Métodos para la predicción del resultado clínico para inhibidores del receptor del factor de crecimiento epidérmico para pacientes de cáncer.

Procedimiento para seleccionar un paciente que padece cáncer que es razonable o no beneficiarse de una administración terapéutica de un inhibidor de EGFR, comprendiendo el hecho:

A) De detectar en una muestra de células tumorales que provienen de un paciente, un cambio del número de copias de gen escogido en el grupo constituido:

I) De una amplificación del gen del receptor de factor de crecimiento de la epidermis

(EGFR);

Ii) de una polisomía del gen EGFR;

Iii) de una amplificación del gen de receptor de tipo receptor de tirosina kinase humana (HER2); y

Iv) de una polisomía del gen HER2;

B) De comparar el número de copias del gen EGFR y/o HER2 en la muestra de células tumorales del paciente con un número de copias del gen EGFR y/o HER2 que proviene de células tumorales que son sensibles o resistentes a un inhibidor de EGFR, y

C) De seleccionar al paciente como siendo razonable beneficiarse de una administración terapéutica del inhibidor de EGFR, si el número de copias del gen EGFR y/o HER2 en las células tumorales del paciente es estadísticamente similar o superior al número de copias del gen EGFR y/o HER2 en células tumorales que son sensible a un inhibidor de EGFR, o si un número de copias del gen EGFR y/o HER2 en las células tumorales del paciente es estadísticamente superior al número de copias del gen EGFR y/o HER2 en células tumorales que son resistentes a un inhibidor de EGFR; o

D) De seleccionar al paciente como siendo razonable beneficiarse de una administración terapéutica del inhibidor de EGFR, si el número de copias del gen EGFR y/o HER2 en las células tumorales del paciente es estadísticamente inferior al número de copias del gen EGFR y/o HER2 en células tumorales que son sensibles a un inhibidor de EGFR, o si el número de copias de gen EGFR y/o HER2 en las células tumorales del paciente es estadísticamente similar o inferior a un número de copias del gen EGFR y/o HER2 en células tumorales que son resistentes a un inhibidor de EGFR.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2005/018879.

Solicitante: THE REGENTS OF THE UNIVERSITY OF COLORADO.

Nacionalidad solicitante: Estados Unidos de América.

Dirección: 201 Regent Administrative Center, 3 SYS Boulder, CO 80309 ESTADOS UNIDOS DE AMERICA.

Inventor/es: GARCIA,MARILEILA VARELLA, BUNN,PAUL A. JR, CAPPUZZO,FEDERICO, FRANKLIN,WILBUR A, HIRSCH,FRED R.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/68 (en los que intervienen ácidos nucleicos)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > AZUCARES; SUS DERIVADOS; NUCLEOSIDOS; NUCLEOTIDOS;... > Compuestos que contienen al menos dos unidades mononucleótido... > C07H21/04 (con desoxirribosilo como radical sacárido)
google+ twitter facebookPin it
Ilustración 1 de Métodos para la predicción del resultado clínico para inhibidores del receptor del factor de crecimiento epidérmico para pacientes de cáncer.
Ilustración 2 de Métodos para la predicción del resultado clínico para inhibidores del receptor del factor de crecimiento epidérmico para pacientes de cáncer.
Ilustración 3 de Métodos para la predicción del resultado clínico para inhibidores del receptor del factor de crecimiento epidérmico para pacientes de cáncer.
Ilustración 4 de Métodos para la predicción del resultado clínico para inhibidores del receptor del factor de crecimiento epidérmico para pacientes de cáncer.
Ilustración 5 de Métodos para la predicción del resultado clínico para inhibidores del receptor del factor de crecimiento epidérmico para pacientes de cáncer.
Métodos para la predicción del resultado clínico para inhibidores del receptor del factor de crecimiento epidérmico para pacientes de cáncer.

Texto extraído del PDF original:

DESCRIPCIÓN

Métodos para la predicción del resultado clínico para inhibidores del receptor del factor de crecimiento epidérmico para pacientes de cáncer

Campo de la Invención

[0001] La presente invención se refiere generalmente a biomarcadores, métodos y kits de ensayo para la identificación de los pacientes con cáncer que se espera que puedan beneficiarse de la terapia del inhibidor del EGFR.

Antecedentes de la Invención

[0002] La neoplasia, o un proceso de proliferación celular rápida que da como resultado un crecimiento nuevo y anormal, es una característica de muchas enfermedades que pueden ser graves, y a veces, amenazantes para la vida. Típicamente, el crecimiento neoplásico de células y tejidos está caracterizado por una proliferación de células mayor de lo normal, donde las células siguen creciendo incluso después de que el factor de instigación (por ejemplo, el promotor del tumor, carcinogen, virus) no esté presente. El crecimiento celular tiende a mostrar una falta de organización estructural y/o coordinación con el tejido normal y normalmente crea una masa de tejido (por ejemplo, un tumor) que puede ser benigno o maligno. El crecimiento maligno celular, o tumores malignos (cáncer), son una causa principal de muerte por todo el mundo, y el desarrollo de una terapia eficaz para la enfermedad neoplásica es el objeto de un gran cuerpo de investigación. Aunque se han propuesto una diversidad de enfoques innovadores de tratar y prevenir cánceres, muchos cánceres siguen causando un alto índice de mortalidad y pueden ser difíciles de tratar o ser relativamente insensibles a terapias convencionales. Además, los pacientes pueden responder de manera diferente a diversas terapias contra el cáncer, haciendo algunos enfoques útiles para algunos pacientes y no para otros. Por lo tanto, existe una necesidad continua en la técnica de identificación de factores de riesgo de cáncer adicionales y métodos para el diagnóstico temprano y terapia para cánceres, así como métodos para identificar a los pacientes que se espera que se beneficien de un tipo particular de terapia.

[0003] A fin de ilustrar este punto, el cáncer de pulmón de células no pequeñas (NSCLC) es la causa principal de muerte por cáncer en el mundo. Mientras la quimioterapia ha producido beneficios modestos de supervivencia en fases avanzadas, las combinaciones de dos fármacos convencionales generan una toxicidad considerable y requieren administración intravenosa (Non-small Cell Lung Cancer Collaborative Group, 1995; Schiller y col., 2002; Kelly y col., 2001). El progreso en el campo de la biología del cáncer de pulmón condujo al desarrollo de inhibidores de moléculas pequeñas de proteínas diana implicadas en la proliferación, la apoptosis y la angiogénesis. Los agentes diana de terapia, tales como imatinib y trastuzumab produjeron un beneficio en la supervivencia coherente en leucemia mieloide crónica (Druker, 2001), tumores estromales gastrointestinales (GIST) (Demetri 2002) y cánceres de mama que sobreexpresan las proteínas diana (Slamon 2001). La superfamilia del receptor del factor de crecimiento epidérmico (EGFR), incluyendo los cuatro receptores distintos EGFR/erbB-1, HER2/erbB-2, HER3/erbB- 3 y HER4/ERBB-4, se identificaron tempranamente como una diana terapéutica potencial en tumores sólidos.

Después de la unión al ligando, estos receptores se homodimerizan y se heterodimerizan, y el dominio de la tirosina cinasa se activa, iniciando una cascada de eventos implicados en el desarrollo y la progresión de cáncer a través de efectos sobre la progresión del ciclo celular, la apoptosis, la angiogénesis y la metástasis (Salomon y col., 2001; Arteaga, 2002; Hirsch y col., 2003, Lung Cancer; Ciardello y Tortora, 2001). El EGFR está sobreexpresado en muchas malignidades epiteliales humanas, incluyendo NSCLC (Non-small-cell lung carcinoma) (Hirsch et al., 2003, J. Clin. Oncol.; Salomon et al., 1995).

[0004] Dada la importancia biológica de la red molecular de EGFR en los carcinomas, se sintetizaron varias moléculas para inhibir el dominio de la tirosina cinasa de EGFR (Levitzki y Gazit, 1995; Levitt y Koty, 1999). Entre los más prometedores de estos nuevos fármacos se encuentran gefitinib (ZD 1839, Iressa®, AstraZeneca, Reino Unido) y erlotinib (OSI 774, Tarceva®, Genntech, Estados Unidos). Ambos son inhibidores de la tirosina cinasa de EGFR selectivos activos por vía oral (EGFR-TKI) que demostraron actividad antitumoral frente a una diversidad de líneas celulares de cáncer humano que expresan EGFR (Ciardiello y col., 2000). De la misma manera, ambos tienen una actividad bien documentada como agentes individuales en estudios de fase I, incluyendo pacientes de NSCLC resistentes a la quimioterapia que tenían tasas de respuesta de aproximadamente el 10 % (Kris y col., 2000, Lung Cancer; Baselga y col., 2002; Herbst y col., 2002; Ranson y col., 2002; Hidalgo y col., 2001). La actividad se confirmó en estudios de fase II grandes que mostraban tasas de respuesta del 19-26 % en pacientes con NSCLC avanzado no tratados previamente, y el 12-18 % en pacientes en los que no habían tenido éxito en una o más combinaciones de quimioterapia anteriores (Fukuoka y col., 2003; Kris y col., 2003, JAMA; Perez-Soler y col., 2001; Miller y col., 2003). Más recientemente, un estudio de fase III (BR21) que comparaba erlotinib con placebo como una terapia de segunda o tercera línea notificó un beneficio en la supervivencia para el inhibidor del EGFR (Relación de Riesgo: 0,73) (Shepherd y col., 2004). De forma importante, este beneficio en la supervivencia no se limitó a los respondedores objetivos, ni a un único género o histología, que hace la selección en base a características clínicas e histopatológica difíciles.

[0005] En estudios de fase II con gefitinib, no se detectó ninguna correlación entre la expresión de la proteína de EGFR y la respuesta a la terapia, aunque pocos estudios han abordado directamente esta cuestión. Los pacientes con carcinomas de células escamosas tenían tasas de respuesta inferiores en comparación con pacientes con adenocarcinoma a pesar de sus mayores tasas de expresión de EGFR (Ciardiello y col., 2000; Fukuoka y col., 2003; Kris y col., 2003, JAMA). Informes recientes mostraron que las mutaciones de sentido erróneo y de deleción específicas en la dominio de la tirosina cinasa del gen EGFR (Lynch y col, 2004; Paez y col., 2004) están relacionados significativamente con la sensibilidad a gefitinib. Sin embargo, aunque se ha notificado una respuesta objetiva en hasta el 18 % y una mejora sintomática del 40 % de gefitinib de NSCLC tratados con gefitinib no seleccionados (Fukuoka y col., 2003; Kris y col., 2003, JAMA), la frecuencia de estas mutaciones en pacientes estadounidenses no seleccionados es baja (Paez y col., 2004). Estas observaciones y el hallazgo de que puede detectarse una respuesta objetiva en pacientes que llevan aparentemente un alelo de tipo salvaje del gen EGFR (Lynch y col., Pao y col., Han y col. (JCO, 23: 2493, 2005), Mitsudomi y col., JCO 23: 2513, 2005, Kim y col., de Clinical Cancer Res, 11: 2244, 2005) sugieren que también están implicados otros mecanismos en la respuesta a gefitinib. Además, mientras estas mutaciones de activación identifican pacientes con altas tasas de respuesta, no pueden considerarse para las altas tasas de enfermedad estable, que se producen en aproximadamente el 30 % de pacientes de NSCLC tratados con gefitinib (Fukuoka y col., 2003; Kris y col., 2003, JAMA).

[0006] La solicitud USA 2004/132097 A1 describe métodos para determinar o pronosticar la respuesta a la terapia de cáncer en un individuo. En particular describe un método para predecir una respuesta a una terapia dirigida por receptor de un factor de crecimiento epidérmico en un ser humano, el método comprende el paso de examinar una muestra de tumor del ser humano antes de la terapia con uno o varios de los reactivos que detectan la expresión y/o la activación de biomarcadores predictivos para el cáncer; y la determinación de un modelo de expresión y/o activación de al menos dos de dichos biomarcadores predictivos, en el que el modelo predice la respuesta del ser humano a la terapia dirigida por receptor de un factor de crecimiento epidérmico. En ciertos modos de realización, el biomarcador predictivo es un receptor de factor de crecimiento, o una molécula de señalización corriente abajo relacionada con un receptor de factor de crecimiento. Los receptores de factor de crecimiento pueden ser HER1 (EGFR - epidermal growth factor receptor), pHER1, HER2/neu, HER3, o cualquier combinación del mismo. Las moléculas de señalización corriente abajo relacionadas con un receptor de factor de crecimiento pueden ser pERK. Demás biomarcadores predictivos son HER1 (EGFR), pHER1, HER2/neu, HER3, o pERK, o cualquier combinación del mismo.

[0007] La WO 03/101491 A1 describe inhibidores Her2 y/o EGFR para ser administrados a sujetos con la sobreexpresión o la activación de Her2 y/o EGFR que han sido sometidos a un examen para detectar la expresión o la actividad de Her2 y/o EGFR y y así se les considera tener la sobreexpresión o la activación de Her y/o EGFR; y composiciones medicinales que contienen dicho inhibidor.

[0008] WO 2004/046386 A se refiere a marcadores de pronóstico asociados con el cáncer EGFR positivo. En particular, el documento trata métodos de pronóstico basados en la caracterización molecular de expresión génica en las muestras de tejido fijo de EGFR, impregnadas por parafina, que expresan el cáncer, y que permite a un médico predecir si un paciente probablemente responde bien al tratamiento con un inhibidor EGFR.

[0009] WO 2004/111273 A se refiere a marcadores de pronóstico asociados con el cáncer y a métodos de pronóstico particulares basados en la caracterización molecular de expresión génica en las muestras fijas de tejido de cáncer, dichas muestras impregnadas por parafina, que permiten a un médico predecir si un paciente probablemente responde bien al tratamiento con un inhibidor EGFR.

[0010] Además citada como referencia es: Linche T.J. et al.: .: "Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small cell lung cancer to gefitinib", New England journal of Medicine, Massachusetts Medical Society, Boston, MA, US’, vol., 350, no. 21, 20 May 2004, pages 2129-2139. (" La activación de mutaciones en el receptor de factor de crecimiento epidérmico que es la base de la sensibilidad del cáncer pulmonar no microcítico a gefitinib ", el Diario de Medicina de Nueva Inglaterra, la Sociedad Médica de Massachusetts, Boston, MA, Estados Unidos vol., 350, núm. 21, 20 de mayo del 2004, páginas 2129-2139 ); Hirsch et Al-.. "Evaluation of HER- 2/neu gene amplification and protein expression in non-small lung carcinomas", ‘British Journal of Cancer’ . vol. 86, 2002, pages 1449-1456 (" La evaluación de HER - 2/neu la amplificación génica y la expresión de proteína en carcinomas pulmonares no microcíticas", el Diario británico de Cáncer”, vol. 86, 2002, páginas 1449-1456), y Hirsch et al.: "Epidermal growth factor receptor in non-small-cell lung carcinomas: correlation between gene copy number and protein expression and impact on prognosis", Journal of Clinical oncology, American Society of Clinical Oncology, US , vol.21, no 20, 15 October 2003, pages 3798-3807. (" Receptor de factor de crecimiento epidérmico en carcinomas pulmonares no microcíticas: la correlación entre el número de la copia génica y la expresión de proteína y el impacto sobre el pronóstico ", el Diario de Oncología Clínica, Sociedad Americana de Oncología Clínica, Estados Unidos, vol.21, núm 20, 15 de octubre del 2003, páginas 3798-3807.) [0011] En resumen, no hay ningún criterio de selección fiable para determinar que pacientes con cáncer, incluyendo pacientes de NSCLC, se beneficiarán del tratamiento con inhibidores del EGFR ilustrados por, pero sin limitación, gefitinib. Por lo tanto, es de gran interés identificar tanto pacientes que se beneficiarían de inhibidores del EGFR como pacientes que no van a beneficiarse de tal terapia, así como identificar los tratamientos que pueden mejorar la sensibilidad de las células cancerosas que son resistentes a los inhibidores del EGFR, y desarrollar los tratamientos adyuvantes que mejoran la respuesta.

Resumen de la Invención

[0012] Una realización de la invención se refiere a un método para seleccionar un paciente con cáncer que se espera se beneficie o no de la administración terapéutica de un inhibidor del EGFR.

