Suministro eficaz de genes grandes por vectores de AAV duales.

Un sistema de construcción dual para expresar la secuencia codificadora de un gen de interés en una célula hospedante,

y dicha secuencia codificadora consiste en una porción del extremo 5' y una porción del extremo 3', y dicho sistema de construcción dual comprende:

a) un primer plásmido que comprende, en la dirección 5'-3':

- una secuencia de repetición terminal invertida 5' (5'-ITR) de AAV;

- una secuencia de promotor;

- la porción del extremo 5' de dicha secuencia codificadora, y dicha porción del extremo 5' está unida operablemente a dicho promotor y está bajo su control;

- una secuencia de ácido nucleico de una señal donante de ruptura; y

- una secuencia de repetición terminal invertida 3' (3'-ITR) de AAV; y

b) un segundo plásmido que comprende, en la dirección 5'-3':

- una secuencia de repetición terminal invertida 5' (5'-ITR) de AAV;

- una secuencia de ácido nucleico de una señal aceptora de ruptura;

- el extremo 3' de dicha secuencia codificadora;

- una secuencia de ácido nucleico de señal de poliadenilación; y

- una secuencia de repetición terminal invertida 3' (3'-ITR) de AAV,

en el que dicho primer plásmido comprende además una secuencia de ácido nucleico de una región recombinogénica en la posición 5' del 3'-ITR de AAV de dicho primer plásmido y en la posición 3' de la secuencia de ácido nucleico de la señal donante de ruptura, y en el que dicho segundo plásmido comprende además la secuencia de ácido nucleico de la región recombinogénica en la posición 3' del 5'-ITR de AAV de dicho segundo plásmido y en la posición 5' de la secuencia de ácido nucleico de la señal aceptora de ruptura, en el que la región recombinogénica es una región recombinogénica del fago F1 que consiste en la secuencia:

GGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAA T (SEQ ID NO:3), o uno de sus fragmentos que mantiene la propiedad recombinogénica de SEQ ID NO:3, en el que, tras la introducción de dicho primer plásmido y dicho segundo plásmido en la célula hospedante, dicha secuencia codificadora se reconstituye por medio de las señales donante de ruptura y aceptora de ruptura.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2014/058000.

Solicitante: Fondazione Telethon.

Nacionalidad solicitante: Italia.

Dirección: Via Varese 16B 00185 Roma ITALIA.

Inventor/es: AURICCHIO,ALBERTO, COLELLA,PASQUALINA, TRAPANI,IVANA.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • A61K48/00 SECCION A — NECESIDADES CORRIENTES DE LA VIDA.A61 CIENCIAS MEDICAS O VETERINARIAS; HIGIENE.A61K PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO (dispositivos o métodos especialmente concebidos para conferir a los productos farmacéuticos una forma física o de administración particular A61J 3/00; aspectos químicos o utilización de substancias químicas para, la desodorización del aire, la desinfección o la esterilización, vendas, apósitos, almohadillas absorbentes o de los artículos para su realización A61L;   composiciones a base de jabón C11D). › Preparaciones medicinales que contienen material genético que se introduce en las células del cuerpo vivo para tratar enfermedades genéticas; Terapia génica.
  • C07K14/705 SECCION C — QUIMICA; METALURGIA.C07 QUIMICA ORGANICA.C07K PEPTIDOS (péptidos que contienen β -anillos lactamas C07D; ipéptidos cíclicos que no tienen en su molécula ningún otro enlace peptídico más que los que forman su ciclo, p. ej. piperazina diones-2,5, C07D; alcaloides del cornezuelo del centeno de tipo péptido cíclico C07D 519/02;   proteínas monocelulares, enzimas C12N; procedimientos de obtención de péptidos por ingeniería genética C12N 15/00). › C07K 14/00 Péptidos con más de 20 aminoácidos; Gastrinas; Somatostatinas; Melanotropinas; Sus derivados. › Receptores; Antígenos celulares de superficie; Determinantes celulares de superficie.
  • C12N15/86 C […] › C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12N MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN (biocidas, productos que repelen o atraen a los animales nocivos, o reguladores del crecimiento de los vegetales, que contienen microorganismos virus, hongos microscópicos, enzimas, productos de fermentación o sustancias obtenidas por o extraídas de microorganismos o sustancias animales A01N 63/00; preparaciones de uso médico A61K; fertilizantes C05F ); PROPAGACION,CULTIVO O CONSERVACION DE MICROORGANISMOS; TECNICAS DE MUTACION O DE INGENIERIA GENETICA; MEDIOS DE CULTIVO (medios para ensayos microbiológicos C12Q 1/00). › C12N 15/00 Técnicas de mutación o de ingeniería genética; ADN o ARN relacionado con la ingeniería genética, vectores, p. ej. plásmidos, o su aislamiento, su preparación o su purificación; Utilización de huéspedes para ello (mutantes o microorganismos modificados por ingeniería genética C12N 1/00, C12N 5/00, C12N 7/00; nuevas plantas en sí A01H; reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00; nuevas razas animales en sí A01K 67/00; utilización de preparaciones medicinales que contienen material genético que es introducido en células del cuerpo humano para tratar enfermedades genéticas, terapia génica A61K 48/00; péptidos en general C07K). › Vectores virales.

