19 patentes, modelos y diseños de YISSUM RESEARCH DEVELOPMENT COMPANY OF THE HEBREW UNIVERSITY OF JERUSALEM LTD

Formulación y método para aumentar la biodisponibilidad oral de fármacos.

Sección de la CIP Necesidades corrientes de la vida

(08/05/2019). Inventor/es: DOMB, ABRAHAM, J., HOFFMAN, AMNON, ELGART ANNA, CHERNIAKOV,IRINA. Clasificación: A61K31/17, A61K9/00, A61K45/06, A61K38/00, A61K31/352, A61K31/05, A61K9/127, A61K47/22, A61K31/343, A61K31/436, A61K31/7048, A61K9/51, A61K31/366, A61K36/67.

Una composición para la administración oral de al menos un fármaco, comprendiendo dicha composición: a) un concentrado dispersable, caracterizado por ser capaz de formar, tras el contacto con una disolución acuosa, partículas de un diámetro medio menor que 500 nm, medido por un analizador de tamaños de partícula VLA, comprendiendo dicho concentrado dispersable: (i) al menos un tensioactivo; (ii) al menos un componente sólido a 25ºC, seleccionado de ácidos grasos, ésteres de ácidos grasos, aminas grasas, amidas grasas, alcoholes grasos y ésteres de alcoholes grasos; y (iii) un disolvente anfifílico; b) una cantidad de al menos una piperina, o isómero de la misma, suficiente para aumentar la biodisponibilidad de dicha composición, en donde la composición contiene un cannabinoide como fármaco.

PDF original: ES-2739194_T3.pdf

Fotocatalizadores basados en oxihaluro de bismuto, proceso para su preparación y sus usos.

Secciones de la CIP Técnicas industriales diversas y transportes Química y metalurgia

(20/03/2019). Inventor/es: SASSON,YOEL, GNAYEM,HANI. Clasificación: B01J37/02, C02F1/32, B01J35/00, B01J37/08, C01G29/00, B01J37/10.

Un proceso para la preparación del oxihaluro de bismuto, que comprende combinar al menos una sal de bismuto y al menos una fuente de haluro en un medio acuoso ácido en presencia de un agente reductor, y aislar un precipitado formado.

PDF original: ES-2731563_T3.pdf

Sistema de intubación endotraqueal guiado.

(07/03/2018) Un sistema para llevar a cabo una intubación traqueal guiada a un sujeto, que comprende: - una fuente de iluminación autónoma adaptada para proporcionar una salida de iluminación modulada, teniendo la salida de iluminación modulada una intensidad máxima predeterminada y estando periódicamente modulada entre un estado de intensidad máxima y un estado de intensidad mínima a una frecuencia predeterminada, estando la fuente de iluminación autónoma adaptada para ser aplicada externamente al cuello del sujeto en la región de la laringe del sujeto; - un sistema de detección óptica adaptado para recibir un flujo de datos de imagen de un dispositivo de colocación endotraqueal dentro de la garganta del sujeto, incluyendo los datos de imagen óptica datos relativos a la salida de iluminación modulada que ha penetrado en la tráquea…

Canfenos arilados, procedimientos para su preparación y usos de los mismos.

(24/01/2018) Un compuesto de fórmula general (I): **(Ver fórmula)** en la que 1 **(Ver simbolo)** 2, 2 **(Ver simbolo)** 3, 3 **(Ver simbolo)** 4 son cada uno independientemente un enlace simple o doble; Ra se selecciona entre un alquilo C1-C5 lineal o ramificado, alquenilo C2-C5 lineal o ramificado, alquinilo C2-C5 lineal o ramificado y -C(≥O)Rd, cada uno opcionalmente sustituido con al menos un grupo seleccionado entre - OH, -COOH, -NH2, C1-C5 amina, halógeno, fenilo, heteroarilo; en la que Rd se selecciona entre el grupo que consiste en -H, -OH, alquilo C1-C5 lineal o ramificado, alquenilo C2-C5 lineal o ramificado, alquinilo C2-C5 lineal o ramificado, alcoxi C1-C5 lineal…

Ladostigilo de baja dosis para el tratamiento de la deficiencia cognitiva.