[0013] El método según la reivindicación 1 incluye los pasos de : (a) detectar en una muestra de células de tumor de un paciente un nivel de cambio de número de copias génicas seleccionado del grupo que consiste en: i) la amplificación del gen receptor de factor de crecimiento epidérmico (EGFR, ii) polisomía del gen EGFR, iii) la amplificación del receptor del tipo receptor quinasa tirosina humano (HER2); e iv) polisomía del gen HER2; (b) la comparación del número de copias génicas EGFR y/o el HER2 en la muestra de célula de tumor del paciente al número de copias génicas EGFR y/o al HER2 de las células de tumor que son sensibles a o resistentes a un inhibidor EGF; y (c) la selección de un paciente el cual se prevé que se beneficie de la administración terapéutica del inhibidor EGFR, si el número de copias génicas EGFR y/o HER2 en las células de tumor del paciente es estadísticamente mayor que el número de copias génicas EGFR y/o HER2 en las células de tumor que son resistentes a un inhibidor EGFR; o (d) la selección de un paciente el cual se prevé que no se beneficie de la administración terapéutica del inhibidor EGFR, si el número de copias génicas EGFR y/o HER2 en las células de tumor del paciente es estadísticamente menor que el número de copias génicas EGFR y/o HER2 en las células de tumor que son sensibles a un inhibidor EGFR, o si el número de copias génicas EGFR y/o HER2 en las células de tumor del paciente es estadísticamente similar a o menor que el EGFR y/o el número de copias génicas en las células de tumor que son resistentes a un inhibidor EGFR.

[0014] La etapa de detección puede incluir, pero sin limitación, usar una sonda nucleotídica que hibrida al gen EGFR o el gen HER2, y/o usar una sonda nucleotídica que hibrida a las secuencias del centrómero del cromosoma 7 o las secuencias del centrómero del cromosoma 17. En un aspecto, la sonda es una sonda quimérica (por ejemplo, que hibrida al gen EGFR y a las secuencias del centrómero del cromosoma 7 o que hibrida al gen HER2 y a las secuencias del centrómero del cromosoma 17). La etapa de detección puede incluir, en un aspecto, la detección del número de copias del gen EGFR o el gen HER2 por célula tumoral en una o más células tumorales en la muestra, y/o la detección de amplificación génica de EGFR o HER2 por célula tumoral en una o más células tumorales en la muestra. En una realización preferida, la etapa de detección se realiza por hibridación fluorescente in situ (FISH).

[0015] Además descrito pero que no forma parte de la invención es que el paso de comparación comprende la comparación del nivel del biomarcador en las células de tumor a un nivel de control del biomarcador en una o varias células de control que son resistentes al inhibidor EGFR, y/o en una o varias células de control que son sensibles al inhibidor EGFR. En un aspecto, el nivel de control del biomarcador que ha sido correlacionado con la sensibilidad y/o la resistencia al inhibidor EGFR ha sido predeterminado.

[0016] En un aspecto de esta realización, un paciente que tiene una muestra de tumor con 3 o más copias del gen EGFR en menos de aproximadamente el 40 % de las células se predice que será un mal respondedor o no respondedor al tratamiento con el inhibidor del EGFR. En otro aspecto, un paciente que tiene una muestra de tumor con aproximadamente 4 o más copias del gen EGFR en más de o igual a aproximadamente el 40 % de las células se predice que se beneficiará del tratamiento con el inhibidor del EGFR. En otro aspecto, se predice que el paciente se beneficiará del tratamiento con el inhibidor del EGFR, cuando el paciente tiene una muestra de tumor con agrupamientos génicos de EGFR o: (a) una relación de copias del gen EGFR con respecto a copias del cromosoma 7 por célula de aproximadamente 2 o más; o (b) un promedio de aproximadamente 15 o más copias del gen EGFR por célula en más de o igual a aproximadamente el 10 % de las células analizadas. En otro aspecto, un paciente que tiene una muestra de tumor con 3 o más copias del gen HER2 en menos de aproximadamente el 40 % de las células se predice que responderá mal o no responderá al tratamiento con el inhibidor del EGFR. En aún otro aspecto, un paciente que tiene una muestra de tumor con aproximadamente 4 o más copias del gen HER2 en más de o igual a aproximadamente el 40 % de las células se predice que se beneficiará del tratamiento con el inhibidor del EGFR. En otro aspecto, se predice que un paciente se beneficiará del tratamiento con el inhibidor del EGFR, cuando el paciente tiene una muestra de tumor con agrupaciones del gen HER2; o (a) una relación de copias del gen HER2 con respecto a copias del cromosoma 17 por célula de aproximadamente 2 o más; o (b) un promedio de aproximadamente 15 o más copias del gen HER2 por célula en más de o igual a aproximadamente el 10 % de las células analizadas.

[0017] En un aspecto de esta realización, la selección del paciente en la etapa (d) en base a la amplificación génica de EGFR o polisomía se invierte si el paciente se selecciona como beneficiario de la administración terapéutica del inhibidor del EGFR en base a la amplificación génica del HER2 o polisomía. En otro aspecto de esta realización, la selección del paciente en la etapa (c) en base a la amplificación génica de EGFR o polisomía y la selección positiva del paciente en base a la amplificación génica del HER2 o polisomía aumenta la probabilidad de que el paciente responda al tratamiento con el inhibidor del EGFR en comparación con la selección del paciente en la etapa (c) en base a la amplificación génica de EGFR o polisomía en solitario.

[0018] Además descrito pero que no forma parte de la invención es un método que además incluye pasos de : (a) la detección de un nivel de expresión de proteína de receptor de factor de crecimiento epidérmico (EGFR) en la muestra de célula de tumor; (b) la comparación del nivel de expresión de proteína EGFR en la muestra celular del tumor a un nivel de control de expresión de proteína EGFR seleccionada del grupo que consiste en: (i) un nivel de control que ha sido correlacionado con la sensibilidad al inhibidor EGFR; y (ii) un nivel de control que ha sido correlacionado con la resistencia al inhibidor EGFR; y (c) la selección de un paciente el cual se prevé que se beneficie de la administración terapéutica del inhibidor EGFR, si el nivel de la expresión de proteína EGFR en las células de tumor del paciente es estadísticamente similar a o mayor que el nivel de control de la expresión de proteína EGFR que ha sido correlacionada con la sensibilidad frente al inhibidor EGFR, o si el nivel de expresión de proteína EGFR en las células de tumor del paciente es estadísticamente mayor que el nivel de expresión de proteína EGFR que ha sido correlacionada con la resistencia al inhibidor EGFR; o (d) la selección de un paciente el cual se prevé que no se beneficie de la administración terapéutica del inhibidor EGFR, si el nivel de expresión de proteína EGFR en las células de tumor del paciente es estadísticamente menor que el nivel de control de expresión de proteína EGFR que ha sido correlacionada con la sensibilidad frente al inhibidor EGFR, o si el nivel de expresión de proteína EGFR en las células de tumor del paciente es estadísticamente similar a o menor que el nivel de expresión de proteína EGFR que ha sido correlacionada con la resistencia al inhibidor EGFR. En una modo de realización preferida, el nivel de expresión de proteína EGFR es detectado usando inmunohistoquímica (IHC).

[0019] En cualquiera de los modos de realización del método inventivo arriba mencionado, el método también incluye los pasos siguientes: (a) detectar la expresión de la proteína Akt fosforilada en la muestra celular del tumor del paciente; (b) seleccionar a aquellos pacientes que tienen células de tumor que expresan la proteína Akt fosforilada y tienen un número de copias génicas EGFR que es estadísticamente similar a o mayor que el número de copia de EGFR en las células de tumor que son sensibles a un inhibidor EGFR, los cuales se prevé que se beneficien de la administración terapéutica del inhibidor EGFR; o (c) seleccionar a aquellos pacientes que tienen células de tumor que expresan la proteína Akt fosforilada y tienen un número de copias génicas EGFR que es estadísticamente similar a o menor que el número de copias de EGFR en las células tumorales que son resistentes a un inhibidor EGFR, los cuales se prevé que no se beneficien de la administración terapéutica del inhibidor EGFR.

[0020] En un modo de realización preferido, el nivel de la expresión de proteína Akt fosforilada es detectado usando la inmunohistoquímica (IHC). En un aspecto, el método incluye el paso para detectar polisomía EGFR y la expresión de la proteína Akt fosforilada.

[0021] Cualquiera de los dichos modos de realización descritos de la invención pueden incluir además un paso de detectar mutaciones en el gen EGFR, en el que la detección de una o varias mutaciones en el gen EGFR es además predictiva que el paciente beneficiará del tratamiento con el inhibidor EGFR. En particular, las mutaciones en alguno o más exones 18, 19 y 21 del gen EGFR pueden ser detectadas.

[0022] Además descrito pero que no forma parte de la invención es un método de seleccionar a un paciente con cáncer el cual se prevé que se beneficie o no de la administración terapéutica de un inhibidor EGFR. El método comprende los pasos de : (a) detectar en una muestra de células de tumor de un paciente un nivel de expresión de proteína de receptor de factor de crecimiento epidérmico (EGFR); (b) la comparación del nivel de expresión de proteína EGFR en la célula de tumor prueban a un nivel de control de expresión de proteína EGFR seleccionada del grupo que consiste en: (i) un nivel de control que ha sido correlacionado con la sensibilidad frente al inhibidor EGFR; y (ii) un nivel de control que ha sido correlacionado con la resistencia al inhibidor EGFR; y (c) la selección del paciente el cual se prevé que se beneficie de la administración terapéutica del inhibidor EGFR, si el nivel de la expresión de proteína EGFR en las células de tumor del paciente es estadísticamente similar a o mayor que el nivel de control de la expresión de proteína EGFR que ha sido correlacionada con la sensibilidad frente al inhibidor EGFR, o si el nivel de la expresión de proteína EGFR en las células de tumor del paciente es estadísticamente mayor que el nivel de la expresión de proteína EGFR que ha sido correlacionada con la resistencia al inhibidor EGFR; o (d) la selección del paciente el cual se prevé que no se beneficie de la administración terapéutica del inhibidor EGFR, si el nivel de la expresión de proteína EGFR en las células de tumor del paciente es estadísticamente menor que el nivel de control de la expresión de proteína EGFR que ha sido correlacionada con la sensibilidad frente al inhibidor EGFR, o si el nivel de la expresión de proteína EGFR en las células de tumor del paciente es estadísticamente similar a o menor que el nivel de la expresión de proteína EGFR que ha sido correlacionada con la resistencia al inhibidor EGFR. En un modo de realización preferido, el nivel de expresión de proteína EGFR es detectado empleando la inmunohistoquímica (IHC).

[0023] En un aspecto, el método además incluye un paso de detectar mutaciones en el gen EGFR, en el que la detección de una o varias mutaciones en el gen EGFR es además predictiva que el paciente responderá al tratamiento con el inhibidor EGFR. Por ejemplo, las mutaciones en alguno o más de exones 18, 19 y 21 del gen EGFR o mutaciones en el dominio quinasa tirosina del gen EGFR pueden ser detectadas.

[0024] En otro aspecto, el método incluye además los pasos de : (a) la detección de un nivel de la expresión de la proteína Akt fosforilada en la muestra celular del tumor; (b) la comparación del nivel de la expresión de la proteína Akt fosforilada en la muestra celular del tumor a un nivel de control de la expresión de la proteína Akt fosforilada seleccionada del grupo que consiste en: (i) un nivel de control que ha sido correlacionado con la sensibilidad frente al inhibidor EGFR; y (ii) un nivel de control que ha sido correlacionado con la resistencia al inhibidor EGFR; y (c) seleccionar el paciente el cual se prevé que se beneficie de la administración terapéutica del inhibidor EGFR, si el nivel de la expresión de la proteína Akt fosforilada en las células del tumor del paciente es estadísticamente similar a o mayor que el nivel de control de la expresión de la proteína Akt fosforilada que ha sido correlacionada con la sensibilidad frente al inhibidor EGFR, o si el nivel de la expresión de la proteína Akt fosforilada en las células de tumor del paciente es estadísticamente mayor que el nivel de la expresión de la proteína Akt fosforilada que ha sido correlacionada con la resistencia al inhibidor EGFR; o (d) seleccionar el paciente el cual se prevé que no se beneficie de la administración terapéutica del inhibidor EGFR, si el nivel de la expresión de la proteína Akt fosforilada en las células de tumor del paciente es estadísticamente menor que el nivel de control de la expresión de la proteína Akt fosforilada que ha sido correlacionada con la sensibilidad frente al inhibidor EGFR, o si el nivel de la expresión de la proteína Akt fosforilada en las células de tumor del paciente es estadísticamente similar a o menor que el nivel de la expresión de la proteína Akt fosforilada que ha sido correlacionada con la resistencia al inhibidor EGFR.

[0025] El método en cualquiera de las realizaciones de la invención que se ha descrito anteriormente puede usarse con un paciente que tiene cualquier tipo de cáncer. En una realización preferida, el paciente tiene cáncer de pulmón, incluyendo, pero sin limitación, carcinoma de pulmón de células no pequeñas (NSCLC), carcinoma bronquialveolar (BAC) o adenocarcinomas con rasgos BAC.

[0026] En cualquiera de las realizaciones de la invención que se ha descrito anteriormente, puede evaluarse la capacidad de respuesta a cualquier inhibidor de EGFR, incluyendo, pero sin limitación, gefitinib, eroltinib y cetuximab.

[0027] Aún otro modo de realización de la invención se relaciona con el empleo de un equipo de ensayo para seleccionar a un paciente con cáncer el cual se prevé que se beneficiará o no de la administración terapéutica de un inhibidor EGFR. El equipo de ensayo incluye: (a) un medio para detectar en una muestra de células de tumor un nivel de un biomarcador o una combinación de biomarcadores seleccionado de : (i) un nivel de amplificación del gen del receptor de factor de crecimiento epidérmico (EGFR); (ii) un nivel de polisomía del gen EGFR; (iii) un nivel de amplificación del gen (HER2) receptor del tipo receptor quinasa tirosina humano; y (iv) un nivel de polisomía del gen HER2. El equipo también incluye: (b) un control seleccionado de : (i) un muestra de control para detectar la sensibilidad frente al inhibidor EGFR; (ii) un muestra de control para detectar la resistencia al inhibidor EGFR; (iii) información que contiene un nivel de control predeterminado del biomarcador que ha sido correlacionado con la sensibilidad frente al inhibidor EGFR; y/o (iv) información que contiene un nivel de control predeterminado del biomarcador que ha sido correlacionado con la resistencia al inhibidor EGFR. En un aspecto, el equipo además puede incluir al menos un medio para detectar al menos una mutación en el gen EGFR.

[0028] En un aspecto de este modo de realización, el medio para detectar en cualquiera de (a) (i) - (a) (iv) comprende una sonda de nucleótido que hibridiza a una parte del gen, incluyendo, pero no limitado a : una sonda de nucleótido que hibridiza a una parte del cromosoma humano 7 o el cromosoma humano 17; una sonda de nucleótido que hibridiza a una parte de un gen EGFR y a una parte del cromosoma 7, otro que el gen EGFR; y una sonda de nucleótido que hibridiza a una parte de un gen HER2 y a una parte del cromosoma 17, otro que la detección en (a) (v) o (a) (vi) comprende un fragmento de unión al anticuerpo o al antígeno del mismo que con criterio selectivo se une a la proteína. Preferentemente, cualquiera de los medios mencionados arriba para la detección comprende una un marcador detectable y/o es inmovilizado sobre un sustrato

Breve Descripción de las Figuras de la Invención

[0029] Las figuras 1A y 1B muestran curvas de Kaplan Meyers para el tiempo hasta la progresión de la enfermedad (A) y la supervivencia (B) en las seis categorías de FISH: Disomía, Baja Trisomía, Alta Trisomía, Baja Polisomía, Alta polisomía y Amplificación Génica en el Ejemplo 1.

Las figuras 2A y 2B muestran curvas de Kaplan Meyers para el tiempo hasta la progresión de la enfermedad (A) y la supervivencia (B) en Grupos 1 y 2 de FISH en el Ejemplo 1.

Las figuras 3A y 3B muestran curvas de Kaplan-Meier para el tiempo hasta la progresión de la enfermedad (figura 3A) y la supervivencia (figura 3B), analizadas de acuerdo con el nivel de expresión de la proteína.

La figura 4A muestra curvas de supervivencia para toda la cohorte S0126 (N = 136 pacientes) en comparación con la subcohorte para FISH de EGFR (N = 81 pacientes).

La figura 4B muestra la supervivencia sin progresión para los grupos positivo para FISH y negativo para FISH de EGFR.

La figura 4C muestra las curvas de supervivencia total para los grupos positivo para FISH y negativo para FISH de EGFR.

