22 patentes, modelos y diseños de ACADEMISCH ZIEKENHUIS LEIDEN

Péptidos largos de 22-45 residuos de aminoácidos que inducen y/o mejoran las respuestas inmunológicas específicas para antígenos.

Secciones de la CIP Necesidades corrientes de la vida Física Química y metalurgia

(27/02/2019). Inventor/es: OFFRINGA, RIENK, VAN DER BURG, SJOERD, HENRICUS, MELIEF,CORNELIS,JOHANNES,MARIA, TOES,RENE EVERARDUS MARIA, OTTENHOF,TOM HENRICUS MARIA, GELUK,ANNEMIEKE, SCHOENMAEKERS-WELTERS,MARIA JOHANNA PHILOMENA, DE JONG,ANNEMIEKE M. Clasificación: A61K39/00, G01N33/53, A61K39/12, C12Q1/02, A61K38/17, A61K39/39, A61K35/14, A61P31/12, C12N5/06, G01N33/48, A61P31/04, A61K39/04, C12P21/02, C07K14/025, A61K39/23, A61K38/095.

Uso de un peptido que consiste en una secuencia de aminoacido, que cubre la region de la posicion de aminoacidos 127-158 de la proteina E6 de VPH16 para la fabricacion de un medicamento para inducir o aumentar una respuesta de la celula T especifica del VPH16 en un animal o un humano para la prevencion o tratamiento de una enfermedad relacionada con el VPH16.

PDF original: ES-2724121_T3.pdf

Un montaje de cabezal de herramienta y aparato asociado.

Secciones de la CIP Necesidades corrientes de la vida Técnicas industriales diversas y transportes

(14/01/2019). Ver ilustración. Inventor/es: DIJKSTRA,PIETER DURK SANDER, BAKKENES,PIETER, BLOK,JESSE PIETER. Clasificación: A61B17/00, A61B17/16, A61B17/14, B23D53/12.

Un montaje de cabezal de herramienta para una herramienta de mano, que comprende: un cuerpo (201, 301a, 301b) para sujetarlo a la herramienta de mano; una banda de corte continuo que tiene un borde de corte para cortar en un sujeto; al menos un miembro de tensión acoplado al cuerpo y configurado para mantener la banda de corte bajo tensión; al menos un miembro de accionamiento acoplado al cuerpo y configurado para girar la banda de corte con respecto al cuerpo; y un montaje de guía para engancharse de manera retráctil con el sujeto y mantener una relación lateral fija entre la banda de corte y el sujeto.

PDF original: ES-2696234_T3.pdf

Métodos y medios para el salto eficaz de al menos uno de los siguientes exones del gen de distrofia muscular de Duchenne humana: 43, 46, 50-53.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(05/12/2018). Inventor/es: VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA, DE KIMPE,Josephus Johannes, PLATENBURG,Gerardus Johannes, AARTSMA-RUS,ANNEMIEKE. Clasificación: A61K48/00, C12N5/10, A61P21/00, A61K31/7105.

Oligonucleótido antisentido, donde dicho oligonucleótido antisentido comprende o consiste en la secuencia de nucleótidos antisentido SEQ ID N.º: 287.

PDF original: ES-2692886_T3.pdf

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(19/11/2018). Inventor/es: DEN DUNNEN, JOHANNES, THEODORUS, VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, C12N15/11, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un método in vitro para determinar si un oligonucleótido antisentido de 14-40 nucleótidos que comprende complementariedad a una parte de un exón 51 de distrofia humana es capaz de inhibir específicamente una secuencia de reconocimiento de exón de dicho exón, comprendiendo: Proporcionar una célula que tiene un pre-ARNm que contiene dicho exón con dicho olinogucleótido antisentido, Cultivar dicha célula para permitir la formación de un ARNm a partir de dicho pre-ARNm y Determinar si dicho exón está ausente de dicho ARNm.

PDF original: ES-2690049_T3.pdf

Intervención terapéutica en una enfermedad genética en un individuo mediante la modificación de la expresión de un gen expresado de forma aberrante o anormal.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(29/11/2017). Inventor/es: DEN DUNNEN, JOHANNES, THEODORUS, VAN OMMEN,GARRIT-JAN BOUDEWIJN, 'T HOEN,PETER ABRAHAM CHRISTIAAN, STERRENBERG,PETRONELLA JOHANNA ELISABETH. Clasificación: A61K38/18, C12N15/113, C12N5/077.

Uso de un compuesto para reducir, inhibir y/o antagonizar la expresión de proteína morfogenética ósea 4 (BMP4) en una célula, para la producción de un medicamento para el alivio de un síntoma de una distrofia muscular genética en un individuo, donde dicha distrofia muscular genética es la distrofia muscular de Duchenne (DMD) o la distrofia muscular de Becker (DMB), y donde dicho compuesto comprende un ARN antisentido de BMP-4.

PDF original: ES-2657502_T3.pdf

Método para el salto eficaz del exón (44) en la distrofia muscular de Duchenne y medios asociados.

