Método para clasificar una enfermedad inflamatoria del intestino como una enfermedad de Crohn o como una colitis ulcerosa.

Un método para clasificar una enfermedad inflamatoria del intestino en un paciente como enfermedad de Crohn o como colitis ulcerosa,

comprendiendo dicho método:

i) una etapa de medir un perfil de expresión de miARN en una muestra aislada en mucosa no inflamada del colon del paciente, en la que dichos miARN son miR15a, miR26a, miR29a, miR29b, miR30c, miR126*, miR127-3p, miR-142-3p, miR-142-5p, miR-146a, miR-146b-5p, miR150, miR-181d, miR-182, miR185, miR196a, miR199a- 3p, miR199a-5p, miR199b-5p, miR-203, miR223, miR-299-5p, miR320a, miR324-3p y miR-328 y

ii) una etapa que consiste en comparar el perfil de expresión de dichos miARN en la muestra del paciente con perfiles de control de dichos miARN, en la que una diferencia o similitud entre dichos perfiles de expresión es indicativa de una enfermedad de Crohn o una colitis ulcerosa.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2011/063949.

Solicitante: INSERM (INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE).

Nacionalidad solicitante: Francia.

Dirección: 101, RUE DE TOLBIAC 75013 PARIS FRANCIA.

Inventor/es: OGIER-DENIS,ERIC, TRETON,XAVIER.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • C12Q1/68 SECCION C — QUIMICA; METALURGIA.C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12Q PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS QUE INTERVIENEN ENZIMAS O MICROORGANISMOS (ensayos inmunológicos G01N 33/53 ); COMPOSICIONES O PAPELES REACTIVOS PARA ESTE FIN; PROCESOS PARA PREPARAR ESTAS COMPOSICIONES; PROCESOS DE CONTROL SENSIBLES A LAS CONDICIONES DEL MEDIO EN LOS PROCESOS MICROBIOLOGICOS O ENZIMOLOGICOS. › C12Q 1/00 Procesos de medida, investigación o análisis en los que intervienen enzimas o microorganismos (aparatos de medida, investigación o análisis con medios de medida o detección de las condiciones del medio, p. ej. contadores de colonias, C12M 1/34 ); Composiciones para este fin; Procesos para preparar estas composiciones. › en los que intervienen ácidos nucleicos.

PDF original: ES-2534920_T3.pdf

 


Fragmento de la descripción:

Método para clasificar una enfermedad inflamatoria del intestino como una enfermedad de Crohn o como una colitis ulcerosa

Sector de la técnica

La presente invención se refiere a un método para clasificar una enfermedad inflamatoria del intestino en un paciente como una enfermedad de Crohn o como una colitis ulcerosa.

Estado de la técnica

Las enfermedades inflamatorias del intestino (Eli), tales como enfermedad de Crohn (EC) y colitis ulcerosa (CU) son trastornos crónicos graves y recidivantes mediados por el sistema inmunológico del tracto gastrointestinal. Las Eli son enfermedades heterogéneas caracterizadas por diversas anomalías genéticas que conducen a respuestas inflamatorias excesivamente agresivas a un subconjunto de bacterias entéricas comensales.

La enfermedad de Crohn puede afectar a todas las partes del tracto digestivo y especialmente al íleon y/o al colon y conduce a ulceraciones de la mucosa, fístula, e infiltración profunda de células inflamatorias en la pared intestinal.

La colitis ulcerosa con frecuencia implica a la parte inferior del colon y el recto y la inflamación de la mucosa puede extenderse al ciego en un patrón contiguo.

En la práctica clínica, del 2 al 3 % de los pacientes con colitis de Eli no pueden clasificarse como EC o CU basándose en criterios endoscópicos, radiológicos e histopatológicos habituales, aunque esta distinción puede ser crucial para guiar las elecciones terapéuticas, especialmente cuando se analiza la resección colónica.

De forma similar, la sensibilidad de los marcadores serológicos (autoanticuerpos para neutrófilos [ANCA, pANCA] y anticuerpos antimicrobianos [ASCA, anti-OmpC, anti-12, y anti-CBir1 ]) sigue siendo insuficiente para diferenciar entre EC y CU. Por otro lado, la etiología de las Eli y la causa del brote siguen siendo en gran medida desconocidas y también se necesitan marcadores bioespecíficos de EC y CU para evaluar un diagnóstico temprano. Hasta la fecha, sigue siendo difícil elegir biomarcadores estrictamente específicos.