Descripción Detallada de la Invención

[0030] En base a los resultados prometedores de los estudios clínicos de Fase II, se aprobó gefitinib por la US Food and Drug Administration para el tratamiento de NSCLC quimiorefractario avanzado NSCLC en 2003, y erlotinib en 2004 después de que demostrase un beneficio en la supervivencia significativo en comparación con el placebo en pacientes con NSCLC pretratado (Shepherd y col., 2004). La eficacia clínica de estos inhibidores de tirosina cinasa de EGFR (EGFR-TKI) es significativa, pero lamentablemente se limita a un subgrupo de los pacientes. En el estudio BR-21 Canadiense (erlotinib frente a placebo), aproximadamente el 30 % de los pacientes muertos 3 meses después del inicio del tratamiento, que indicó que no se consiguió ningún beneficio clínico en este subgrupo de pacientes. Clínicamente, los pacientes que se benefician con mayor probabilidad tienen el género femenino, histología de adenocarcinoma y un nunca han fumado (Fukuoka y col., 2003; Kris y col., 2003, JAMA; Miller y col., 2004, J. Clin. Oncol.) . Sin embargo, los rasgos clínicos en solitario no son suficientes para la selección de los pacientes porque los pacientes que carecen de rasgos individuales todavía pueden beneficiarse. Estas observaciones han dejado la necesidad de proporcionar características biológicas que pueden predecir el beneficio del paciente en NSCLC y otros cánceres relacionados con la expresión de EGFR. La presente invención proporciona potentes biomarcadores y protocolos que abordan este problema.

[0031] La presente invención se refiere generalmente a la identificación de los pacientes con cáncer que se predice que se beneficiarán de la administración terapéutica de un inhibidor del receptor del factor de crecimiento epidérmico (EGFR). La presente invención también se refiere generalmente a métodos para identificar tratamientos que pueden mejorar la sensibilidad de las células cancerosas resistentes al inhibidor del EGFR al tratamiento, y al desarrollo de tratamientos adyuvante que mejoran la respuesta al inhibidor del EGFR.

[0032] Por consiguiente, una realización de la presente invención se refiere a un método y un kit de ensayo correspondiente para su uso en la selección de un paciente con cáncer que se predice que se beneficiará de la administración terapéutica de un inhibidor del receptor del factor de crecimiento epidérmico (EGFR), un agonista del mismo, o un fármaco que tiene una actividad biológica sustancialmente similar que el inhibidor del EGFR de referencia. El método incluye generalmente la detección en una muestra de células tumorales de un paciente de los biomarcadores relacionados con EGFR y combinaciones de los mismos que se ha descubierto por los inventores que son inestimable en la detección de células tumorales EGFR sensibles o resistentes al inhibidor del EGFR, prediciendo de esta manera el beneficio clínico de los pacientes con respecto al tratamiento que usa el inhibidor del EGFR. En base al descubrimiento de los inventores, se proponen una diversidad de pruebas y combinaciones de estrategias de detección de biomarcadores, y se analizarán en detalle a continuación. Inicialmente, sin embargo, la presente invención incluye el uso de las siguientes estrategias para la detección de biomarcadores, en solitario o en diversas combinaciones: (1) detección del nivel de amplificación del gen del receptor del factor de crecimiento epidérmico (EGFR) (por ejemplo, el gen que codifica EGFR); (2) detección de un nivel de polisomía del gen del receptor del factor de crecimiento epidérmico (EGFR); (3) detección de un nivel de amplificación génica del gen HER2; (4) detección del nivel de polisomía del gen HER2; (5) detección de mutaciones en el gen EGFR; (6) detección de expresión de la proteína de EGFR; y (7) detección de la expresión de Akt fosforilada. La invención incluye el uso de estos protocolos de detección individualmente o en diversas combinaciones, y la invención incluye adicionalmente el uso de diversas combinaciones de una o más técnicas de detección de biomarcadores para mejorar adicionalmente la capacidad del presente método para identificar tumores sensibles y resistentes al inhibidor del EGFR, así como predecir el beneficio clínico de los pacientes (por ejemplo, respuesta y resultado) con respecto a inhibidores del EGFR.

[0033] Los inventores también han descubierto que las combinaciones de las pruebas descritas en el presente documento pueden usarse para seleccionar pacientes con cáncer, incluyendo NSCLC, que no tendrán el beneficio clínico de los inhibidores del EGFR (por ejemplo pacientes con tumores que son negativos para dos o más pruebas).

[0034] Los presentes inventores han descubierto que los pacientes con células tumorales que muestran amplificación génica de EGFR y/o alta polisomía en lo que concierne al gen EGFR (también generalmente denominado en el presente documento como un aumento del número de copias del gen EGFR o una ganancia en el número de copias de EGFR), y/o la amplificación génica de HER2 y/o alta polisomía (también denominada generalmente en el presente documento como un aumento del número de copias del gen HER2 o una ganancia en el número de copias de HER2) en lo que concierne al gen HER2, se predice que serán especialmente sensibles al tratamiento con inhibidores del EGFR y, por lo tanto, son los mejores candidatos para el uso de esta línea de terapia. Por el contrario, los pacientes que tienen tumores con poca o ninguna ganancia en el número de copias de los genes EGFR y/o HER2 se predice que tienen un resultado deficiente con respecto al tratamiento con inhibidores del EGFR.

[0035] De modo interesante, los presentes inventores también han descubierto que para los pacientes que son EGFR negativos (por ejemplo, no predispuestos a no responder a inhibidores del EGFR en base a los resultados de EGFR en solitario), si los tumores de dichos pacientes tienen amplificación génica de HER2 y/o polisomía (por ejemplo, alta trisomía o alta o baja polisomía) del gen HER2, el resultado del paciente se compara mejor con pacientes sin amplificación génica de HER2 . Además, para pacientes predispuestos a responder a los inhibidores del EGFR en base a los resultados de EGFR en solitario, la amplificación génica de HER2 y/o la alta polisomía en los tumores de estos pacientes es profética de aún mayor sensibilidad con respecto al tratamiento con inhibidor del EGFR que en ausencia de la amplificación génica de HER2.

[0036] Los inventores también han descubierto que la expresión de la proteína de EGFR puede usarse para predecir el resultado del paciente con el tratamiento de inhibidor del EGFR, en contraste con estudios previos que no detectaron ninguna correlación entre la expresión de la proteína de EGFR y la respuesta a la terapia. Específicamente, los presentes inventores han usado criterios de evaluación que consideran tanto para la intensidad de expresión como la fracción de células de expresión positiva en una muestra, y ahora han demostrado que los pacientes que tenían células tumorales por encima del 50 % del protocolo de puntuación (es decir, representados expresores de EGFR positivo/alto) tenían resultados mucho mejores (por ejemplo, mejores tiempos de respuesta, tasas de progresión más lentas y tiempos de supervivencia mayores) cuando se trataban con inhibidores del EGFR que aquellos en los grupos de expresión inferior. Además, los inventores han demostrado que la combinación de detección de expresión de la proteína de EGFR amplificación génica de HER2 o EGFR o polisomía es considerablemente más predictiva del resultado del paciente al tratamiento de inhibidor del EGFR que la detección de uno o ningún marcador.

[0037] Los inventores también han descubierto encontrado que un grupo de pacientes con cáncer con baja/ninguna ganancia del gen EGFR (por ejemplo, "FISH negativa") y baja/ninguna expresión de la proteína de EGFR (por ejemplo, "IHC negativa"), que constituyen aproximadamente el 30 % del total de la población de NSCLC, parece no tener ningún beneficio clínico (ninguna/muy baja tasa de respuesta, tiempo corto hasta la progresión y tiempo corto de supervivencia) de los inhibidores del EGFR.

[0038] Los inventores también han mostrado que dos otros biomarcadores, concretamente genes EGFR mutados o expresión de Akt fosforilada, pueden combinarse con cualquiera de estos biomarcadores y protocolos que se han analizado anteriormente para mejorar la capacidad de detectar a pacientes predispuestos a responder al tratamiento del inhibidor del EGFR. Por ejemplo, los inventores demuestran en el presente documento que la combinación de detección de mutaciones en el gen EGFR con la expresión de proteína de EGFR, la amplificación génica de EGFR y/o polisomía, y/o la amplificación génica de HER2 y/o polisomía, puede usarse para seleccionar pacientes que tendrán un beneficio clínico de la terapia de inhibidor del EGFR. Los inventores también han demostrado en el presente documento que la combinación de la detección de Akt fosforilada (es decir, Akt activada) con la detección de la expresión de proteína de EGFR y/o detección de amplificación génica de EGFR y/o polisomía puede usarse seleccionar pacientes que tendrán un beneficio clínico de la terapia de inhibidor del EGFR.

[0039] Los presentes inventores también demuestran en el presente documento el poder de usar técnicas de detección particulares, hibridación fluorescente in situ (FISH) e inmunohistoquímica (IHC) en los presentes métodos, aunque los métodos de la invención no se limitan al uso de estas técnicas.

[0040] Finalmente, aunque muchos de los ejemplos proporcionados en el presente documento se refieren al inhibidor de EGFR, gefitinib, los métodos de la presente invención no se limitan a la predicción de los pacientes que responderán o no responderán a este inhibidor del EGFR particular, sino más bien, pueden usarse para predecir resultado del paciente a cualquier inhibidor de EGFR, incluyendo inhibidores que son moléculas pequeñas (fármacos), péptidos, anticuerpos, ácido nucleicos, u otros tipos de inhibidores. Por ejemplo, los presentes inventores también han demostrado el uso de los presentes métodos para predecir la resistencia del tumor o la susceptibilidad al inhibidor de EGFR, Cetuximab (Erbitux®), que es un anticuerpo monoclonal que se une a EGFR e impide la unión del ligando natural al receptor.

[0041] Más específicamente, los presentes inventores han demostrado que el número de copias del gen EGFR (determinado por polisomía y/o amplificación génica) detectado por FISH y la expresión de la proteína de EGFR por IHC relacionado significativamente con la actividad de gefitinib, y los pacientes que tenían amplificación génica de EGFR y/o polisomía (particularmente alta polisomía) y/o alta expresión de la proteína de EGFR tenían una mejora significativa en la respuesta, tiempo hasta la progresión y supervivencia. Los inventores también han demostrado que la amplificación génica de HER2 y/o polisomía (particularmente alta polisomía) proporciona efectos similares. El mayor beneficio se observó en pacientes con amplificación génica, siento particularmente fuerte la combinación de amplificación génica de EGFR y la amplificación génica de HER2. Un análisis multivariante confirmó que la amplificación génica de EGFR y la polisomía (particularmente alta polisomía) y la expresión de la proteína de EGFR redujeron significativamente el riesgo de muerte en pacientes que recibieron gefitinib. Entre las características clínicas (sexo, historial como fumador, estado funcional e histología), únicamente la histología y el PS estuvieron relacionados significativamente con el riesgo de muerte cuando el modelo se ajustó para el estado de EGFR. El riesgo de muerte fue significativamente inferior en pacientes con adenocarcinoma o carcinoma bronquioloalveolar y significativamente mayor para aquellos con un estado funcional 2.

[0042] Anterior a la presente invención, el papel pronóstico de la expresión de la proteína de EGFR o el estado del gen en NSCLC ha sido confuso en el mejor de los casos, como han ido variando los informes en la bibliografía. Los inventores han estudiado el papel pronóstico de la expresión de la proteína de EGFR y el número de copias de genes y descubrieron que la expresión de la proteína de EGFR relacionada con un aumento del número de copias de genes, y que un elevado número de copias de genes por célula mostró una tendencia hacia un mal pronóstico (Hirsch y col., 2003 JCO). Asimismo, los inventores estudiaron el número de copias del gen HER2 y la expresión de proteína en 238 pacientes con NSCLC y descubrieron que una elevada expresión de proteína de HER2 mostrada una tendencia hacia una supervivencia más corta (Hirsch y col., BJC, 2002). Sin embargo, los niveles de expresión de la proteína de EGFR evaluados por ensayos inmunohistoquímicos no han demostrado previamente una relación con la respuesta a la terapia en estudios preclínicos (Sirotnak y col., Clin Cancer Res 2000; 6: 4885-92) y clínicos (Kris y col., 2003, JAMA; Giaccone y col., 2004). Gefitinib ejerce su acción a nivel proteico, por lo tanto, no se esperaba que el número de copias del gen EGFR por célula pudiera ser un indicador de una respuesta clínica, dada la falta de correlación con los estudios inmunohistoquímicos.

[0043] En el estudio ilustrado en el Ejemplo 1, se observó una mejor respuesta en la cohorte con amplificación o alta polisomía para el gen EGFR, confirmando, por lo tanto, el impacto positivo del fármaco en este grupo de pacientes. Además, la supervivencia a 1 año de los pacientes en pacientes positivos para FISH (Grupo 2 en el Ejemplo 1 que se indica a continuación) fue notablemente mayor en el estudio de los presentes inventores que notificaron sobre los ensayos de fase II anteriores con.

[0044] Un inconveniente principal para los estudios clínicos con gefitinib ha sido la falta de relación entre el nivel de expresión de la proteína de EGFR y la respuesta al tratamiento. Otros estudios centrados en HER2 y la respuesta a trastuzumab en cáncer de mama confirmaron que los análisis genómicos se relacionaban mejor con la respuesta que la expresión de proteína puntuada como 2+ en el HerceptTest (Vogel y col., 2002; Bartlett y col., 2003). La identificación de mutaciones del gen EGFR específicas en pacientes sensibles a gefitinib confirmaron la validez de los análisis a nivel genómico (Lynch y col., 2004; Paez y col., 2004). Sin embargo, estos estudios implicaban tecnología para el análisis completamente diferente del propuesto en la presente invención.

[0045] En los estudios presentados en el presente documento, se estudiaron los números de copias de los genes EGFR y HER2 por FISH ya que este método presenta varias ventajas, aunque la práctica de la presente invención no se limita a esta técnica. El análisis por FISH se basa en el ADN y puede realizarse con éxito en muestras tumorales embebidas en parafina frescas o conservadas. La tecnología está bien establecida, tiene un plazo corto en la citogenética clínica y laboratorios de patología molecular, y ya está disponible en el mercado la sonsa FISH de EGFR. Además, para pacientes con enfermedad avanzada, y especialmente para aquellos que progresan después de las terapias convencionales, la estabilización de la enfermedad y la mejora sintomática con parámetros importantes, y gefitinib alcanza su meta en aproximadamente el 40 % de los casos (Fukuoka y col., 2003; Kris y col., 2003, JAMA). Los resultados demostraron que los pacientes con amplificación génica de EGFR y alta polisomía tuvieron ventajas significativas no sólo sobre la respuesta, sino también en la tasa de control de la enfermedad. Estos hallazgos, junto con la simplicidad del ensayo y la reproducibilidad del resultado, sostienen el uso rutinario de análisis por FISH de EGFR y están relacionados con técnicas para seleccionar pacientes con pacientes con NSCLC para la terapia de gefitinib.

[0046] Las características clínicas de la población evaluadas en el estudio descritas en los Ejemplos 1 y 3 reflejan lo que se observa generalmente en Italia en la práctica clínica, y el resultado de esta cohorte está en el mismo intervalo de los estudios IDEAL 1 y 2 (Fukuoka y col., 2003; Kris y col., 2003, JAMA). El estado del EGFR apenas se ha estudiado en cáncer de pulmón. En el estudio actual, el 12,7 % de los tumores tenía amplificación génica y el 19,7 % tenía un alto nivel de polisomía. Se ha indicado amplificación génica en el 6,2 % de 286 especimenes usando análisis de transferencia de Southern (Reissmann y col., 1999), mientras que se ha observado respectivamente polisomía y amplificación en el 13 % y el 9 % de 183 NSCLC investigados en una micromatriz de tumor (Hirsch y col., 2003 JCO). Otros estudios de población verificaron si esta variabilidad representa la heterogeneidad real en los pacientes con NSCLC.

[0047] También se evaluaron los niveles de expresión de proteína de EGFR por inmunohistoquímica y los elevados niveles se relacionaron estadísticamente de forma significativa con una mejor respuesta, tasa de control de la enfermedad, tiempo hasta la progresión y supervivencia como se describe a continuación en los Ejemplos. En los estudios presentados en el presente documento, la sensibilidad a gefitinib se asoció con una alta expresión de la proteína de EGFR; los resultados en pacientes con bajas puntuaciones de la expresión de EGFR (<200) fueron tan deficientes como en los pacientes con bajos números de copias de genes o que carecen de mutaciones. Las razones para la diferencia en los resultados de esta invención en comparación con informes anteriores pueden ser múltiples. Por ejemplo, los presentes inventores han usado un sistema de puntuación diferente al de los investigadores anteriores, teniendo en cuenta tanto la fracción de células que expresan EGFR (0-100 %) como la intensidad de la expresión (1-4), que puede haber mejorado la capacidad de los inventores para detectar y analizar diferencias en la expresión. Sin embargo, la aplicación de esta invención no se limita a estos criterios de puntuación, y pueden ser útiles otros métodos de evaluación en la práctica de la invención. Los análisis inmunohistoquímicos para la expresión de la proteína de EGFR es un ensayo fácilmente aplicable clínicamente y el anticuerpo usado en esta invención se basa en un anticuerpo disponible en el mercado (Zymed; véanse los Ejemplos). Sin embargo, la aplicación de esta invención no se limita a un anticuerpo específico.

