FACTOR NEUROTROFICO DEPENDIENTE DE ACTIVIDAD III (ADNF III).

Un ácido nucleico aislado que codifica un polipéptido de ADNF III que evita la muerte de células neuronales,

en el que dicho ácido nucleico aislado hibrida específicamente, en condiciones rigurosas, a un gen de ADNF III en presencia de una biblioteca genómica humana, teniendo dicho gen de ADNF III una secuencia de ácido nucleico que comprende la SEC ID Nº:

Tipo: Resumen de patente/invención. Número de Solicitud: W9802485US.

Solicitante: THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY OF THE DEPARTME
RAMOT UNIVERSITY, AUTHORITY FOR APPLIED RESEARCH & INDUSTRIAL DEVELOPMENT LTD
.

Nacionalidad solicitante: Estados Unidos de América.

Dirección: OFFICE OF THE DIRECTOR, OFFICE OF TECHNOLOGY TRANSFER, BOX OTT,ROCKVILLE, MD 20892-9902.

Inventor/es: BRENNEMAN, DOUGLAS, E., GOZES, ILLANA, BASSAN,MERAV.

Fecha de Publicación: .

Fecha Concesión Europea: 16 de Septiembre de 2009.

Clasificación Internacional de Patentes:

  • C07K14/475 SECCION C — QUIMICA; METALURGIA.C07 QUIMICA ORGANICA.C07K PEPTIDOS (péptidos que contienen β -anillos lactamas C07D; ipéptidos cíclicos que no tienen en su molécula ningún otro enlace peptídico más que los que forman su ciclo, p. ej. piperazina diones-2,5, C07D; alcaloides del cornezuelo del centeno de tipo péptido cíclico C07D 519/02;   proteínas monocelulares, enzimas C12N; procedimientos de obtención de péptidos por ingeniería genética C12N 15/00). › C07K 14/00 Péptidos con más de 20 aminoácidos; Gastrinas; Somatostatinas; Melanotropinas; Sus derivados. › Factores de crecimiento; Reguladores de crecimiento.

Clasificación PCT:

  • A61K38/22 SECCION A — NECESIDADES CORRIENTES DE LA VIDA.A61 CIENCIAS MEDICAS O VETERINARIAS; HIGIENE.A61K PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO (dispositivos o métodos especialmente concebidos para conferir a los productos farmacéuticos una forma física o de administración particular A61J 3/00; aspectos químicos o utilización de substancias químicas para, la desodorización del aire, la desinfección o la esterilización, vendas, apósitos, almohadillas absorbentes o de los artículos para su realización A61L;   composiciones a base de jabón C11D). › A61K 38/00 Preparaciones medicinales que contienen péptidos (péptidos que contienen ciclos beta-lactama A61K 31/00; dipéptidos cíclicos que no tienen en su molécula ningún otro enlace peptídico más que los que forman su ciclo, p. ej. piperazina 2,5-dionas, A61K 31/00; péptidos basados en la ergolina A61K 31/48; que contienen compuestos macromoleculares que tienen unidades aminoácido repartidas estadísticamente A61K 31/74; preparaciones medicinales que contienen antígenos o anticuerpos A61K 39/00; preparaciones medicinales caracterizadas por los ingredientes no activos, p. ej. péptidos como soportes de fármacos, A61K 47/00). › Hormonas (derivados de pro-opiomelanocortina, pro-encefalina o pro-dinorfina A61K 38/33, p. ej. corticotropina A61K 38/35).
  • C07K14/475 C07K 14/00 […] › Factores de crecimiento; Reguladores de crecimiento.
  • C07K16/22 C07K […] › C07K 16/00 Inmunoglobulinas, p. ej. anticuerpos mono o policlonales. › contra factores de crecimiento.
  • C12N15/18 C […] › C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12N MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN (biocidas, productos que repelen o atraen a los animales nocivos, o reguladores del crecimiento de los vegetales, que contienen microorganismos virus, hongos microscópicos, enzimas, productos de fermentación o sustancias obtenidas por o extraídas de microorganismos o sustancias animales A01N 63/00; preparaciones de uso médico A61K; fertilizantes C05F ); PROPAGACION,CULTIVO O CONSERVACION DE MICROORGANISMOS; TECNICAS DE MUTACION O DE INGENIERIA GENETICA; MEDIOS DE CULTIVO (medios para ensayos microbiológicos C12Q 1/00). › C12N 15/00 Técnicas de mutación o de ingeniería genética; ADN o ARN relacionado con la ingeniería genética, vectores, p. ej. plásmidos, o su aislamiento, su preparación o su purificación; Utilización de huéspedes para ello (mutantes o microorganismos modificados por ingeniería genética C12N 1/00, C12N 5/00, C12N 7/00; nuevas plantas en sí A01H; reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00; nuevas razas animales en sí A01K 67/00; utilización de preparaciones medicinales que contienen material genético que es introducido en células del cuerpo humano para tratar enfermedades genéticas, terapia génica A61K 48/00; péptidos en general C07K). › Hormonas de crecimiento.