Algunas identificaciones específicas de la expresión de miARN en la mucosa colónica de pacientes con Eli ya se han desvelado en la técnica anterior (X. Treton*, M. Fasseu, E. Pedruzzi, Y. Bouhnik, T. Aparicio, D. Cazals-Hatem, F. Daniel, M. Laburthe, A. Grover, E. Ogierdenis: "P273: Alteration Of Microrna Expression In Inflamed And Inactive Colonic Mucosa Of Patients With Inflammatory Bowel Disease", Gastro 29- Uegw/Wcogh, Londres, 2 de Noviembre de 29 (2-11-29), - 25 de Noviembre de 29 (25-11-29); TRETON ET AL: "P217 SPECIFIC ALTERATION OF MICRO-RNA EXPRESSION IN INFLAMMATORY BOWEL DISEASE", JOURNAL OF CROHNS AND COLITIS, vol. 2, Ni) 21, 1 de Febrero de 28 (1-2-28), página S69; Treton et al.: "Alteration de lexpression des microARN dans la muqueuse colique quiescente de patients atteints de maladies inflammatoires chroniques de lintestin (MICI)", 26 de Marzo de 21 (26-3-21); y el documento WO 29/12877). Sin embargo dichas identificaciones no permiten al mismo tiempo el diagnóstico de Eli (Eli frente a sano) y el diagnóstico diferencial de CU y EC.

Objeto de la invención

La presente invención se refiere a un método para clasificar una enfermedad inflamatoria del intestino en un paciente como una EC o como una CU, comprendiendo dicho método:

i) una etapa de medir un perfil de expresión de miARN en una muestra aislada en mucosa no inflamada del colon del paciente, en la que dichos miARN son miR15a, miR26a, miR29a, miR29b, miR3c, miR126*, miR127-3p, m¡R-142-3p, m¡R-142-5p, miR-146a, miR-146b-5p, miR15, miR-181d, miR-182, miR185, miR196a, miR199a-3p, m¡R199a-5p, m¡R199b-5p, miR-23, miR223, miR-299-5p, miR32a, miR324-3p, y miR-328y

ii) una etapa que consiste en comparar el perfil de expresión de dichos miARN en la muestra del paciente con perfiles de control de dichos miARN, en la que una diferencia o similitud entre dichos perfiles de expresión es indicativa de una enfermedad de Crohn o de una colitis ulcerosa.

Descripción detallada de la invención

El objetivo de los inventores fue localizar alteraciones de la expresión génica de miARN en la mucosa colónica quiescente no inflamada de pacientes con Eli frente a la de individuos sanos. En consecuencia, han estudiado alteraciones de todo el genoma en el patrón de expresión génica de miARN en mucosa quiescente de pacientes con CU y EC activas, en comparación con tejido sano normal. Han identificado subconjuntos de 22 (CU) y 34 (EC) miARN con expresión elevadamente alterada en tejido mucoso quiescente, estando 1 desregulados habitualmente en tejidos con CU y EC no inflamados (Tabla B). Más particularmente, los inventores seleccionaron 15 miARN para

los que la expresión fue estadísticamente diferente en biopsias colónicas no inflamadas de pacientes con CU y EC (véase la Tabla B y la Figura 1). Estos miARN y los 1 que están habitualmente desregulados en tejidos con CU y EC no inflamados se ensayaron después con respecto a su capacidad para diferenciar entre EC y CU. Basándose en la clasificación clínica del panel de pacientes como CU o EC, la selección de los 25 miARN fue capaz de predecir 5 15/16 en su verdadera clase (Tabla V).

En consecuencia, la presente invención se refiere a un método para clasificar una enfermedad inflamatoria del intestino en un paciente como una enfermedad de Crohn o como una colitis ulcerosa, comprendiendo dicho método una etapa de medir un perfil de expresión de miARN en una muestra del paciente, en la que dichos miARN son 1 miR15a, miR26a, miR29a, miR29b, miR3c, miR126*, miR127-3p, miR-142-3p, miR-142-5p, miR-146a, miR-146b- 5p, miR15, miR-181 d, miR-182, miR185, miR196a, miR199a-3p, miR199a-5p, miR199b-5p, miR-23, miR223, miR- 299-5p, miR32a, miR324-3p, y miR-328.