Secciones de la CIP Química y metalurgia Necesidades corrientes de la vida

(15/11/2017). Inventor/es: PLATENBURG,GERARD JOHANNES, VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA, DE KIMPE,Josephus Johannes, AARTSMA-RUS,ANNEMIEKE. Clasificación: C12N15/86, C12N15/11, A61K31/7088, C12N15/113.

Oligonucleótido antisentido que consiste en la secuencia de 5' ucagcuucuguuagccacug 3' (SEQ ID Nº: 5) donde al menos uno de los nucleótidos es un análogo de nucleótido.

PDF original: ES-2656904_T3.pdf

Medios y métodos para contrarrestar los trastornos musculares.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(28/06/2017). Inventor/es: VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA, DE KIMPE,Josephus Johannes, PLATENBURG,Gerardus Johannes, AARTSMA-RUS,ANNEMIEKE. Clasificación: A61K31/56, A61K38/17, A61P21/00, A61K31/57, C07J41/00, C07J1/00.

Combinación de: - un oligonucleótido antisentido que comprende una secuencia que es complementaria a una parte del exón 44 de pre-mRNA de distrofina humana y dicho oligonucleótido se representa por SEQ ID NO:10 o - un oligonucleótido antisentido que comprende una secuencia que es complementaria a una parte del exón 45 de pre-mRNA de distrofina humana y dicho oligonucleótido se representa por SEQ ID NO:60 y - un compuesto complementario para mejorar la función de fibra muscular, integridad y/o supervivencia de fibra muscular donde dicho compuesto complementario comprende una xantina, dicha combinación estando destinada para el uso como un medicamento, para el alivio de uno o más síntoma(s) de distrofia muscular de Duchenne o distrofia muscular de Becker en dicho individuo.

PDF original: ES-2639852_T3.pdf

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(19/04/2017). Inventor/es: DEN DUNNEN, JOHANNES, THEODORUS, VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA. Clasificación: A61K48/00, A61K31/7088, C12N15/113.

Un oligonucleótido antisentido dirigido frente al interior del exón 50 del pre-ARNm de distrofina lo que facilita el enmascaramiento del exón por el aparato de empalme y la exclusión del exón del ARNm final.

PDF original: ES-2628349_T3.pdf

Inducción de la omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(19/04/2017). Inventor/es: DEN DUNNEN, JOHANNES, THEODORUS, VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA. Clasificación: A61K31/7088, C12N15/113.

Un oligonucleótido antisentido de 14 a 40 nucleótidos que comprende una parte de hONA Nº 23: 5'- TGGCATTTCTAGTTTGG-3' (SEC ID NO: 18), siendo dicho oligonucleótido capaz de inducir la omisión del exón 51 del pre-ARNm de la distrofina en una célula, en donde dicho oligonucleótido es complementario con una parte del exón 51 y en el que dicho oligonucleótido es capaz de interferir específicamente con una secuencia de reconocimiento de exón en dicho exón.

PDF original: ES-2629747_T3.pdf

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(14/12/2016). Inventor/es: DEN DUNNEN, JOHANNES, THEODORUS, VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, C12N15/86, A01K67/027, A61K31/7088, A61K9/127, A61P21/04, C12N15/113.

Un oligonucleótido antisentido ARNmcapaz de inhibir una secuencia de reconocimiento exónico en el exón 51 del pre-ARNm de distrofina lo que facilita el enmascaramiento del exón por el aparato de empalme y la exclusión del exón del ARNm final, en donde el oligonucleótido es complementario a dicho exón o a parte del mismo, y tiene una longitud de 14-40 nucleótidos, en donde el oligonucleótido induce la omisión de dicho exón cuando dicho oligonucleótido antisentido está presente en una célula que tiene un pre-ARNm de distrofina que contiene dicho exón.

PDF original: ES-2609421_T3.pdf

Medios y método para la inducción del salto de exón.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(16/11/2016). Inventor/es: VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA, AARTSMA-RUS,ANNEMIEKE. Clasificación: A61K48/00, C12N15/11, A61K31/7088, A61K31/7115.

Primer oligonucleótido antisentido (AON) que puede hibridar una parte interna de exón de un exón a partir de un precursor del ARNm de distrofina y un segundo AON que puede hibridar otra parte interna de exón de dicho exón para usar en el tratamiento DMD, donde la eficiencia con la cual dicho exón es excluido de un ARNm maduro se aumenta proporcionando dicho segundo AON, donde dicho exón de distrofina es el exón 45.

PDF original: ES-2614980_T3.pdf

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(09/11/2016). Inventor/es: DEN DUNNEN, JOHANNES, THEODORUS, VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 2 del pre-ARNm de distrofina humana que facilita el enmascaramiento de dicho exón por el aparato de empalme y la exclusión de dicho exón del ARNm final.

