701 Patentes de enero de 2005 (pag. 8)

  1. 225.-

    PROCEDIMIENTO PARA PREPARAR DERIVADOS DE ACIDO 2-AMINO-OMEGA-OXOALCANOICO OPTICAMENTE ACTIVOS.

    (01/2005)
    Solicitante/s: DSM N.V.. Inventor/es: BOESTEN, WILHELMUS, HUBERTUS, JOSEPH, BROXTERMAN, QUIRINUS, BERNARDUS, PLAUM, MARCUS JOSEPH MARIA. Clasificación: C12P41/00, C12P13/04, C07D319/06, C07C253/00, C07D317/28, C07C255/24, C07C229/22, C07C231/06, C07C237/04, C07D317/30.

    LA PRESENTE INVENCION SE REFIERE A UN PROCESO PARA PREPARAR UN DERIVADO DEL ACIDO (S) - 2 - AMINO - OE - OXOALCANOICO. EN DICHO PROCESO EL ALDEHIDO CORRESPONDIENTE SE TRANSFORMA EN EL ALDEHIDO PROTEGIDO EN EL GRUPO ACETAL CORRESPONDIENTE, ESTE ULTIMO SE CONVIRETE EN EL AMINONITRILO CORRESPONDIENTE Y, A CONTINUACION, DICHO AMINONITRILO SE CONVIERTE EN LA AMIDA DE AMINOACIDO CORRESPONDIENTE. DICHA AMIDA SE SOMETE A UNA HIDROLISIS ENZIMATICA ENANTIOSELECTIVA EN LA CUAL EL ENANTIOMERO R DE LA AMIDA DE AMINOACIDO PERMANECE COMO RESIDUO Y EL ENANTIOMERO S ES TRANSFORMADO EN AMINOACIDO S. LUEGO, SE AISLA DICHO AMINOACIDO S. PREFERIBLEMENTE, LA MEZCLA DE REACCION OBTENIDA DESPUES DE LA CONVERSION DEL AMINONITRILO EN LA AMIDA DE AMINOACIDO SE TRATA CON UN BENZALDEHIDO, TRAS LO CUAL SE FORMA LA BASE DE SCHIFF DE LA DICHA AMIDA. DICHA BASE SE SEPARA Y SE TRANSFORMA EN LA AMIDA DE AMINOACIDO LIBRE.

  2. 226.-

    PROCEDIMIENTO DE ACONDICIONAMIENTO DE GUANTES Y GUANTES ASI ACONDICIONADOS.

    (01/2005)
    Ver ilustración. Solicitante/s: HUTCHINSON. Inventor/es: LESENNE, YVES, LABBE, HERVE. Clasificación: B65D85/18, B65B63/04, B65B25/20.

    LA INVENCION SE REFIERE A UN PROCEDIMIENTO DE ACONDICIONAMIENTO DE GUANTES. SE CARACTERIZA PORQUE INCLUYE LAS SIGUIENTES ETAPAS: A) COLOCAR LOS GUANTES EN PLANO EN UN PRIMERO Y UN SEGUNDO SOPORTES ESPACIADOS ENTRE SI DE MANERA QUE UNA PRIMERA REGION DE LOS GUANTES DESCANSE SOBRE EL PRIMER SOPORTE Y QUE UNA SEGUNDA PARTE DE LOS GUANTES SE APOYE SOBRE EL SEGUNDO SOPORTE ; B) DISPONER SOBRE LA PRIMERA PARTE DE LOS GUANTES UNA PIEZA DE PROTECCION ; C) DESPLAZAR EL PRIMER Y EL SEGUNDO SOPORTE EL UNO RESPECTO AL OTRO PARA SUPERPONER EL SEGUNDO SOPORTE AL PRIMER SOPORTE A LA VEZ QUE SE PLIEGAN LOS GUANTES EN DOS ALREDEDOR DE UN EXTREMO DE LA PIEZA DE PROTECCION ; D) TRANSFERIR EL CONJUNTO CONSTITUIDO POR LOS GUANTES PLEGADOS Y POR LA PIEZA DE PROTECCION HACIA UN PUESTO DE EMBALAJE.

  3. 227.-

    CIRCUITO DE ALIMENTACION PARA UN CONTADOR DE ELECTRICIDAD.

    (01/2005)
    Ver ilustración. Solicitante/s: SCHLUMBERGER INDUSTRIES S.A.. Inventor/es: ZAIM, BRAHIM. Clasificación: H02M3/335, G01R22/00.

