Oligonucleótido antisentido contra la isoforma R de la acetilcolinesterasa humana (ACHE-R) y sus usos.

Un oligonucleótido sintético antisentido dirigido contra el ARNm de AChE humano que tiene la secuencia denucleótidos:



5'CTGCCACGTTCTCCTGCACC 3' (SEQ ID NO: 1), en la que dicho oligonucleótido antisentido suprime de formaselectiva la producción de la isoforma AChE-R.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/IL2002/000411.

Solicitante: YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW UNIVERSITY OF JERUSALEM LTD.

Nacionalidad solicitante: Israel.

Dirección: Hi-Tech Park, Edmond J. Safra Campus, Givat Ram, P.O.B 39135 91390 Jerusalem ISRAEL.

Inventor/es: SOREQ, HERMONA.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • A61K31/711 SECCION A — NECESIDADES CORRIENTES DE LA VIDA.A61 CIENCIAS MEDICAS O VETERINARIAS; HIGIENE.A61K PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO (dispositivos o métodos especialmente concebidos para conferir a los productos farmacéuticos una forma física o de administración particular A61J 3/00; aspectos químicos o utilización de substancias químicas para, la desodorización del aire, la desinfección o la esterilización, vendas, apósitos, almohadillas absorbentes o de los artículos para su realización A61L;   composiciones a base de jabón C11D). › A61K 31/00 Preparaciones medicinales que contienen ingredientes orgánicos activos. › Acidos desoxirribonucleicos naturales, es decir conteniendo unicamente 2'-desoxirribosas unidas a la adenina, la guanina, la citosina o la timina y teniendo enlaces 3'-5' fosfodiester.
  • A61P21/04 A61 […] › A61P ACTIVIDAD TERAPEUTICA ESPECIFICA DE COMPUESTOS QUIMICOS O DE PREPARACIONES MEDICINALES.A61P 21/00 Medicamentos para el tratamiento de trastornos del sistema muscular o neuromuscular. › para la miastenia grave.
  • A61P25/00 A61P […] › Medicamentos para el tratamiento de trastornos del sistema nervioso.
  • C07H21/02 SECCION C — QUIMICA; METALURGIA.C07 QUIMICA ORGANICA.C07H AZUCARES; SUS DERIVADOS; NUCLEOSIDOS; NUCLEOTIDOS; ACIDOS NUCLEICOS (derivados de ácidos aldónicos o sacáricos C07C, C07D; ácidos aldónicos, ácidos sacáricos C07C 59/105, C07C 59/285; cianohidrinas C07C 255/16; glicales C07D; compuestos de constitución indeterminada C07G; polisacáridos, sus derivados C08B; ADN o ARN concerniente a la ingeniería genética, vectores, p. ej. plásmidos o su aislamiento, preparación o purificación C12N 15/00; industria del azúcar C13). › C07H 21/00 Compuestos que contienen al menos dos unidades mononucleótido que tienen cada una grupos fosfato o polifosfato distintos unidos a los radicales sacárido de los grupos nucleósido, p. ej. ácidos nucleicos. › con ribosilo como radical sacárido.
  • C12N15/113 C […] › C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12N MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN (biocidas, productos que repelen o atraen a los animales nocivos, o reguladores del crecimiento de los vegetales, que contienen microorganismos virus, hongos microscópicos, enzimas, productos de fermentación o sustancias obtenidas por o extraídas de microorganismos o sustancias animales A01N 63/00; preparaciones de uso médico A61K; fertilizantes C05F ); PROPAGACION,CULTIVO O CONSERVACION DE MICROORGANISMOS; TECNICAS DE MUTACION O DE INGENIERIA GENETICA; MEDIOS DE CULTIVO (medios para ensayos microbiológicos C12Q 1/00). › C12N 15/00 Técnicas de mutación o de ingeniería genética; ADN o ARN relacionado con la ingeniería genética, vectores, p. ej. plásmidos, o su aislamiento, su preparación o su purificación; Utilización de huéspedes para ello (mutantes o microorganismos modificados por ingeniería genética C12N 1/00, C12N 5/00, C12N 7/00; nuevas plantas en sí A01H; reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00; nuevas razas animales en sí A01K 67/00; utilización de preparaciones medicinales que contienen material genético que es introducido en células del cuerpo humano para tratar enfermedades genéticas, terapia génica A61K 48/00; péptidos en general C07K). › Acidos nucleicos no codificantes que modulan la expresión de genes, p.ej. oligonucleótidos antisentido.