PDF original: ES-2610568_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(27/04/2016). Inventor/es: DEN DUNNEN, JOHANNES, THEODORUS, VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA. Clasificación: A61K48/00, A61K31/7088, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 44 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final, en donde dicho antisentido no es un ADN o un ADN fosforotioato que consiste en la secuencia nucleótida GCACTTTGCAATGCTGCTGTCTTCTTGCTTAT descrita como SEQ ID NO:3 en el documento de patente EP 1 160 318 o un ADN o un ADN fosforotioatoque consiste en una secuencia nucleótida complementaria a la secuencia nucleótida AGCAAGAAGACAGCAGCAUUGCAAAG descrita como SEQ ID NO:1 en el documento de patente EP 1 160 318.

PDF original: ES-2581285_T3.pdf

Inducción de las omisiones de exón en las células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(02/03/2016). Ver ilustración. Inventor/es: DEN DUNNEN, JOHANNES, THEODORUS, VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 53 de pre-mARN de distrofina humana, que facilita el enmascarado de dicho exón para el aparato de empalme y la exclusión de ducho exón de mARN final.

PDF original: ES-2567417_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(30/12/2015). Ver ilustración. Inventor/es: DEN DUNNEN, JOHANNES, THEODORUS, VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 44 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final.

PDF original: ES-2561292_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(30/12/2015). Ver ilustración. Inventor/es: DEN DUNNEN, JOHANNES, THEODORUS, VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 45 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final.

PDF original: ES-2561293_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(30/12/2015). Ver ilustración. Inventor/es: DEN DUNNEN, JOHANNES, THEODORUS, VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 52 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final.

PDF original: ES-2561294_T3.pdf

Medios y métodos para contrarrestar trastornos del músculo.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(23/12/2015). Ver ilustración. Inventor/es: VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA, DE KIMPE,Josephus Johannes, PLATENBURG,Gerardus Johannes, AARTSMA-RUS,ANNEMIEKE. Clasificación: A61K31/56, A61K38/17, A61P21/00, A61K31/57, C07J41/00, C07J1/00.

Combinación de: - un oligonucleótido antisentido que comprende una secuencia que es complementaria a una parte de exón 51 de pre-ARNm de distrofina humana y dicho oligonucleótido se representa por SEC ID n.º: 204 y - un compuesto complementario para reducir la inflamación, donde este compuesto comprende un esteroide, donde dicha combinación es para su uso como un medicamento, para aliviar uno o varios síntomas de distrofia muscular de Duchenne en dicho individuo.

PDF original: ES-2564563_T3.pdf

Péptidos largos de 22-45 residuos de aminoácidos que inducen y/o mejoran las respuestas inmunológicas específicas para antígenos.

(23/07/2014) Uso de un péptido que consiste en las posiciones de aminoácido 43 - 77 de E7 del VPH, para la fabricación de un medicamento para inducir o mejorar una respuesta de las células T específica del VPH en un animal o un humano para la prevención o tratamiento de una enfermedad relacionada con el VPH.

Modulación de identificación de exones en pre-ARNm por interferencia con la estructura secundaria del ARN.

(18/12/2013) Método para generar un oligonucleótido que comprende determinar, de una estructura secundaria de ARN de unexón, una región que se hibrida con otra parte de dicho ARN (estructura cerrada) y una región que no se hibrida endicha estructura (estructura abierta), y posteriormente generar un oligonucleótido, del cual al menos tres nucleótidosconsecutivos de dicho oligonucleótido son complementarios a dicha estructura cerrada y del cual al menos otros tresnucleótidos consecutivos de dicho oligonucleótido son complementarios a dicha estructura abierta y donde el gen dedicho ARN que comprende dicho exón es transcrito,…

INHIBIDORES DE PEPTIDOS DE TOXINAS DERIVADOS DE LL-37.

Secciones de la CIP Química y metalurgia Necesidades corrientes de la vida

(16/11/2009). Inventor/es: DRIJFHOUT, JAN, WOUTER, GROTE,JOHANNES,JAKOBUS. Clasificación: C07K14/47A14, A61K48/00, C12N15/12, C07K14/47, A61K38/17, A61P31/04.

Compuesto peptídico con afinidad por toxinas bacterianas y fúngicas, y especialmente por lipopolisacáridos (LPS) o ácido lipoteicoico (LTA), comprendiendo dicho compuesto la secuencia de aminoácidos IGKEFKRIVE RIKRFLRELVRPLR, facultativamente acetilado en el extremo N y amidado en el extremo C.

INDUCCION DE LA OMISION DE EXON EN CELULAS EUCARIOTICAS.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(01/04/2009). Ver ilustración. Inventor/es: VAN OMMEN,GARRIT-JAN BOUDEWIJN, VAN DEUTEKOM,JUDITH CHRISTINA THEODORA, DEN DUNNEN,JOHANNES THEODORA. Clasificación: A61K48/00, C12N15/11, A61K31/7088.

El uso de un oligonucleótido antisentido dirigido contra el interior del exón 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 ó 53 en un pre-mARN de distrofina, en el que dicho oligonucleótido antisentido es capaz de inhibir expresamente una señal de inclusión de exón en dicho exón y contiene entre 14-40 nucleótidos, para la preparación de un medicamento para dirigir el empalme de dicho pre-mARN de distrofina en una célula capaz de realizar una operación de empalme.

 

Patentes más consultadas

 

Clasificación Internacional de Patentes 2015