ALDEHIDO DESHIDROGENASA.

UNA NUEVA ALDEHIDO - DESHIDROGENASA QUE TIENE LAS PROPIEDADES FISICO - QUIMICAS SIGUIENTES:

PESO MOLECULAR: 150.000 (MAS MENOS) 6.000 O 230.000 (MAS MENOS) 9.000; ESPECIFICIDAD DEL SUBSTRATO: ACTIVO SOBRE COMPUESTOS DE ALDEHIDO; COFACTORES: PIRROLOQUINOLIN - QUINONA Y HEME - C; PH OPTIMO: 7,0 - 8,5; E INHIBIDORES CO 2+ , CU 2+ , FE 2+ , NI 2+ , ZN SU P,2+ , MONOYODOACETATO Y EDTA, QUE SE DERIVA DE UN MICROORGANISMO PERTENECIENTE AL GENERO GLUCONOBACTER. ESTA ALDEHIDO - DESHIDROGENASA PUEDE PRODUCIRSE POR CULTIVO DE UN MICROORGANISMO DEL GENERO GLUCONOBACTER, CAPAZ DE PRODUCIR UNA ALDEHIDO - DESHIDROGENASA QUE TIENE LAS MENCIONADAS PROPIEDADES, EN UN MEDIO NUTRIENTE ACUOSO Y EN CONDICIONES AEROBICAS, ALTERANDOSE LAS CELULAS DEL MICROORGANISMO Y AISLANDOSE Y PURIFICANDOSE LA ALDEHIDO DESHIDROGENASA DEL EXTRACTO DE CELULAS LIBRES DE LAS CELULAS ALTERADAS DEL MICROORGANISMO. EL ACIDO 2 - CETO - L - GULONICO (2 - KGA) PUEDE PRODUCIRSE A PARTIR DE LA L - SORBOSONA PONIENDO LA L - SORBOSONA EN CONTACTO CON (I) LA ALDEHIDO DESHIDROGENASA EN PRESENCIA DE UN ACEPTOR DE ELECTRONES, (II) UN MICROORGANISMO GLUCONOBACTER CAPAZ DE PRODUCIR LA ALDEHIDO DESHIDROGENASA EN MEDIO ACUOSO EN CONDICIONES AEROBICAS O (III) UN EXTRACTO SIN CELULAS DE DICHO MICROORGANISMO Y, EN CADA CASO, AISLANDO EL 2 -KGA RESULTANTE DE LA MEZCLA DE REACCION.

Tipo: Resumen de patente/invención.

Solicitante: F. HOFFMANN-LA ROCHE AG.

Nacionalidad solicitante: Suiza.

Dirección: ,4070 BASEL.

Inventor/es: HOSHINO, TATSUO, MIYAZAKI, TARO, SUGISAWA, TERUHIDE.

Fecha de Publicación: .

Fecha Concesión Europea: 28 de Enero de 2004.

Clasificación Internacional de Patentes:

  • C12N9/02 SECCION C — QUIMICA; METALURGIA.C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12N MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN (biocidas, productos que repelen o atraen a los animales nocivos, o reguladores del crecimiento de los vegetales, que contienen microorganismos virus, hongos microscópicos, enzimas, productos de fermentación o sustancias obtenidas por o extraídas de microorganismos o sustancias animales A01N 63/00; preparaciones de uso médico A61K; fertilizantes C05F ); PROPAGACION,CULTIVO O CONSERVACION DE MICROORGANISMOS; TECNICAS DE MUTACION O DE INGENIERIA GENETICA; MEDIOS DE CULTIVO (medios para ensayos microbiológicos C12Q 1/00). › C12N 9/00 Enzimas, p. ej. ligasas (6.; Proenzimas; Composiciones que las contienen (preparaciones para la limpieza de los dientes que contienen enzimas A61K 8/66, A61Q 11/00; preparaciones de uso médico que contienen enzimas A61K 38/43; composiciones detergentes que contienen enzimas C11D ); Procesos para preparar, activar, inhibir, separar o purificar enzimas. › Oxidorreductasas (1.), p. ej. luciferasa.
  • C12P7/60 C12 […] › C12P PROCESOS DE FERMENTACION O PROCESOS QUE UTILIZAN ENZIMAS PARA LA SINTESIS DE UN COMPUESTO QUIMICO DADO O DE UNA COMPOSICION DADA, O PARA LA SEPARACION DE ISOMEROS OPTICOS A PARTIR DE UNA MEZCLA RACEMICA.C12P 7/00 Preparación de compuestos orgánicos que contienen oxígeno. › Acido ceto-2 gulónico.

Patentes similares o relacionadas:

Métodos para controlar la producción de proteasas, del 1 de Julio de 2020, de ROAL OY: Una célula hospedadora que comprende al menos un gen cromosómico inactivado en donde el gen cromosómico inactivado comprende una secuencia de ácido nucleico que codifica un […]

Productos y métodos para el tratamiento de la esclerosis lateral amiotrófica, del 27 de Mayo de 2020, de The Research Institute at Nationwide Children's Hospital: Un virus recombinante adenoasociado que comprende el ADN que codifica el ARNhc de la dismutasa de superóxido 1 (SOD1) CATGGATTCCATGTTCATGA (SEQ ID NO: […]

Reconocimiento de unión a diana celular mediante un agente bioactivo usando transferencia de energía de resonancia de bioluminiscencia intracelular, del 6 de Mayo de 2020, de PROMEGA CORPORATION: Un sistema de ensayo que comprende: (a) una biblioteca de agentes bioactivos, cada uno de los cuales está fijado a un fluoróforo; (b) una diana celular fusionada a […]

Métodos para ajustar los niveles de producción de carotenoides y composiciones en géneros de Rhodosporidium y Rhodotorula, del 15 de Abril de 2020, de TEMASEK LIFE SCIENCES LABORATORY LIMITED: Un método para ajustar el nivel de producción y la composición de carotenoides en un huésped fúngico que comprende: (a) manipular genéticamente […]

Luciferasas de Oplophorus sintéticas con mayor emisión de luz, del 15 de Abril de 2020, de PROMEGA CORPORATION: Método que comprende: (a) expresar un polipéptido de luciferasa en una célula, en el que el polipéptido de luciferasa es una luciferasa modificada […]

Expresión de polipéptido químico con receptores de linfocitos variables en células inmunes y usos para tratar el cáncer, del 8 de Abril de 2020, de EMORY UNIVERSITY: Un vector recombinante que comprende un ácido nucleico que codifica un polipéptido quimérico que comprende una secuencia de direccionamiento de un dominio de receptor […]

Péptido que muestra actividad que promueve la generación de melanina y uso del mismo, del 8 de Abril de 2020, de CAREGEN CO., LTD: Un péptido que consiste en la secuencia de aminoácidos de la SEQ ID NO: 1.

Polipéptidos de fusión relacionados con omega-hidroxilasa con propiedades mejoradas, del 8 de Abril de 2020, de Genomatica, Inc: Una variante de polipéptido de fusión híbrida de CYP153A-reductasa que comprende al menos el 90 % de identidad de secuencia con SEQ ID NO: 38 y que tiene […]

Utilizamos cookies para mejorar nuestros servicios y mostrarle publicidad relevante. Si continua navegando, consideramos que acepta su uso. Puede obtener más información aquí. .