PDF original: ES-2397302_T3.pdf

 

  • Fb
  • Twitter
  • G+
  • 📞

Fragmento de la descripción:

Oligonucleótido antisentido contra la isoforma R de la acetilcolinesterasa humana (ACHE-R) y sus usos Campo de la invención La presente invención se refiere a un oligonucleótido sintético antisentido dirigido al dominio común que codifica el ARNm de la acetilcolinesterasa (AChE) , y a composiciones farmacéuticas o médicas que comprenden el mismo, particularmente para el tratamiento y/o la prevención de un trastorno neuromuscular progresivo.

Antecedentes de la invención Las uniones neuromusculares (UNM) están muy especializadas, son morfológicamente distintas, y comprenden sinapsis colinérgicas bien caracterizadas [Hall y Sanes (1993) Cell 72 Suppl., 99.121]. La discapacidad crónica de la actividad de las UNM induce trastornos neuromusculares caracterizados por un progresivo deterioro de la estructura y la función muscular. No se han elucidado los mecanismos moleculares y celulares que conducen, a partir de una actividad de la UNM comprometida, al debilitamiento del músculo.

Uno de dichos trastornos es la miastenia grave (MG) , producida por un defecto en la transmisión neuromuscular mediada por autoanticuerpos que reducen drásticamente el número de receptores funcionales de la acetilcolina nicotínica del músculo post-sináptico. (AChR) [Drachman D.G. (1994) N. Engl. J. Med. 330, 1797-1810, Vincent A. (1999) Curr. Opin. Neurol. 12, 545-551]. MG se caracteriza por una debilidad muscular fluctuante que puede mejorarse transitoriamente mediante inhibidores de la acetilcolinesterasa (AChE) [Penn A.S. y Rowland L.P. (1995) Myasthenia Gravis En: Meritt’s Textbook of Neurology, 9ª Edición, Williams y Wilkins, Baltimore, sección XVII, 754-761]. La anormalidad electrodiagnóstica característica es un declive progresivo, rápido en la amplitud de los potenciales de acción muscular del compuesto (PAMC) evocados por una estimulación nerviosa repetitiva a 3 o 5 Hz. Hasta la fecha, el tratamiento normalizado para la MG incluye la terapia inmunosupresora combinada con la administración crónica de múltiples dosis diarias de inhibidores de la AChE periféricos tales como piridostigmina (Mestinon™) . Aunque los inhibidores de la AChE restauran eficazmente el comportamiento muscular en los pacientes con MG, sus efectos son de corta duración, solicitándose el desarrollo de un tratamiento eficaz adicional.

La tecnología antisentido, ofrece una alternativa atractiva basada en los genes a los agentes terapéuticos convencionales de la acetilcolinesterasa. La tecnología antisentido aprovecha las reglas del emparejamiento de bases de Watson y Crick para diseñar oligonucleótidos cortos, de 15-25 restos de longitud, cuya secuencia es complementaria a la de un ARNm diana [Agrawal S. y Kandimalla E.R. (2000) Mol. Med. Today, 6, 72-81]. Los tramos de ARN bicatenario, resultantes de la hibridación del oligonucleótido antisentido (ASON) con su diana activan la ARNasa H [Crooke S.T. (2000) Methods Enzymol. 313, 3-45] y promueven la degradación específica del duplete de ARNm. Ya que el ARN terapéutico diana antisentido, más bien que las proteínas, ofrece el potencial para diseñar fármacos muy específicos con concentraciones eficaces en el intervalo nanomolar [Galyam N. y col. (2001) Antisense Nucleic Acid Drug Dev. 11, 51-57]. Los oligonucleótidos 2’-O-metilo antisentido, fosforotioados y protegidos en el extremo 3’ dirigidos al ARNm de la AChE de ratón demostraron ser eficaces en el bloqueo de la expresión de AChE in vitro en células de roedores y seres humanos cultivadas [Koenigsberger C. y col. (1997) J. Neurochem. 69, 1389-1397; documento WO 98/26062; Grisaru D. y col. (2001) Mol. Med. 7, 93-105], e in vivo en cerebro [Shohami E. y col. (2000) J. Mol. Med. 78, 278-236; Cohen y col. (2002) Molecular Psychiatr y , en prensa], músculo [Lev-Lehman E. y col. (2000) J. Mol. Neurosci. 14, 93-105] y médula ósea [Grisaru y col. (2001) ibíd.].

