CEBADORES UNIVERSALES PARA LA IDENTIFICACIÓN DE ESPECIES, Y SUS USOS.

Cebadores universales para la identificación de especies, y sus usos.



Se proporciona un método in vitro y un kit para la identificación a nivel taxonómico de al menos una especie biológica en una muestra. El método comprende (a) extracción de ADN de la muestra; (b) amplificación de un segmento del 16s ADNr con los cebadores oligonucleótidos: 16S-HF: 5' ATAACACGAGAAGACCCT 3', y 16S-HR1: 5' CCCACGGTCGCCCCAAC 3', y/o, 16S-HR2: 5' CCCGCGGTCGCCCCAAC 3', o equivalentes de estos cebadores; (c) secuenciación del fragmento amplificado o fragmentos amplificados; y, (d) comparación de la secuencia obtenida en la reacción de secuenciación del ADN del fragmento amplificado o fragmentos amplificados con las secuencias del 16S ADNr presentes en una base de datos.

Tipo: Patente de Invención. Resumen de patente/invención. Número de Solicitud: P201031217.

Solicitante: UNIVERSIDAD DE OVIEDO.

Nacionalidad solicitante: España.

Inventor/es: GARCÍA VÁZQUEZ,Eva, HÓRREO ESCANDÓN,José Luis, MARTÍNEZ FERNÁNDEZ,José Luis.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • C12Q1/68 SECCION C — QUIMICA; METALURGIA.C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12Q PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS QUE INTERVIENEN ENZIMAS O MICROORGANISMOS (ensayos inmunológicos G01N 33/53 ); COMPOSICIONES O PAPELES REACTIVOS PARA ESTE FIN; PROCESOS PARA PREPARAR ESTAS COMPOSICIONES; PROCESOS DE CONTROL SENSIBLES A LAS CONDICIONES DEL MEDIO EN LOS PROCESOS MICROBIOLOGICOS O ENZIMOLOGICOS. › C12Q 1/00 Procesos de medida, investigación o análisis en los que intervienen enzimas o microorganismos (aparatos de medida, investigación o análisis con medios de medida o detección de las condiciones del medio, p. ej. contadores de colonias, C12M 1/34 ); Composiciones para este fin; Procesos para preparar estas composiciones. › en los que intervienen ácidos nucleicos.

PDF original: ES-2388821_A1.pdf

 

  • Fb
  • Twitter
  • G+
  • 📞

Fragmento de la descripción:

Cebadores universales para la identificación de especies, y sus usos.

CAMPO DE LA INVENCIÓN

La presente invención se refiere al campo de la identificación de especies, basada en el uso de cebadores universales derivados de la secuencia del ADN ribosomal 16S.

ESTADO DE LA TÉCNICA

La identificación de una o más especies en una muestra, en general, y la demanda de tests que proporcionen la trazabilidad del origen taxonómico de una o más especies en muestras biológicas o alimentarias han aumentado por distintas razones.

Los métodos actuales de identificación de especies se basan en ADN. Inicialmente estaban relacionados con las reacciones de hibridación pero han sido reemplazados por los basados en técnicas PCR (acción en cadena de la polimerasa; en inglés, Polymerase Chain Reaction) : RAPD (amplificación aleatoria de ADN polimórfico; en inglés, Random Amplified Polymorphic DNA) , RFLP (polimorfismos de longitud de fragmentos de restricción; en inglés, Restriction Fragment Lenght Polymorphism) y secuenciación de ADN.

Los métodos RAPD tienen varios inconvenientes, especialmente la dificultad de interpretación de los perfiles electroforéticos producidos por estas técnicas y el hecho de que son extremadamente dependientes de las variaciones en las condiciones de los laboratorios, haciendo muy difícil comparar resultados de distintos laboratorios. La PCR-RFLP tiene como gran desventaja que la posible aparición de mutaciones en las dianas de restricción puede producir fragmentos de ADN no digeridos y falsos resultados.

El análisis de la secuencias de ADN es actualmente el método más utilizado para la identificación molecular de especies (WO2005040423) . Sin embargo, para obtener la suficiente información para una discriminación segura, esta técnica requiere la secuenciación de grandes regiones de ADN, generalmente sobre 300 pares de bases. La necesidad de amplificar fragmentos tan grandes puede llevar al fallo de la técnica cuando la muestra tiene poca cantidad de ADN

o ADN degradado.