    CONTADOR DE ELECTRICIDAD ELECTRONICO QUE COMPRENDE UN CIRCUITO METROLOGIO Y UN CIRCUITO DE ALIMENTACION. EL CIRCUITO DE ALIMENTACION COMPRENDE UN CONDENSADOR PRINCIPAL ( O ) Y UN TRANSFORMADOR REGULADO POR UN CIRCUITO DE CORTE. EL TRANSFORMADOR SE CARACTERIZA POR UN BOBINADO SUPLEMENTARIO ENTRE LA MOLDURA CILINDRICA Y EL PRIMARIO Y UN CIRCUITO DE INTEGRACION DIMENSIONADOS PARA PROPORCIONAR EN LA SALIDA UNA IMAGEN DE TENSION SENSIBLEMENTE PROPORCIONAL A LA TENSION DEL CONDENSADOR PRINCIPAL.

  4. 228.-

    METODO ADAPTABLE Y APARATO PARA DETECCION DE SEÑAL.

    (01/2005)

    CIRCUITO Y METODO PARA CALCULAR DE UN MODO ADAPTABLE UN ERROR DE DECISION DE UNA SEÑAL DIGITAL EN UN SISTEMA DE MODULACION DIGITAL. EL CIRCUITO INCLUYE UN FILTRO DIGITAL PARA EL FILTRADO DE TRANSFORMACION HILBERT DE LOS DATOS DE CANAL I PARA GENERAR LOS DATOS DE CANAL Q QUE DIFIEREN EN FASE CON LOS DATOS DEL CANAL I, UN RETARDADOR PARA RETRASAR LOS DATOS DE CANAL I DURANTE EL TIEMPO DE FILTRADO DEL FILTRO DIGITAL , UN PROCESADOR DE INTERVALOS DE SEÑAL DE REFERENCIA PARA RECIBIR LOS DATOS DE CANAL I Y GENERAR UN...

  5. 229.-

    PEPTIDOS AGONISTAS Y/O INHIBIDORES DE LA FORMACION DE AMILOIDE Y/O DE CITOTOXICIDAD Y SU UTILIZACION CONTRA LA ENFERMEDAD DE ALZHEIMER, LA DIABETES MELLITUS DE TIPO II Y LA ENCEFALOPATIA ESPONGIFORME.

    (01/2005)
    Ver ilustración. Solicitante/s: FRAUNHOFER-GESELLSCHAFT ZUR FORDERUNG DER ANGEWANDTEN FORSCHUNG E.V.. Inventor/es: BRUNNER, HERWIG, BERNHAGEN, JURGEN, KAPURNIOUTU, AFRODITI. Clasificación: C07K14/47, C07K7/06, A61K38/22, C07K14/575.

    LA INVENCION TRATA DE UN PEPTIDO COMO ANTAGONISTA Y/O INHIBIDOR DE AMILOIDEFORMACION, MOSTRANDO EL PEPTIDO DE 3 A 15 AMINOACIDOS Y COMPRENDIENDO AL MENOS LA EFICAZ SECUENCIA PEPTIDA GA.

  6. 230.-

    MAQUINA PARA EL FROTAMIENTO Y SALAZON DE CARNES CRUDAS PARA CURADO Y CONSERVACION.

    (01/2005)
    Ver ilustración. Solicitante/s: MACCHINE SONCINI ALBERTO S.P.A.. Inventor/es: SONCINI, ALBERTO. Clasificación: A23B4/32.

    SE DESCRIBE UN DISPOSITIVO DISPENSADOR Y DOSIFICADOR PARA SAL FINA SECA, EN PARTICULAR PARA MAQUINAS DE PRESALADO - FROTAMIENTO PARA TROZOS DE CARNE CRUDA PREVISTA PARA EL CURADO, ESTANDO EL DISPOSITIVO COLOCADO ENCIMA DE UNA CINTA TRANSPORTADORA PARA LOS TROZOS DE CARNE CRUDA ; INCLUYENDO DICHO DISPOSITIVO DISPENSADOR UNA CARCASA CON DOS PAREDES LATERALES , ESTANDO SOPORTADA ENTRE AMBAS UNA TOLVA , ENCONTRANDOSE LA BOCA INFERIOR DE LA MISMA SOBRE UN RODILLO DOSIFICADOR , EXISTIENDO UN MEDIO PARA VARIAR LA ABERTURA DISPENSADORA DE SAL ENTRE LA BOCA INFERIOR DE LA TOLVA Y EL RODILLO DOSIFICADOR , Y ESTANDO FORMADO UN MEDIO PARA CERRAR Y RESPECTIVAMENTE ABRIR LA ABERTURA DISPENSADORA DE SAL ENTRE EL EXTREMO DE LA TOLVA Y EL RODILLO DOSIFICADOR.

  7. 231.-

    SISTEMA DE FILTRACION DE SUBSTANCIAS EN SUSPENSION.