Los inventores han observado recientemente que el tratamiento con diisopropilfluorofosfonato (DFP) , inhibidor irreversible de la colinesterasa induce la expresión en exceso de una por lo demás rara, variante de corte y empalme no sináptica alternativa de la AChE, AChE-R, en el cerebro [Kaufer D. y col. (1998) Nature, 393, 373-377] y el intestino [Shapira M. y col. (2000) Hum. Mol. Genet. 9, 1273-1282]. Los músculos de los animales tratados con DPF, expresan en exceso también la AChE-R, acompañada por una ramificación exagerada de neuritas, fibras debilitadas desorganizadas y proliferación en la UNM. Los oligonucleótidos 2’-O-metilo antisentido parcialmente protegidos dirigidos al ARNm de la AChE de ratón suprimieron la regulación en exceso de la retroalimentación de la AChE y la proliferación mejorada de la UNM inducida por DFP [Lev-Lehman y col. (2000) ibíd.]. Estas observaciones demostraron que el estrés colinérgico estimula la expresión en exceso de la AChE-R en el músculo y que los oligonucleótidos antisentido pueden suprimir dicho exceso de AChE-R y evitar su resultado perjudicial.

Tal como se ha mencionado anteriormente, la anomalía característica del electrodiagnóstico es un declive progresivo, rápido en la amplitud de los potenciales de acción muscular evocados por una estimulación nerviosa repetitiva a 3 o 5 Hz. Esta fatiga miasténica está producida por la disminución en el número de moléculas de ACR disponible en el sitio post-sináptico. Los anticuerpos dirigidos contra AChR inhibidores están presentes en un 85 % a 90 % de los pacientes [Vincent, A. (1999) id ibíd].

Los pacientes con MG, pero no con miastenias congénitas debidas a otras causas [Triggs y col. (1992) Muscle Nerve 15, 267-72], muestran una respuesta clínica transitoria a los inhibidores de la AChE tales como edrofonio. Los fármacos anti-AChE disponibles están en primera línea de tratamiento, pero la mayoría de los pacientes requieren ayuda adicional.

Esto incluye drásticas medidas, tales como intercambio de plasma, timectomía e inmunosupresión. Desafortunadamente, todos los regímenes de fármacos contra la MG empleados actualmente están asociados a consecuencias a largo plazo perjudiciales. Estas incluyen perturbación de la transmisión neuromuscular, exacerbación e inducción de los síntomas de la MG. También, el uso seguro por lo demás de fármacos comunes tales como antiinfecciosos, fármacos cardiovasculares, anticolinérgicos, anticonvulsivos, antirreumáticos y otros se ha notificado que empeoran los síntomas de los pacientes con MG [Wittbrodt (1997) Arch. Intern. Med., 157, 399-408].