[0048] Otro importante hallazgo de los estudios descritos en el presente documento fue la ausencia virtual de mutaciones de EGFR en pacientes con enfermedad estable. Entre los 21 pacientes con enfermedad estable que se evaluaron para comprobar las mutaciones de EGFR, únicamente un paciente tenía una mutación de EGFR. El pequeño número de mutaciones en pacientes con enfermedad estable tiene relevancia clínica ya que los datos de un estudio clínico mostraron que el beneficio en la supervivencia de gefitinib no se limita a los pacientes que respondieron al tratamiento (Shepherd y col., 2004). Es posible que la mejora en la supervivencia en los pacientes tratados con gefitinib, como un conjunto, se deba a la presencia de un grupo de pacientes con un beneficio intermedio del tratamiento, tal como aquellos con enfermedad estable, que se excluirían del tratamiento con inhibidor de tirosina cinasa si el análisis de mutación se estableció como la prueba de elección para la selección de pacientes. Además, aunque estudios previos sugirieron que las mutaciones de EGFR están presentes en la gran mayoría de los pacientes que responden al tratamiento (Lynch y col., 2004; Paez y col., 2004; Pao y col., 2004), en este estudio, los inventores observaron que el 40 % de los pacientes con mutaciones en EGFR tenían enfermedad progresiva.

[0049] En los estudios presentados en el presente documento, los inventores también descubrieron una relación entre la ruta de Akt activada (por ejemplo, la expresión de Akt fosforilada) y sensibilidad a gefitinib, una relación que también se había descrito y analizado por otros (Sordella y col., 2004; Cappuzzo y col., 2004, J. Natl Cancer Inst.). El análisis combinado del estado de EGFR y P-Akt indicó que, independiente del método de evaluación de EGFR, cuando el estado de EGFR fue positivo, la presencia de fosforilación de Akt estaba relacionada significativamente con una mejor respuesta, tasa de control de la enfermedad, tiempo hasta la progresión y supervivencia. De manera importante, se observó un mejor resultado no sólo cuando el subconjunto de pacientes EGFR+/P-Akt+ se comparó con todos los demás grupos combinados pero también cuando este subconjunto se comparó con pacientes positivos para EGFR pero negativos para P-Akt. Estos hallazgos sostienen la hipótesis de que, cuando la diana de gefitinib está presente pero la ruta anti-apoptótica no está activada, el paciente no es sensible a los efectos inhibidores de gefitinib. Como se espera, el grupo EGFR+/P-Akt+ también tuvo un resultado significativamente mejor en comparación con el grupo EGFR negativo y P-Akt positivo, confirmando los datos preclínicos que indican que la activación de Akt independiente de EGFR aberrante puede conducir a una resistencia a gefitinib (Bianco y col., 2003; Janmaat y col., 2003). Estos datos indican que el estado P-Akt positivo es relevante en pacientes EGFR positivo para la identificación de un subgrupo de pacientes particularmente sensibles al fármaco. En pacientes EGFR negativo, el estado P-Akt positivo puede identificar un grupo de pacientes con una posibilidad muy baja de beneficiarse del tratamiento con gefitinib.

[0050] La información concerniente a la relación entre la expresión de la proteína de EGFR y la activación de la ruta de Akt promoverá en gran medida la compresión del mecanismo de sensibilidad a gefitinib. Los inventores compararon la expresión de la proteína de EGFR y P-Akt en un subgrupo de pacientes y, en general, los inventores encontraron la expresión de las proteínas de EGFR y P-Akt en las mismas poblaciones celulares (datos no mostrados), sugiriendo que la P-Akt observado era resultado de la actividad de EGFR.

[0051] Los métodos y kits de ensayo proporcionados por la presente invención son extremadamente útiles para pacientes con cualquier cáncer que puedan tratarse con inhibidores del EGFR, tal como NSCLC. Dichos pacientes, como resultado de los métodos proporcionados en el presente documento, podrían evitar los efectos secundarios y los costes financieros de una terapia ineficaz en el caso de que no tengan una ganancia genómica que afecte al locus de EGFR y tengan una baja o ninguna expresión de la proteína de EGFR. En segundo lugar, es útil para los médicos, que pueden recomendar, o no, este tratamiento específico (es decir, terapia con inhibidor de EGFR) a pacientes particulares en base a la información sobre las características moleculares de sus tumores. En tercer lugar, aumentará la demanda para el ensayo por FISH con sondas EGFR disponibles y aún por desarrollar.

[0052] Se describen más realizaciones específicas de la invención como se indica a continuación. En una realización, el método incluye la detección en una muestra de células tumorales de un paciente de un nivel de amplificación (descrito en detalle a continuación) del gen del receptor del factor de crecimiento epidérmico (EGFR) (es decir, el gen que codifica EGFR). Los pacientes con células tumorales que muestran amplificación génica de EGFR están predispuestos a responder al tratamiento con inhibidores del EGFR, y, por lo tanto, son los mejores candidatos para el uso de esta línea de terapia. Por el contrario, los pacientes que tienen tumores con poca o ninguna ganancia en la amplificación génica de EGFR están predispuestos para responder mal o no responder al tratamiento con inhibidores del EGFR y, por lo tanto, pueden usarse diferentes tratamientos terapéuticos con dichos pacientes. En otra realización relacionada, el método incluye la detección en una muestra de células tumorales de un paciente de un nivel de polisomía (descrito en detalle a continuación) del gen del receptor del factor de crecimiento epidérmico (EGFR). En esta realización, los pacientes con células tumorales que muestran mayor polisomía con respecto al gen EGFR están predispuestos a responder al tratamiento con inhibidores del EGFR, y, por lo tanto, son los mejores candidatos para el uso de esta línea de terapia. Por el contrario, los pacientes que tienen tumores con un bajo número de copias con respecto al gen EGFR están predispuestos para responder mal o no responder al tratamiento con inhibidores del EGFR. En una realización, este método de detección de la polisomía puede combinarse con la detección de amplificación génica de EGFR en las células tumorales. Comúnmente, la amplificación génica y la polisomía pueden denominarse como una ganancia en el número de copias del gen EGFR o un aumento del número de copias del gen EGFR. Además, los presentes inventores demuestran en el presente documento que el aumento del número de copias del gen EGFR detectado por FISH está relacionado con una mejora en la supervivencia después de la terapia de gefitinib en pacientes con carcinoma bronquioloalveolar (BAC) y adenocarcinoma con rasgos de BAC en fase avanzada, un subconjunto de NSCLC que puede servir como un modelo para el estudio de rutas de EGFR debido a sus características biológicas subyacentes.

[0053] En otra realización de la invención, el método incluye la detección en una muestra de células tumorales de un paciente de un nivel de amplificación génica del gen HER2 (es decir, el gen que codifica HER2). Los pacientes con células tumorales que muestran amplificación génica de HER2 están predispuestos a responder al tratamiento con inhibidores del EGFR, y, por lo tanto, son los mejores candidatos para el uso de esta línea de terapia. Por el contrario, los pacientes que tienen tumores con baja o ninguna amplificación génica de HER2 están predispuestos para responder mal o no responder al tratamiento con inhibidores del EGFR y, por lo tanto, pueden usarse diferentes tratamientos terapéuticos con dichos pacientes. En otra realización, el método incluye la detección en una muestra de células tumorales de un paciente de un nivel de polisomía del gen HER2. En esta realización, los pacientes con células tumorales que muestran mayor polisomía con respecto al gen HER2 están predispuestos a responder al tratamiento con inhibidores del EGFR, y, por lo tanto, son los mejores candidatos para el uso de esta línea de terapia. Por el contrario, los pacientes que tienen tumores con un bajo número de copias con respecto al gen HER2 están predispuestos para responder mal o no responder al tratamiento con inhibidores del EGFR. En una realización, este método de detección de la polisomía puede combinarse con la detección de amplificación génica de HER2 en las células tumorales. Comúnmente, la amplificación génica y la polisomía pueden denominarse como una ganancia en el número de copias del gen HER2 o un aumento del número de copias del gen HER2. Estos métodos también pueden combinarse con la detección de amplificación génica de EGFR y/o polisomía de EGFR. Los pacientes que tienen tumores que muestran tanto un aumento del número de copias del gen EGFR y un aumento del número de copias del gen HER2 están predispuestos incluso para ser mejores candidatos para responder al tratamiento con inhibidores del EGFR que pacientes con tumores que muestran aumentos del número de copias del gen EGFR en solitario. Además, los pacientes que tienen tumores que muestran baja o ninguna ganancia en el número de copias del gen EGFR pero que tienen un aumento del número de copias del gen HER2 están predispuestos para responder mejor al tratamiento con inhibidores del EGFR que los pacientes que tienen tumores con baja o ninguna ganancia en el número de copias del gen HER2.

[0054] Además descrito pero que no forma parte de la invención es que el método incluye la detección de un nivel de expresión de proteína EGFR en una muestra de células tumorales de un paciente (por ejemplo, empleando técnicas de inmunohistoquímica). Se prevé que los pacientes con células de tumor que muestran niveles más altos de proteína EGFR serán sensibles al tratamiento con inhibidores EGFR, y son por lo tanto los mejores candidatos para el empleo de esta línea de terapia. En particular, se prevé que los pacientes con células de tumor que tienen tanto una fracción más alta de células que expresan EGFR como una intensidad más alta de expresión de EGFR por las células serán sensibles al tratamiento con inhibidores EGFR. Además descrito es el empleo de un sistema puntuación de 0-400 basado en los resultados de la fracción y la intensidad (descrito detalladamente abajo), se prevé que los pacientes con células de tumor que tienen resultados de la expresión de proteína EGFR mayores que 200 responderán bien a un tratamiento con inhibidores EGFR. Además, este método puede ser combinado con la detección de amplificación génica HER2 y/o polisomía; detección de la amplificación génica EGFR y/o polisomía; la detección de mutaciones en EGFR (descrito abajo) y/o la detección de niveles de proteína Akt fosforilada (descrito abajo). Se prevé que los pacientes que tienen tumores con una alta expresión de proteína EGFR en combinación con : la amplificación génica HER2 y/o polisomía HER2, con la amplificación génica EGFR y/o polisomía EGFR, las mutaciones en el gen EGFR, y/o la expresión Akt fosforilada, serán sensibles al tratamiento con inhibidores EGFR.

[0055] En una realización de la invención, el método incluye la detección de mutaciones en el gen EGFR en una muestra de células tumorales de un paciente. Los pacientes con células tumorales que muestran mutaciones en el gen EGFR están predispuestos a responder al tratamiento con inhibidores del EGFR, y, por lo tanto, son los mejores candidatos para el uso de esta línea de terapia. Las mutaciones de activación causa actividad independiente del ligando de las tirosina cinasas del receptor, e informes recipientes muestran en las mutaciones de sentido erróneo y deleción específicas en el dominio de tirosina cinasa del gen EGFR (Lynch y col., 2004; Paez y col., 2004; Pao y col., 2004) están relacionadas con la sensibilidad al inhibidor de tirosina cinasa de EGFR, y también con el sexo femenino, histología de adenocarcinoma, y el estado de no fumador, todas características clínicas que se sabe que están relacionadas con la sensibilidad al inhibidor de la tirosina cinasa (Fukuoka y col., 2003; Kris y col., 2003, JAMA; Perez-Soler y col., 2001; Miller y col., 2003, Proc. Am Soc Clin Oncol.; Miller y col., 2004, J. Clin. Oncol.). Aunque estas mutaciones en EGFR pueden explicar la gran mayoría de respuestas objetivas obtenidas con los inhibidores de tirosina cinasa, el beneficio clínico observado con estos fármacos y el beneficio en la supervivencia identificado en un ensayo clínico anterior no pueden explicarse únicamente por la presencia de mutaciones.

[0056] Mientras que puede detectarse cualquier mutación en EGFR, ya se sabe que se producen múltiples mutaciones en seres humanos, particularmente en los exones 18, 19 y 21. Como se ha analizado anteriormente, este método puede combinarse con la detección de expresión de la proteína de EGFR; la detección de amplificación génica de EGFR y/o polisomía; la detección de amplificación génica de HER2 y/o polisomía; y/o la detección de niveles de proteína Akt fosforilada (descrita más adelante). Los pacientes que tienen tumores con una o más mutaciones en el gen EGFR en combinación con: alta expresión de la proteína de EGFR, amplificación génica de HER2 y/o polisomía de HER2, amplificación génica de EGFR y/o polisomía de EGFR, y/o expresión de Akt fosforilada, están predispuestos a responder al tratamiento con inhibidores del EGFR.

[0057] En otra realización de la invención, el método incluye la detección en una muestra de células tumorales de un paciente de niveles de proteína Akt fosforilada. El estado de activación de la proteína Akt se ha destacado como un importante protagonista en la sensibilidad al inhibidor de tirosina cinasa de EGFR en estudios preclínicos y clínicos (Sordella y col., 2004; Cappuzzo y col., 2004, J. Natl. Cancer Inst.). Akt es una serina/treonina cinasa que actúa corriente abajo de EGFR para regular muchos procesos celulares, incluyendo la supervivencia, la proliferación y el crecimiento celular, y se activa por fosforilación en los aminoácidos Thr308 y Ser473 (Datta y col., 1999). Sordella y col., anteriormente, mostraron que las mutaciones en EGFR de sensibilización a gefitinib activan rutas anti- apoptóticas que implican Akt en líneas celulares de cáncer de pulmón, y Cappuzzo y col., anteriormente, han mostrado que el estado de activación de Akt está relacionado con la sensibilidad a gefitinib de los pacientes con NSCLC, cuando a la respuesta y tiempo hasta la progresión, pero no en cuanto a supervivencia. La falta de asociación con la supervivencia podría explicarse por la presencia de un subconjunto de pacientes positivos para (P)-Akt fosforilada que son resistentes a la terapia de gefitinib como consecuencia de la activación de Akt por un mecanismo no dependiente de EGFR.

[0058] Los pacientes con células tumorales que expresan proteína Akt fosforilada están predispuestos a responder al tratamiento con inhibidores del EGFR, y, por lo tanto, son los mejores candidatos para el uso de esta línea de terapia. Como se ha analizado anteriormente, este método está diseñado para combinarse con una cualquiera de: la detección de expresión de la proteína de EGFR; la detección de amplificación génica de EGFR y/o polisomía; la detección de amplificación génica de HER2 y/o polisomía; y/o la detección de mutaciones en el gen EGFR, con el fin de mejorar la capacidad de identificar pacientes que tengan tumores que estén predispuestos a responder a la terapia con el inhibidor de EGFR. Los pacientes que tienen tumores que expresan Akt fosforilada en combinación con: una o más mutaciones en el gen EGFR, alta expresión de la proteína de EGFR, amplificación génica de HER2 y/o polisomía de HER2, y/o amplificación génica de EGFR y/o polisomía de EGFR, están predispuestos a responder al tratamiento con inhibidores del EGFR.

[0059] En una realización de la invención, el método incluye la detección de amplificación génica de HER2 y EGFR y/o polisomía usando hibridación fluorescente in situ (FISH).

[0060] En una realización de la invención, el método incluye la detección de proteína de EGFR o proteína Akt fosforilada usando técnicas inmunohistoquímicas (IHC).

[0061] Será evidente para los expertos en la técnica a partir de la descripción de la invención en el presente documento que una diversidad de combinaciones de los biomarcadores y protocolos de detección que se han descrito anteriormente pueden potenciar o mejorar la capacidad de identificar pacientes que están predispuestos a responder a la terapia inhibidores del EGFR (y que pacientes que están predispuestos a responder mal al tratamiento). Por lo tanto, se incluye en la invención cualquier combinación del uso de los biomarcadores, protocolos de detección y técnicas de detección. Además, la invención no se limita a las técnicas de detección que se describen en el presente documento (por ejemplo, FISH e IHC), ya que pueden usarse otras técnicas para conseguir el mismo resultado. A modo de ejemplo, las siguientes combinaciones particulares han demostrado ser particularmente útiles por los inventores en la predicción de la capacidad de respuesta a los inhibidores del EGFR: (1) combinación de la detección de amplificación génica de EGFR y/o polisomía usando FISH y la detección de amplificación génica de HER2 y/o polisomía usando FISH; (2) combinación de la detección de expresión de la proteína de EGFR usando IHC y la detección de amplificación génica de HER2 y/o polisomía usando FISH; (3) combinación de la detección de mutaciones en el gen EGFR y la detección de amplificación génica de HER2 y/o polisomía usando FISH; (4) combinación de la detección de amplificación génica de EGFR y/o polisomía usando FISH y la detección de expresión de la proteína de EGFR usando IHC; (5) combinación de la detección de expresión de la proteína de EGFR usando IHC y la detección de mutaciones en el gen EGFR; (6) combinación de la detección de expresión de la proteína de EGFR y la detección de proteína Akt fosforilada usando IHC; (7) la detección de amplificación génica de EGFR y/o polisomía y la detección de mutaciones en el gen EGFR; (8) la detección de amplificación génica de EGFR y/o polisomía, la detección de expresión de la proteína de EGFR usando IHC, y la detección de mutaciones en el gen EGFR; y (9) la detección de amplificación génica de EGFR y/o polisomía, la detección de expresión de la proteína de EGFR usando IHC, y la detección de expresión de proteína Akt fosforilada usando IHC.

