23 inventos, patentes y modelos de VAN DEUTEKOM,JUDITH CHRISTINA THEODORA

Métodos y medios para el salto eficaz de al menos uno de los siguientes exones del gen de distrofia muscular de Duchenne humana: 43, 46, 50-53.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(05/12/2018). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N5/10, A61P21/00, A61K31/7105.

Oligonucleótido antisentido, donde dicho oligonucleótido antisentido comprende o consiste en la secuencia de nucleótidos antisentido SEQ ID N.º: 287.

PDF original: ES-2692886_T3.pdf

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(19/11/2018). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, C12N15/11, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un método in vitro para determinar si un oligonucleótido antisentido de 14-40 nucleótidos que comprende complementariedad a una parte de un exón 51 de distrofia humana es capaz de inhibir específicamente una secuencia de reconocimiento de exón de dicho exón, comprendiendo: Proporcionar una célula que tiene un pre-ARNm que contiene dicho exón con dicho olinogucleótido antisentido, Cultivar dicha célula para permitir la formación de un ARNm a partir de dicho pre-ARNm y Determinar si dicho exón está ausente de dicho ARNm.

PDF original: ES-2690049_T3.pdf

Método para el salto eficaz del exón (44) en la distrofia muscular de Duchenne y medios asociados.

Secciones de la CIP Química y metalurgia Necesidades corrientes de la vida

(15/11/2017). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: C12N15/86, C12N15/11, A61K31/7088, C12N15/113.

Oligonucleótido antisentido que consiste en la secuencia de 5' ucagcuucuguuagccacug 3' (SEQ ID Nº: 5) donde al menos uno de los nucleótidos es un análogo de nucleótido.

PDF original: ES-2656904_T3.pdf

Medios y métodos para contrarrestar los trastornos musculares.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(28/06/2017). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K31/56, A61K38/17, A61P21/00, A61K31/57, C07J41/00, C07J1/00.

Combinación de: - un oligonucleótido antisentido que comprende una secuencia que es complementaria a una parte del exón 44 de pre-mRNA de distrofina humana y dicho oligonucleótido se representa por SEQ ID NO:10 o - un oligonucleótido antisentido que comprende una secuencia que es complementaria a una parte del exón 45 de pre-mRNA de distrofina humana y dicho oligonucleótido se representa por SEQ ID NO:60 y - un compuesto complementario para mejorar la función de fibra muscular, integridad y/o supervivencia de fibra muscular donde dicho compuesto complementario comprende una xantina, dicha combinación estando destinada para el uso como un medicamento, para el alivio de uno o más síntoma(s) de distrofia muscular de Duchenne o distrofia muscular de Becker en dicho individuo.

PDF original: ES-2639852_T3.pdf

Inducción de la omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(19/04/2017). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K31/7088, C12N15/113.

Un oligonucleótido antisentido de 14 a 40 nucleótidos que comprende una parte de hONA Nº 23: 5'- TGGCATTTCTAGTTTGG-3' (SEC ID NO: 18), siendo dicho oligonucleótido capaz de inducir la omisión del exón 51 del pre-ARNm de la distrofina en una célula, en donde dicho oligonucleótido es complementario con una parte del exón 51 y en el que dicho oligonucleótido es capaz de interferir específicamente con una secuencia de reconocimiento de exón en dicho exón.

PDF original: ES-2629747_T3.pdf

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(19/04/2017). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, A61K31/7088, C12N15/113.

Un oligonucleótido antisentido dirigido frente al interior del exón 50 del pre-ARNm de distrofina lo que facilita el enmascaramiento del exón por el aparato de empalme y la exclusión del exón del ARNm final.

PDF original: ES-2628349_T3.pdf

Molécula para tratar un trastorno inflamatorio.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(14/12/2016). Solicitante/s: BioMarin Technologies B.V. Clasificación: A61P29/00, A61K31/712, A61K31/7115, C12N15/113.

Oligonucleótido que es capaz de alterar el empalme de un pre-ARNm que codifica un IL-1RAcP para aumentar la cantidad de un IL-1RAcP soluble donde dicho oligonucleótido es capaz de inducir el salto del exón que codifica el dominio de transmembrana de IL-1RAcP y no interrumpe el marco de lectura abierto de IL-1RAcP, donde dicho oligonucleótido comprende o consiste en una secuencia que es complementaria de una extensión contigua de al menos 8 nucleótidos de SEQ ID NO: 5, 64 o 65.