Los métodos basados en cebadores de PCR especie-específicos también han sido descritos para la identificación molecular de especies (US2005233334) . La principal desventaja de dicho método es la necesidad de reacciones PCR independientes para detectar cada especie que pueda estar presente en la muestra.

Una reducción en el tamaño de los fragmentos amplificados que son secuenciados o en el número de cebadores usados implica comprometer la precisión del método.

En resumen, los métodos disponibles actualmente para la identificación de especies son de uso limitado. Sólo pueden confirmar la presencia de un número muy limitado de especies no relacionadas estrechamente, por lo que para abarcar un mayor número de especies interrelacionadas es necesario el uso de un mayor número de cebadores o la amplificación de fragmentos mayores de ADN.

Por todo ello, existe una necesidad de métodos rápidos, simplificados y precisos para la identificación molecular de cualquier especie en cualquier tipo de muestra.

BREVE DESCRIPCIÓN DE LA INVENCIÓN

Se describe a continuación un nuevo acercamiento a la identificación de especies. El método se basa en la observación de que el fragmento del ADN ribosomal 16S (16S ADNr) no está bien conservado entre las diferentes especies pero sí lo está dentro de la misma especie. Los inventores han encontrado una secuencia nucleotídica dentro del gen 16S ribosomal más útil para la identificación de especies que aquellas utilizadas hasta el momento. Este hallazgo ha permitido satisfacer una antigua demanda, el desarrollo de un método mucho más específico, rápido y preciso para la identificación de especies utilizando cebadores universales para amplificar dicha secuencia nucleotídica del gen 16S ribosomal.

La presente invención proporciona tres cebadores universales, cebadores que hibridan en una región altamente conservada del gen 16S ribosomal, que amplifican un fragmento de dicho gen que es específico en cada especie en su secuencia de nucleótidos, y difiere así entre especies en su secuencia de nucleótidos. Consecuentemente, la presente invención proporciona también un método simplificado para la identificación de especies utilizando dichos cebadores. Este reducido número de cebadores utilizados en el método de la presente invención ni compromete la fiabilidad de los métodos ni la aplicabilidad de amplio espectro de dichos métodos en función del tipo y estado de la muestra en la que se aplican. Consecuentemente, los métodos de la presente invención son particularmente ventajosos para identificar especies en muestras degradadas debido al pequeño tamaño del producto amplificado. Dichos métodos también han sido comprobados como especialmente adecuados para cualquier tipo de muestra, tanto fresca como procesada. Finalmente, los presentes métodos son especialmente adecuados para muestras con cantidades pequeñas, o de baja calidad, de ADN.

La presente invención, por lo tanto, proporciona un nuevo y preciso método in vitro para la identificación a nivel taxonómico de al menos una especie biológica en una muestra, que comprende las siguientes etapas: (a) extracción de ADN de la muestra; (b) amplificación de un segmento del 16s ADNr con los siguientes cebadores: 16SH-F (SEQ ID NO: 1) : 5´ ATAACACGAGAAGACCCT 3´; y 16SH-R1 (SEQ ID NO: 2) : 5´ CCCACGGTCGCCCCAAC 3´, y/o, 16SH-R2 (SEQ ID NO: 3) : 5´ CCCGCGGTCGCCCCAAC 3´, o las secuencias complementarias, o equivalentes de estos cebadores, difiriendo dichos equivalentes en la secuencia de alguno de los cebadores arriba especificados bien por adición o eliminación de cualquiera de sus respectivas extremidades de uno o varios nucleótidos, o por cambio de uno o más nucleótidos dentro de dichas secuencias, o por una combinación de ambos, siempre que dichos equivalentes todavía hibriden con la misma diana de ARN o ADN como los cebadores correspondientes no modificados; (c) secuenciación del fragmento amplificado o fragmentos amplificados; y (d) comparación de la secuencia obtenida en la reacción de secuenciación del ADN del fragmento amplificado o fragmentos amplificados con las secuencias del 16S ADNr presentes en una base de datos.