Clasificación antigua:

  • A61K38/22 A61K 38/00 […] › Hormonas (derivados de pro-opiomelanocortina, pro-encefalina o pro-dinorfina A61K 38/33, p. ej. corticotropina A61K 38/35).
  • C07K14/475 C07K 14/00 […] › Factores de crecimiento; Reguladores de crecimiento.
  • C07K16/22 C07K 16/00 […] › contra factores de crecimiento.
  • C12N15/18 C12N 15/00 […] › Hormonas de crecimiento.
  • Fb
  • Twitter
  • G+
  • 📞
  • Pinit
FACTOR NEUROTROFICO DEPENDIENTE DE ACTIVIDAD III (ADNF III).

Fragmento de la descripción:

Factor Neurotrófico Dependiente de Actividad III (ADNF III).

Campo de la invención

La presente invención se refiere en general al Factor Neurotrófico Dependiente de Actividad III (ADNF III), también conocido como Proteína Neuroprotectora Dependiente de Actividad (ADNP). Más particularmente, la presente invención se refiere a secuencias de ácido nucleico que codifican polipéptidos de ADNF III; los polipéptidos de ADNF III codificados por tales secuencias de ácidos nucleico; anticuerpos para polipéptidos de ADNF III y el uso de tales polipéptidos de ADNF III para el tratamiento de deficiencias neurológicas y para la prevención de muerte celular asociada con (1) gp120, la proteína de envuelta de VIH; (2) ácido N-metil-D-aspártico (excito-toxicidad); (3) tetrodotoxina (bloqueo de actividad eléctrica) y (4) péptido ß-amiloide, una sustancia relacionada con degeneración neuronal en enfermedad de Alzheimer.

Antecedentes de la invención

La división, supervivencia y diferenciación neuronal dependen durante el desarrollo de un diverso grupo de proteínas y factores de crecimiento peptídico. En este grupo de moléculas reguladoras se incluyen factores tróficos reconocidos, tales como factor de crecimiento nervioso (NGF) (Levi-Montalcini, Differentiation, 13: 51-53 (1979)), factor neurotrófico ciliar (CNTF) (Lin y col., Science 24: 1023-1025 (1989)), factor de crecimiento de fibroblastos (FGF) (Wallicke y col., J. Neurosci. 11: 2249-2258 (1991)), factores de crecimiento similares a insulina 1 y 2 (IGF 1 y 2) (Ishii y col., Pharmacol. & Ther. 62: 125-144 (1994)), factor neurotrófico derivado del cerebro (BDNF) (Laibrock y col., Nature 341: 149-152 (1989)), factor neurotrófico derivado de la glía (GDNF) (Lin y col., Science 260: 1130-1132 (1993)) y neutrofina-3 y neutrofina-4/5 (Henderson y col., Nature 363: 266-269 (1993)). Además, las citoquinas también tienen propiedades neurotróficas (Brenneman y col., J. Neurochem. 58: 454-460 (1992); Patterson, Curr. Opin. Neurobiol. 2: 91-97 (1992)). Aunque muchos de los factores de crecimiento clásicos en primer lugar se reconoció que jugaban papeles tróficos importantes en las interacciones neurona/célula diana, actualmente está claro que las células gliales en el sistema nervioso central (SNC) expresan la mayoría de estos factores de crecimiento/citoquinas y que estas células de soporte juegan papeles significativos durante el desarrollo y la reparación/regeneración nerviosa.

