Sondas de ácido nucleico y métodos para detectar patógenos fúngicos clínicamente importantes.

Método para la detección y diferenciación simultáneas de las diferentes especies fúngicas patógenas siguientes Candida albicans,

Candida parapsilosis, Candida tropicalis, Candida krusei, Candida glabrata, Aspergillus flavus, Aspergillus versicolor, Aspergillus nidulans, Aspergillus fumigatus y Cryptococcus neoformans en combinación entre sí, en un único ensayo, que incluye;

(i) liberar, aislar y/o concentrar los ácidos nucleicos de los patógenos fúngicos presentes posiblemente en la muestra,

(ii) si es necesario, amplificar la región espaciadora transcrita interna (ITS) de dichos ácidos nucleicos con al menos un par de cebadores universales fúngicos,

(iii) hibridar los ácidos nucleicos de la etapa (i) o (ii) con las siguientes sondas de oligonucleótidos específicas de especie de ITS-1, seleccionándose estas sondas para detectar y diferenciar dichas diferentes especies fúngicas patógenas, que comprende;

- para Candida albicans: al menos una de GTCTAAACTTACAACCAATT (SEQ ID NO 1),

TGTCACACCAGATTATTACT (SEQ ID NO 2) o

TATCAACTTGTCACACCAGA (SEQ ID NO 3),

- para Candida parapsilosis:

TGCCAGAGATTAAACTCAAC (SEQ ID NO 5),

- para Candida tropicalis:

GGTTATAACTAAACCAAACT (SEQ ID NO 6),

- para Candida krusei:

GGAATATAGCATATAGTCGA (SEQ ID NO 9),

- para Candida glabrata:

GAGCTCGGAGAGAGACATC (SEQ ID NO 10),

- para Cryptococcus neoformans:

CATCTACACCTGTGAACTGT (SEQ ID NO 15),

- para Aspergillus flavus:

GTTTACTGTACCTTAGTTGCT (SEQ ID NO 18),

- para Aspergillus versicolor:

CCTCTCGGGGGCGAGCC (SEQ ID NO 21),

- para Aspergillus nidulans:

CCGAGTGCGGCTGCCTC (SEQ ID NO 22),

- para Aspergillus fumigatus:

GTTGATTATCGTAATCAGT (SEQ ID NO 26),

o variantes de dichas sondas, difiriendo dichas variantes de las secuencias citadas anteriormente en la deleción y/o adición de uno o dos nucleótidos en el extremo 5' y/o 3' de la secuencia de nucleótidos, sin afectar al comportamiento de hibridación específica de especie de la sonda, o los equivalentes de ARN de dichas sondas, en los que se reemplaza T por U, o las moléculas complementarias de dichas sondas, y (iv) detectar los complejos de hibridación formados en la etapa (iii).

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2000/004714.

Solicitante: Fujirebio Europe N.V.