Aunque el malfuncionamiento asociado con la MG puede aliviarse transitoriamente mediante la administración sistémica crónica de inhibidores de la carbamato acetilcolinesterasa (AChE) (por ejemplo, piridostigmina) , los inventores han encontrado que la piridostigmina induce una respuesta de retroalimentación que conduce a una acumulación de AChE en exceso [Friedman y col. (1996) Nature Medicine 2, 1382-1385; Kaufer y col. (1998) id ibíd; Meshorer, E. y col. (2002) Science 295, 508-12]. Esto sugirió que el uso crónico de dichos inhibidores podría modificar el equilibrio colinérgico en el sistema neuromuscular del paciente y requeriría un aumento de las dosis de estos fármacos; se proporciona también una explicación de los regímenes de dosis muy variables en pacientes con MG y se consideró esto para el desarrollo de una solución alternativa para suprimir la hidrólisis de la acetilcolina.

El ARN que codifica la AChE está sujeto a un corte y empalme en 3’ alternativo que da como resultado un ARNm que codifica una isoforma (S) “sináptica”, que contiene los exones 1-4 y 6, designada también ARNm E6 en el presente documento, una isoforma (E) “eritrocítica”, que contiene los exones 1-6, designada también ARNm E5 en el presente documento, y la AChE-R “translectura” derivada del transcrito 3’ sin corte y empalme, que contiene los exones 1-6 y el pseudointrón 14, designado también ARNm 14 en el presente documento.

Ratones transgénicos que expresaban en exceso la AChE-S humana en las motoneuronas de la médula espinal, pero no en el músculo, presentaron deficiencias neuromotoras progresivas que se asociaron con cambios en la ultraestructura de la UNM [Andres, C. y col. (1997) Proc. Natl. Acad. Sci. USA 94, 8173-8178]. Sin embargo, no está claro si la moderada extensión de la AChE expresada en exceso en el músculo fue por sí misma suficiente para mediar esta grave miopatología. En el cerebro de roedor, los inventores encontraron previamente que el estrés traumático y los inhibidores de la colinesterasa inducen la expresión en exceso drástica dependiente del calcio de la AChE-R [Kaufer, y col. (1998) id ibid.], asociada con hipersensibilidad neuronal a los agonistas y antagonistas... [Seguir leyendo]

 


Reivindicaciones:

1. Un oligonucleótido sintético antisentido dirigido contra el ARNm de AChE humano que tiene la secuencia de nucleótidos:

5’CTGCCACGTTCTCCTGCACC 3’ (SEQ ID NO: 1) , en la que dicho oligonucleótido antisentido suprime de forma selectiva la producción de la isoforma AChE-R.

2. Un oligonucleótido antisentido resistente a nucleasa sintética que tiene la secuencia de nucleótidos:

5’CTGCCACGTTCTCCTGCACC 3’ (SEQ ID NO: 1) , en la que dicho oligonucleótido antisentido suprime de forma selectiva la producción de la isoforma AChE-R.

3. Un oligonucleótido de la reivindicación 1 o 2 que es un oligodesoxinucleótido.

4. Un oligodesoxinucleótido antisentido sintético de la reivindicación 3, que es un oligodesoxinucleótido modificado que comprende una cadena de hidrocarburo alifático parcialmente insaturada y uno o más grupos polares o cargados incluyendo grupos de ácido carboxílico, grupos éster y grupos alcohol.

5. Un oligodesoxinucleótido antisentido resistente a nucleasa sintética de la reivindicación 3 o 4, en el que al menos uno de los tres nucleótidos del extremo 3’, preferiblemente los últimos tres nucleótidos del extremo 3’, están 2’-O-metilados, y/o en que al menos un nucleótido está fluorado, y/o tiene enlaces de fosfotioato uniendo al menos dos de las últimas bases de nucleótidos del extremo 3’, preferiblemente entre las últimas cuatro bases de nucleótidos del extremo 3’, y/o que tiene una secuencia formadora de bucle de nucleótidos en el extremo 3’, en el que dicho bucle preferiblemente es un bucle de 9 nucleótidos que tiene la secuencia de nucleótidos CGCGAAGCG (SEQ ID NO:2) .

6. Un oligonucleótido antisentido resistente a nucleasa sintética de una cualquiera de las reivindicaciones 1 a 5, capaz de suprimir selectivamente la producción de AChE-R humano en el sistema nervioso central.