Sección de la CIP Necesidades corrientes de la vida

(12/04/2017). Inventor/es: WEINSTOCK-ROSIN, MARTA. Clasificación: A61K31/325.

R(+)-6-(N-metilo,N-etilo-carbamoiloxi)-N'-propargilo-1-aminoindano o una sal del mismo para uso en el tratamiento de deterioro definitivo leve COG (MCI) en un sujeto humano, en una cantidad eficaz para tratar MCI siendo no mas que 0,37 mg/kg/dia R(+)-6-(N-metilo, N-etilo-carbamoiloxi)-N'-propargilo-1-aminoindano de la presente, o una cantidad correspondiente de la sal del mismo.

PDF original: ES-2632638_T3.pdf

Organismo con contenido de carotenoides alterados y procedimiento para producirlo.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(22/02/2017). Inventor/es: HIRSCHBERG,JOSEPH, ZAMIR,DANI. Clasificación: A01H5/00, C12N15/82, C07K14/415.

Un organismo que produce carotenoides alterado genéticamente que comprende al menos una célula que contiene cromoplasto que tiene expresión reducida de actividad de la proteína Ziso que comprende una secuencia de aminoácidos de al menos 70%, 75%, 80%, 85% o 95% homóloga a la secuencia de aminoácidos expuesta en SEQ ID NO: 3 en comparación con un organismo no alterado correspondiente que tiene la expresión no alterada de la proteína Ziso, en el que el organismo alterado genéticamente tiene un contenido elevado de al menos un carotenoide seleccionado de entre el grupo que consiste en fitoeno, fitoflueno, caroteno zeta y combinaciones de los mismos en comparación con el organismo no alterado correspondiente, seleccionándose dicho organismo genéticamente modificado del grupo que consiste en una planta, un alga y una cianobacteria.

PDF original: ES-2625658_T3.pdf

Materiales compuestos basados en celulosa.

Secciones de la CIP Química y metalurgia Técnicas industriales diversas y transportes

(07/12/2016). Inventor/es: SHOSEYOV, ODED, HEYMAN,ARNON, LAPIDOT,SHAUL, MEIROVITCH,SIGAL, NEVO,YUVAL, GUSTAFSSON,TORD. Clasificación: C08J9/28, C08J5/00, C08J9/00, B32B5/18, C08J9/35, C08J9/40, B82Y30/00.

Un artículo compuesto construido de un armazón de nano material de celulosa y al menos una resina polimérica, siendo el armazón de nanomaterial de celulosa de un material seleccionado de celulosa nano cristalina (NCC) y celulosa microfibrilar (MFC), al menos una resina polimérica que al menos parcialmente ocupa una pluralidad de poros en el armazón y el armazón está dispuesto en nano-láminas.

PDF original: ES-2617986_T3.pdf

Procedimientos y composiciones de tratamiento de trastornos mitocondriales.

Sección de la CIP Química y metalurgia

(17/02/2016). Ver ilustración. Inventor/es: GALSKI-LORBERBOUM,HAYA, RAPOPORT,MATAN, ELPELEG,ORIY, SAADA,ANN. Clasificación: C12N15/62, C07K14/435.

Una proteína de fusión para su uso en un procedimiento de tratamiento de un trastorno mitocondrial en un sujeto, comprendiendo dicha proteína de fusión, un dominio de transducción de proteínas (PTD) fusionado a un componente funcional de una enzima mitocondrial y una secuencia de direccionamiento mitocondrial (MTS), en el que dicha MTS está situada entre dicho PTD y dicho componente funcional y en el que dicha MTS es una MTS de otra enzima mitocondrial codificada por un gen nuclear, en el que dicha enzima es una enzima mitocondrial de un complejo enzimático multicomponente mitocondrial, y en el que dicho dominio de transducción de proteínas es un péptido TAT, en el que dicho tratamiento comprende la administración de dicha proteína de fusión a dicho sujeto y es un tratamiento prolongado continuo para una enfermedad crónica o comprende una única o unas pocas administraciones temporales para el tratamiento de un trastorno agudo.

PDF original: ES-2560097_T3.pdf

Composiciones y métodos para bloquear la respuesta del etileno en plantas usando sal del ácido 3-cicloprop-1-enil-propanoico.