    (01/2005)

    EL SISTEMA DE FILTRADO DE MATERIAS EN SUSPENSION MUESTRA UN AGRUPAMIENTO DE FILTROS DE TAMBOR Y UN BASTIDOR , QUE SE HA DISPUESTO EN POSICION OPERATIVA PERMANENTE PROXIMO AL AGRUPAMIENTO. SE HAN DISPUESTO OPERATIVAMENTE VARIOS ELEMENTOS LONGITUDINALES SOBRE EL BASTIDOR Y CADA ELEMENTO LONGITUDINAL SE EXTIENDE POR LA ZONA INTERIOR DE UN FILTRO DE TAMBOR. UNA TOBERA DE SUCCION SE EXTIENDE DESDE CADA ELEMENTO LONGITUDINAL, PARA ESTAR CONECTADA OPERATIVAMENTE A LA ZONA DEL LADO INTERIOR DEL FILTRO DE TAMBOR PARA...

  8. 232.-

    SOPORTE PARA UN INTERRUPTOR TERMOSENSIBLE.

    (01/2005)
    Ver ilustración. Solicitante/s: THERMIK GERATEBAU GMBH. Inventor/es: BECHER, MICHAEL, GUTTINGER, EDWIN. Clasificación: H01H1/58, H01H37/04.

    UN SOPORTE PARA UN INTERRUPTOR DEPENDIENTE DE LA TEMPERATURA CON DOS CONEXIONES , PRESENTA UN DISPOSITIVO PARA SUJETAR EL INTERRUPTOR . ASIMISMO SE HA PREVISTO COMO MINIMO UNA PIEZA DE CONEXION PARA CONEXION EXTERNA, CONECTADA CON UNA DE LAS CONEXIONES , QUE LLEVA UN BORNE DE CORTE.

  9. 233.-

    PROCEDIMIENTO PARA LA FABRICACION DE PARTICULAS EXPANDIBLES DE POLIMEROS DE ESTIRENO.

    (01/2005)
    Solicitante/s: ENICHEM S.P.A.. Inventor/es: GHIDONI, DARIO, ANFUSO, FRANCESCO. Clasificación: C08J9/224.

    PROCEDIMIENTO DE PRODUCCION DE PARTICULAS EXPANSIBLES DE POLIMEROS DE ESTIRENO, CON CARACTERISTICAS DE PROCESABILIDAD MEJORADAS, QUE COMPRENDE: I) PRODUCIR PARTICULAS EXPANSIBLES DE POLIMEROS DE ESTIRENO, QUE CONTIENEN ENTRE 2 Y 20 % DE UN AGENTE EXPANSOR INCORPORADO; II) CUBRIR DICHAS PARTICULAS CON UN AGENTE ANTIESTATICO EN UNA CANTIDAD INFERIOR AL 1 % EN PESO; III) FRICCIONAR VIGOROSAMENTE LAS PARTICULAS EN UN APARATO MEZCLADOR, A FIN DE CALENTAR SU SUPERFICIE, EN UN TIEMPO CORTO, MEDIANTE SIMPLE FRICCION MECANICA; IV) DESCARGAR LAS PARTICULAS ASI TRATADAS A PARTIR DEL APARATO MEZCLADOR.

  10. 234.-

    DESMINERALIZACION DE SUERO LACTEO, DULCE, DE QUESERIA.

    (01/2005)
    Ver ilustración. Solicitante/s: SOCIETE DES PRODUITS NESTLE S.A.. Inventor/es: BERROCAL, RAFAEL, CHAVERON, MICHEL. Clasificación: A23C9/146, B01D61/48, A23C9/144.

    SE UTILIZA LA ELECTRODESIONIZACION PARA DESMINERALIZAR SUERO LACTICO DULCE DE QUESERIA CON BOLAS DE RESINA DE INTERCAMBIO DE IONES CATIONICA FUERTE SOLA O CATIONICA Y ANIONICA DEBIL MEZCLADA. EL PH DE LOS COMPARTIMENTOS DE CONCENTRACION SE AJUSTA A UN VALOR INFERIOR A 5. EL METODO APORTA UNA ECONOMIA CONSIDERABLE DE AGUA Y ENERGIA SIN UTILIZAR REGENERADORES QUIMICOS.

  11. 235.-

    DISPOSITIVO AJUSTABLE DE CONEXION ELECTRICA PARA TUBO TELESCOPICO DE ASPIRADOR.

    (01/2005)
    Ver ilustración. Solicitante/s: BOSCH-SIEMENS HAUSGERATE GMBH. Inventor/es: SYKORA, VLADIMIR. Clasificación: A47L9/24, A47L9/28.

