 117 aagaagtgct gaaaaatata tttaa 25

<210> 118

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo K268R en el gen NAT2

<400> 118 ttaaatatat ttttcagcac ttctt 25

<210> 119

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo K268R en el gen NAT2

<400> 119 aagaagtgct gagaaatata tttaa 25

<210> 120

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo K268R en el gen NAT2

<400> 120 ttaaatatat ttctcagcac ttctt 25

<210> 121

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo G286E en el gen NAT2

<400> 121 aacctggtga tggatccctt actat 25

<210> 122

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo G286E en el gen NAT2

<400> 122 acctggtgat ggatccctta cta 23

<210> 123

<211> 25

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo G286E en el gen NAT2

<400> 123 aacctggtga tgaatccctt actat 25

<210> 124

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo G286E en el gen NAT2

<400> 124 acctggtgat gaatccctta cta 23

<210> 125

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo -786 T>C en el gen NOS3

<400> 125 tcttccctgg ctggctgacc ctg 23

<210> 126

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo -786 T>C en el gen NOS3

<400> 126 cagggtcagc cagccaggga aga 23

<210> 127

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo -786 T>C en el gen NOS3

<400> 127 tcttccctgg ccggctgacc ctg 23

<210> 128

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo -786 T>C en el gen NOS3

<400> 128 cagggtcagc cggccaggga aga 23

<210> 129

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Glu298Asp en el gen NOS3

<400> 129 gccccagatg agcccccaga act 23

<210> 130

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo Glu298Asp en el gen NOS3

<400> 130 agttctgggg gctcatctgg ggc 23

<210> 131

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Glu298Asp en el gen NOS3

<400> 131 gccccagatg atcccccaga act 23

<210> 132

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo Glu298Asp en el gen NOS3

<400> 132 agttctgggg gatcatctgg ggc 23

<210> 133

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Leu7Pro en el gen NPY

<400> 133 cggacagccc cagtcgcttg tta 23

<210> 134

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo Leu7Pro en el gen NPY

<400> 134 taacaagcga ctggggctgt ccg 23

<210> 135

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Leu7Pro en el gen NPY

<400> 135 cggacagccc cggtcgcttg tta 23

<210> 136

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo Leu7Pro en el gen NPY

<400> 136 taacaagcga ccggggctgt ccg 23

<210> 137

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Cys326Ser en el gen OGG1

<400> 137 cctgcgccaa tcccgccatg ctc 23

<210> 138

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo Cys326Ser en el gen OGG1

<400> 138 ctgcgccaat cccgccatgc t 21

<210> 139

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Cys326Ser en el gen OGG1

<400> 139 cctgcgccaa tgccgccatg ctc 23

<210> 140

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo Cys326Ser en el gen OGG1

<400> 140 ctgcgccaat gccgccatgc t 21

<210> 141

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 1 para detectar el polimorfismo Ala16Val en el gen SOD2

<400> 141 gataccccaa agccggagcc agc 23

<210> 142

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 2 para detectar el polimorfismo Ala16Val en el gen SOD2

<400> 142 ataccccaaa gccggagcca g 21

<210> 143

<211> 23

<212> DNA

<213> Artificial

<220>

<223> sonda 3 para detectar el polimorfismo Ala16Val en el gen SOD2

<400> 143 gataccccaa aaccggagcc agc 23

<210> 144

<211> 21

<212> DNA

<213> Artificial

<220>

<223> sonda 4 para detectar el polimorfismo Ala16Val en el gen SOD2

<400> 144 ataccccaaa accggagcca g 21

<210> 145

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo Intron 16 ins/del en el gen ACE

<400> 145 gggactctgt aagccactgc 20

<210> 146

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo Intron 16 ins/del en el gen ACE