Con respecto a esto, se han realizado esfuerzos para apreciar el papel de neuropéptidos en la regulación de la liberación/expresión de sustancias tróficas derivadas de la glía y para identificar nuevas moléculas gliales que contribuyen a la supervivencia de neuronas del SNC en desarrollo. En particular, se han realizado esfuerzos para apreciar el papel del soporte trófico para neuronas dependientes de actividad en el SNC. Las neuronas dependientes de actividad son una clase de neuronas que mueren durante el bloqueo eléctrico debido a una reducción de materiales tróficos solubles en su entorno (Brenneman y col., Dev. Brain Res. 9: 13-27 (1993); Brenneman y col., Dev. Brain Res. 15: 211-217 (1984)). Se ha demostrado que el bloqueo eléctrico inhibe la síntesis y liberación de materiales tróficos en el medio extracelular de cultivos de SNC (Agostan y col., Mol. Brain. Res. 10: 235-240 (1991); Brenneman y col., Peptides 6(2): 35-39 (1985)). En esta mezcla trófica se incluye péptido intestinal vasoactivo (VIP) (Brenneman y col., Peptides, mencionado anteriormente (1985); Brenneman y col., Proc. Natl. Acad. Sci. EE.UU. 83: 1159-1162 (1986)).

El péptido de 28 aminoácidos VIP, aislado originalmente por Said (Said y col. Ann. NY Acad. Sci. 527: 1-691 (1988)), se ha asociado con protección celular en neuronas sensoriales, neuronas simpáticas axotomizadas y pulmones y vías respiratorias con lesión aguda (véase, por ejemplo, Gressens y col., J. Clin. Invest. 100: 390-397 (1997)). De hecho, la carencia de regulación de expresión de VIP observada en estos sistemas lesionados o inflamados probablemente representa una respuesta adaptativa que limita el daño y promueve la recuperación.

Se ha demostrado que VIP interacciona con receptores de alta afinidad presentes en las células gliales (Gozes y col., J. Pharmacol. Exp. Therap. 257: 959-966 (1991)), dando como resultado la liberación de sustancias promotoras de la supervivencia (Brenneman y col., J. Cell. Biol. 104: 1603-1610 (1987); Brenneman y col., J. Neurosci. Res. 25: 386-394 (1990), entre las cuales se encuentra una citoquina derivada de la glía IL-1-a (Brenneman y col., J. Neurochem. 58: 454-460 (1992); Brenneman y col., Int. J. Dev. Neurosci. 13: 137-200 (1995)) y proteasa nexina I, un inhibidor de serina proteasa (Festoff y col., J. Neurobiol. 30: 255-26 (1995)). Sin embargo, los efectos promotores de la supervivencia neuronal del medio acondicionado con VIP se observaron en concentraciones muy bajas que podrían no atribuirse a IL-1 o proteasa nexina I liberada de la astroglia. Por lo tanto, se han realizado esfuerzos para identificar otras proteínas promotoras de la supervivencia liberadas a partir de células gliales estimuladas mediante VIP.