    LA INVENCION CONSISTE EN UN DISPOSITIVO AJUSTABLE DE TRANSFERENCIA DE CORRIENTE PARA UN TUBO TELESCOPICO ASPIRADOR DE POLVO. EL DISPOSITIVO SE COMPONE DE AL MENOS DOS PIEZAS TUBULARES (3 Y 4), QUE SE DESLIZAN UNA DENTRO DE LA OTRA Y SE ACOPLAN MECANICAMENTE A LOS SEGMENTOS 1A Y 1B DEL TUBO TELESCOPICO . DICHAS PIEZAS INCORPORAN EN SUS EXTREMOS OPUESTOS SENDOS DISPOSITIVOS ELECTRICOS DE ENCHUFE (12 Y 21). EN LA PARED INTERIOR DE UNA DE LAS PIEZAS TUBULARES SE ENCUENTRAN DOS O MAS VIAS CONDUCTORAS DE LA ELECTRICIDAD UNIDAS AL DISPOSITIVO DE ENCHUFE DE ESA PIEZA. LA OTRA PIEZA INCORPORA DOS O MAS CONTACTOS DESLIZANTES UNIDOS AL DISPOSITIVO DE ENCHUFE DE ESA PIEZA . AL AJUSTAR LAS PIEZAS TUBULARES, CADA CONTACTO SE DESLIZA A LO LARGO DE UNA VIA , DE MODO QUE HAY EL MISMO NUMERO DE CONTACTOS QUE DE VIAS.

  12. 236.-

    REACTIVO Y METODO PARA INHIBIR LA EXPRESION DE N-RAS.

    (01/2005)
    Ver ilustración. Solicitante/s: HOECHST AKTIENGESELLSCHAFT. Inventor/es: UHLMANN, EUGEN, DR., ENGELS, JOACHIM, PROF. DR., SCHERR, MICHAELA, GANSER, ARNOLD, PROF. DR. Clasificación: C12N9/00.

    ESTA INVENCION SE REFIERE A MOLECULAS DE ARN ENZIMATICO QUE ROMPEN MARN DE N DE RUPTURA NUX (N = CUALQUIER BASE, X = A, C = A, C O U), QUE PREFERIBLEMENTE PRESENTAN LAS SECUENCIAS 5' CCAACACCUGAUGAGCGUUAGCGAAACCUGCU A SUS DERIVADOS MODIFICADOS, A PRODUCTOS FARMACEUTICOS QUE CONTIENEN DICHAS MOLECULAS, PARA PREPARAR PRODUCTOS DESTINADOS AL TRATAMIENTO DE ENFERMEDADES QUE IMPLICAN CRECIMIENTO Y/O DIFERENCIACION CELULAR ANORMAL.

  13. 237.-

    FABRICACION TOTAL DE GOMA DE MASCAR UTILIZANDO MEZCLAMIENTO EN CONTINUO DE ALTA EFICACIA.

    (01/2005)
    Solicitante/s: WM. WRIGLEY JR. COMPANY. Inventor/es: WOLFE, JOHN T., SONG, JOO H., SUNDSTROM, CHRISTAFOR E., RECORD, DAVID W., TOWNSEND, DONALD J., BRODERICK, KEVIN B., SCHNELL, PHILIP G. Clasificación: A23G3/30.

    SE SUMINISTRA UN METODO PARA LA MANUFACTURA DE GOMA DE MASCAR SOBRE UNA BASE CONTINUA. EL METODO UTILIZA UNA MEZCLADORA CONTINUA DE ALTA EFICIENCIA QUE ESTA CONFIGURADA PARA LA MANUFACTURA TOTAL DE UNA AMPLIA VARIEDAD DE PRODUCTOS DE GOMA DE MASCAR E INCLUYE AL MENOS UNA ABERTURA DE SUMINISTRO DE INGREDIENTES QUE ESTAN AGRANDADA.

  14. 238.-

    SENSOR DE GAS FOTOACUSTICO Y SU UTILIZACION.

    (01/2005)

    UN SENSOR DE GAS FOTOACUSTICO PARA LA MEDICION DE LA CONCENTRACION DE GASES DIFERENTES, INCLUYENDO GASES EXPLOSIVOS, SE COMPONE DE UN CUERPO 1 DE SENSOR CILINDRICO, QUE CONTIENE INCLUSO UNA CELDA 13 DE MEDICION CILINDRICA, CUYO EJE LONGITUDINAL DISCURRE DE FORMA PERPENDICULAR CON RESPECTO AL EJE LONGITUDINAL DEL CUERPO 1 DE SENSOR. LA LONGITUD DE CELDA DE MEDICION PUEDE SER MODIFICADA SEGUN UNA SENSIBILIDAD DE MEDICION DESEADA Y DE ACUERDO CON UNA ZONA DE MEDICION TAMBIEN DESEADA, DONDE LAS DIMENSIONES EXTERIORES...

  15. 239.-

    APARATO CRIPTOGRAFICO CON DOBLE FUNCION DE ALIMENTACION DIRECTA.