La presente invención es, por lo tanto, particularmente ventajosa para el etiquetado indispensable en alimentos comercializados en mercados internacionales. Los productos alimenticios comercializados en Europa deben mostrar una etiqueta declarando el nombre científico de las especies, tras la nomenclatura binomial estándar. La presente invención es también particularmente ventajosa para detectar adulteraciones o diluciones ilegales, para controlar el comercio ilegal de especies en peligro o la suplantación entre especies.

Asimismo, los inventores han encontrado también que el método puede ser aplicado a cualquier tipo de muestra, materia prima, materia en cualquier fase de procesamiento, o a alimentos después de ser procesados. De acuerdo con una ventajosa realización del método de la invención, el ADN extraído de la muestra de materia orgánica puede estar no degradado o ADN intacto proveniente de una muestra fresca; o ADN degradado o fragmentado, proveniente de una muestra que haya sido procesada, en particular, cocinada, liofilizada, secada, pasteurizada, etc.

Otro objeto de la presente invención es un oligonucleótido caracterizado por tener una secuencia seleccionada del grupo que consiste en las SEQ ID NOs: 1-3, o las secuencias complementarias.

También es objeto de la presente invención un juego de oligonucleótidos que consiste en un oligonucleótido que tiene la secuencia correspondiente a la SEQ ID NO: 1, o la secuencia complementaria, y en un oligonucleótido que tiene la secuencia correspondiente a la SEQ ID NO: 2 o SEQ ID NO: 3, o las secuencias complementarias.

Otro objeto de la presente invención es un juego de oligonucleótidos que consiste en los oligonucleótidos que tienen las secuencias correspondientes a las SEQ ID Nos: 1-3, o las secuencias complementarias.

También es parte de la presente invención un kit para la realización de los métodos de la presente invención que comprende cualquiera de los anteriores oligonucleótidos.

BREVE DESCRIPCIÓN DE LAS FIGURAS

FIG. 1 Amplificación de fragmentos de 6 especies diferentes de pescado obtenidos usando los cebadores universales de la invención, a saber, cebador... [Seguir leyendo]

 


Reivindicaciones:

1. Un método in vitro para la identificación a nivel taxonómico de al menos una especie biológica en una muestra, que comprende las siguientes etapas:

(a) extracción de ADN de la muestra;

(b) amplificación de un segmento del 16s ADNr con los siguientes cebadores: 16SH-F (SEQ ID NO: 1) : 5´ ATAACACGAGAAGACCCT 3´; y 16SH-R1 (SEQ ID NO: 2) : 5´ CCCACGGTCGCCCCAAC 3´, y/o, 16SH-R2 (SEQ ID NO: 3) : 5´ CCCGCGGTCGCCCCAAC 3´

o las secuencias complementarias, o equivalentes de estos cebadores, difiriendo dichos equivalentes en la secuencia de alguno de los cebadores arriba especificados bien por adición o eliminación de cualquiera de sus respectivas extremidades de uno o varios nucleótidos, o por cambio de uno o más nucleótidos dentro de dichas secuencias, o por una combinación de ambos, siempre que dichos equivalentes todavía hibriden con la misma diana de ARN o ADN como los cebadores correspondientes no modificados;

(c) secuenciación del fragmento amplificado o fragmentos amplificados; y,

(d) comparación de la secuencia obtenida en la reacción de secuenciación del ADN del fragmento o fragmentos amplificados con las secuencias del 16S ADNr presentes en una base de datos.

2. El método según la reivindicación 1, que además comprende la clonación del fragmento amplificado o los fragmentos amplificados y la secuenciación del clon resultante o de cada uno de los clones resultantes.

3. El método según cualquiera de las reivindicaciones anteriores, donde la muestra es fresca o procesada.

4. El método según cualquiera de las reivindicaciones anteriores, donde la secuencia del 16S ADNr presente en la base de datos es la secuencia completa o un fragmento de la misma que comprende el fragmento amplificado usando al menos los cebadores correspondientes a las SEQ ID NOs: 1 y 2 y/o 3, o las secuencias complementarias.

5. El método según cualquiera de las reivindicaciones anteriores, donde la muestra contiene una sola especie o una mezcla heterogénea de especies.

6. Un oligonucleótido caracterizado por tener una secuencia seleccionada del grupo que consiste en las SEQ ID NOs: 1-3, o las secuencias complementarias.