Al hacer esto, se ha descubierto una proteína neuroprotectora novedosa secretada por la astroglía en presencia de VIP (Brenneman & Gozes, J. Clin. Invest. 97: 2299-2307 (1996); Gozes y Brenneman, J. Molec. Meurosci. 7: 235-244 (1996)). La proteína neurotrófica se aisló mediante procedimientos cromatográficos secuenciales que combinan intercambio de iones, separación por tamaño e integración hidrófoba. Esta proteína neuroprotectora (masa molar, 14 kD y pl, 8,3 ± 0,25) se denominó factor neurotrófico dependiente de actividad (ADNF o ADNF I) por dos razones: (1) era necesario un bloqueo de actividad eléctrica espontánea para detectar la acción neuroprotectora de esta sustancia en cultivos de médula espinal disociados; y (2) VIP, un secretagogo para ADNF, se liberaba durante la actividad eléctrica, haciendo que la presencia de ADNF en el medio extracelular dependiera indirectamente de actividad espontánea. Se observó que ADNF mostraba neuroprotección en concentraciones sin precedentes. Más particularmente, se observó que concentraciones femtomolares de ADNF protegían a las neuronas de muerte asociada con una amplia variedad de toxinas, incluyendo las relacionadas con enfermedad de Alzheimer, el virus de inmunodeficiencia humana (VIH), excitotoxicidad y bloqueo eléctrico (véase, por ejemplo, Gozes y col., Dev. Brain Res. 99: 167-175 (1997)).

A lo largo de estudios dirigidos a las características estructurales de ADNF, se descubrió un fragmento peptídico activo de ADNF. Este péptido activo, 9 aminoácidos obtenidos de ADNF (ADNF-9), se observó que tenían homología marcada, pero no identidad, con una proteína de estrés intracelular: proteína de choque térmico 60 (hsp60). Además, se demostró que ADNF-14 imitaba la potencia de la proteína precursora, mientras que mostraba un intervalo más amplio de concentraciones eficaces en comparación con la proteína precursora. Además, ADNF-14, similar a ADNF, ha demostrado evitar la muerte de células neuronales asociada con la proteína de envuelta (gp120) de VIH (véase Dibbern y col., J. Clin. Invest. 99: 2837-2841 (1997)), con excitotoxicidad (N-metil-D-aspartato), con el péptido ß-amiloide (citotoxina putativa en enfermedad de Alzheimer) y con tetrodotoxina (bloqueo eléctrico) (véase Brenneman & Gozes, J. Clin. Invest. 97: 2299-2307 (1996)).

El descubrimiento de ADNF ha proporcionado conocimiento adicional con respecto a la acción neuroprotectora de VIP (Gozes & Brenneman, Mol. Neurobiol. 3: 201-236 (1989), Said, J. Clin Invest. 97: 2163-2164 (1996)). Además, las propiedades neurotróficas del polipéptido de ADNF tienen implicaciones terapéuticas y de diagnóstico significativas. Se prevé que el descubrimiento de que un péptido de 14 aminoácidos puede imitar la actividad de ADNF facilite el diseño de fármaco innovador para el tratamiento de síntomas neurológicos asociados con infección de VIH, enfermedad de Alzheimer y otras enfermedades neurodegenerativas frecuentes. Aunque ADNF y ADNF-14 tienen potencial ilimitado como neuroprotectores, todavía sería provechoso identificar otras proteínas promotoras de la supervivencia liberadas a partir de células gliales estimuladas por VIP.

En un primer aspecto de la presente invención se proporciona un ácido nucleico aislado que codifica un polipéptido de ADNF III que evita la muerte de células neuronales, en el que dicho ácido nucleico aislado hibrida específicamente, en condiciones rigurosas, a un gen de ADNF III en...

 


Reivindicaciones:

1. Un ácido nucleico aislado que codifica un polipéptido de ADNF III que evita la muerte de células neuronales, en el que dicho ácido nucleico aislado hibrida específicamente, en condiciones rigurosas, a un gen de ADNF III en presencia de una biblioteca genómica humana, teniendo dicho gen de ADNF III una secuencia de ácido nucleico que comprende la SEC ID Nº: 2.

2. El ácido nucleico aislado de acuerdo con la reivindicación 1, en el que dicho ácido nucleico aislado tiene una secuencia de ácido nucleico que comprende la SEC ID Nº: 2 o su complemento.

3. Un ácido nucleico aislado que codifica un polipéptido de ADNF III que evita la muerte de células neuronales, en el que dicho ácido nucleico aislado hibrida específicamente, en condiciones rigurosas, a un gen de ADNF III en presencia de una biblioteca genómica murina, teniendo dicho gen de ADNF III una secuencia de ácido nucleico que comprende la SEC ID Nº: 4.