    (01/2005)

    UN APARATO ES SUMINISTRADO PARA AUTENTIFICAR INFORMACION UTILIZANDO UNA FUNCION DE DOBLE ALIMENTACION DIRECTA PARTIDA, PARA PROPORCIONAR COMPLEMENTARIEDAD EN LA IMPLEMENTACION DE UN ALGORITMO DE ENCRIPTACION. UN PROCESADOR CRIPTOGRAFICO TIENE UNA PRIMERA ENTRADA PARA LA RECEPCION DE UN TEXTO INTELIGIBLE, UNA SEGUNDA ENTRADA PARA LA RECEPCION DE UNA CLAVE Y UNA SALIDA PARA ENVIAR EL TEXTO CIFRADO GENERADO POR EL PROCESAMIENTO CRIPTOGRAFICO DEL TEXTO INTELIGIBLE Y DE LA CLAVE. UN PRIMER ELEMENTO DE CIRCUITO ES RESPONSABLE...

  16. 240.-

    FRACCIONES DEL FACTOR VON WILLEBRAND DE ELEVADO Y BAJO PESOS MOLECULARES.

    (01/2005)
    Solicitante/s: BAXTER AKTIENGESELLSCHAFT. Inventor/es: MITTERER, ARTUR, DORNER, FRIEDRICH, PROF., FISCHER, BERNHARD. Clasificación: C07K14/755, A61K38/37.

    LA PRESENTE INVENCION SE REFIERE A UN PROCESO PARA LA SEPARACION DE VWF EN VWF DE ALTO PESO MOLECULAR Y VWF DE BAJO PESO MOLECULAR, QUE SE CARACTERIZA DE TAL MODO, QUE SE LIGA EL VWF EN UN PORTADOR DE AFINIDAD Y SE ELUYE ENTONCES MEDIANTE CONCENTRACIONES DE SALES DIFERENTES.

  17. 241.-

    PROCEDIMIENTO PARA EL ANALISIS DE UNA MUESTRA MEDICA MEDIANDO EVITACION DE CONTRIBUCIONES PERTURBADORAS A CAUSA DE UNA HEMOLISIS.

    (01/2005)
    Solicitante/s: BOEHRINGER MANNHEIM GMBH. Inventor/es: WILD, THOMAS, WEBER, FRIEDERIKE, BERDING, CHRISTOPH, DR., KLEIDER, WILHELM. Clasificación: G01N33/72, C12Q1/32.

    PARA EL ANALISIS DE UNA MUESTRA MEDICA BAJO PREVENCION DE SOPORTES DE PERTURBACION SOBRE BASE DE HEMOLISIS SE GENERA Y SE MIDE UNA REACCION PREVIA ANTES DE LA REACCION PRINCIPAL PARA UN COMPONENTE CONTENIDO EN LA MUESTRA, QUE SE DETERMINA POR MEDIO DEL GRADO DE HEMOLISIS DE LA MUESTRA. EL RESULTADO OBTENIDO A CONTINUACION EN LA MUESTRA A SER DETERMINADA, SE CORRIGE DE LAS SITUACIONES PERTURBADORAS MEDIANTE UTILIZACION DE LOS PROCESOS CONJUNTOS LOCALIZADOS (CORRELACION) ENTRE EL GRADO DE HEMOLISIS Y EL IMPORTE DE PERTURBACION.

  18. 242.-

    INSTRUMENTO LIMPIAVENTANAS.

    (01/2005)

    UN LIMPIADOR DE VENTANA MUESTRA UNA PIEZA BASICA UNIDA CON UN ASIDERO O UNA PIEZA DE UNION PARA LA APLICACION DE UN AGARRE O MANGO EN UN SOPORTE QUE SE EXTIENDE DE FORMA LONGITUDINAL PARA UN LISTON DE RESTREGADO DE MATERIAL ELASTICO ASI COMO PARA UNA ALMOHADA QUE RECIBE AGUA Y QUE SE EXTIENDE A LO LARGO DEL SOPORTE . EL LISTON DE RESTREGADO SE ASIENTA EN UNA SECCION TRANSVERSAL CORTADA POSTERIORMENTE SEGUN UN CANAL ABIERTO, QUE DISCURRE EN EL SOPORTE , HACIA EL CUAL SE MUESTRA UN TRAMO DE SECCION TRANSVERSAL ESENCIALMENTE COMPLEMENTARIA. EL LISTON DE RESTREGADO ESTA RIGIDIZADO POR MEDIO DE UN LISTON DE APLICACION METALICA O ENGASTE DE TAL MODO, QUE DISPONE DE CAPACIDAD DE FUNCIONAMIENTO CON UN TRAMO QUE SE DESPLAZA A PARTIR DE UNO...

  19. 243.-

    TRANSMISION DE RESOLUCION MULTIPLE, EN PARTICULAR CON SEÑALES MULTIPORTADORAS.