Inventor/es: JANNES, GEERT, ROSSAU, RUDI, SMITH,TERRY, MAHER,MAJELLA, MARTIN,CARA, VAN DER WEIDE,MARJO.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • C12N15/09 SECCION C — QUIMICA; METALURGIA.C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12N MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN (biocidas, productos que repelen o atraen a los animales nocivos, o reguladores del crecimiento de los vegetales, que contienen microorganismos virus, hongos microscópicos, enzimas, productos de fermentación o sustancias obtenidas por o extraídas de microorganismos o sustancias animales A01N 63/00; preparaciones de uso médico A61K; fertilizantes C05F ); PROPAGACION,CULTIVO O CONSERVACION DE MICROORGANISMOS; TECNICAS DE MUTACION O DE INGENIERIA GENETICA; MEDIOS DE CULTIVO (medios para ensayos microbiológicos C12Q 1/00). › C12N 15/00 Técnicas de mutación o de ingeniería genética; ADN o ARN relacionado con la ingeniería genética, vectores, p. ej. plásmidos, o su aislamiento, su preparación o su purificación; Utilización de huéspedes para ello (mutantes o microorganismos modificados por ingeniería genética C12N 1/00, C12N 5/00, C12N 7/00; nuevas plantas en sí A01H; reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00; nuevas razas animales en sí A01K 67/00; utilización de preparaciones medicinales que contienen material genético que es introducido en células del cuerpo humano para tratar enfermedades genéticas, terapia génica A61K 48/00; péptidos en general C07K). › Tecnología del ADN recombinante.
  • C12Q1/68 C12 […] › C12Q PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS QUE INTERVIENEN ENZIMAS O MICROORGANISMOS (ensayos inmunológicos G01N 33/53 ); COMPOSICIONES O PAPELES REACTIVOS PARA ESTE FIN; PROCESOS PARA PREPARAR ESTAS COMPOSICIONES; PROCESOS DE CONTROL SENSIBLES A LAS CONDICIONES DEL MEDIO EN LOS PROCESOS MICROBIOLOGICOS O ENZIMOLOGICOS. › C12Q 1/00 Procesos de medida, investigación o análisis en los que intervienen enzimas o microorganismos (aparatos de medida, investigación o análisis con medios de medida o detección de las condiciones del medio, p. ej. contadores de colonias, C12M 1/34 ); Composiciones para este fin; Procesos para preparar estas composiciones. › en los que intervienen ácidos nucleicos.

PDF original: ES-2621547_T3.pdf

 

Patentes similares o relacionadas:

Bacteria productora de butirato y su uso, del 8 de Mayo de 2019, de KABUSHIKI KAISHA YAKULT HONSHA: Una bacteria productora de butirato perteneciente a Anaerostipes hadrus (Eubacterium hadrum), donde la bacteria productora de butirato es Anaerostipes hadrus […]

Regiones epítopo de un receptor de tirotropina (TSH), sus usos y anticuerpos para las mismas, del 8 de Mayo de 2019, de RSR LIMITED: Un kit para la detección de autoanticuerpos para un receptor de TSH en una muestra de fluido corporal obtenida de un sujeto que se sospecha que padece, es susceptible […]

Anticuerpo anti-receptor de IL-23 humano nuevo, del 1 de Mayo de 2019, de ASTELLAS PHARMA INC.: Anticuerpo anti-IL-23R humano que comprende una región variable de cadena pesada que consiste en la secuencia de aminoácidos mostrada por SEQ ID NO: 5 y una región […]

Planta mutante, del 1 de Mayo de 2019, de UNIVERSITY OF TSUKUBA: Una planta mutante que comprende una proteína Della mutante, en que la proteína Della mutante tiene una secuencia de aminoácidos que tiene una identidad de […]

Anticuerpos monoclonales para los virus del Ébola y Marburgo, del 1 de Mayo de 2019, de HER MAJESTY, THE QUEEN IN RIGHT OF CANADA, AS REPRESENTED BY THE MINISTER OF HEALTH: Una composición que comprende anticuerpos monoclonales que se unen a la glucoproteína del virus del Ébola, comprendiendo dichos anticuerpos: (a) una región variable […]

Selección de células que expresan polipéptidos heterómeros, del 30 de Abril de 2019, de IMMUNEX CORPORATION: Un método para producir y aislar un complejo de cadena pesada y ligera de inmunoglobulina heterómera que comprende transfectar células con un vector […]

Método para preparar una mezcla de proteínas homodiméricas usando efecto de repulsión de carga, del 29 de Abril de 2019, de Jiangsu Alphamab Biopharmaceuticals Co., Ltd: Un método para obtener una mezcla que contiene dos o más proteínas usando un único clon celular recombinante, en donde las proteínas están en forma […]

Ácido nucleico antisentido, del 26 de Abril de 2019, de National Center of Neurology and Psychiatry: Un oligómero antisentido que se selecciona de un grupo que consiste en de (a) a (c) a continuación, o una sal o hidrato farmacéuticamente aceptable […]

Otras patentes de la CIP C12Q1/68