[0062] Los métodos de la presente invención pueden usarse para predecir eficazmente la capacidad de respuesta de tumores de pacientes y el resultado clínico al tratamiento con cualquier inhibidor de EGFR. Aunque la mayor parte de los datos proporcionados en el presente documento se generó en pacientes que recibieron el inhibidor de EGFR bien conocido, gefitinib (ZD 1839, Iressa®, AstraZeneca, Reino Unido), se entenderá que la evaluación de la capacidad de respuesta del tumor de los pacientes a cualquier inhibidor de EGFR de cualquier tipo se incluye por la presente invención.

[0063] De acuerdo con la presente invención, un inhibidor de EGFR es cualquier agente que inhibe (bloquea, reduce, antagoniza, disminuye, invierte) la expresión y/o la actividad biológica de un receptor del factor de crecimiento epidérmico (EGFR), incluyendo cualquier EGFR. Por lo tanto, un inhibidor puede incluir, pero sin limitación, un producto de diseño o selección de fármaco/compuesto/péptido, un fragmento de unión a anticuerpo o antígeno del mismo, una proteína, un péptido, un ácido nucleico (incluyendo ribozimas, antisentido, ARNi y aptámeros), o cualquier otro agente que inhibe la expresión y/o la actividad biológica de un EGFR. Por ejemplo, los inhibidores conocidos de EGFR incluyen los fármacos, gefitinib (ZD 1839, Iressa®, AstraZeneca, Reino Unido) y erlotinib (OSI 774, Tarceva®, Genentech, Estados Unidos), y el anticuerpo monoclonal, Cetuximab (Erbitux®, Imclone, Bristol-Myers Squibb). Sin embargo, la invención no se limita a estos agentes específicos, y puede incluir un agonista (descrito más adelante) de dichos agentes o agentes que tengan una actividad biológica sustancialmente similar a la de estos agentes. La actividad biológica o la acción biológica de una proteína, tal como un EGFR, se refiere a cualquier función o funciones mostradas o realizadas por una forma de origen natural de la proteína según se mide o se observa in vivo (es decir, en el entorno fisiológico natural de la proteína) o in vitro (es decir, en condiciones de laboratorio). Las actividades biológicas de EGFR incluyen, pero sin limitación, la unión a EGF, la homo o heterodimerización del receptor, la actividad de la tirosina cinasa, y actividades corriente abajo relacionadas con la homeostasis y el desarrollo celular.

[0064] A continuación se describirán diversas definiciones y aspectos de la invención, pero la invención no se limita a ninguna realización específica que pueda usarse con fines ilustrativos o ejemplares. En la medida en que gefitinib se describe en el presente documento, es un inhibidor de EGFR ejemplar y, como se ha analizado anteriormente, los métodos de la invención pueden aplicarse a la evaluación de la sensibilidad o la resistencia del tumor de un paciente a cualquier inhibidor de EGFR.

[0065] Los métodos de la presente invención incluyen detectar en una muestra de células tumorales de un paciente que se va a ensayar, una cualquiera o cualquier combinación de 2, 3, 4, 5, 6 o 7 de los siguientes biomarcadores y tipos de detección de dichos biomarcadores: (1) un nivel de amplificación del gen del receptor del factor de crecimiento epidérmico (EGFR) (es decir, el gen que codifica EGFR); (2) un nivel de polisomía del gen del receptor del factor de crecimiento epidérmico (EGFR); (3) un nivel de amplificación génica del gen HER2; (4) un nivel de polisomía del gen HER2; (5) mutaciones en el gen EGFR; (6) expresión de la proteína de EGFR (que no pertenecen a la invención); y/o (7) la expresión Akt fosforilada. La detección de (1) y (2) juntos y/o la detección de (3) y (4) juntos generalmente pueden indicar la detección de un incremento o un aumento del número de copias génicas. Según la invención presente, un biomarcador incluye cualquier gen o proteína o parte de eso que puede ser detectado, medido o de otra manera evaluado y se utiliza para identificar, medir o prever un efecto particular, que en la invención presente es la sensibilidad del tumor del paciente (o la no sensibilidad) a un inhibidor EGFR. Biomarcadores útiles en la invención presente incluyen el gen EGFR, el gen HER2 y la proteína Akt fosforilada. El empleo de un biomarcador según la invención puede incluir el empleo de un protocolo o una técnica particular para detectar o medir el biomarcador (los tipos de detección "por ejemplo., FISH-Fluorescent In Situ Hybridization o IHC- Immunohistochemistry) o la identificación de una característica particular asociada con el biomarcador, como la amplificación génica, la polisomía génica, el nivel de expresión del gen o la proteína, la identificación de una mutación, etc. Combinaciones preferidas en particular incluyen las combinaciones de los biomarcadores siguientes y tipos de detección de los mismos tal y como se describe arriba: (1) y (2); (3) y (4); (1), (2), (3) y (4); (2) y (4); (1) y/o (2) y (6); (1) y/o (2) y (7); y (6) y (7). La invención no está limitada a estas combinaciones.

[0066] Se conocen métodos adecuados para obtener una muestra de un paciente por un experto en la técnica. Una muestra de paciente puede incluir cualquier fluido corporal o tejido de un paciente que pueda contener células tumorales o proteínas de las células tumorales. Más específicamente, de acuerdo con la presente invención, la expresión "muestra de ensayo" o "muestra de paciente" puede usarse generalmente para referirse a una muestra de cualquier tipo que contenga células o productos que se han secretado de las células que se van a evaluar por el presente método, incluyendo, pero sin limitación, una muestra de células aisladas, una muestra tisular y/o una muestra de fluido corporal. Mucho más típicamente en la presente invención, la muestra es una muestra de tejido. De acuerdo con la presente invención, una muestra de células aisladas es un especimen de células típicamente en suspensión o separadas del tejido conectivo que pueden tener conectadas las células en un tejido in vivo, que se han recogido de un órgano, tejido o fluido mediante cualquier método adecuado que dé como resultado la recolección de un número adecuado de células para su evaluación por el método de la presente invención. Las células en la muestra celular no son necesariamente del mismo tipo, aunque pueden usarse métodos de purificación para enriquecer el tipo de células que se evalúan preferiblemente. Las células pueden obtenerse, por ejemplo, raspando un tejido, procesando una muestra tisular para liberar células individuales, por aislamiento de un fluido corporal.

[0067] Una muestra tisular, aunque similar a una muestra de células aisladas, se define en el presente documento como una sección de un órgano o tejido del cuerpo que típicamente incluye varios tipos celulares y/o una estructura citoesquelética que mantiene las células juntas. Un experto en la técnica apreciará que puede usarse la expresión "muestra tisular", en algunos casos, de forma intercambiable con una "muestra celular", aunque se usa preferiblemente para designar una estructura más compleja que una muestra celular. Una muestra tisular puede obtenerse mediante una biopsia, por ejemplo, incluyendo mediante corte, rebanado o punzonado.

[0068] Una muestra de fluido corporal, como la muestra tisular, contiene las células que se van a evaluar, y es un fluido obtenido mediante cualquier método adecuado para el fluido corporal particular a muestrear. Los fluidos corporales adecuados para el muestreo incluyen, pero sin limitación, pero sin limitación, sangre, moco, líquido seminal, saliva, esputo, lavado bronquial, leche materna, bilis y orina.

[0069] En general, el tipo de muestra (es decir, célula, tejido o fluido corporal) se selecciona en base a la accesibilidad y la estructura del órgano o tejido a evaluar para el crecimiento de células tumorales y/o en base a qué tipo de cáncer se va a evaluar. Por ejemplo, si el órgano/tejido a evaluar es el pecho, la muestra puede ser una muestra de células epiteliales de una biopsia (es decir, una muestra celular) o una muestra de tejido mamario de una biopsia (una muestra tisular). La presente invención es particularmente útil para evaluar pacientes con cáncer de pulmón y particularmente, carcinoma de pulmón de células no pequeñas, y en este caso, una muestra típica es una sección de un tumor del pulmón del paciente.

[0070] El número de copias de genes en células tumorales de acuerdo con la invención puede medirse, por ejemplo, en ensayos por FISH, en los núcleos, y la expresión de proteína puede medirse, por ejemplo, en ensayos de inmunohistoquímica, en el núcleo de las células tumorales, citoplasma y/o membranas. Ambos ensayos, por ejemplo, FISH e inmunohistoquímica, así como otros medios de detección, pueden realizarse en tumores primarios, tumores metastásicos, tumores recurrentes localmente, esputo, lavado bronquial, ascitis, líquido cefalorraquídeo, u otras configuraciones tumorales. Los marcadores pueden medirse en especimenes de tumor que estén frescos, congelados, fijados o conservados de otro modo.

[0071] Una vez que se obtiene una muestra del paciente, la muestra se evalúa para la detección de uno o más de cualquiera de los biomarcadores descritos en el presente documento. En algunas realizaciones de la presente invención, un tejido, una célula o una porción de los mismos (por ejemplo, una sección de tejido, un componente de una célula, tal como ácidos nucleicos, etc.) se ponen en contacto con uno o más ácidos nucleicos. Dichos protocolos se usan para detectar la expresión génica, la amplificación génica y/o la polisomía génica, por ejemplo. Dichos procedimientos pueden incluir ensayos basados en células o ensayos no basados en células. El tejido o célula que expresa un gen diana se pone en contacto típicamente con un agente de detección (por ejemplo, una sonda, cebador, u otro marcador detectable), mediante cualquier método adecuado, tal como mezcla, hibridación o combinación de manera que permita la detección del gen diana mediante una técnica adecuada.

[0072] La muestra del paciente se prepara mediante cualquier método adecuado para la técnica de detección utilizada. En una realización, la muestra del paciente puede usarse fresca, congelada, fijada o conservada de otro modo. Por ejemplo, las células del tumor del paciente pueden prepararse inmovilizando el tejido del paciente, por ejemplo, en parafina. El tejido inmovilizado puede seccionarse y después ponerse en contacto con una sonda para la detección de la hibridación de la sonda a un gen diana (por ejemplo, EGFR o HER2).

[0073] En una realización preferida, la detección de un gen de acuerdo con la presente invención se realiza usando ensayos de hibridación. La hibridación de ácidos nucleicos simplemente implica poner en contacto una sonda (por ejemplo, un oligonucleótido o un polinucleótido mayor) y ácido nucleico diana en condiciones en las que la sonda y su diana complementaria puedan formar dúplex híbridos estables a través de emparejamiento complementario de bases. Como se usa en el presente documento, las condiciones de hibridación se refieren a condiciones de hibridación convencionales bajo las que se usan moléculas de ácido nucleico para identificar moléculas de ácido nucleico similares. Se desvelan dichas condiciones convencionales, por ejemplo, en Sambrook y col., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Labs Press, 1989. Sambrook y col., ibid.,. Además, las fórmulas para calcular la hibridación apropiada y las condiciones de lavado para conseguir una hibridación que permita grados variables de apareamiento erróneo de nucleótidos se desvelan, por ejemplo, en Meinkoth y col., 1984, Anal.

Biochem. 138, 267-284; Meinkoth y col., ibid.. es incorporado íntegramente en el presente documento por referencia (véase expresamente, las páginas 9.31-9.62). Además, se describen las fórmulas para calcular las condiciones de hibridación y lavado apropiadas para alcanzar la hibridación que permite grados variados de desajuste de los nucleótidos, por ejemplo, en Meinkoth et al., 1984, Anal. Biochem. 138, 267-284; Meinkoth et al., ibíd., es incorporado íntegramente por referencia en el presente documento. Los ácidos nucleicos que no forman los dúplex híbridos son quitados de los ácidos nucleicos hibridizados mediante el lavado y los ácidos nucleicos hibridizados entonces pueden ser detectados, típicamente mediante la detección de una un marcador unido perceptible. Generalmente es reconocido que los ácidos nucleicos son desnaturalizados aumentando la temperatura o disminuyendo la concentración de sal del buffer que contiene los ácidos nucleicos. En condiciones de rigurosidad bajas (por ejemplo, una temperatura baja y/o una alta concentración de sal) los dúplex híbridos (por ejemplo., ADN:ADN, ARN:ARN, o ARN:ADN) se formarán incluso donde/en los casos en que las secuencias templadas no son absolutamente complementarias. Así se reduce la especificidad de hibridación en una rigurosidad inferior. A la inversa, en una rigurosidad más alta (por ejemplo, la temperatura más alta o una concentración de sal inferior) la hibridación acertada requiere menos desajustes.

[0074] Las condiciones de lavado e hibridación de rigurosidad alta, tal como se les hace referencia en el presente documento, se refieren a condiciones que permiten el aislamiento de moléculas de ácido nucleico que presentan una identidad de secuencia de ácido nucleico de al menos aproximadamente el 90 % con la molécula de ácido nucleico que está utilizándose para estudiar con sonda en la reacción de hibridación (es decir, condiciones que permiten un apareamiento erróneo de nucleótidos de aproximadamente el 10 % o inferior). Un experto en la técnica puede utilizar las fórmulas en Meinkoth y col., 1984, Anal. Biochem. 138, 267-284 (incorporado íntegramente en el presente documento por referencia) para calcular las condiciones de hibridación y lavado apropiadas para alcanzar estos niveles particulares de desajuste de nucleótidos mal apareados. Tales condiciones variarán, dependiendo de si se están formando híbridos de ADN:ARN o de ADN:ADN. Temperaturas de fusión determinadas para híbridos ADN:ADN son 10°C menos que para híbridos ADN:ARN. En modos de realización particulares, condiciones de hibridación rigurosas para híbridos ADN:ADN incluyen la hibridación con una fuerza iónica de 6X SSC (0.9 M Na +) con una temperatura de entre aproximadamente 20°C y alrededor de los 35°C, más preferentemente, entre aproximadamente 28°C y aproximadamente 40°C, y aún más preferentemente, entre aproximadamente 35°C y aproximadamente 45°C. En modos de realización particulares, condiciones de hibridación rigurosas para híbridos ADN:ARN incluyen la hibridación con una fuerza iónica de 6X SSC (0.9 M Na+ con una temperatura de entre aproximadamente 30°C y aproximadamente 45°C, más preferentemente, entre aproximadamente 38°C y aproximadamente 50°C, y aún más preferentemente, entre aproximadamente 45°C y aproximadamente 55°C.

Dichos valores están basados en los cálculos de una temperatura de fusión para moléculas más grandes que aproximadamente 100 nucleótidos, el 0 % formamida y un contenido G + C del 40 % aproximadamente. O bien, la Tm puede ser calculada empíricamente tal y como se establece en Sambrook et al., supra, páginas 9.31 a 9.62.

[0075] Los ácidos nucleicos hibridados se detectan detectando una o más etiquetas fijadas a los ácidos nucleicos de muestra. Las etiquetas pueden incorporarse por un número cualquiera de medios bien conocidos por los expertos en la técnica. Las etiquetas detectable adecuadas para su uso en la presente invención incluyen cualquier composición detectable por medios espectroscópicos, fotoquímicos, bioquímicos, inmunoquímicos, eléctricos, ópticos o químicos. Las etiquetas útiles en la presente invención incluyen tintes fluorescentes (por ejemplo, fluoresceína, rojo texas, rodamina, Alexa flúor, tintes Spectrum, y similares), puntos cuánticos, radioetiquetas (por ejemplo, 3H 125I, 35S, 14C, o 32P), y etiquetas colorimétricas. Los medios de detección de dichas etiquetas se conocen bien por los expertos en la técnica. Por lo tanto, por ejemplo, pueden detectarse radioetiquetas usando película fotográfica o contadores de centelleo, los marcadores fluorescentes pueden detectarse usando un fotodetector para detectar la luz emitida y microscopios de fluorescencia. Las etiquetas colorimétricas se detectan visualizando simplemente la etiqueta coloreada. Preferiblemente, los ácidos nucleicos de hibridación se detectan mediante etiquetas fluorescentes y, mucho más preferiblemente, en el contexto de un ensayo de hibridación fluorescente in situ (FISH). Los ensayos por FISH se conocen bien en la técnica y se describen, por ejemplo, en la sección de Ejemplos.