    (01/2005)

    EN EL TRANSMISOR, LOS DATOS SON DIVIDIDOS EN DOS O MAS GRUPOS, DE ACUERDO CON LA IMPORTANCIA. EN UN SISTEMA DE TRES GRUPOS, POR EJEMPLO, LAS CORRIENTES DE DATOS SON CONFIGURADAS EN CONSTELACIONES QAM DE MULTIRRESOLUCION EN LA FORMA SIGUIENTE. LOS DATOS MAS IMPORTANTES DETERMINAN EL CUADRANTE, LOS SIGUIENTES MAS IMPORTANTES DETERMINAN CUAL DE LOS CUATRO SUBCONJUNTOS ES UTILIZADO EN EL CUADRANTE, EL SIGUIENTE MAS IMPORTANTE DETERMINA CUAL DE LOS CUATRO PUNTOS ES UTILIZADO DENTRO DEL SUBCONJUNTO. ESTE SISTEMA DE CONFIGURACION PERMITE RECEPTORES DE CAPACIDADES DIFERENTES PARA DETECTAR TANTOS DATOS COMO SEAN CAPACES, O UN SIMPLE RECEPTOR PARA DETECTAR TANTOS DATOS COMO PERMITA LA CALIDAD DEL CANAL. POR EJEMPLO, UN RECEPTOR QPSK PUEDE DETECTAR LOS DATOS MAS IMPORTANTES,...

  20. 244.-

    PROCEDIMIENTO DE GOBIERNO DE LA DEPOSICION DE MECHAS POR ENROLLAMIENTO O EN CONTACTO SOBRE ESTRUCTURAS DE GRANDES DIMENSIONES Y MAQUINA PARA LA PUESTA EN MARCHA DEL PROCEDIMIENTO.

    (01/2005)

    LA INVENCION SE REFIERE A UN PROCEDIMIENTO DE CONTROL DE INSTALACION DE BROCAS POR ENROLLAMIENTO O POR CONTACTO EN ESTRUCTURAS DE GRANDES DIMENSIONES Y A UNA MAQUINA PARA SU PUESTA EN PRACTICA. EL PROCEDIMIENTO EN EL QUE SE EFECTUA LA INSTALACION EN UN MANDRIL ARRASTRADO EN ROTACION ALREDEDOR DE SU EJE ( ZE ), MEDIANTE UNA CABEZA DE INSTALACION APROPIADA, AJUSTABLE EN POSICION SEGUN AL MENOS UN PRIMER EJE DE DESPLAZAMIENTO RECTILINEO (X) PARALELO AL EJE DE ROTACION ( ZE ) DEL MANDRIL Y UN SEGUNDO EJE DE DESPLAZAMIENTO RECTILINEO (Y) ORTOGONAL A DICHO EJE DEL MANDRIL, SE CARACTERIZA PORQUE CONSISTE EN: TOMAR COMO EJE MAESTRO EL EJE DE ROTACION ( ZE ) DEL MANDRIL Y SOMETER LOS OTROS EJES (X, Y, BE , GA , 8, 9) A DICHO EJE MAESTRO, EN CONTROLAR EL EJE MAESTRO...

  21. 245.-

    PAR DE RIELES PARA ASIENTO DE VEHICULO.

    (01/2005)
    Ver ilustración. Solicitante/s: KEIPER GMBH & CO. KG. Inventor/es: MUHLBERGER, JOACHIM. Clasificación: B60N2/06.

    Par de rieles de guía para un asiento de vehículo, de modo especial para un asiento de vehículo automóvil, con un riel superior que puede montarse en el asiento del vehículo , y un riel inferior para soportar y guiar el riel superior , de modo que el riel inferior presenta tramos de fijación laterales (15’) para colocar en la estructura del vehículo, caracterizado por el hecho de que una primera zona correspondiente al riel inferior y una primera zona (28’) correspondiente al riel superior , así como una segunda zona correspondiente el riel inferior y una segunda zona (28´´) correspondiente al riel superior agarran recíprocamente entre sí, de modo que existe otra zona de agarre entre riel inferior y riel superior.

  22. 246.-

    PROTECCION MODULAR CON PIE EXCENTRICO.

    (01/2005)
    Ver ilustración. Solicitante/s: DALO, PIETRO. Inventor/es: DALO, PIETRO. Clasificación: E04H1/12.

    Protección modular que comporta por lo menos un elemento de techo y un sistema de sostenimiento que presenta un extremo superior y un extremo inferior que forma la base, caracterizada por el hecho de que: - el elemento de techo está constituido por un elemento de una sola pieza en forma que comporta, en la totalidad de su periferia, un canelón integrado; - dicho extremo superior del sistema de sostenimiento está situado sensiblemente en la vertical del centro del elemento de techo; - dicho extremo superior del sistema de sostenimiento comporta medios de unión con el elemento de techo que garantizan el mantenimiento del mismo a partir de su centro; - la base del sistema de sostenimiento está situada sensiblemente en la vertical (uu’) bajada hacia al suelo a partir de la periférica del elemento de techo.