7. Una composición farmacéutica que comprende el oligonucleótido antisentido hEN101 definido en la SEQ ID NO:1.

8. Una composición farmacéutica de acuerdo con la reivindicación 7, para el tratamiento y/o la prevención de un trastorno neuromuscular progresivo, para mejorar la resistencia y/o para usar en la fatiga muscular crónica, preferiblemente para el tratamiento y/o la prevención de la miastenia grave, en la que dicho oligodesoxinucleótido antisentido suprime selectivamente la producción de la isoforma AChE-R.

9. La composición farmacéutica de acuerdo con la reivindicación 8, que es para el uso diario por un paciente de una dosis de ingrediente activo entre aproximadamente 0, 001 !g/g y aproximadamente 50 !g/g, preferiblemente aproximadamente de 0, 01 a aproximadamente 5, 0 !g/g, lo más preferiblemente aproximadamente de 0, 15 a aproximadamente 0, 50 !g/g.

10. La composición farmacéutica de acuerdo con una cualquiera de las reivindicaciones 8 o 9 para uso en el tratamiento y/o la prevención de un trastorno neuromuscular progresivo, en donde dicho trastorno está asociado a un exceso de ARNm o proteína de AChE-R, y/o en donde dicho trastorno está asociado al desequilibrio de la transmisión colinérgica, y/o en donde dicho trastorno implica anomalías en la distorsión muscular, la reinervación muscular o la unión neuromuscular (UNM) , y/o en donde dicho trastorno está seleccionado entre miastenia grave, enfermedad de Eaton-Lambert, distrofia muscular, esclerosis lateral amiotrófica, trastorno por estrés postraumático (TEPT) , esclerosis múltiple, distonía, esclerosis posterior a ictus, daño muscular posterior a una lesión, reinervación excesiva, parálisis posterior a cirugía de origen desconocido, y tras exposición a inhibidores de AChE.

11. La composición farmacéutica como se ha definido en una cualquiera de las reivindicaciones 8 a 10 para uso en la mejora de la resistencia en el ejercicio físico o en la disminución de la fatiga muscular.

12. Una composición farmacéutica de acuerdo con una cualquiera de las reivindicaciones 7 a 11 o un oligonucleótido antisentido de acuerdo con una cualquiera de las reivindicaciones 1 a 6 para facilitar el paso de los compuestos a través de la barrera hematoencefálica (BHE) , que comprende además otros principios farmacéuticamente activos a transportar a través de la BHE y/o un adyuvante, vehículo o diluyente farmacéuticamente aceptables.

13. La composición farmacéutica de la reivindicación 12, en la que dicho principio farmacéuticamente activo a transportar se selecciona entre uno cualquiera de los agentes de contraste usados para obtener imágenes del sistema nervioso central, agentes que actúan bloqueando los efectos del abuso de fármacos, antibióticos, fármacos quimioterapéuticos y vectores a usar en terapia génica.

14. Uso de un oligonucleótido antisentido de acuerdo con una cualquiera de las reivindicaciones 1 a 6 en la fabricación de una composición farmacéutica.

15. Uso de un oligonucleótido antisentido de acuerdo con una cualquiera de las reivindicaciones 1 a 6 en la fabricación de una composición farmacéutica para el tratamiento y/o la prevención de un trastorno neuromuscular progresivo, para

mejorar la resistencia y/o para usar en la fatiga muscular crónica, preferiblemente para el tratamiento y/o la prevención de la miastenia grave.

