14 inventos, patentes y modelos de DEN DUNNEN, JOHANNES, THEODORUS

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(19/11/2018). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, C12N15/11, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un método in vitro para determinar si un oligonucleótido antisentido de 14-40 nucleótidos que comprende complementariedad a una parte de un exón 51 de distrofia humana es capaz de inhibir específicamente una secuencia de reconocimiento de exón de dicho exón, comprendiendo: Proporcionar una célula que tiene un pre-ARNm que contiene dicho exón con dicho olinogucleótido antisentido, Cultivar dicha célula para permitir la formación de un ARNm a partir de dicho pre-ARNm y Determinar si dicho exón está ausente de dicho ARNm.

PDF original: ES-2690049_T3.pdf

Intervención terapéutica en una enfermedad genética en un individuo mediante la modificación de la expresión de un gen expresado de forma aberrante o anormal.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(29/11/2017). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K38/18, C12N15/113, C12N5/077.

Uso de un compuesto para reducir, inhibir y/o antagonizar la expresión de proteína morfogenética ósea 4 (BMP4) en una célula, para la producción de un medicamento para el alivio de un síntoma de una distrofia muscular genética en un individuo, donde dicha distrofia muscular genética es la distrofia muscular de Duchenne (DMD) o la distrofia muscular de Becker (DMB), y donde dicho compuesto comprende un ARN antisentido de BMP-4.

PDF original: ES-2657502_T3.pdf

Inducción de la omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(19/04/2017). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K31/7088, C12N15/113.

Un oligonucleótido antisentido de 14 a 40 nucleótidos que comprende una parte de hONA Nº 23: 5'- TGGCATTTCTAGTTTGG-3' (SEC ID NO: 18), siendo dicho oligonucleótido capaz de inducir la omisión del exón 51 del pre-ARNm de la distrofina en una célula, en donde dicho oligonucleótido es complementario con una parte del exón 51 y en el que dicho oligonucleótido es capaz de interferir específicamente con una secuencia de reconocimiento de exón en dicho exón.

PDF original: ES-2629747_T3.pdf

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(19/04/2017). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, A61K31/7088, C12N15/113.

Un oligonucleótido antisentido dirigido frente al interior del exón 50 del pre-ARNm de distrofina lo que facilita el enmascaramiento del exón por el aparato de empalme y la exclusión del exón del ARNm final.

PDF original: ES-2628349_T3.pdf

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(14/12/2016). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, C12N15/86, A01K67/027, A61K31/7088, A61K9/127, A61P21/04, C12N15/113.

Un oligonucleótido antisentido ARNmcapaz de inhibir una secuencia de reconocimiento exónico en el exón 51 del pre-ARNm de distrofina lo que facilita el enmascaramiento del exón por el aparato de empalme y la exclusión del exón del ARNm final, en donde el oligonucleótido es complementario a dicho exón o a parte del mismo, y tiene una longitud de 14-40 nucleótidos, en donde el oligonucleótido induce la omisión de dicho exón cuando dicho oligonucleótido antisentido está presente en una célula que tiene un pre-ARNm de distrofina que contiene dicho exón.

PDF original: ES-2609421_T3.pdf

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(09/11/2016). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 2 del pre-ARNm de distrofina humana que facilita el enmascaramiento de dicho exón por el aparato de empalme y la exclusión de dicho exón del ARNm final.

PDF original: ES-2610568_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(27/04/2016). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, A61K31/7088, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 44 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final, en donde dicho antisentido no es un ADN o un ADN fosforotioato que consiste en la secuencia nucleótida GCACTTTGCAATGCTGCTGTCTTCTTGCTTAT descrita como SEQ ID NO:3 en el documento de patente EP 1 160 318 o un ADN o un ADN fosforotioatoque consiste en una secuencia nucleótida complementaria a la secuencia nucleótida AGCAAGAAGACAGCAGCAUUGCAAAG descrita como SEQ ID NO:1 en el documento de patente EP 1 160 318.

PDF original: ES-2581285_T3.pdf

Inducción de las omisiones de exón en las células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(02/03/2016). Ver ilustración. Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 53 de pre-mARN de distrofina humana, que facilita el enmascarado de dicho exón para el aparato de empalme y la exclusión de ducho exón de mARN final.

PDF original: ES-2567417_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(30/12/2015). Ver ilustración. Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 52 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final.

PDF original: ES-2561294_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(30/12/2015). Ver ilustración. Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 45 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final.

PDF original: ES-2561293_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(30/12/2015). Ver ilustración. Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 44 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final.

PDF original: ES-2561292_T3.pdf

Modulación de identificación de exones en pre-ARNm por interferencia con la estructura secundaria del ARN.

(18/12/2013) Método para generar un oligonucleótido que comprende determinar, de una estructura secundaria de ARN de unexón, una región que se hibrida con otra parte de dicho ARN (estructura cerrada) y una región que no se hibrida endicha estructura (estructura abierta), y posteriormente generar un oligonucleótido, del cual al menos tres nucleótidosconsecutivos de dicho oligonucleótido son complementarios a dicha estructura cerrada y del cual al menos otros tresnucleótidos consecutivos de dicho oligonucleótido son complementarios a dicha estructura abierta y donde el gen dedicho ARN que comprende dicho exón es transcrito,…

MÉTODO PARA LA DETERMINACIÓN DEL GENOTIPO DE ANTÍGENOS DE CÉLULAS DE LA SANGRE Y KIT ADECUADO PARA LA DETERMINACIÓN DEL GENOTIPO DE ANTÍGENOS DE CÉLULAS DE LA SANGRE.

(24/02/2011) Método de determinación del genotipo de antígenos de células de la sangre que comprende someter al ADN de un individuo de una especie de mamífero a una Reacción en Cadena de la Polimerasa (PCR) múltiple para amplificar y marcar de forma detectable una región del locus de, como mínimo, dos antígenos diferentes de células de la sangre que contiene el sitio de polimorfismo de nucleótido de dicho antígeno de células de la sangre y utilizar los fragmentos de ADN amplificados y marcados de esta manera para determinar el genotipo de cada uno de dichos antígenos de células de la sangre, comprendiendo dicha PCR múltiple el uso de, como mínimo,…

APARATO PARA EL TRATAMIENTO DE BIOPOLIMEROS SENSIBLES A LA LUZ.

Sección de la CIP Técnicas industriales diversas y transportes

(01/12/2005). Ver ilustración. Solicitante/s: FLEXGEN TECHNOLOGIES B.V. Clasificación: B01J19/00.

Aparato para el tratamiento de biopolímeros sensibles a la luz, que comprende como mínimo una fuente de luz, una cámara de proceso adecuada para recibir un sustrato sobre el que se colocan los biopolímeros para tratamiento con luz desde la fuente de luz, y un elemento de distribución para dirigir la luz desde la fuente de luz a lugares seleccionados del sustrato, caracterizado porque el elemento de distribución comprende como mínimo un espejo accionado por motor, estando montado el espejo sobre una bobina rotativa dispuesta entre polos del dispositivo que genera un campo magnético, y porque el elemento de distribución tiene una fuente ajustable de electricidad conectada con la bobina para controlar la orientación del espejo.

 

Patentes más consultadas

 

Clasificación Internacional de Patentes 2015