Sección de la CIP Necesidades corrientes de la vida

(23/12/2015). Ver ilustración. Inventor/es: SISLER, EDWARD C., GOREN,RAFFI, GOLDSCHMIDT,ELIEZER, RIOV,JOSEPH, APELBAUM,AKIVA, HUBERMAN,MOSHE. Clasificación: A01N37/06, A01N3/02, A01N3/00, A23B7/00.

Un método para inhibir una respuesta al etileno en una planta, método que comprende la aplicación, al menos a una parte de dicha planta, de una cantidad eficaz que inhibe la respuesta al etileno de una sal del ácido 3-(1- ciclopropenil)propanoico soluble en agua definida con la Fórmula :**Fórmula** en la que M es sodio, dicha sal del ácido 3-(1-ciclopropenil)propanoico soluble en agua se proporciona en forma de una solución acuosa con una concentración de dicha sal que es de 0,1 a 200 μg/ml, en el que dicha aplicación comprende: a. preparar dicha solución acuosa de sal del ácido 3-(1-ciclopropenil)propanoico; y, b. aplicar dicha solución acuosa a dicha planta con un método seleccionado entre el grupo que consiste en pulverizar al menos una parte de dicha planta con dicha solución acuosa; irrigar al menos una parte de dicha planta con dicha solución acuosa; irrigar, mediante emisión de goteo de dicha solución, al menos parte de dicha planta con dicha solución.

PDF original: ES-2554809_T3.pdf

Derivados 2-(2-feniletenilo)-1,3-benzotiazol útiles para el tratamiento del cáncer.

Secciones de la CIP Necesidades corrientes de la vida Química y metalurgia

(23/12/2015). Ver ilustración. Inventor/es: LEVITZKI, ALEXANDER, REUVENI,HADAS. Clasificación: A61P35/00, A61K31/5415, C07D279/08.

Un compuesto representado por la estructura de la fórmula I:**Fórmula** Donde A es H o CN; Z es S, SO o SO2; X1, X2, X3, X4, X5, Y1 y Y2 son cada uno seleccionados independientemente de H, halógenos, alquilos, haloalquilos y OR1; Y3 y Y4 son cada uno OR1; y Cada R1 es independientemente H, alquilo C1-C4, acilo, -(CH2CH2O)nH donde n es un número entero del 1 al 20, una amida o un carboxilato, Incluyendo sales, hidratos, solvatos, polimorfos, isómeros ópticos, isómeros geométricos, enantiómeros, diaestereómeros y sus mezclas.

PDF original: ES-2566673_T3.pdf

Novedosos moduladores de la señalización de proteínas cinasas.

(25/02/2015) Un compuesto representado por la estructura de fórmula 1: **Fórmula** en la que R1, R2, R5 y R6 están seleccionados cada uno independientemente de H, alquilo C1-C4, alquenilo C2-C6, alquinilo C2-C6, alquil C1-C4-alquenilo C2-C6, alquil C1-C4-alquinilo C2-C6, (CH2CH2O)nH, cicloalquilo C3-C7, arilo, heterociclilo, heteroarilo, alquil (C1-C4)-arilo, alquil (C1-C4)-heterociclilo, alquil (C1-C4)-heteroarilo, haloalquilo, acilo y un grupo funcional que da lugar a hidroxilo tras la hidrólisis; R3, R4, R7, R8, R9, R10, R11, R12, R13 y R14 están seleccionados cada uno independientemente de H, alquilo C1- C4, alquenilo C2-C6, alquinilo C2-C6, alquil C1-C4-alquenilo C2-C6, alquil C1-C4-alquinilo C2-C6, cicloalquilo C3-C7, arilo, heterociclilo, heteroarilo,…

RNasa T2 humana recombinante y usos de la misma.

(03/09/2014) Una proteína de ribonucleasa aislada de la familia T2 como se expone en SEC ID Nº: 4, en la que la actividad ribonucleasa se inactiva por calor mediante autoclave y tiene actividad de unión a actina.

Uso de incensol y de derivados del mismo para neuroprotección y para el tratamiento de la depresión y la ansiedad.