<400> 146 ccatgcccat aacaggtctt 20

<210> 147

<211> 20

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo R577X en el gen ACTN3

<400> 147 agctgacact tcctgcctgt 20

<210> 148

<211> 20

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo R577X en el gen ACTN3

<400> 148 gggtgatgta gggattggtg 20

<210> 149

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo G389R en el gen ADRB1

<400> 149 gccttcaacc ccatcatcta 20

<210> 150

<211> 18

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo G389R en el gen ADRB1

<400> 150 caggctcgag tcgctgtc 18

<210> 151

<211> 18

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo Q27E en el gen ADRB2

<400> 151 gctcacctgc cagactgc 18

<210> 152

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo Q27E en el gen ADRB2

<400> 152 gccaggacga tgagagacat 20

<210> 153

<211> 18

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo G16R en el gen ADRB2

<400> 153 gctcacctgc cagactgc 18

<210> 154

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo G16R en el gen ADRB2

<400> 154 gccaggacga tgagagacat 20

<210> 155

<211> 19

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo W64Ren el gen ADRB3

<400> 155 caataccgcc aacaccagt 19

<210> 156

<211> 19

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo W64Ren el gen ADRB3

<400> 156 cgaagtcacg aacacgttg 19

<210> 157

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo M235Ten el gen AGT

<400> 157 gaactggatg ttgctgctga 20

<210> 158

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo M235Ten el gen AGT

<400> 158 ttgccttacc ttggaagtgg 20

<210> 159

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo L7P en el gen NPY

<400> 159 ctctgcctggtgatgaggtt 20

<210> 160

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo L7P en el gen NPY

<400> 160 gcagaggagggaggtgct 20

<210> 161

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo -75 G>A en el gen APOA1

<400> 161 cacctccttc tcgcagtctc 20

<210> 162

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo -75 G>A en el gen APOA1

<400> 162 gggacagagc tgatccttga 20

<210> 163

<211> 29

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo R3480Wen el gen APOB

<400> 163 agcctcacct cttacttttc cattgagtc 29

<210> 164

<211> 24

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo R3480Wen el gen APOB

<400> 164 cgttggtgaa aaagaggccc tcta 24

<210> 165

<211> 29

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo Arg3500Gln en el gen APOB

<400> 165 agcctcacct cttacttttc cattgagtc 29

<210> 166

<211> 24

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo Arg3500Gln en el gen APOB

<400> 166 cgttggtgaa aaagaggccc tcta 24

<210> 167

<211> 29

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo Arg3531Cys en el gen APOB

<400> 167 agcctcacct cttacttttc cattgagtc 29

<210> 168

<211> 24

<212> DNA

<213> Artificial <220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo Arg3531Cys en el gen APOB

<400> 168 cgttggtgaa aaagaggccc tcta 24

<210> 169

<211> 18

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo Cys112Arg en el gen APOE

<400> 169 ctgtccaagg agctgcag 18

<210> 170

<211> 18

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo Cys112Arg en el gen APOE

<400> 170 ctgttccacc aggggccc 18

<210> 171

<211> 18

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo Arg158Cys en el gen APOE

<400> 171 ctgtccaagg agctgcag 18

<210> 172

<211> 18

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo Arg158Cys en el gen APOE

<400> 172 ctgttccacc aggggccc 18

<210> 173

<211> 24

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo R45Q en el gen DSG2

<400> 173

tgacacataa taaattttgg caat 24

<210> 174

<211> 20

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo R45Q en el gen DSG2

<400> 174 ggcaattgga ttcttcttgg 20

<210> 175

<211> 24

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo R48H en el gen DSG2

<400> 175 tgacacataa taaattttgg caat 24

<210> 176

<211> 20

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo R48H en el gen DSG2

<400> 176 ggcaattgga ttcttcttgg 20

<210> 177

<211> 20

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo W305X en el gen DSG2

<400> 177 gcttgaaggg atggttgaag 20

<210> 178

<211> 21

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo W305X en el gen DSG2

<400> 178 aagggtcaca attccttcgt t 21

<210> 179

<211> 20

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo C506Y en el gen DSG2

<400> 179 caacgacaac tgtcccacac 20

<210> 180

<211> 20

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo C506Y en el gen DSG2

<400> 180 cttggcgtgc tattttccat 20

<210> 181

<211> 20

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo G811C en el gen DSG2

<400> 181 aaagcggcct cttacactga 20

<210> 182

<211> 20

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo G811C en el gen DSG2

<400> 182 ttttgaccca ggcaaacttc 20

<210> 183

<211> 18

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo 825 C>T (Ser275Ser) en el gen GNB3

<400> 183 ctgccgcttg tttgacct 18

<210> 184

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo 825 C>T (Ser275Ser) en el gen GNB3

<400> 184 cacacgctca gacttcatgg 20

<210> 185

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo GSTM1

<400> 185 atggtttgca ggaaacaagg 20

<210> 186

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo GSTM1

<400> 186 aaagcgggag atgaagtcct 20

<210> 187

<211> 21

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo Ile105Val en el gen GSTP1

<400> 187 tgcttcacgt gttatggagg t 21

<210> 188

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo Ile105Val en el gen GSTP1

<400> 188 gggctcaaat atacggtgga 20

<210> 189

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo Ala114Val en el gen GSTP1

<400> 189 gcaagcagag gagaatctgg 20

<210> 190

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo Ala114Val en el gen GSTP1

<400> 190 ctcacctggt ctcccacaat 20

<210> 191

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo GSTT1

<400> 191 ggcagcataa gcaggacttc 20

<210> 192

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo GSTT1

<400> 192 ctgcagttgc tcgaggacaa 20

<210> 193

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo -174 C>G en el gen IL6

<400> 193 gcctcaatga cgacctaagc 20

<210> 194

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo -174 C>G en el gen IL6

<400> 194 tcatgggaaa atcccacatt 20

<210> 195

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo R64Q en el gen NAT2

<400> 195 ccatggagtt gggcttagag 20

<210> 196

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo R64Q en el gen NAT2

<400> 196 ccatgccagt gctgtatttg 20

<210> 197

<211> 20

<212> DNA

<213> artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo 282 C>T en el gen NAT2