[0076] De acuerdo con la presente invención, un polinucleótido aislado, o una molécula de ácido nucleico aislada, es una molécula de ácido nucleico que se ha retirado de su medio natural (es decir, que se ha sometido a manipulación humana), siendo su medio natural el genoma o el cromosoma en el que la molécula de ácido nucleico se encuentra en la naturaleza. Como tal, "aislado" no refleja el grado hasta el que la molécula de ácido nucleico se ha purificado, pero indica que la molécula no incluye un genoma en su totalidad o un cromosoma en su totalidad en el que la molécula de ácido nucleico se encuentra en la naturaleza. Los polinucleótidos tales como los usados en un método de la presente invención para detectar genes (por ejemplo, por hibridación a un gen) son típicamente una porción del gen diana que es adecuado para su uso como una sonda de hibridación o cebador PCR para la identificación de un gen de longitud completa (o porción del mismo) en una muestra dada (por ejemplo, una muestra de células). Una molécula de ácido nucleico aislada puede incluir un gen o una porción de un gen (por ejemplo, la región reguladora o promotor). Una molécula de ácido nucleico aislada que incluye un gen no es un fragmento de un cromosoma que incluye tal gen, en su lugar incluye la región codificante y regiones reguladoras asociadas al gen, pero ningún gen adicional de origen natural en el mismo cromosoma. Una molécula de ácido nucleico aislada también puede incluir una secuencia de ácidos nucleicos específica flanqueada por (es decir, en el extremo 5' y/o el extremo 3' de la secuencia) ácidos nucleicos adicionales que no flanquean normalmente la secuencia de ácidos nucleicos especificados en la naturaleza (es decir, secuencias heterólogas). La molécula de ácido nucleico aislada puede incluir ADN, ARN (por ejemplo, ARNm), o derivados de ADN o ARN (por ejemplo, ADNc). Aunque la expresión "molécula de ácido nucleico" se refiere principalmente a la molécula de ácido nucleico física y la expresión "secuencia de ácidos nucleicos" se refiere principalmente a la secuencia de nucleótidos de la molécula de ácido nucleico, las dos fases pueden usarse de forma intercambiable, especialmente con respecto a una molécula de ácido nucleico, o una secuencia de ácido nucleico, que es capaz de codificar una proteína. Preferiblemente, una molécula de ácido nucleico aislada de la presente invención se produce usando tecnología de ADN recombinante (por ejemplo, amplificación por reacción en cadena de la polimerasa (PCR), clonación) o síntesis química.

[0077] De acuerdo con la presente invención, una sonda (sonda de oligonucleótidos) es una molécula de ácido nucleico que varía típicamente de tamaño de aproximadamente 50-100 nucleótidos a varios cientos de nucleótidos a varios miles de nucleótidos de longitud. Por lo tanto, una sonda puede ser cualquier longitud adecuada para su uso en un ensayo descrito en el presente documento, incluyendo cualquier longitud en el intervalo de 50 a varios miles de nucleótidos, en aumentos de números enteros. Tal molécula se usa típicamente para identificar una secuencia de ácido nucleico diana en una muestra hibridando a dicha secuencia de ácido nucleico diana en condiciones de hibridación rigurosas. Las condiciones de hibridación se han descrito en detalle anteriormente.

[0078] Los cebadores PCR también son secuencias de ácidos nucleicos, aunque los cebadores PCR son típicamente oligonucleótidos de una longitud bastante corta (por ejemplo, 8-30 nucleótidos) que se usan en reacciones en cadena de la polimerasa. Los cebadores PCR y las sondas de hibridación pueden desarrollarse y producirse selectivamente por los expertos en la técnica, usando la información de secuencia de la secuencia diana.

(Véase, por ejemplo, Sambrook y col., anteriormente o Glick y col., anteriormente).

[0079] La secuencia nucleotídica del gen del receptor del factor de crecimiento epidérmico (EGFR) se conoce en la técnica y puede encontrarse bajo el Nº de Acceso al GenBank AY588246 (incorporado aquí por referencia), por ejemplo. La secuencia nucleotídica del gen del receptor del tipo receptor de la tirosina cinasa humana (HER2) también se conoce en la técnica y puede encontrarse, por ejemplo, bajo los Nº de Acceso al GenBank M16789, M16790, M16791, M16792 y M11730. También se conocen en la técnica sondas nucleotídicas y están disponibles para su uso como sondas para detectar genes EGFR o genes HER2. Por ejemplo, está disponible tal sonda para detectar ambas secuencias de EGFR y el centrómero del cromosoma 7 (por ejemplo, sonda LSI EGFR SpectrumOrange/CEP 7 SpectrumGreen (Vysis, Abbott Laboratories).

[0080] En el método de la invención, el nivel de amplificación génica de EGFR y/o polisomía en la muestra de células tumorales se compara con un nivel de control de la amplificación génica de EGFR y/o polisomía seleccionado entre: (i) un nivel de control que se ha correlacionado con la sensibilidad a un inhibidor de EGFR; y (ii) un nivel de control que se ha correlacionado con la resistencia al inhibidor de EGFR. Un paciente se selecciona como predispuesto a beneficiarse de la administración terapéutica de un inhibidor de EGFR, un agonista del mismo, o un fármaco que tiene una actividad biológica sustancialmente similar que el inhibidor de EGFR, si el nivel de amplificación génica de EGFR y/o polisomía en las células tumorales del paciente es estadísticamente similar a o mayor que el nivel de control de amplificación génica de EGFR y/o polisomía que se ha correlacionado con la sensibilidad al inhibidor de EGFR, o si el nivel de amplificación génica de EGFR y/o polisomía en las células tumorales del paciente es estadísticamente mayor que el nivel de amplificación génica de EGFR y/o polisomía que se ha correlacionado con la resistencia al inhibidor de EGFR. Un paciente se selecciona como predispuesto a no beneficiarse de la administración terapéutica de un inhibidor de EGFR, un agonista del mismo, o un fármaco que tiene una actividad biológica sustancialmente similar que el inhibidor de EGFR, si el nivel de amplificación génica de EGFR y/o polisomía en las células tumorales del paciente es estadísticamente menor que el nivel de control de amplificación génica de EGFR y/o polisomía que se ha correlacionado con la sensibilidad al inhibidor de EGFR, o si el nivel de amplificación génica de EGFR y/o polisomía en las células tumorales del paciente es estadísticamente similar a o menor que el nivel de amplificación génica de EGFR y/o polisomía que se ha correlacionado con la resistencia al inhibidor de EGFR.

[0081] De forma análoga, en el caso en el que se evalúa la amplificación génica de HER2 y/o la polisomía, el nivel de amplificación génica de HER2 y/o polisomía en la muestra de células tumorales se compara con un nivel de control de amplificación génica de HER2 y/o polisomía seleccionado entre: (i) un nivel de control que se ha correlacionado con la sensibilidad al inhibidor de EGFR; y (ii) un nivel de control que se ha correlacionado con la resistencia al inhibidor de EGFR. Un paciente se selecciona como predispuesto a beneficiarse de la administración terapéutica del inhibidor de EGFR, un agonista del mismo, o un fármaco que tiene una actividad biológica sustancialmente similar que el inhibidor de EGFR, si el nivel de amplificación génica de HER2 y/o polisomía en las células tumorales del paciente es estadísticamente similar a o mayor que el nivel de control de amplificación génica de HER2 y/o polisomía que se ha correlacionado con la sensibilidad al inhibidor de EGFR, o si el nivel de amplificación génica de HER2 y/o polisomía en las células tumorales del paciente es estadísticamente mayor que el nivel de amplificación génica de HER2 y/o polisomía que se ha correlacionado con la resistencia al inhibidor de EGFR. Un paciente se selecciona como predispuesto a no beneficiarse de la administración terapéutica de un inhibidor de EGFR, un agonista del mismo, o un fármaco que tiene una actividad biológica sustancialmente similar que el inhibidor de EGFR, si el nivel de amplificación génica de HER2 y/o polisomía en las células tumorales del paciente es estadísticamente menor que el nivel de control de amplificación génica de HER2 y/o polisomía que se ha correlacionado con la sensibilidad al inhibidor de EGFR, o si el nivel de amplificación génica de HER2 y/o polisomía en las células tumorales del paciente es estadísticamente similar a o menor que el nivel de amplificación génica de HER2 y/o polisomía que se ha correlacionado con la resistencia al inhibidor de EGFR.

[0082] Más específicamente, de acuerdo con la presente invención, un "nivel de control" es un nivel de control de la amplificación génica y/o la polisomía, que puede incluir un nivel que se correlaciona con la sensibilidad al inhibidor de EGFR o un nivel que se correlaciona con la resistencia al inhibidor de EGFR. Por lo tanto, puede determinarse, en comparación con el nivel de control o basal de la amplificación génica y/o polisomía, si una muestra de paciente tiene más probabilidad de ser sensible o resistencia a la terapia con el inhibidor de EGFR (por ejemplo, un buen respondedor o respondedor (que se beneficiará de la terapia), o un mal respondedor o no respondedor (que no se beneficiará o se beneficiará poco de la terapia)).

[0083] En una realización de la invención en la que se evalúa el número de copias de genes (es decir, por amplificación génica y/o polisomía génica), los pacientes se clasificaron en seis categorías con un número ascendente de copias por célula: (1) Disomía (2 copias de ambas dianas en >90 % de las células); (2) Baja trisomía (2 copias del gen en 40 % de las células y 3 copias en el 10-40 % de las células); (3) Alta trisomía (2 copias del gen en 40 % de las células y 3 copias en 40 % de las células); (4) Baja polisomía (4 copias del gen en 10-40 % de las células); (5) Alta polisomía (4 copias del gen en 40 % de las células); y (6) Amplificación Génica (GA), definida por la presencia de estrechos agrupamientos del gen EGFR y una relación gen/cromosoma por célula 2, o un promedio de 15 copias de EGFR por célula en 10 % de las células analizadas. Los presentes inventores han descubierto que los pacientes con elevados números de copias de genes o una ganancia en el número de copias (por ejemplo, amplificación génica y/o polisomía, incluyendo alta trisomía, baja polisomía o alta polisomía) de EGFR y/o HER2 tienen más probabilidad de tener una mayor tasa de respuesta a la terapia con el inhibidor de EGFR, una menor tasa de enfermedad progresiva, un mayor tiempo hasta la progresión, y una mayor tasa de supervivientes a largo plazo. Cuanto mayor es la polisomía o la ganancia total en el número de copias de genes, mejor será el resultado pronosticado. Los presentes inventores descubrieron que la presencia de amplificación génica de HER2 y/o polisomía en células de tumor de los pacientes confiere un fenotipo más sensible para los pacientes EGFR positivo (por ejemplo, pacientes que muestran una ganancia en el número de copias del gen EGFR) y un mejor resultado para los pacientes EGFR negativo (por ejemplo, pacientes que tienen poca o ninguna ganancia en el número de copias del gen EGFR).

[0084] El método para establecer un nivel de control de la amplificación génica o polisomía se selecciona en base al tipo de muestra, el tejido u órgano del que se obtiene la muestra, y el estado del paciente a evaluar. Preferiblemente, el método es el mismo método que se usará para evaluar la muestra en el paciente. En una realización preferida, el nivel de control se establece usando el mismo tipo de célula que la célula a evaluar. En una realización preferida, el nivel de control se establece a partir de muestras de control que son de pacientes o líneas celulares que se sabe que son resistentes o sensibles a gefitinib. En un aspecto, las muestras de control se obtuvieron de una población de individuos emparejados. De acuerdo con la presente invención, la expresión "individuos emparejados" se refiere a un emparejamiento de los individuos de control en base a una o más características que son adecuadas para el tipo de crecimiento celular o tumoral a evaluar. Por ejemplo, los individuos de control pueden emparejarse con el paciente a evaluar en base al sexo, edad, raza o cualquier factor biológico o sociológico relevante que puedan afectar a la línea basal de los individuos de control y el paciente (por ejemplo, condiciones preexistentes, consumo de sustancias particulares, niveles de otros factores biológicos o fisiológicos). Para establecer un nivel de control, se obtienen muestras de varios individuos emparejados y se evalúan de la misma manera que para las muestras de ensayo. El número de individuos emparejados de los que deben obtenerse muestras de control para establecer un nivel de control adecuado (por ejemplo, una población) puede determinarse por los expertos en la técnica, pero debe ser estadísticamente apropiado para establecer una línea basal adecuada para la comparación con el paciente a evaluar (es decir, el paciente de ensayo). Los valores obtenidos de las muestras de control se procesan estadísticamente usando cualquier método adecuado de análisis estadístico para establecer un nivel inicial adecuado usando métodos convencionales en la técnica para establecer dichos valores. La sección de Ejemplos describe dichos métodos estadísticos.

[0085] Se apreciará por los expertos en la técnica que no es necesario establecer un nivel de control para cada ensayo según se realiza el ensayo sino que en su lugar puede establecerse una línea basal o control haciendo referencia a una forma de información almacenada con respecto a un nivel de control previamente determinado para pacientes sensibles y resistentes (respondedores y no respondedores), tal como un nivel de control establecido por cualquiera de los métodos que se han descrito anteriormente. Tan forma de información almacenada puede incluir, por ejemplo, pero sin limitación, un gráfico de referencia, un listado o un archivo electrónico de la población o datos individuales relativos a tumores/pacientes sensibles y resistentes, o cualquier otra fuente de datos relacionados con el nivel de control de la amplificación génica o la polisomía que es útil para el paciente a evaluar. Por ejemplo, se pueden usar las directrices que se han establecido anteriormente y se describen adicionalmente en los Ejemplos para establecer la polisomía y para detectar la amplificación génica, que ya se han correlacionado con la capacidad de respuesta a un inhibidor de EGFR, para valorar una muestra de paciente determinada.

[0086] En una modo de realización de la invención presente, el método incluye un paso de detectar la expresión de Akt fosforilada. La expresión de proteína - que no pertenece a la invención presente - puede ser detectada en tejidos convenientes, como el tejido de tumor y el material célular obtenido por la biopsia. Por ejemplo, la muestra de biopsia de tumor del paciente, que puede ser inmovilizada, puede entrar en contacto con un anticuerpo, un fragmento de anticuerpo, o un aptámero, que de forma selectiva se une a la proteína a ser detectada, y determinar si el anticuerpo, fragmento del mismo o el aptámero se ha unido a la proteína. La expresión de proteína puede ser medida usando una variedad de métodos estándar en la técnica, incluyendo, pero no limitada a:, el immunoblot (El Western blot), ensayo por inmunoadsorción ligado a enzimas (ELISA), radioinmunoanálisis (RIA), inmunoprecipitación, resonancia plasmónica de superficie, quimioluminiscencia, la polarización fluorescente, la fosforescencia, el análisis inmunohistoquímica, la espectrometría de masas mediante la desorción/ionización láser asistida por matriz TOF (MALDI-TOF), microcitometría, las micromatrices (microarray), la microscopía, la clasificación celular activada por la fluorescencia (FACS), y el flujo citometría. En un modo de realización preferido, el análisis inmunohistoquímica (IHC) es usado para detectar la expresión de proteína. Los métodos IHC y criterios de evaluación preferidos para la detección de la expresión de proteína son descritos detalladamente, por ejemplo, en Hirsch et al., J. Clin. Oncol. 2003, 21:3798-3807, y también son descritos en los Ejemplos.

[0087] En un método preferido, pero no restrictivo para evaluar la expresión de proteína, el protocolo siguiente es usado como una evaluación de resultados de inmunohistoquímica. La expresión P-Akt puede ser puntuada, en un aspecto de la invención, basada en la intensidad y la fracción de células positivas, aunque otros sistemas de puntuación sean evidentes para los expertos en la materia, dadas la directrices proporcionadas en el presente documento. La puntuación de intensidad se define como se indica a continuación: 0 = ninguna tinción apreciable en las células de tumor, 1 = una tinción apenas perceptible en el citoplasma y/o núcleo comparado con los elementos estromales, 2 = tinción marrón fácilmente apreciable que claramente marca el citoplasma de célula de tumor y/o núcleo, 3 = tinción marrón oscuro en las células de tumor que oscurecen el citoplasma y/o núcleo, o 4 = una tinción muy fuerte del núcleo y/o citoplasma. puntuación está basada en la fracción de células positivas (0%-100 %). La puntuación total es calculada multiplicando la puntuación de intensidad y la puntuación de fracción que produce una gama total de 0 a 400. Para los análisis estadísticos, puntuaciones de 0-200 son consideradas expresiones negativas/bajas, y puntuaciones de 201-400, son consideradas expresiones positivas/altas. Este nivel límite está basado en estudios anteriores de los inventores, en los cuales ellos encontraron una correlación entre la expresión de proteína EGFR aumentada y el número de copias génicas aumentado (Hirsch et al., J. Clin. Oncol. 2003, 21:3798-3807). Estos niveles límites son niveles convenientes para realizar el ensayo, pero no niveles absolutos. Es contemplado, por ejemplo, que este sistema de puntuación puede ser revisado o manipulado, por ejemplo reduciendo o elevando la puntuación límite por 5, 10, 15, 20, 25, 30, 35, o más puntos.