  23. 247.-

    SISTEMA DE VIGILANCIA PARA SUPERVISAR EL TRAFICO EN LA PROXIMIDAD DE UNA SEÑAL DE TRAFICO VARIABLE.

    (01/2005)
    Ver ilustración. Solicitante/s: ROBOT VISUAL SYSTEMS GMBH. Inventor/es: BEHRENS, ANDREAS. Clasificación: G08G1/01.

    Sistema de vigilancia para supervisar el tráfico en las proximidades de señales de tráfico variables, en el que, en caso de conmutación de la señal de tráfico variable, es posible conmutar correspondientemente el parámetro del sistema de vigilancia, caracterizado por una cámara de vídeo que observa la señal de tráfico variable y medios de procesamiento de imagen para reconocer la indicación respectiva de la señal de tráfico variable , realizándose la conmutación del parámetro del sistema de vigilancia conforme a la indicación así reconocida.

  24. 248.-

    VOLQUETE BASCULANTE.

    (01/2005)
    Ver ilustración. Solicitante/s: VICTORIA ADMINISTRATION LIMITED. Inventor/es: DE KOCK, HUGO. Clasificación: B62D21/02, B60P1/28, B60P1/20.

    Dispositivo basculante para vehículos de carretera que comprende un chasis fijo , un volquete basculante y un sistema de inhalación de estructura en compás caracterizado porque: - el volquete basculante , es una estructura semicilíndrica autoportante - los extremos libres de la estructura en compás están solidarizados con pivotamiento, respectivamente al chasis y a la parte inferior del volquete , estando por lo menos un gato dispuesto entre las ramas de este compás, respectivamente cerca de la articulación del compás y de la parte inferior del volquete semicilíndrico , y ejerciendo sobre dicho volquete, durante la elevación, un esfuerzo en alargamiento.

  25. 249.-

    DISPOSITIVO PARA LA ALIMENTACION DE HOJAS DE CARTON.

    (01/2005)
    Ver ilustración. Solicitante/s: BOBST S.A.. Inventor/es: VALTERIO, ROBERTO, NAULA, VALERY. Clasificación: B65H3/04.

    Dispositivo de alimentación para una máquina que elabora hojas de cartón, que comprende al menos un órgano de transporte para el transporte de dichas hojas una a una, medios de arrastre del órgano de transporte, al menos un tope de retención de una pila (P) de dichas hojas por encima del citado órgano de transporte, al menos un órgano de levantamiento desplazable, alternativamente, entre dos posiciones límites, en una de las cuales se encuentra por encima del nivel superior de dicho órgano de transporte, y otra en la que está sensiblemente alineado con relación a éste nivel superior, caracterizado porque cada órgano de levantamiento está conectado con un puesto de accionamiento programable (T, C) con el fin de permitir el accionamiento individual de cada uno de dichos órganos de levantamiento.

  26. 250.-

    PROCEDIMIENTO E INSTALACION PARA LA CLARIFICACION DE LIQUIDOS Y SUSPENSIONES POR FLOCULACION LASTRADA Y DECANTACION.

    (01/2005)

    Procedimiento de clarificación de líquidos y suspensiones en particular de las aguas residuales urbanas o industriales, potables, de procedimientos o residuales, que utilizan la técnica de floculación lastrada con una etapa de inyección en el líquido a clarificar, pretratado o no con una masa de contacto o lastre, constituida por un material granular, tal como particularmente arena, y un polímero, seguida de una etapa de floculación que lleva la formación de un copo lastrado y una etapa de decantación acelerada, recirculándose el indicado lastre en la etapa de floculación, bien sea tal cual, o después de la limpieza, según un primer régimen de recirculación que asegura la extracción del lastre contenido en el copo lastrado...

  27. 251.-

    METODO Y APARATO PARA FORMAR ESTRUCTURAS DE SUJETADOR MECANICO CON VASTAGOS DOTADOS DE CABEZAS.

    (01/2005)

    Un método de formar un sujetador mecánico con vástagos dotados de cabezas que tiene una banda de respaldo y una agrupación de elementos de gancho erectos con partes de base de vástago erectas y cabezas de gancho con partes para aplicación con las fibras que sobresalen hacia abajo, que comprende: a) proporcionar una banda que tiene un respaldo de banda con una agrupación de salientes de elementos de gancho de termoplástico, sustancial mente erectos formados, cada uno de ellos al menos en parte por una parte de base de vástago sustancialmente erecta y una parte de cabeza de gancho que tiene una parte para aplicación con las fibras que se extiende hacia fuera desde la parte de base de vástago, teniendo la banda un...