PDF original: ES-2616561_T3.pdf

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(14/12/2016). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, C12N15/86, A01K67/027, A61K31/7088, A61K9/127, A61P21/04, C12N15/113.

Un oligonucleótido antisentido ARNmcapaz de inhibir una secuencia de reconocimiento exónico en el exón 51 del pre-ARNm de distrofina lo que facilita el enmascaramiento del exón por el aparato de empalme y la exclusión del exón del ARNm final, en donde el oligonucleótido es complementario a dicho exón o a parte del mismo, y tiene una longitud de 14-40 nucleótidos, en donde el oligonucleótido induce la omisión de dicho exón cuando dicho oligonucleótido antisentido está presente en una célula que tiene un pre-ARNm de distrofina que contiene dicho exón.

PDF original: ES-2609421_T3.pdf

Medios y método para la inducción del salto de exón.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(16/11/2016). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/11, A61K31/7088, A61K31/7115.

Primer oligonucleótido antisentido (AON) que puede hibridar una parte interna de exón de un exón a partir de un precursor del ARNm de distrofina y un segundo AON que puede hibridar otra parte interna de exón de dicho exón para usar en el tratamiento DMD, donde la eficiencia con la cual dicho exón es excluido de un ARNm maduro se aumenta proporcionando dicho segundo AON, donde dicho exón de distrofina es el exón 45.

PDF original: ES-2614980_T3.pdf

Inducción de omisión de exones en células eucarióticas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(09/11/2016). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 2 del pre-ARNm de distrofina humana que facilita el enmascaramiento de dicho exón por el aparato de empalme y la exclusión de dicho exón del ARNm final.

PDF original: ES-2610568_T3.pdf

Oligonucleótido que comprende una inosina para tratar la DMD.

Sección de la CIP Química y metalurgia

(06/07/2016). Solicitante/s: BioMarin Technologies B.V. Clasificación: C12N15/11, C12N15/113.

Oligonucleótido antisentido que comprende al menos una inosina, donde el oligonucleótido comprende una secuencia dirigida al menos a parte de una parte de un exón de pre-ARNm de distrofina que es una extensión contigua que comprende al menos 13 nucleótidos y donde el oligonucleótido antisentido es capaz de realizar saltos de exón.

PDF original: ES-2593836_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(27/04/2016). Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, A61K31/7088, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 44 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final, en donde dicho antisentido no es un ADN o un ADN fosforotioato que consiste en la secuencia nucleótida GCACTTTGCAATGCTGCTGTCTTCTTGCTTAT descrita como SEQ ID NO:3 en el documento de patente EP 1 160 318 o un ADN o un ADN fosforotioatoque consiste en una secuencia nucleótida complementaria a la secuencia nucleótida AGCAAGAAGACAGCAGCAUUGCAAAG descrita como SEQ ID NO:1 en el documento de patente EP 1 160 318.

PDF original: ES-2581285_T3.pdf

Moléculas para direccionar compuestos a varios órganos o tejidos seleccionados.

Sección de la CIP Necesidades corrientes de la vida

(20/04/2016). Solicitante/s: BioMarin Technologies B.V. Clasificación: A61K47/48, A61P21/00, A61P19/00, A61P5/00.

Conjugado de un péptido o péptido mimético que comprende o consiste en la secuencia LGAQSNF (SEC ID n.º: 100) enlazada a una fracción seleccionada de una fracción biológicamente activa y una fracción de diagnóstico.

PDF original: ES-2577712_T3.pdf

Inducción de las omisiones de exón en las células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(02/03/2016). Ver ilustración. Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 53 de pre-mARN de distrofina humana, que facilita el enmascarado de dicho exón para el aparato de empalme y la exclusión de ducho exón de mARN final.

PDF original: ES-2567417_T3.pdf

Procedimientos y medios para el salto eficiente del exón 45 en el pre-ARNm de la distrofia muscular de Duchenne.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(06/01/2016). Ver ilustración. Solicitante/s: BioMarin Technologies B.V. Clasificación: A61K31/7105, C12N15/113.