[0088] En el método de la invención, el nivel de la expresión Akt fosforilada en la muestra de células tumorales se compara con un nivel de control de la expresión Akt fosforilada seleccionada entre : (i) un nivel de control que ha sido correlacionado con la sensibilidad a un inhibidor EGFR; y (ii) un nivel de control que ha sido correlacionado con la resistencia al inhibidor EGFR. Se selecciona a un paciente el cual se prevé que se beneficie de la administración terapéutica de un inhibidor EGFR, un agonista de eso/del mismo, o un fármaco que tiene la actividad biológica sustancialmente similar al inhibidor EGFR, si el nivel de expresión de proteína EGFR (no incluido en el marco de la invención) y/o la expresión Akt fosforilada en las células tumorales del paciente es estadísticamente similar a o mayor que el nivel de control de expresión de proteína EGFR (no incluido en el marco de la invención) y/o la expresión Akt fosforilada que ha sido correlacionada con la sensibilidad frente al inhibidor EGFR, o si el nivel de expresión de proteína EGFR (no incluido en el marco de la invención) y/o la expresión Akt fosforilada en las células de tumor del paciente es estadísticamente mayor que el nivel de expresión de proteína EGFR (no incluido en el marco de la invención) y/o la expresión Akt fosforilada que ha sido correlacionada con la resistencia al inhibidor EGFR. Se selecciona a un paciente el cual se prevé que no se beneficie de la administración terapéutica de un inhibidor EGFR, un agonista del mismo, o un fármaco que tiene la actividad biológica considerablemente similar al inhibidor EGFR, si el nivel de expresión de proteína EGFR (no incluido en el marco de la invención) y/o la expresión Akt fosforilada en las células tumorales del paciente es estadísticamente menor que el nivel de control de expresión de proteína EGFR (no incluido en el marco de la invención) y/o la expresión Akt fosforilada que ha sido correlacionada con la sensibilidad al inhibidor EGFR, o si el nivel de expresión de proteína EGFR (no incluido en el marco de la invención) y/o la expresión Akt fosforilada en las células tumorales del paciente es estadísticamente similar a o menor que el nivel de expresión de proteína EGFR (no incluido en el marco de la invención) y/o la expresión Akt fosforilada que ha sido correlacionada con la resistencia al inhibidor EGFR.

[0089] Los controles apropiados se han analizado anteriormente con respecto a la detección de la amplificación génica y la polisomía, y tal análisis puede extrapolarse fácilmente a controles para la expresión de proteínas. Como se ha analizado anteriormente, un nivel de control para la comparación puede ser cualquier tipo de control, incluyendo un control establecido previamente que se proporciona como una forma de información. Por ejemplo, con respecto a la expresión de la proteína de EGFR, usando el sistema de puntuación para la expresión de EGFR que se ha descrito anteriormente y en los Ejemplos, una puntuación de más de aproximadamente 200 (201-400) se considerará que será un paciente con alta expresión (positivo para la expresión de EGFR) y una puntuación de aproximadamente 0-200 se considerará que será un paciente con baja expresión (negativo para la expresión de EGFR). Pueden preverse otros sistemas de puntuación en base a comparaciones con controles, y los pacientes que están cerca del corte, pueden evaluarse por otros criterios, biomarcadores, o técnicas para confirmar un diagnóstico.

Además, el corte puede variarse según se desee por el médico o investigador de acuerdo con las poblaciones de pacientes. Los niveles de corte que se han descrito anteriormente son niveles convenientes para realizar el ensayo y se optimizan por los presentes inventores dados los datos actuales, pero no son niveles absolutos. Por ejemplo, se contempla que este sistema de puntuación puede revisarse o manipularse, tal como reduciendo o elevando la puntuación de corte en 5, 10, 15, 20, 25, 30, 35 o más puntos. Con respecto a la Akt fosforilada, se usó una metodología similar.

[0090] En una realización de la presente invención, el método incluye una etapa adicional de detección de una mutación en el dominio de tirosina cinasa del gen EGFR. En el presente documento, los exones 18, 19 y 21 del gen EGFR son buenas dianas para la evaluación de mutaciones, ya que estos exones contienen aproximadamente el 98 % de las 56 mutaciones en EGFR en NSCLC notificados hasta la fecha. En Lynch y col. o Paez y col. (26, 27), se identificaron mutaciones somáticas en el dominio de tirosina cinasa del gen EGFR en la mayoría de los pacientes con cáncer de pulmón con respuesta a gefitinib, en comparación con ningún de los pacientes sin respuesta (P<0,001). Las mutaciones fueron deleciones pequeñas dentro del marco de lectura o sustituciones aminoacídicas agrupadas alrededor del sitio de unión a ATP del dominio de tirosina cinasa. Se detectaron mutaciones similares en tumores del 8 % de los pacientes con cáncer de pulmón de células no pequeñas primario que no se habían expuesto a gefitinib. Todas las mutaciones fueron heterocigotas, y se observaron mutaciones idénticas en múltiples pacientes, lo que sugería una ganancia específica aditiva de la función. In vitro, los mutantes en EGFR demostraron una mejora en la actividad de tirosina cinasa en respuesta al factor del crecimiento epidérmico y el aumento de la sensibilidad a la inhibición por gefitinib. Por lo tanto, la presente invención contempla la detección de dichas mutaciones en las muestras de células tumorales para su uso en combinación con o como una detección secundaria posterior a la detección de la amplificación génica de EGFR y/o polisomía y/o la amplificación génica de HER2. La detección de una o más mutaciones en el gen EGFR pronostica que es más probable que un paciente responda o se beneficie de la terapia con el inhibidor de EGFR. La falta de detección de mutaciones pronostica que es probable que un paciente responda o se beneficie de la terapia con el inhibidor de EGFR. Se conocen bien en la técnica métodos para detectar mutaciones génicas, se describen en Lynch y col. y Paez y col., e incluyen, pero sin limitación, hibridación, reacción en cadena de la polimerasa, análisis en gel de poliacrilamida, cromatografía o espectroscopia, y pueden incluir adicionalmente detección de un producto de proteína alterado codificado por el gen (por ejemplo, a través de inmunotransferencia (por ejemplo, transferencia Western), ensayo inmunoabsorbente vinculado a enzimas (ELISA), radioinmunoensayo (RIA), inmunoprecipitación, inmunohistoquímica, inmunofluorescencia, clasificación inmunofluorescencia, clasificación de células activadas por fluorescencia (FACS) y microscopía por inmunofluorescencia).

[0091] Como se usa en el presente documento, la expresión "se une selectivamente a" se refiere a la unión específica de una proteína a otra (por ejemplo, un anticuerpo, fragmento del mismo, o compañero de unión a una proteína), donde el nivel de unión, como se mide por cualquier ensayo convencional (por ejemplo, un inmunoensayo), es estadísticamente mayor de forma significativa que el control de fondo para el ensayo. Por ejemplo, al realizar un inmunoensayo, los controles incluyen típicamente un pocillo/tubo de reacción que contienen un fragmento de unión a anticuerpo o antígeno en solitario (es decir, en ausencia de antígeno), donde una cantidad de reactividad (por ejemplo, unión no específica al pocillo) por el fragmento de unión a anticuerpo o antígeno del mismo en ausencia del antígeno se considera que es el fondo.

[0092] Las etapas de detección de los biomarcadores de acuerdo con la presente invención pueden combinarse en muchas combinaciones diferentes como se describe en el presente documento, y las etapas pueden realizarse en cualquier orden, o posteriormente simultáneamente. El análisis estadístico para determinar las diferencias entre los controles y las muestras de pacientes pude realizarse usando cualquier método conocido en la técnica, incluyendo, pero sin limitación, test exacto de Fisher de prueba chi cuadrado de Pearson para variables cualitativas, y usando la prueba t de Student o el análisis de la variación para variables continuas. El significado estadístico se define típicamente como p<0,05. Se describen métodos estadísticos en más detalle en los Ejemplos.

[0093] El método de la presente invención es útil para determinar o pronosticar los pacientes que tienen más probabilidad de responder (por ejemplo, con un beneficio terapéutico) a la terapia que usa un inhibidor de EGFR, un agonista del mismo, o un fármaco que tiene una actividad biológica sustancialmente similar que el inhibidor de EGFR, así como para determinar o pronosticar los pacientes con mucha más probabilidad de no responder a la terapia usando un inhibidor de EGFR. Un agonista, como se usa en el presente documento, es un compuesto que está caracterizado por la capacidad de agonizar (por ejemplo, estimular, inducir, aumentar, potenciar o imitar) la actividad biológica de una proteína o compuesto de origen natural o de referencia. Más particularmente, un agonista puede incluir, pero sin limitación, un compuesto, proteína, péptido, anticuerpo o ácido nucleico que imita o potencia la actividad del compuesto natural o de referencia, e incluye cualquier homólogo, mimético o cualquier producto adecuado de diseño o selección de fármaco/compuesto/péptido adecuado que se caracteriza por su capacidad para agonizar (por ejemplo, estimular, inducir, aumentar, potenciar) la actividad biológica de un compuesto de origen natural o de referencia. Por el contrario, un antagonista se refiere a cualquier compuesto que inhibe (por ejemplo, antagoniza, reduce, disminuye, bloquea, invierte o altera) el efecto de un compuesto de origen natural o de referencia como se ha descrito anteriormente. Más particularmente, un antagonista es capaz de actuar de manera relativa a la actividad del compuesto de referencia, de tal forma que la actividad biológica del compuesto natural o de referencia, se disminuya de una manera que sea antagónica (por ejemplo, contra, una inversión, contraria a) a la acción natural del compuesto de referencia. Dichos antagonistas pueden incluir, pero sin limitación, cualquier compuesto, proteína, péptido o ácido nucleico (incluyendo ribozimas y antisentido) o producto de diseño o selección de fármaco/compuesto/péptido que proporciona el efecto antagónico.

[0094] Los agonistas y antagonistas que son productos de diseño de fármaco pueden producirse usando diversos métodos conocidos en la técnica. Se detallan diversos métodos de diseño de fármaco, útiles para diseñar miméticos u otros compuestos útiles en la presente invención en Maulik y et al., 1997, Molecular Biotechnology: Therapeutic

Applications and Strategies, Wiley-Liss, Inc, que se incorpora íntegramente en el presente documento por referencia. Un agonista o antagonista puede obtenerse, por ejemplo, a partir de estrategias de diversidad molecular (una combinación de estrategias relacionadas que permiten la rápida construcción de grandes bibliotecas de moléculas químicamente diversas), bibliotecas de compuestos naturales o sintéticos, en particular de bibliotecas químicas o de combinación (es decir, bibliotecas de compuestos que difieren de secuencia o tamaño pero que tienen los componentes básicos similares) o por diseño de fármaco racional, dirigido o aleatorio. Véase, por ejemplo, Maulik y et al., anteriormente.

[0095] En una estrategia de diversidad molecular, se sintetizan grandes bibliotecas de compuestos, por ejemplo, a partir de péptidos, oligonucleótidos, compuestos esteroideos naturales o sintéticos, carbohidratos y/o moléculas orgánicas y no esteroideas naturales o sintéticas, usando enfoques biológicos, enzimáticos y/o químicos. Los parámetros críticos en el desarrollo de una estrategia de diversidad molecular incluyen diversidad entre subunidades, tamaño molecular y diversidad en la biblioteca. La meta general de detección de dichas bibliotecas es utilizar aplicación secuencial de la sección de combinación para obtener ligandos de alta afinidad para una diana deseada, y después para optimizar las moléculas principales por estrategias de diseño aleatorio o dirigido. Se describen en detalle métodos de diversidad molecular en Maulik, y col., ibid.

[0096] Un fármaco que tiene actividad biológica sustancialmente similar como gefitinib se refiere a un fármaco que tiene sustancialmente cualquier función mostrada o realizada por el compuesto de referencia que se atribuye al compuesto de referencia que se mide o ser observa in vivo (es decir, en condiciones fisiológicas) o in vitro (es decir, en condiciones de laboratorio).

[0097] Otros tipos de inhibidores del EGFR pueden incluir, pero sin limitación, aptámeros, ARNi y ribozimas. Los aptámeros son hebras cortas de ácidos nucleicos sintéticos (normalmente ARN pero también ADN) seleccionados entre bibliotecas de ácidos nucleicos de combinación aleatorizados en virtud de su capacidad para unirse a una molécula diana específica predeterminada con alta afinidad y especificidad. Los aptámeros asumen una estructura tridimensional definida y son capaces de discriminar entre los compuestos con diferencias muy pequeñas en la estructura. La interferencia por ARN (ARNi) es un proceso por el que se usa ARN bicatenario, y en sistemas de mamíferos, ARN de interferencia corta (ARNsi), para inhibir o silenciar la expresión de genes complementarios. En la célula diana, los ARNsi se desenrollan y se asocian con un complejo silenciador inducido por ARN (RISC), que después se guía a las secuencias de ARNm que son complementarias al ARNsi, por lo que el RISC escinde el ARNm. Una ribozima es un segmento de ARN que es capaz de realizar una catálisis biológica (por ejemplo, ruptura o formación de enlaces covalentes). Más específicamente, las ribozimas son moléculas de ARN antisentido que funcionan uniéndose al resto de ARN diana y lo inactivan escindiendo la estructura fosfodiéster en un sitio de corte específico.

[0098] Otro tipo de inhibidor de EGFR puede incluir un anticuerpo, un fragmento de unión a antígeno del mismo, o un péptido de unión a antígeno o "compañero de unión". Los anticuerpos se caracterizan por que comprenden dominios de inmunoglobulinas y como tal, son miembros de la superfamilia de proteínas de las inmunoglobulinas. Un anticuerpo puede incluir anticuerpos policlonales y monoclonales, anticuerpos divalentes y monovalentes, anticuerpos bi o multi-específicos, suero que contiene dichos anticuerpos, anticuerpos que se han purificado a grados variables, y cualquier equivalente funcional de anticuerpos completos. Los anticuerpos aislados útiles como inhibidores del EGFR pueden incluir suero que contiene dichos anticuerpos, o anticuerpos que se han purificado a grados variables. Los anticuerpos completos de la presente invención pueden ser policlonales o monoclonales. Como alternativa, los equivalentes funcionales de anticuerpos completos, tales como fragmentos de unión a antígeno en los que uno o más dominios de anticuerpo están truncados o ausentes (por ejemplo, fragmentos Fv, Fab, Fab' o F(ab)2), así como anticuerpos creados por ingeniería genética o fragmentos de unión a antígeno de los mismos, que incluyen anticuerpos monocatenarios o anticuerpos que pueden unirse a más de un epítopo (por ejemplo, anticuerpos biespecíficos), o anticuerpos que pueden unirse a uno o más antígenos diferentes (por ejemplo, anticuerpos bi o multi-específicos), también pueden emplearse como inhibidores del EGFR. También pueden evaluarse compañeros de unión que están diseñados para unirse específicamente a y para inhibir un EGFR. Se dan ejemplos del diseño de dichos polipéptidos, que poseen una especificidad de ligando prescrita en Beste y col. (Proc. Natl. Acad. Sci. 96: 1898-1903, 1999).

[0099] Otra realización de la invención incluye el uso de un kit de ensayo para realizar cualquiera de los métodos de la presente invención. El kit de ensayo puede incluir uno cualquiera o más de los siguientes componentes: (a) un medio para detectar en una muestra de células tumorales un nivel de amplificación del gen del receptor del factor de crecimiento epidérmico (EGFR) y/o un nivel de polisomía del gen del receptor del factor de crecimiento epidérmico (EGFR); (b) un medio para detectar en una muestra de células tumorales un nivel de amplificación del gen HER2; (c) un medio para detectar en una muestra de células tumorales la expresión de la proteína de EGFR; (d) un medio para detectar en una muestra de células tumorales la expresión de la proteína Akt fosforilada; y/o (e) un medio para detectar en una muestra de células tumorales al menos una (pero puede incluir más de una) mutaciones en el gen EGFR. El kit de ensayo también incluye preferiblemente uno o más controles. Los controles pueden incluir: (i) una muestra de control para detectar la sensibilidad al inhibidor de EGFR que se evalúa para su uso en un paciente; (ii) una muestra de control para detectar la resistencia al inhibidor de EGFR; (iii) información que contiene un nivel de control predeterminado de biomarcador particular que se va a medir con respecto a la sensibilidad o resistencia al inhibidor de EGFR (por ejemplo, un nivel de control predeterminado de amplificación génica de EGFR y/o polisomía que se ha correlacionado con la sensibilidad al inhibidor de EGFR o la resistencia al inhibidor de EGFR).