(30/07/2014) Un compuesto que tiene la fórmula estructural I, incluyendo enantiómeros, diastereómeros, solvatos, y sales farmacéuticamente aceptables de los mismos: [I] **Fórmula** en la que, R es seleccionado de entre H, -C(≥O)R' y -C(≥O)OR", en las que R' es alquilo C1-2 y R" es H o alquilo C1-25; R1, R2, R5 y R6 son seleccionados independientemente de entre H, OH y CH3; R3, R4, R7 y R8 son seleccionados independientemente H y OH; R9 es H o CH3; o uno de R1 y R2 y uno de R3 y R4 tomados conjuntamente forman (i) un segundo enlace entre C12 y C13 o (ii) un anillo epóxido, junto con el carbono al que están unidos; y/o uno de R5 y R6 y uno de R7 y R8 tomados conjuntamente forman (iii) un segundo enlace entre C8 y C9 o (iv) un anillo epóxido, junto con el carbono al que…

Uso de NKp46 para prevenir la diabetes tipo I.

(30/04/2014) Una composicion que comprende, al menos, una proteina y un portador farmaceuticamente aceptable, en la que la proteina se selecciona del grupo formado por: una proteina que comprende un fragmento aislado de la region extracelular de NKp46; un anticuerpo especifico para la region extracelular de NKp46,y una combinacion de los mismos, para su uso en la prevencion o el tratamiento de la diabetes tipo 1.

Oligonucleótido antisentido contra la isoforma R de la acetilcolinesterasa humana (ACHE-R) y sus usos.

(06/03/2013) Un oligonucleótido sintético antisentido dirigido contra el ARNm de AChE humano que tiene la secuencia denucleótidos: 5'CTGCCACGTTCTCCTGCACC 3' (SEQ ID NO: 1), en la que dicho oligonucleótido antisentido suprime de formaselectiva la producción de la isoforma AChE-R.

Uso de una ribonucleasa de la familia T2 que tiene actividad de unión a actina para inhibir angiogénesis tumoral.

(04/03/2013) Una ribonucleasa de la familia T2 para uso en la inhibición de la angiogénesis tumoral en un sujeto, en donde laribonucleasa de la familia T2 se une a actina en su forma ribonucleolítica activa o no activa, en donde dicharibonucleasa se caracteriza por un peso molecular de la proteína T2 de 24 a 36 kDa y un pH óptimo para actividadRNasa.

Uso de una ribonucleasa de la familia T2 que tiene actividad de unión a actina para inhibir y/o invertir la proliferación.

(01/03/2013) Una ribonucleasa de la familia T2 para uso en la prevención, la inhibición y/o la inversión de la proliferación, lacolonización, la diferenciación y/o el desarrollo de células tumorales en un sujeto en donde dicha ribonucleasa de lafamilia T2 es RNasa B1 y estando dicha ribonucleasa desprovista de actividad ribonucleolítica.

Construcciones que contienen múltiples casetes de expresión para terapia de cáncer.

(22/01/2013) Una construcción de ácido nucleico, que comprende: un primer marco abierto de lectura que codifica una toxina diftérica, estando el primer marco abierto de lecturaunido operativamente a una secuencia reguladora de la transcripción específica de H19; y un segundo marco abierto de lectura que codifica una toxina diftérica, estando el segundo marco abierto delectura unido operativamente a una secuencia reguladora de la transcripción de IGF-II seleccionada de lassecuencias P4 de IGF-II y P3 de IGF-II, o que comprende: un primer marco abierto de lectura que codifica una toxina diftérica, estando dicho primer marco abierto delectura unido operativamente…

PRODUCTOS PARA PREVENIR LA PENETRACIÓN EN LA PIEL.

(02/02/2011) Un compuesto representado por la fórmula general (I): CH3(CH2)mCH(OX)(CH2)nCOO(CH2)iCH(OX)(CH2)kCH3 en la que X es un grupo orgánico que absorbe luz en la región ultravioleta y (CH2)i, (CH2)k, (CH2)m y (CH2)n son cadenas alifáticas que contienen de 5 a 30 grupos metileno

 

Patentes más consultadas

 

Clasificación Internacional de Patentes 2015