Plataformas de suministro de antígenos.

Una molécula de ARN de auto-replicación que comprende un polinucleótido que comprende:



a. una primera secuencia de nucleótidos que codifica una primera proteína o un fragmento de la misma de un virus del herpes;

b. una segunda secuencia de nucleótidos que codifica una segunda proteína o un fragmento de la misma de dicho virus del herpes;

c. una tercera secuencia de nucleótidos que codifica una tercera proteína o un fragmento de la misma de dicho virus del herpes;

d. una cuarta secuencia de nucleótidos que codifica una cuarta proteína o un fragmento de la misma de dicho virus del herpes; y

e. una quinta secuencia de nucleótidos que codifica una quinta proteína o un fragmento de la misma de dicho virus del herpes;

en la que la primera proteína o fragmento de la misma, segunda proteína o fragmento de la misma, tercera proteína o fragmento de la misma, cuarta proteína o fragmento de la misma y quinta proteína o fragmento de la misma son proteínas del virus del herpes que forman complejos pentaméricos entre sí; y

en la que la primera secuencia de nucleótidos, la segunda de nucleótido, la tercera secuencia de nucleótidos, la cuarta secuencia de nucleótidos y la quinta secuencia de nucleótidos están operativamente enlazadas a uno o más elementos de control de tal forma que cuando se introduce la molécula de ARN de auto-replicación en una célula adecuada, la primera, la segunda, la tercera, la cuarta y la quinta proteínas del virus del herpes o fragmentos de las mismas se producen en una cantidad suficiente para la formación de un complejo en la célula que contiene la primera, la segunda, la tercera, la cuarta y la quinta proteínas o fragmentos.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2011/055834.

Solicitante: GLAXOSMITHKLINE BIOLOGICALS SA.

Nacionalidad solicitante: Bélgica.

Dirección: RUE DE L'INSTITUT 89 1330 RIXENSART BELGICA.

Inventor/es: FRANTI,MICHAEL, MASON,PETER, LILJA,ANDERS, LOOMIS,REBECCA.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • A61K39/12 SECCION A — NECESIDADES CORRIENTES DE LA VIDA.A61 CIENCIAS MEDICAS O VETERINARIAS; HIGIENE.A61K PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO (dispositivos o métodos especialmente concebidos para conferir a los productos farmacéuticos una forma física o de administración particular A61J 3/00; aspectos químicos o utilización de substancias químicas para, la desodorización del aire, la desinfección o la esterilización, vendas, apósitos, almohadillas absorbentes o de los artículos para su realización A61L;   composiciones a base de jabón C11D). › A61K 39/00 Preparaciones medicinales que contienen antígenos o anticuerpos (materiales para ensayos inmunológicos G01N 33/53). › Antígenos virales.
  • C07K14/005 SECCION C — QUIMICA; METALURGIA.C07 QUIMICA ORGANICA.C07K PEPTIDOS (péptidos que contienen β -anillos lactamas C07D; ipéptidos cíclicos que no tienen en su molécula ningún otro enlace peptídico más que los que forman su ciclo, p. ej. piperazina diones-2,5, C07D; alcaloides del cornezuelo del centeno de tipo péptido cíclico C07D 519/02;   proteínas monocelulares, enzimas C12N; procedimientos de obtención de péptidos por ingeniería genética C12N 15/00). › C07K 14/00 Péptidos con más de 20 aminoácidos; Gastrinas; Somatostatinas; Melanotropinas; Sus derivados. › de origen vírico.
  • C12N15/86 C […] › C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12N MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN (biocidas, productos que repelen o atraen a los animales nocivos, o reguladores del crecimiento de los vegetales, que contienen microorganismos virus, hongos microscópicos, enzimas, productos de fermentación o sustancias obtenidas por o extraídas de microorganismos o sustancias animales A01N 63/00; preparaciones de uso médico A61K; fertilizantes C05F ); PROPAGACION,CULTIVO O CONSERVACION DE MICROORGANISMOS; TECNICAS DE MUTACION O DE INGENIERIA GENETICA; MEDIOS DE CULTIVO (medios para ensayos microbiológicos C12Q 1/00). › C12N 15/00 Técnicas de mutación o de ingeniería genética; ADN o ARN relacionado con la ingeniería genética, vectores, p. ej. plásmidos, o su aislamiento, su preparación o su purificación; Utilización de huéspedes para ello (mutantes o microorganismos modificados por ingeniería genética C12N 1/00, C12N 5/00, C12N 7/00; nuevas plantas en sí A01H; reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00; nuevas razas animales en sí A01K 67/00; utilización de preparaciones medicinales que contienen material genético que es introducido en células del cuerpo humano para tratar enfermedades genéticas, terapia génica A61K 48/00; péptidos en general C07K). › Vectores virales.

PDF original: ES-2716243_T3.pdf

 

Patentes similares o relacionadas:

Productos y métodos para el tratamiento de la esclerosis lateral amiotrófica, del 27 de Mayo de 2020, de The Research Institute at Nationwide Children's Hospital: Un virus recombinante adenoasociado que comprende el ADN que codifica el ARNhc de la dismutasa de superóxido 1 (SOD1) CATGGATTCCATGTTCATGA (SEQ ID NO: […]

Métodos para mejorar la eficiencia de la transducción vectorial en linfocitos T, del 27 de Mayo de 2020, de CELGENE CORPORATION: Un método de transducción de un linfocito T primario, que comprende: (i) poner en contacto un linfocito T primario con un compuesto que es BX795 o 2-Aminopurina; (ii) […]

Métodos para la transducción y el procesamiento de células, del 27 de Mayo de 2020, de Juno Therapeutics, Inc: Un método de transducción, que comprende incubar, en una cavidad interna de una cámara de centrífuga, una composición de entrada que comprende células y partículas […]

Composiciones promotoras, del 6 de Mayo de 2020, de UNIVERSITY OF IOWA RESEARCH FOUNDATION: Una secuencia promotora aislada que comprende un ácido nucleico de entre 500 y 1700 nucleótidos de longitud que tiene por lo menos un 98% de identidad con la SEQ […]

Métodos mejorados para producir terapias celulares adoptivas, del 22 de Abril de 2020, de Bluebird Bio, Inc: Un método in vitro para producir un producto terapéutico de células T que comprende: a) proporcionar una población de células mononucleares […]

Vectores lentivirales, del 8 de Abril de 2020, de IP2IPO Innovations Limited: Un vector lentiviral pseudotipado con hemaglutinina-neuraminidasa (HN) y proteínas de fusión (F) de un paramixovirus respiratorio, en el que dicho vector lentiviral comprende […]

Ingeniería del genoma multiplex mediante CRISPR, del 8 de Abril de 2020, de The Regents of the University of Colorado, a body corporate: Un casete sintetizado que comprende: (i) al menos un casete de edición que comprende (a) una región homóloga a una región objetivo de […]

Un sistema de administración y expresión de terapia génica adenoviral dependiente de linfocitos T colaboradores, del 1 de Abril de 2020, de BAYLOR COLLEGE OF MEDICINE: Un sistema de administración y expresión de la terapia génica que comprende al menos un vector adenoviral dependiente de linfocitos T colaboradores que […]

Utilizamos cookies para mejorar nuestros servicios y mostrarle publicidad relevante. Si continua navegando, consideramos que acepta su uso. Puede obtener más información aquí. .