  28. 252.-

    LAVAVAJILLAS EN EL QUE EL CONTROL DE HUMEDAD SE REALIZA MEDIANTE UN SENSOR DE TEMPERATURA.

    (01/2005)
    Ver ilustración. Solicitante/s: ARCELIK A.S.. Inventor/es: PASIN, MERIH. Clasificación: A47L15/48.

    Lavavajillas en el que el secado se realiza descargado el aire dentro de una cuba cerrada del lavavajillas, por medio de una disposición que elimina el aire, teniendo dicha cuba una abertura de entrada del aire y una abertura de descarga de aire y conteniendo objetos para su secado que tienen una capacidad térmica relativamente elevada tal como platos, etc., caracterizado porque el funcionamiento de la disposición que elimina el aire está controlado midiendo los cambios en la temperatura del aire descargado mediante un sensor de temperatura durante el cual se utiliza como indicación el descenso brusco seguido de un repentino aumento para completar el ciclo de secado, a través del cual se controla la humedad del contenido del lavavajillas.

  29. 253.-

    CARCASA PARA COMPRESOR.

    (01/2005)
    Ver ilustración. Solicitante/s: SCRIVENER, RHYS PARKER, RONALD BRIAN. Inventor/es: SCRIVENER, RHYS, PARKER, RONALD BRIAN. Clasificación: F04B39/00.

    Aparato de reducción de ruido con una base, sobre la que están colocadas una carcasa exterior y una carcasa interior , que incluye una cámara interior para albergar una unidad de compresor y/ o condensador; en el que la carcasa exterior incluye un panel frontal 15 y paneles laterales que están unidas con el panel frontal por enlaces herméticos, y el aparato está caracterizado porque la carcasa interior está apoyada en un miembro de apoyo , que incluye un túnel , por el que entra aire en el aparato, que llega directamente a una cámara interior , y desde allí a la carcasa interior. El panel frontal de la carcasa interior tiene una salida de aire por la que el aire puede salir de la carcasa interior y entrar en un canal con forma de “U” , que está situado entre las piezas de paneles frontal y laterales de las carcasas interior y exterior, y salidas de aire por las que el aire gastado puede salir del aparato.

  30. 254.-

    COMPOSICION DE TINTA ACUOSA PARA IMPRESORA DE CHORRO DE TINTA.

    (01/2005)
    Solicitante/s: 3M INNOVATIVE PROPERTIES COMPANY. Inventor/es: SAITO, KOJI. Clasificación: C09D11/00.

    – Una composición de tinta acuosa para una impresora de chorro de tinta, que comprende (a) una resina dispersante del pigmento soluble en agua, (b) un pigmento, (c) un disolvente acuoso y (d) un humectante, en la cual la resina dispersante del pigmento soluble en agua (a) es una resina de tipo estireno–ácido (met)acrílico, y el humectante (d) contiene poli(óxido de etileno) sulfonado.

  31. 255.-

    PROCEDIMIENTO Y DISPOSITIVO DE BUSQUEDA PARA BASE DE DATOS ELECTRONICA PARA EXPLORAR EL CONTENIDO DE UNA BASE DE DATOS ELECTRONICA.

    (01/2005)

    Dispositivo de búsqueda para base de datos electrónica que comprende un dispositivo electrónico de memoria adecuado para almacenar y recuperar elementos de la base de datos, una unidad de visualización, una interfaz de usuario para seleccionar y visualizar al menos un elemento de la base de datos en la unidad de visualización, y medios de control para controlar la interfaz de usuario, asignando la interfaz de usuario iconos a elementos de la base de datos, siendo los iconos adecuados para visualizarse en la unidad de visualización a distancias entre sí que dependen del grado de disimilitud de los elementos, en el cual la interfaz de usuario...

  32. 256.-

    PIGMENTOS CON TRATAMIENTO ULTERIOR ORGANICO PARA SISTEMAS DE LAQUEADO.

    (01/2005)
    Solicitante/s: KRONOS TITAN GMBH & CO. OHG. Inventor/es: ORTH-GERBER, JURGEN, ELFENTHAL, LOTHAR, BLIMEL, SIEGFRIED. Clasificación: C09C1/00, C09C3/08, C09C1/36.

    Procedimiento para preparar partículas de pigmentos fácilmente dispersables y humectables, en el cual se muelen partículas primarias en un molino a chorro, adicionando una sustancia orgánica / una mezcla de sustancias orgánicas (sustancia orgánica I) como agente auxiliar de molienda, caracterizado porque después de la molienda a chorro se aplica una sustancia orgánica I / una mezcla de sustancias orgánicas (sustancia orgánica II) sobre las partículas de pigmento, en donde la sustancia orgánica II es un compuesto anfifílico y presenta un valor de HLB entre 10 y 18.

<< · 4 · 6 · < · 8 · > · 11 · 15 · >>