4. El ácido nucleico aislado de acuerdo con la reivindicación 3, en el que dicho ácido nucleico aislado tiene una secuencia de ácido nucleico que comprende la SEC ID Nº: 4 o su complemento.

5. El ácido nucleico aislado de acuerdo con la reivindicación 1 ó 3, en el que dicho ácido nucleico comprende además un vector recombinante.

6. Un ácido nucleico aislado que codifica un polipéptido de ADNF III que evita la muerte de células neuronales, en el que el ácido nucleico se amplifica mediante cebadores que hibridan específicamente en condiciones de hibridación rigurosas a la misma secuencia que un conjunto de cebadores que comprende cebadores seleccionados entre el grupo constituido por:

sentido 5'TCCAATGTTCACCTGCAG 3' (SEC ID Nº: 7)
sentido 5' ACCTGCAGCAAAACAACTAT 3' (SEC ID Nº: 9) hskip0.3cm y
antisentido 5' GCTCGTTACAGATTGTAC 3' (SEC ID Nº: 8)

7. Un polipéptido de ADNF III aislado que evita la muerte de células neuronales, estando dicho ADNF III codificado por un ácido nucleico de la reivindicación 1 ó 3.

8. El polipéptido de ADNF III aislado de acuerdo con la reivindicación 7, en el que dicho polipéptido de ADNF III, tiene una secuencia de aminoácidos que comprende la SEC ID Nº: 1.

9. El polipéptido de ADNF III aislado de acuerdo con la reivindicación 7, en el que dicho polipéptido de ADNF III, tiene una secuencia de aminoácidos que comprende la SEC ID Nº: 3.

10. El polipéptido de ADNF III aislado de la reivindicación 7, en el que dicho polipéptido de ADNF III está codificado por un ácido nucleico que tiene una secuencia de ácido nucleico que comprende la SEC ID Nº: 2.

11. El polipéptido de ADNF III aislado de la reivindicación 7, en el que dicho polipéptido de ADNF III se reproduce de forma recombinante.

12. Un polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III, comprendiendo dicho polipéptido la siguiente secuencia de aminoácidos:

(R1)x-Asn-Ala-Pro-Val-Ser-Ile-Pro-Gln-(R2)y hskip1cm (SEC ID Nº: 10),

en el que:

R1 es una secuencia de aminoácidos que comprende de 1 a aproximadamente 40 aminoácidos en la que cada aminoácido se selecciona independientemente;

R2 es una secuencia de aminoácidos que comprende de 1 a aproximadamente 40 aminoácidos en la que cada aminoácido se selecciona independientemente; y

x e y se seleccionan independientemente y son iguales a cero o uno.

13. El polipéptido de ADNF III de acuerdo con la reivindicación 12 en el que:

x e y son ambos cero.

14. El polipéptido de ADNF III de acuerdo con la reivindicación 12 en el que:

x es uno;

R1 es Gly-Gly-; e

y es cero.

15. El polipéptido de ADNF III de acuerdo con la reivindicación 12 en el que:

x es uno;

R1 es Leu-Gly-Gly-;

y es uno; y

R2 es -Gln-Ser.

16. El polipéptido de ADNF III de acuerdo con la reivindicación 12 en el que:

x es uno;

R1 es Leu-Gly-Leu-Gly-Gly- (SEC ID Nº: 17);

y es uno; y

R2 es -Gln-Ser.

17. El polipéptido de ADNF III de acuerdo con la reivindicación 12 en el que:

x es uno;

R1 es Ser-Val-Arg-Leu-Gly-Leu-Gly-Gly- (SEC ID Nº: 18);

y es uno; y

R2 es -Gln-Ser.

18. El polipéptido de ADNF III de acuerdo con la reivindicación 12, en el que dichos polipéptidos de ADNF III tienen una secuencia de aminoácidos seleccionada entre el grupo constituido por las SEC ID Nº: 1 y SEC ID Nº: 3.

19. El polipéptido de ADNF III de una cualquiera de las reivindicaciones 12 a 18, para uso en terapia.

20. Uso del polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF III) de una cualquiera de las reivindicaciones 12 a 18 en la preparación de un medicamento para el tratamiento de enfermedad de Alzheimer.