Un oligonucleótido antisentido, por el que dicho oligonucleótido antisentido es capaz de unirse a un tramo de al menos 21 nucleótidos dentro de la siguiente secuencia de nucleótidos dentro del exón 45 del pre-ARNm de distrofina:**Fórmula** y en el que dicho oligonucleótido tiene una longitud de al menos 21 nucleótidos y en el que dicho oligonucleótido antisentido no consiste en 5'-AACAGTTTGCCGCTGCCAATGCCA-3', 5'-CTGACAACAGTTTGCCGCTGCCCAA-3', 5'-GTTGCATTCAATGTTCTGACAACAG-3', 5'-GCTGAATTATTTCTTCCCCAGTTGC-3' o 5'-ATTATTTCTTCCCCAGTTGCATTCA-3'.

PDF original: ES-2562658_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(30/12/2015). Ver ilustración. Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 52 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final.

PDF original: ES-2561294_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(30/12/2015). Ver ilustración. Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 45 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final.

PDF original: ES-2561293_T3.pdf

Inducción de la omisión de exón en células eucariotas.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(30/12/2015). Ver ilustración. Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/09, A61K45/00, C12Q1/68, A01K67/027, A61K31/7088, A61P21/04, C12N15/113.

Un oligonucleótido antisentido dirigido contra el interior del exón 44 del pre-ARNm de distrofina humana, que facilita la ocultación de dicho exón del aparato de corte y empalme, y la exclusión de dicho exón del ARNm final.

PDF original: ES-2561292_T3.pdf

Medios y métodos para contrarrestar trastornos del músculo.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(23/12/2015). Ver ilustración. Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K31/56, A61K38/17, A61P21/00, A61K31/57, C07J41/00, C07J1/00.

Combinación de: - un oligonucleótido antisentido que comprende una secuencia que es complementaria a una parte de exón 51 de pre-ARNm de distrofina humana y dicho oligonucleótido se representa por SEC ID n.º: 204 y - un compuesto complementario para reducir la inflamación, donde este compuesto comprende un esteroide, donde dicha combinación es para su uso como un medicamento, para aliviar uno o varios síntomas de distrofia muscular de Duchenne en dicho individuo.

PDF original: ES-2564563_T3.pdf

Procedimiento para la eficiente omisión del exón (44) en distrofia muscular de Duchenne y medios asociados.

(16/11/2015) Un oligonucleótido antisentido que consiste en la secuencia de 5' ucagcuucuguuagccacug 3' (SEC ID Nº: 5).

Procedimientos y medios para el salto eficiente del exón 45 en el pre-ARNm de la distrofia muscular de Duchenne.

(24/12/2014) Un oligonucleótido antisentido que comprende la secuencia nucleotídica SEC ID N.º: 3.

Modulación de identificación de exones en pre-ARNm por interferencia con la estructura secundaria del ARN.

(18/12/2013) Método para generar un oligonucleótido que comprende determinar, de una estructura secundaria de ARN de unexón, una región que se hibrida con otra parte de dicho ARN (estructura cerrada) y una región que no se hibrida endicha estructura (estructura abierta), y posteriormente generar un oligonucleótido, del cual al menos tres nucleótidosconsecutivos de dicho oligonucleótido son complementarios a dicha estructura cerrada y del cual al menos otros tresnucleótidos consecutivos de dicho oligonucleótido son complementarios a dicha estructura abierta y donde el gen dedicho ARN que comprende dicho exón es transcrito,…


Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(01/04/2009). Ver ilustración. Solicitante/s: ACADEMISCH ZIEKENHUIS LEIDEN. Clasificación: A61K48/00, C12N15/11, A61K31/7088.

El uso de un oligonucleótido antisentido dirigido contra el interior del exón 2, 8, 29, 43, 44, 45, 46, 50, 51, 52 ó 53 en un pre-mARN de distrofina, en el que dicho oligonucleótido antisentido es capaz de inhibir expresamente una señal de inclusión de exón en dicho exón y contiene entre 14-40 nucleótidos, para la preparación de un medicamento para dirigir el empalme de dicho pre-mARN de distrofina en una célula capaz de realizar una operación de empalme.


Últimas patentes publicadas


Clasificación Internacional de Patentes 2015