7. Un juego de oligonucleótidos que consiste en un oligonucleótido que tiene la secuencia correspondiente a la SEQ ID NO: 1, o la secuencia complementaria, y en un oligonucleótido que tiene la secuencia correspondiente a la SEQ ID NO: 2 o SEQ ID NO: 3, o las secuencias complementarias.

8. Un juego de oligonucleótidos que consiste en los oligonucleótidos que tienen las secuencias correspondientes a las SEQ ID Nos: 1-3, o las secuencias complementarias.

9. Un kit para llevar a cabo los métodos definidos en cualquiera de las reivindicaciones 1-5, que comprende los oligonucleótidos definidos en cualquiera de las reivindicaciones 6-8.

Fig. 1

Fig. 2

ACCATGTTCCCAACCCTCCAATAAGAGACTAAA—CTAGTGGTTGCCTTCCCTAATGTCTTTGGTTGGGGCGACCG

Scorpaena notata

ACTACCTTAATTACCCCTGGATAAAGGGCAAAAGCTAAAGGTACCCCNTCCCCAGCGTCTTTGGTTGGGGCGACCC

Dicentrarchus labrax

ACCACGTTTAATATACTAAAGTTAATAGCAAAAACTTAGTGGATGTTTATTAAAGTGTCTTTGGTTGGGGCGACCG

Merluccius merluccius

ACCCCG--AAAGCACCCTACACCAGGGCCCAAA—CAACGTGGTTTTGGCACAACCGTCTTCGGTTGGGGCGACCG

Sardina pilchardus


 

Patentes similares o relacionadas:

Dispositivo de recolección de sangre para estabilizar ARN libre de células en sangre durante el transporte y almacenamiento de muestras, del 19 de Octubre de 2018, de Streck Inc: Un procedimiento para manipular una muestra biológica en un sitio remoto para el análisis de ARN libre de células, que comprende las etapas de: a. extraer una muestra de […]

Combinaciones de biomarcadores para su uso en la detección del cáncer de páncreas, del 19 de Octubre de 2018, de RANDOX LABORATORIES LTD.: Un método para determinar si un paciente tiene, o está en riesgo de desarrollar cáncer de páncreas que comprende, i) determinar el nivel de proteína de los biomarcadores S100A11, […]

Método para seleccionar una triterapia personalizada para el tratamiento del cáncer, del 18 de Octubre de 2018, de Worldwide Innovative Network: Un método para determinar en un paciente que tiene cáncer una clasificación de puntos de intervención de acuerdo con su estado de activación, consistiendo […]

Métodos para el tratamiento o prevención de la anemia, del 18 de Octubre de 2018, de FIBROGEN, INC.: Un compuesto para su uso en el tratamiento o prevención de la anemia, en donde el compuesto es un compuesto de fórmula (I):**Fórmula** en donde A es (C1-C4)-alquileno; […]

Medicamentos para tratar anemia asociada con enfermedad renal, del 18 de Octubre de 2018, de FIBROGEN, INC.: Un compuesto para su uso en la prevención o tratamiento de anemia asociada con enfermedad renal en un sujeto, en donde el compuesto es un compuesto […]

Determinaciones de cáncer de pulmón utilizando relaciones de miARN, del 18 de Octubre de 2018, de Biomirna Holdings Ltd: Un método para determinar la presencia de un tumor pulmonar en un sujeto, el método comprende: (a) determinar la relación de expresión de un par de miARN en […]

Asociación de variaciones genéticas raras recurrentes con el trastorno por déficit de atención e hiperactividad (TDAH) y procedimientos de uso de las mismas para el diagnóstico y tratamiento del mismo, del 17 de Octubre de 2018, de THE CHILDREN'S HOSPITAL OF PHILADELPHIA: Un procedimiento para detectar un riesgo aumentado de desarrollar trastorno por déficit de atención e hiperactividad (TDAH) en un sujeto de […]

Método para preparar una biblioteca de moléculas de ácido nucleico, del 16 de Octubre de 2018, de Lexogen GmbH: Método para generar una biblioteca de partes de ácido nucleico amplificadas de un ácido nucleico molde, que comprende A) obtener dicho ácido nucleico molde, […]

‹‹ DISPOSITIVO PARA LA SUSTITUCIÓN DEL CILINDRO DE INCLINACIÓN EN EL BUJE DE UN AEROGENERADOR

LÁSER DE COLORANTE EN ESTADO SÓLIDO ››