El término "miARN" se refiere a moléculas de microARN maduras (ARN pequeños no codificantes) que son 15 generalmente de 21 a 22 nucleótidos de longitud, incluso aunque se han indicado longitudes de 19 y hasta 23 nucleótidos. Los miARN se procesan cada uno a partir de moléculas de ARN precursoras más largas ("miARN precursor": pri-miARN y pre-miARN). Los pri-miARN se transcriben a partir de genes que no codifican proteínas o se incluyen en genes que codifican proteínas (dentro de intrones o exones no codificantes). Los "miARN precursores" se pliegan en estructuras en horquilla que contienen tallos con emparejamiento de bases imperfecto y se procesan 2 en dos etapas, catalizadas en animales por dos endonucleasas de tipo ribonucleasa III denominadas Drosha y Dicer. El miARN procesado es típicamente una parte del tallo. Los miARN procesados (también denominados "miARN maduros") se ensamblan en complejos de ribonucleoproteínas grandes (miRISC) que reprimen de forma post- transcripcional (regulación negativa) a un gen o genes diana específicos.

Todos los miARN pertenecientes a la invención se conocen por sí mismos y sus secuencias están públicamente disponibles de la base de datos http://www.mirbase.org/cgi-bin/mirna_summary.pl?org=hsa . Los miARN de la invención se enumeran en la Tabla A:

TABLA A: miARN pertenecientes a la invención

miARNJd

Número de Referencia

Secuencia

SEC ID Nfi:

hsa-mir-15a

MIMAT68

uagcagcacauaaugguuugug

hsa-mir-26a

MIMAT82

uucaaguaauccaggauaggcu

hsa-mir-29a

MIMAT86

uagcaccaucugaaaucgguua

hsa-mir-29b

MIMAT1

uagcaccauuugaaaucaguguu

hsa-mir-3c

MIMAT244

uguaaacauccuacacucucagc

hsa-mir-126*

MIMAT444

cauuauuacuuuugguacgcg

hsa-mir-127-3p

MIMAT446

ucggauccgucugagcuuggcu

hsa-mir-146a

MIMAT449

ugagaacugaauuccauggguu

hsa-mir-15

MIMAT451

ucucccaacccuuguaccagug

hsa-mir-142-5p

MIMAT433

cauaaaguagaaagcacuacu

hsa-mir-142-3p

MIMAT434

uguaguguuuccuacuuuaugga

hsa-mir-146b-5p

MIMAT289

ugagaacugaauuccauaggcu

hsa-mir-181d

... [Seguir leyendo]

 


Reivindicaciones:

1. Un método para clasificar una enfermedad inflamatoria del intestino en un paciente como enfermedad de Crohn o 5 como colitis ulcerosa, comprendiendo dicho método:

i) una etapa de medir un perfil de expresión de miARN en una muestra aislada en mucosa no inflamada del colon del paciente, en la que dichos miARN son miR15a, miR26a, miR29a, miR29b, miR3c, miR126*, miR127-3p, miR-142-3p, miR-142-5p, miR-146a, miR-146b-5p, m¡R15, miR-181d, miR-182, miR185, miR196a, miR199a- 1 3p, miR199a-5p, miR199b-5p, miR-23, miR223, miR-299-5p, miR32a, miR324-3p y miR-328 y

¡i) una etapa que consiste en comparar el perfil de expresión de dichos miARN en la muestra del paciente con perfiles de control de dichos miARN, en la que una diferencia o similitud entre dichos perfiles de expresión es indicativa de una enfermedad de Crohn o una colitis ulcerosa.

2. El método de acuerdo con la reivindicación 1 en el que la muestra resulta de biopsias endoscópicas realizadas en

el colon del paciente.


 

Patentes similares o relacionadas:

Marcadores de diagnóstico para el tratamiento de los trastornos proliferativos celulares con inhibidores de la telomerasa, del 13 de Marzo de 2019, de GERON CORPORATION: Un método de selección de un individuo diagnosticado o sospechoso de tener cáncer que se beneficiará del tratamiento con un inhibidor de la telomerasa, […]

Métodos de identificación, evaluación, prevención y terapia de enfermedades pulmonares y kits de los mismos, incluida la identificación, evaluación, prevención y terapia de enfermedades en base al género, del 12 de Marzo de 2019, de CANCER PREVENTION AND CURE, LTD: Un método ex vivo de caracterización fisiológica en un sujeto que comprende determinar el grado de expresión de los siguientes tres biomarcadores leptina, IL-10, y MCP-1 […]