DEFINICIÓN ARNm de la acetilcolinesterasa humana (ACNE) , cds. completo ACCESO M55040 VERSIÓN M55040.1 GI: 177974 FUENTE ADN de feto humano de 21 semanas de edad, y ADNc y ARNm ORGANISMO Homo sapiens AUTORES SoreqH. E., Ben-Aziz R, Pmdy C.A., Seidman S., Gnatt, A, , Neville L.,

Liernan-Hurwitz, J., Lev-Lehman, E., Ginzberg, D., Lapidot-Lifson, Y. y Zakut H, TÍTULO Clonación y construcción molecular de la región de codificación de la

acetilcolinesterasa humana revela un estructura atenuante rica en G+C REVISTA Proc. Natl, Acad, Sd. U.S.A. 87 (24) , 9688-9692 (1990) MEDLINE 91088577 AChE humana 795-5’ ggtgcaggagaacgtggcag 3-814 Secuencia de codificación 3 ccacgtcctcttgcaccgtc 5’ Secuencia complementaria 5’ CTGCCACGTTCTCCTGCACC 3’ Secuencia de ASODN (SEQ ID NO: 1) hEN101

Fig. 1

hEN101 5’-CTGCCACGTTCTCCTGCACC-3’ Oligo actual.

2. mer [1]: Oligo+ actual: sin formación de dímero en el extremo 3’ Oligo- actual: sin formación de dímero en el extremo 3’ Oligo+ actual: el dímero más estable en su conjunto: 4 roturas, -6, 9 kcal/mol

Horquilla: G= -0, 5 kcal/mol, Bucle = 11 nucleótidos, Tm=34°

Fig. 2A

Oligo actual.

2. mer [1]: Td = 70, 4° [procedimiento del vecino más próximo] Tm = 74, 4° [procedimiento % GC] Tm = 66° [procedimiento 2º* (A+T) + 4º* (G + C) ] Mr = 6045 [monocatenario] Mr = 12, 4k [bicatenario] !g/OD = 45, 6 [ADNds]

Base Número y %

A 2 [10, 0]

C 10 [50, 0]

G 3 [15, 0]

T 5 [25, 0]

A+T 7 [35, 0]

G+C 13 [65, 0]

Temperatura de fusión del ADN en diferentes concentraciones de sal y formamida [°C]

[mM] xSSC 0 % 10 % 50 %

1 10 50 165 330 500 1000 (0, 006) (0, 06) (0, 03) (1) (2) (3) (6) 24, 6 41, 2 52, 8 61, 4 66, 4 69, 4 74, 4 18, 1 34, 7 46, 3 54, 9 59, 9 62, 9 67, 9 -7, 9 8, 7 20, 3 28, 9 33, 9 36, 9 41, 9

Tm [°C] = 81, 5 + 16, 6 * log[Na] + 0, 41* (% GC}

675/longitud - 0, 65 * (% formamida) — (% no emparejado) Tm aproximada del oligo no emparejado:

(1) 64, 4°; (2) 58, 4; (3) 52, 4°; (4) 45, 4° Tm no emp, = Td — 1, 2° x [% no emparejado]

Fig. 2B

DEFINICIÓN ARNm de la acetilcolinesterasa de ratón ACCESO X56518

VERSIÓN X56518.1 Gi: 49844

FUENTE Ratón doméstico

ORGANISMO Mus musculus REFERENCIA 1 (bases 1 a 2089)

AUTORES Taylor, P.

REVISTA (Enviado e.

3. oct-1990) Taylor P., University of California, San Diego, Departament of Pharmacology, La Jolla, CA 92093-0636

REFERENCIA 2 (bases 1 a 2089)

AUTORES Rachinsky, T, L, Camp, S., Li, Y., Ekstrom, T.J., Newton, M, y Taylor, P. Molecular cloning of mouse acetylcholinesterase tissue distribution of alternatively spliced mRNA species REVISTA Neurpn 5 (3) .

31. 327 (1990)

MEDLINE 90380429

AChE de ratón (se muestran las bases 1-720)

639-5’ ggtgcaagaaaatattgcag 3’658 Secuencia de codificación 3’ caacgttcttttataacgtc 5’ Secuencia complementaria 5 CTGCAATA1TITCUGCACC 3’ ODN antisentido (SEQ ID NO: 3) mEN101

Fig. 3

mEN101 5’-CTGCAATATTTTCTTGCACC-3’ Oligo actual.