PDF original: ES-2704677_T3.pdf

 

Patentes similares o relacionadas:

Transferencia del gen acuaporina mediada por un virus adenoasociado (aav) para el tratamiento del síndrome de Sjögren, del 27 de Marzo de 2019, de The United States Of America, As Represented By The Secretary, Department Of Health And Human Services (100.0%): Una composición para su uso (i) en el tratamiento del síndrome de Sjögren o (ii) en la prevención de la xerostomía o la xeroftalmía asociadas con […]

Composiciones para el tratamiento de trastornos neurogénicos del suelo pélvico, del 27 de Marzo de 2019, de THE BOARD OF TRUSTEES OF THE LELAND STANFORD JUNIOR UNIVERSITY: Un primer polinucleotido para su uso en un metodo para el tratamiento de la hiperreflexia del detrusor y/o de la disinergia detrusor-esfinter externo […]

Agente profiláctico o terapéutico para la fibrosis, del 27 de Marzo de 2019, de Mie University: Un ARNip que tiene una longitud total de 21 a 23 nucleótidos, que se selecciona de los siguientes (a) a (o): (a) un ARNip que comprende una secuencia en sentido […]

Modalidades mejoradas para el tratamiento de enfermedades degenerativas de la retina, del 27 de Marzo de 2019, de Astellas Institute for Regenerative Medicine: Un método para diferenciar citoblastos embrionarios humanos en células de RPE humano, comprendiendo dicho método: a) permitir el sobrecrecimiento de cultivos […]

Métodos y ensayos basados en microARN para el osteosarcoma, del 27 de Marzo de 2019, de 3-D Matrix, Ltd: Una cantidad eficaz de una molécula antisentido específica para un microARN (miARN) seleccionado de miR-1, miR-10b y miR-133a para su uso en el tratamiento […]

Composiciones y métodos para alterar la especificidad de tejido y mejorar la transferencia génica mediada por AAV9, del 27 de Marzo de 2019, de THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIA: Una composición que comprende un vector viral de virus adenoasociado (AAV) que tiene una cápside de AAV de clado F que comprende un dominio […]

Un método para el tratamiento de la enfermedad de Pompe usando 1-desoxinojirimicina y derivados, del 22 de Marzo de 2019, de AMICUS THERAPEUTICS, INC: Una composición que comprende N-butil-1-desoxinojirimicina (NB-DNJ) o una sal de la misma para el uso en el tratamiento de la enfermedad de Pompe, […]

Composición para la inserción de genes que comprende quitosano y material de formación de cristales líquidos, del 22 de Marzo de 2019, de CHONG KUN DANG PHARMACEUTICAL CORP: Una composición para la inserción de genes que forma un cristal líquido en un fluido acuoso, que comprende: (a) un material de formación de cristales […]

Otras patentes de la CIP C12N15/86