Biomarcadores de ácidos nucleicos en circulación asociados al cáncer de mama, del 12 de Marzo de 2019, de Chronix Biomedical: Un método de detección del nivel de una molécula de ADN extracelular en circulación asociada con cáncer de mama en el ADN extracelular en circulación en una muestra de sangre, […]

MÉTODO Y DISPOSITIVO PARA EL ANÁLISIS DE ÁCIDOS NUCLEICOS, del 7 de Marzo de 2019, de MEDINA VENEGAS, Pedro Manuel: Constituido a partir de un conjunto de sistemas de recepción y procesamiento de muestras, de captura, concentración y purificación de moléculas diana […]

Material poroso para la detección de Candida albicans, método de diagnóstico que lo utiliza y método de preparación del mismo, del 6 de Marzo de 2019, de UNIVERSITAT POLITECNICA DE VALENCIA: Material poroso para la detección de Candida albicans, método de diagnóstico que lo utiliza y método de preparación del mismo. Concretamente, […]

Qtl responsable de la firmeza de los frutos del tomate, del 6 de Marzo de 2019, de SYNGENTA PARTICIPATIONS AG: Un método para seleccionar una planta de tomate cultivada que comprende QTL1 ligado a firmeza de los frutos aumentada en comparación con frutos de una planta de tomate […]

Agentes de ARNi modificados, del 6 de Marzo de 2019, de ALNYLAM PHARMACEUTICALS, INC: Un agente de ARNi que comprende una primera cadena y una segunda cadena, en el que al menos una subunidad que tiene una fórmula (I) se incorpora […]

Análisis genómico fetal a partir de una muestra biológica materna, del 6 de Marzo de 2019, de THE CHINESE UNIVERSITY OF HONG KONG: Un método para determinar una primera proporción de un genoma fetal que ha sido secuenciado de una muestra biológica obtenida de una mujer embarazada, teniendo […]

Otras patentes de INSERM (INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE)
  • 1. Uso de una laminina para diferenciar células pluripotentes en células de linaje hepatocitario. (07 Mar. 2019)
  • 2. Péptido de donante aislado derivado de mhc y usos del mismo. (04 Mar. 2019)
  • 3. Inhibidores de progastrina en el tratamiento del cáncer de colon. (27 Feb. 2019)
  • 4. Biomarcador de rehospitalización tras insuficiencia cardíaca. (20 Feb. 2019)
  • 5. Anticuerpo sintético de un solo dominio. (06 Feb. 2019)
  • 6. Métodos para expresar un polinucleótido de interés en la retina de un sujeto. (06 Feb. 2019)
  • 7. Antagonistas de interleucina 15 (il-15) y usos de los mismos para el tratamiento de enfermedades autoinmunes y enfermedades inflamatorias. (04 Feb. 2019)
  • 8. Un polipéptido de interleucina 34 aislado para uso en la prevención del rechazo de trasplante y el tratamiento de enfermedades autoinmunitarias. (09 Ene. 2019)
  • 9. Administración directa de proteínas con microvesículas modificadas por ingeniería. (07 Dic. 2018)
  • 10. Métodos para determinar la calidad de un embrión. (29 Nov. 2018)
  • 11. Polipéptido de flagelina como agonista de tlr5 para su uso en el tratamiento de infecciones de las vías respiratorias. (22 Nov. 2018)
  • 12. Métodos para seleccionar ovocitos competentes y embriones competentes con elevado potencial de resultado de embarazo. (21 Nov. 2018)
  • 13. Uso de m-csf para prevenir o tratar la citopenia mieloide y las complicaciones relacionadas. (22 Oct. 2018)
  • 14. Combinación de un compuesto de arsénico y al menos un retinoide para tratar la leucemia mielógena aguda. (10 Oct. 2018)
  • 15. Anticuerpos dirigidos contra icos para tratar la enfermedad de injerto contra hospedador. (03 Oct. 2018)
  • 16. Partículas de hpv y usos de las mismas. (26 Sep. 2018)

 

Patente actualizada el . Inventos patentados en España en los últimos 80 años. Clasificación Internacional de Patentes CIP 2015. · Inventos patentados en España. Acerca de · Contacto · Patentados.com desde 2007 hasta 2019 // Última actualización: 22/11/2019.