2. mer [1}: Oligo+ actual: sin formación de dímero en el extremo 3’ Oligo- actual: sin formación de dímero en el extremo 3’ Oligo+ actual: el dímero más estable en su conjunto: 5 pb, -8, 8 kcal/mol

Horquilla: G = -4, 7 kcal/mol, Bucle = 7 nucleótidos, Tm=77°

Fig. 4A

Oligo actual.

2. mer [1]: Td = 60, 4° [procedimiento del vecino más próximo] Tm = 64, 2° [procedimiento % GC] Tm = 66° [procedimiento 2º* (A+T) + 4º* (G + C) ] Mr = 6098 [monocatenario] Mr = 12, 4k [bicatenario] !g/OD = 48, 1 [ADNds]

Base Número y %

A 4 [20, 0]

C 6 [30, 0]

G 2 [10, 0]

T 8 [40, 0]

A+T 12 [60, 0]

G+C 8 [20, 0]

Temperatura de fusión del ADN en diferentes concentraciones de sal y formamida [°C]

[mM] xSSC 0 % 10 % 50 %

1 10 50 165 330 500 1000 (0, 006) (0, 06) (0, 03) (1) (2) (3) (6) 14, 4 31, 0 42, 6 51, 2 56, 2 59, 2 64, 2 7, 9 24, 5 36, 1 44, 7 49, 7 52, 7 57, 7 -18, 1 -1, 5 10, 1 38, 7 23, 1 26, 7 31, 7

Tm [°C] = 81, 5 + 16, 6 * log[Na] + 0, 41* (% GC}

675/longitud - 0, 65 * (% formamida) — (% no emparejado) Tm aproximada del oligo no emparejado:

(1) 54, 4°; (2) 48, 4; (3) 42, 4°; (4) 36, 4° Tm no emp, = Td — 1, 2° x [% no emparejado]

Fig. 4B

DEFINICIÓN Subunidad T de la acetilcolinesterasa (rata, ARNm parcial, 2066 nucleótidos)

ACCESO S50879

VERSIÓN 550879.1 GI: 262092

FUENTE Rattus sp.

ORGANISMO Rattus sp.

REFERENCIA 1 (bases 1 a 2066)

AUTORES Legay, C., Bon, S., Vemier, P., Coussen, F. y Massoulie J.

TÍTULO Clonación y expresión de una subunidad de la acetilcolinesterasa de rata: generación de múltiples formas moleculares y complementariedad con una unidad colagénica Torpedo REVISTA J. Neurochern, 60 (1) .

33. 346 (1 993)

MEDLINE 93107932 AChE de rata (se muestran las bases 1-720)

rAS.

5. 5’ cctcttcctcctcctctccc 3’-70 - Secuencia de codificación 3’ ggagaaggaggaggagaggg 5’ Secuencia complementaria 5’ GGGAGAGGAGGAGGAGAGG 3’ ODN antisentido (SEQ ID NO: 5) =rEN 102 rAS.

63. 5’gtacaagaaaatatcgcag 3-658 Secuencia de codificación 3’ ccatgttcttltatagcgtc 5’ Secuencia complementaria 5’ CTGCGATA1TTTCTTGTACC 3’ ODN antisentido (SEQ ID NO: 4) rEN 101 NOTA: AS1 de ratón y AChE de rata son idénticas

Fig. 5

rEN101 5’- CTGCGATATflTCflGTACC-3’

Oligo actual.

2. mer [1]:

Oligo+ actual: sin formación de dímero en el extremo 3’

Oligo- actual: sin formación de dímero en el extremo 3’

Oligo+ actual: el dímero más estable en su conjunto: 4 pb, -4, 0 kcal/mol

Sin vástagos en forma de horquilla 3 pg

Fig. 6A

Oligo actual.