<400> 197 ccatggagtt gggcttagag 20

<210> 198

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo 282 C>T en el gen NAT2

<400> 198 ccatgccagt gctgtatttg 20

<210> 199

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo I114T en el gen NAT2

<400> 199 ccatggagtt gggcttagag 20

<210> 200

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo I114T en el gen NAT2

<400> 200 ccatgccagt gctgtatttg 20

<210> 201

<211> 19

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo 481C>T en el gen NAT2

<400> 201 caggtgcctt gcattttct 19

<210> 202

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo 481C>T en el gen NAT2

<400> 202 gatgaagccc accaaacagt 20

<210> 203

<211> 19

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo R197Q en el gen NAT2

<400> 203 caggtgcctt gcattttct 19

<210> 204

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo R197Q en el gen NAT2

<400> 204 gatgaagccc accaaacagt 20

<210> 205

<211> 24

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo K268R en el gen NAT2

<400> 205 aaagacaata cagatctggt cgag 24

<210> 206

<211> 24

<212> DNA

<213> Artificial <220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo K268R en el gen NAT2

<400> 206 tcttcaaaat aacgtgaggg taga 24

<210> 207

<211> 24

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo G286E en el gen NAT2

<400> 207 aaagacaata cagatctggt cgag 24

<210> 208

<211> 24

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo G286E en el gen NAT2

<400> 208 tcttcaaaat aacgtgaggg taga 24

<210> 209

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo -786 T>C en el gen NOS3

<400> 209 gtgtacccca cctgcattct 20

<210> 210

<211> 19

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo -786 T>C en el gen NOS3

<400> 210 cccaccctgt cattcagtg 19

<210> 211

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo Glu298Asp en el gen NOS3

<400> 211 gaaggcagga gacagtggat 20

<210> 212

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo Glu298Asp en el gen NOS3

<400> 212 cagtcaatcc ctttggtgct 20

<210> 213

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo Cys326Ser en el gen OGG1

<400> 213 tagtctcacc agccctgacc 20

<210> 214

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo Cys326Ser en el gen OGG1

<400> 214 tggggaattt ctttgtccag 20

<210> 215

<211> 20

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 1 para amplificar el fragmento en el que puede existir el polimorfismo Ala16Val en el gen SOD2

<400> 215 ggctgtgctt tctcgtcttc 20

<210> 216

<211> 19

<212> DNA

<213> Artificial

<220>

<223> oligonucleótido 2 para amplificar el fragmento en el que puede existir el polimorfismo Ala16Val en el gen SOD2

<400> 216 ccgtagtcgt agggcaggt 19


 

Patentes similares o relacionadas:

Método para analizar ácido nucleico molde, método para analizar sustancia objetivo, kit de análisis para ácido nucleico molde o sustancia objetivo y analizador para ácido nucleico molde o sustancia objetivo, del 29 de Julio de 2020, de Kabushiki Kaisha DNAFORM: Un método para analizar un ácido nucleico molde, que comprende las etapas de: fraccionar una muestra que comprende un ácido nucleico molde […]

MÉTODOS PARA EL DIAGNÓSTICO DE ENFERMOS ATÓPICOS SENSIBLES A COMPONENTES ALERGÉNICOS DEL POLEN DE OLEA EUROPAEA (OLIVO), del 23 de Julio de 2020, de SERVICIO ANDALUZ DE SALUD: Biomarcadores y método para el diagnostico, estratificación, seguimiento y pronostico de la evolución de la enfermedad alérgica a polen del olivo, kit […]

Secuenciación dirigida y filtrado de UID, del 15 de Julio de 2020, de F. HOFFMANN-LA ROCHE AG: Un procedimiento para generar una biblioteca de polinucleótidos que comprende: (a) generar una primera secuencia del complemento (CS) de un polinucleótido diana a partir […]

Detección de interacciones proteína a proteína, del 15 de Julio de 2020, de THE GOVERNING COUNCIL OF THE UNIVERSITY OF TORONTO: Un método para medir cuantitativamente la fuerza y la afinidad de una interacción entre una primera proteína de membrana o parte de la misma y una […]

Métodos para la recopilación, estabilización y conservación de muestras, del 8 de Julio de 2020, de Drawbridge Health, Inc: Un método para estabilizar uno o más componentes biológicos de una muestra biológica de un sujeto, comprendiendo el método obtener un […]

Evento de maíz DP-004114-3 y métodos para la detección del mismo, del 1 de Julio de 2020, de PIONEER HI-BRED INTERNATIONAL, INC.: Un amplicón que consiste en la secuencia de ácido nucleico de la SEQ ID NO: 32 o el complemento de longitud completa del mismo.

Composiciones para modular la expresión de SOD-1, del 24 de Junio de 2020, de Biogen MA Inc: Un compuesto antisentido según la siguiente fórmula: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Te (secuencia […]

Aislamiento de ácidos nucleicos, del 24 de Junio de 2020, de REVOLUGEN LIMITED: Un método de aislamiento de ácidos nucleicos que comprenden ADN de material biológico, comprendiendo el método las etapas que consisten en: (i) efectuar un lisado […]

Utilizamos cookies para mejorar nuestros servicios y mostrarle publicidad relevante. Si continua navegando, consideramos que acepta su uso. Puede obtener más información aquí. .