21. El polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF III) de una cualquiera de las reivindicaciones 12 a 18 para uso en el tratamiento de enfermedad de Alzheimer.

22. Uso del polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 en la preparación de un medicamento para la prevención de muerte de células neuronales inducida por el péptido ß-amiloide en un paciente aquejado con enfermedad de Alzheimer.

23. El polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 para uso en la prevención de muerte de células neuronales inducida por el péptido ß-amiloide en un paciente aquejado con enfermedad de Alzheimer.

24. Uso del polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 en la preparación de un medicamento para la prevención de muerte neuronal en un paciente infectado con virus de inmunodeficiencia humana.

25. El polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 para uso en la prevención de muerte neuronal en un paciente infectado con virus de inmunodeficiencia humana.

26. Uso del polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 en la preparación de un medicamento para aliviar el deterioro del aprendizaje producido por bloqueo colinérgico en un paciente aquejado con enfermedad de Alzheimer.

27. El polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 12 a 18 para uso en el alivio del deterioro del aprendizaje producido por bloqueo colinérgico en un paciente aquejado con enfermedad de Alzheimer.

28. Una composición farmacéutica que comprende un excipiente farmacéuticamente aceptable y el polipéptido Factor Neurotrófico Dependiente de Actividad (ADNF) III de una cualquiera de las reivindicaciones 7 a 18.


 

Patentes similares o relacionadas:

Imagen de 'Células madre de revestimiento del cordón umbilical y métodos…' Células madre de revestimiento del cordón umbilical y métodos y material para aislar y cultivar las mismas, del 16 de Febrero de 2016, de Davinci Biosciences LLC: Un método in vitro para aislar células madre de revestimiento del cordón umbilical (ULSCs) de un cordón umbilical, comprendiendo dicho método a) obtener el revestimiento […]

Usos de péptidos que se unen específicamente al receptor del HGF (cMet), del 25 de Enero de 2016, de DYAX CORP.: Un agente de contraste formador de imágenes diagnósticas que comprende un polipéptido o un polipéptido multimérico que tiene la capacidad de unirse a cMet o […]

Imagen de 'Método para la producción de proteína TAT-HOXB4H recombinante…' Método para la producción de proteína TAT-HOXB4H recombinante para su utilización como estimulante de la hematopoyesis in vivo, del 20 de Enero de 2016, de TAIWAN ADVANCE BIO-PHARM INC: Una composición farmacéutica para la administración in vivo para mejorar la movilización de Células Madre Hematopoyéticas (CMH) desde la médula […]

Remodelación y glicoconjugación de péptidos, del 15 de Enero de 2016, de NOVO NORDISK A/S: Una composición farmacéutica que comprende un diluyente farmacéuticamente aceptable y un conjugado covalente entre un péptido y un polímero hidrosoluble, en la que dicho […]

Remodelación y glicoconjugación de anticuerpos, del 23 de Diciembre de 2015, de RATIOPHARM GMBH: Un procedimiento de formación de un conjugado entre un péptido de anticuerpo y un grupo modificador, en el que dicho grupo modificador está unido […]

Imagen de 'Una composición farmacéutica que comprende PCMV-VEGF165 para…' Una composición farmacéutica que comprende PCMV-VEGF165 para la estimulación de angiogénesis, del 16 de Diciembre de 2015, de "Nextgen" Company Limited: Una composición farmacéutica que comprende: una preparación del ADN del plásmido purificado pCMV-VEGF165 que codifica un factor de crecimiento del endotelio vascular […]

Imagen de 'Péptido derivado de WNT10 y su uso' Péptido derivado de WNT10 y su uso, del 25 de Noviembre de 2015, de CAREGEN CO., LTD: Un péptido que comprende la secuencia de aminoácidos de la SEC ID N.º: 1.

Un ligando peptídico para alterar la migración de células cancerígenas, del 29 de Abril de 2015, de Wntresearch AB: Un péptido formilado seleccionado a partir del grupo que consiste en:**Fórmula**