2. mer [1]: Td = 57, 1° [procedimiento del vecino más próximo] Tm = 64, 2° [procedimiento % GC] Tm = 56° [procedimiento 2º* (A+T) + 4º* (G + C) ] Mr = 6129 [monocatenario] Mr = 12, 4k [bicatenario]

!g/OD = 48, 1 [ADNds]

Base Número y %

A 3 [150]

C 5 [25, 0]

G 3 [15, 0]

T 9 [45, 0]

A+T 12 [60, 0]

G+C 8 [40, 0]

Temperatura de fusión del ADN en diferentes concentraciones de sal y formamida [°C]

[mM] xSSC 0 % 10 % 50 %

1 10 50 165 330 500 1000 (0, 006) (0, 06) (0, 03) (1) (2) (3) (6) 14, 4 31, 0 42, 6 51, 2 56, 2 59, 2 64, 2 7, 9 24, 5 36, 1 44, 7 49, 7 52, 7 57, 7 -18, 1 -1, 5 10, 1 38, 7 23, 7 26, 7 31, 7

Tm [°C] = 81, 5 + 16, 6 * log[Na] + 0, 41* (% GC}

675/longitud - 0, 65 * (% formamida) — (% no emparejado) Tm aproximada del oligo no emparejado:

(1) 51, 1°; (2) 45, 1; (3) 39, 1°; (4) 33, 1° Tm no emp, = Td — 1, 2° x [% no emparejado]

Fig. 6B


 

Patentes similares o relacionadas:

ROS quinasa mutante y de translocación en el carcinoma pulmonar no microcítico humano, del 28 de Septiembre de 2018, de CELL SIGNALING TECHNOLOGY, INC.: Un método para caracterizar un cáncer de pulmón que comprende detectar la presencia de una mutación de ROS en una muestra biológica procedente de un cáncer de pulmón […]

Nuevos ligandos de RIG-I y métodos para producirlos, del 6 de Junio de 2018, de RHEINISCHE FRIEDRICH-WILHELMS-UNIVERSITAT BONN: Un oligonucleótido que comprende una hebra sentido y una hebra antisentido, en donde el oligonucleótido comprende una hebra sentido que comprende la secuencia […]

Modulación de la expresión tipo angiopoyetina 3, del 30 de Mayo de 2018, de Ionis Pharmaceuticals, Inc: Un compuesto que comprende un oligonucleótido modificado quimérico de 10 a 30 nucleósidos unidos de longitud dirigida a un ácido nucleico que codifica la tipo angiopoyetina […]

Métodos para modular la expresión de un transcrito-1 de adenocarcinoma en pulmón asociado a metástasis (MALAT-1), del 2 de Mayo de 2018, de Ionis Pharmaceuticals, Inc: Un oligonucleótido antisentido para su uso en un método para tratar un animal que tiene cáncer, en donde el cáncer es un cáncer primario, y […]

Modulación de microRNAs contra la distrofia miotónica tipo 1 y antagonistas de microRNAs para ello, del 19 de Marzo de 2018, de UNIVERSITAT DE VALENCIA: Modulación de microRNAs contra la distrofia miotónica tipo 1 y antagonistas de microRNAs para ello. La invención proporciona el uso de inhibidores […]

Entrega del mrna para la aumentación de proteínas y enzimas en enfermedades genéticas humanas, del 14 de Febrero de 2018, de Translate Bio, Inc: Una composición farmacéutica para su uso en un método para tratar una enfermedad en un sujeto que resulta de una deficiencia de proteína, la composición farmacéutica […]

Inhibición mediada por interferencia de ARN de expresión génica usando áciddo nucleico de interferencia corto (ANic), del 31 de Enero de 2018, de SIRNA THERAPEUTICS, INC: Una molécula de ácido nucleico de interferencia corto (ANic) sintética modificada químicamente capaz de regular negativamente la expresión de un gen diana en células por […]

Oligonucleótidos modificados para la inhibición de la telomerasa, del 17 de Enero de 2018, de GERON CORPORATION: Un compuesto que tiene la estructura:**Fórmula** en la que los enlaces internucleosídicos del oligonucleótido comprenden al menos un enlace tiofosforamidato […]

‹‹ Composición de catalizador y procedimiento para la oligomerización de etileno

Embalaje ››