[0100] En una realización, un medio para detectar la amplificación génica de EGFR o HER2 y/o polisomía puede ser generalmente cualquier tipo de reactivo que puede usarse en un método de la presente invención. Tales medios para la detección incluyen, pero sin limitación: una sonda o un cebador o cebadores que hibridan en condiciones de hibridación rigurosas a un gen EGFR o un gen HER2 o una porción del cromosoma 7 (cromosoma en el que se localiza EGFR) o el cromosoma 17 (cromosoma en el que se localiza HER2). Se conocen en la técnica secuencias de ácidos nucleicos para los genes EGFR y HER2 y pueden usarse para producir dichos reactivos para la detección. También pueden incluirse reactivos adicionales útiles para realizar un ensayo usando dichos medios para la detección, tales como reactivos para realizar hibridación in situ, reactivos para detectar marcadores fluorescentes, reactivos para realizar la reacción en cadena de la polimerasa, etc.

[0101] En otro modo de realización, medios para detectar la expresión de la proteína de EGFR o Akt fosforilada pueden ser generalmente cualquier tipo de reactivo que pueda usarse en un método de la presente invención. Otros medios para la detección, que no pertenecen a la invención, incluyen anticuerpos y fragmentos antigénicos de fijación del mismo, péptidos, parejas de unión, aptámeros, enzimas, y moléculas pequeñas. Se pueden incluir reactivos adicionales que son útiles para la realización de un ensayo, utilizando dichos medios para la detección, tales como reactivos que realizan la inmunohistoquímica u otro ensayo de fijación.

[0102] Los medios para la detección del kit de ensayo de la presente invención pueden conjugarse para un marcador detectable o etiqueta detectable. Tal etiqueta puede ser cualquier etiqueta adecuada que permita la detección de los reactivos usados para detectar el gen o proteína de interés e incluye, pero sin limitación, cualquier composición o etiqueta detectable por medios espectroscópicos, fotoquímicos, eléctricos, ópticos o químicos. Las etiquetas útiles en la presente invención incluyen: biotina para la tinción con conjugado de estreptavidina marcado, perlas magnéticas (por ejemplo, Dynabeads™), tintes fluorescentes (por ejemplo, fluoresceína, rojo texas, rodamina, proteína verde fluorescente, y similares), radioetiquetas (por ejemplo, 3H, 125I, 35S, 14C o 32P), enzimas (por ejemplo, peroxidasa de rábano picante, fosfatasa alcalina y otras usadas habitualmente en un ensayo ELISA), y etiquetas colorimétricas, tales como oro coloidal o perlas de vidrio o plástico de color (por ejemplo, poliestireno, polipropileno, látex, etc.).

[0103] Además, los medios para la detección del kit de ensayo de la presente invención pueden inmovilizarse sobre el sustrato. Tal sustrato puede incluir cualquier sustrato para la inmovilización de un reactivo de detección, tal como se usará en cualquiera de los métodos de detección que se han descrito previamente. En resumen, un sustrato adecuado para la inmovilización de un medio para la detección incluye cualquier soporte sólido, tal como cualquier soporte orgánico sólido, biopolímero o inorgánico que pueda formar un enlace con los medios para la detección sin afectar significativamente a la actividad y/o la capacidad de los medios de detección para detectar la molécula diana deseada. Los soportes sólidos orgánicos ejemplares incluyen polímeros, tales como poliestireno, nylon, resinas de fenolformaldehído y copolímeros acrílicos (por ejemplo, poliacrilamida). El kit también puede incluir reactivos adecuados para la detección del reactivo y/o para el marcado de controles positivos o negativos, soluciones de lavado, tampones de dilución y similares. El kit también puede incluir un conjunto de instrucciones escritas para usar el kit e interpretar los resultados.

[0104] El kit también puede incluir un medio para detectar un marcador de control que es característico del tipo de células que se muestra que se muestra que puede ser generalmente cualquier tipo de reactivo que puede usarse en un método de detección de la presencia de un marcador conocido (al nivel del ácido nucleico o de la proteína) en una muestra, tal como por un método para detectar la presencia de un biomarcador descrito previamente en el presente documento. Específicamente, el medio está caracterizado por que identifica un marcador específico del tipo de célula que se analiza que identifica positivamente el tipo de célula. Por ejemplo, en un ensayo de tumor de pulmón, es deseable detectar células epiteliales de pulmón para el nivel de la expresión del biomarcador y/o la actividad biológica. Por lo tanto, el medio para detectar un marcador de control identifica un marcador que es característico de una célula epitelial y preferiblemente, una célula epitelial de pulmón, de manera que la célula se distinga de otros tipos de células, tales como un tejido conectivo o una célula inflamatoria. Tal medio aumenta la precisión y la especificidad del ensayo de la presente invención. Tal medios para detectar un marcador de control incluyen, pero sin limitación: una sonda que hibrida en condiciones de hibridación rigurosas a una molécula de ácido nucleico que codifica un marcador de proteína; cebadores PCR que amplifican tal molécula de ácido nucleico; un aptámero que se une específicamente a un sitio distinto de forma conformacional en la molécula diana; y/o un anticuerpo, fragmento de unión a antígeno del mismo, o péptido de unión a antígeno que se une selectivamente al marcador de control en la muestra. Se conocen en la técnica secuencias de ácidos nucleicos y aminoácidos para muchos marcadores celulares y pueden usarse para producir dichos reactivos para la detección.

[0105] Los kits de ensayo y los métodos de la presente invención pueden usarse no sólo para identificar pacientes que están predispuestos a responder a un inhibidor de EGFR particular, sino también para identificar tratamientos que puedan mejorar la capacidad de respuesta de las células de cáncer que son resistentes a los inhibidores del EGFR, y para desarrollar tratamientos adyuvantes que potencian la respuesta de los inhibidores del EGFR.

Ejemplos

Ejemplo 1 [0106] El siguiente ejemplo demuestra el uso de detección de amplificación génica de EGFR y polisomía para predecir el resultado del tratamiento de tumores NSCLC con respecto a inhibidores del EGFR (en base al estudio de una cohorte Italiana).

MÉTODOS SELECCIÓN DE PACIENTES Y DISEÑO DE ESTUDIO [0107] Los pacientes para este estudio prevenían de tres instituciones Italianas: el Hospital Bellaria, (Bolonia), el Scientific Institute University Hospital San Raffaele (Milán), y el Policlinico Monteluce (Perugia). La elegibilidad incluía pacientes de NSCLC histológicamente confirmados con enfermedad medible, localmente avanzada o metastásica, que habían evolucionado o recaído después de la quimioterapia, y pacientes inelegibles para la quimioterapia porque eran ancianos, tenían un estado funcional deficiente, o una afección médica comórbida. Antes de la inclusión en el ensayo, se evaluó el estatus de fumadores y los pacientes se clasificaron como nunca, exfumador (cese de fumador >6 meses antes de la inclusión en el ensayo), o fumadores actuales (cese <6 meses antes de la inclusión en la ensayo o fumador activo). El estudio fue aprobado por la junta de supervisión ética a apropiada y se obtuvo el consentimiento escrito informado de cada paciente antes de la entrada en el estudio.

[0108] De mayo de 2001 a enero de 2004, 108 pacientes recibieron gefitinib en la dosis diaria oral de 250 mg hasta una progresión de la enfermedad, toxicidad inaceptable o rechazo. Los resultados de eficacia para algunos de los pacientes se notificaron previamente (28, 29). Se evaluó la respuesta de los pacientes de acuerdo con los criterios RECIST (30). La respuesta tumoral se evaluó por exploración de tomografía computerizada cada dos meses, con una evaluación confirmatoria a repetir en pacientes que responden al menos 4 semanas después de la determinación inicial de respuesta. El tiempo hasta la progresión de la enfermedad (TTP) se calculó desde la fecha de inicio del tratamiento con gefitinib hasta la fecha de detección de enfermedad progresiva o el último contacto. La supervivencia (OS) se calculó desde la fecha de inicio de la terapia hasta la fecha de muerte o el último contacto.

PREPARACIÓN DEL TEJIDO Y ANÁLISIS POR FISH [0109] Los especimenes de tumor se obtuvieron en el momento del diagnóstico antes de cualquier terapia frente al cáncer. Para cada paciente, se cortaron secciones de tejido de 5 m de grueso seriadas de bloques embebidos en parafina que contienen células malignas representativas. La clasificación histopatológica se realizó sobre una sección teñida con hematoxilina-eosina (HE) en base a los criterios de la Organización Mundial de la Salud (OMS) (31). Se realizaron ensayos por FISH en color dual de doble diana usando la sonda LSI EGFR SpectrumOrange/CEP 7 de SpectrumGreen (Vysis, Abbott Laboratories) de acuerdo con un protocolo descrito en otra parte (10). Usando el corte teñido con HE de referencia de la sección adyacente donde se identificaron los focos tumorales dominantes, los números de copias del gen EGFR y las sondas del cromosoma 7 se evaluaron y se registraron independientemente en al menos 100 núcleos no solapantes con morfología intacta. Se realizó un análisis independientemente por dos observadores (FC, MVG) sin que supieran las características clínicas de los pacientes, siguiendo directrices de clasificación estrictas. Había una alta correlación (r = 0,96; p <0,01) entre los patrones de FISH identificados por los dos observadores lo que sugería que los criterios seleccionados para la clasificación podrían reproducirse. Los patrones de FISH discordantes se evaluaron de nuevo y se alcanzó un consenso por los dos investigadores.

[0110] De acuerdo con la frecuencia de las células tumorales con el número específico de las copias del gen EGFR y el centrómero del cromosoma 7, los pacientes se clasificaron en seis categorías de FISH con número ascendente de copias por célula: (1) Disomía (2 copias de ambas dianas en >el 90 % de las células); (2) Baja trisomía (2 copias del gen en el 40 % de las células y 3 copias en el 10-40 % de las células); (3) Alta trisomía (2 copias del gen en el 40 % de las células y 3 copias en 40 % de las células); (4) baja polisomía (4 copias del gen en el 10-40 % de las células); (5) Alta polisomía (4 copias del gen en el 40 % de las células); y (6) Amplificación Génica, definida por la presencia de estrechos agrupamientos de genes EGFR y una relación gen/cromosoma por célula de 2, o un promedio de 15 copias de EGFR por célula en 10 % de las células analizadas.

EXTRACCIÓN DE ARN Y RT-PCR CUANTITATIVA [0111] El ARN se aisló, el ADNc se transcribió y las reacciones en cadena de la polimerasa en tiempo real cuantitativa se realizaron como se ha descrito previamente (Rosell y col. Clin Cancer Res 2004; 10: 1318-25). La microdisección de células tumorales se realizó manualmente o por la técnica de captura láser que usa el instrumento PALM (P.A.L.M. Microlaser Technologies AG Inc., Bernried, Alemania), de acuerdo con las directrices del fabricante. Los cebadores y las sondas son como se describen a continuación: cebador EGFR directo: 5'- TCCGTCTCTTGCCGGGAAT-3' (SEQ ID NO: 1); cebador EGFR inverso: 5'-GGCTCACCCTCCAGAACCTT-3' (SEQ ID NO: 2); sonda Taqman EGFR: 5'-ACGCATTCCCTGCCTCGGCTG-3' (Acceso al Gen Bank: NM_005228).

ANÁLISIS ESTADÍSTICO [0112] Las diferencias entre los grupos de FISH se compararon por la prueba exacta de Fisher o prueba 2 para variables cualitativas y por la prueba t de student o ANOVA para variables continuas. La normalidad de la distribución se evaluó por la prueba de Kolmogorov-Smirnov. El tiempo hasta la progresión), la supervivencia total (OS) y los intervalos de confianza al 95 % se evaluaron por el método de Kaplan-Meier (32), comparando los grupos de FISH por la prueba de rango logarítmico. Los factores de riesgo asociados con la supervivencia se evaluaron usando el modelo de regresión de riesgos proporcionales de Cox con un procedimiento de disminución gradual (33). Sólo aquellas variables con resultados significativos en el análisis univariante se incluyeron en el análisis multivariante. Los criterios para la retirada de variable fueron la relación de probabilidad estadística en base a la probabilidad parcial máxima estimada (valor p valor por defecto = 0,10 para la retirada del modelo).

RESULTADOS CARACTERÍSTICAS CLÍNICAS [0113] Un total de 108 pacientes entraron en el estudio y 102 se analizaron completamente. Se perdieron tres pacientes para el seguimiento y no se obtuvieron resultados por FISH en 3 especimenes debido a necrosis tumoral o una conservación tisular deficiente. Nueve pacientes (8,8 %) recibieron gefitinib como terapia de primera línea: un paciente de edad >80 años, uno para rechazo a quimioterapia, y 7 pacientes para comorbilidades contraindicadas con la quimioterapia. Los pacientes restantes recibieron quimioterapia antes de gefitinib, y el 78,4 % de estos había recibido un agente de platino. La duración media del tratamiento de gefitinib fue de 2,8 meses (intervalo 0,6-20). En el momento de la inclusión del estudio, la mayoría de los pacientes era fumador actual (52,9 %) o exfumador (32,4 %).

[0114] Se observó una respuesta completa (CR: 1 %), 13 respuestas parciales (PR: 12,7 %) y 26 enfermedades estables (SD: 25,5 %), para una tasa de respuesta objetiva (OR = CR + PR) del 13,7 %, y una tasa de control de enfermedad total (DCR: CR+PR+SD) del 39,2 %. Los análisis finales para TTP y OS se realizaron en abril de 2004, cuando habían transcurrido al menos 3 meses desde la inclusión del último paciente. Con un seguimiento medio de 7,0 meses, el TTP medio para toda la población fue 2,9 meses (desviación estándar: 5,1 meses), la OS media fue 7,0 meses (desviación estándar: 7,2 meses), y supervivencia de 1 año fue del 45,1 %.

[0115] La tabla 1 muestra la relación entre las características de los pacientes y la respuesta, tiempo hasta la progresión y supervivencia. Las mujeres tuvieron una mayor tasa de respuesta (28,6 % frente al 6,0 %, p = 0,004), mayor TTP (4,5 de media frente a 2,7 meses, p = 0,02), y una supervivencia ligeramente mayor (9,0 de media frente a 6,9 meses, p = 0,059) en comparación con los hombres. Se observó una mejor tasa de respuesta en pacientes que nunca habían fumado (40,0 % frente al 20,8 %, p = 0,006) en comparación con exfumadores y fumadores actuales, sin ninguna diferencia en el TTP y la supervivencia. En pacientes con adenocarcinoma y carcinoma bronquioloalveolar, aunque las diferencias en las tasas de respuesta y TTP no fueron significativas, la supervivencia media fue más alta (p = 0,02) en comparación con las demás histologías. También se observó una mejor supervivencia en pacientes con PS 0 y 1 (p = 0,01) en comparación con pacientes con PS 2. La edad y la fase de la enfermedad no tenían ninguna relación con la actividad de gefitinib.

TABLA 1. Características de los pacientes con "cánceres pulmonares de células no pequeñas” y resultado gefitinib *

Características* de No de Respuesta Enfermedad Tiempo Supervivencia % de 1 año los Pacientes Pacientes/% Objetiva Progresiva Medio Media en Supervivencia Total / %† Total/% hasta la meses Acumulativa ± Progresión %SD en meses Total 102/100 14/14 62/60 2.9 9.4 41 ± 5 Sexo Hombre 67/66 4/6 46/69 2.7 8.3 37 ± 6 Mujer 35/34 10/29 16/46 5.2 11.3 48 ± 9 P .004¶ .03ǁ .004§ .03§ .22 § Etapa III 14/13 1/7 6/43 6.0 8.3 36 ± 13 IV 88/87 13/15 56/64 2.7 9.5 42 ± 5 P .7¶ .15ǁ .3§ .9§ .77 § Histología AdenocarcinomaA 54/53 8/15 34/63 3.2 11.3 45 ± 7 BronquioloalveolarA 9/9 3/33 5/56 3.0 16.5 67 ± 16 Células B 26/25 2/8 14/54 2.2 6.5 22 ± 9 Escamosas Células B grandes 2/2 2/100 0.8 0.8 0 ± 0 Indiferenciadas B 11/11 1/9 7/64 2.1 9.0 45 ± 15 P (A versus B) .2¶ .7ǁ .3§ .03§ .04 § Estado de rendimiento ‡ 49/48.

5/10 32/65 2.6 10.1 40 ± 7 1 41/40 7/17 22/54 4.2 10.9 47 ± 8 2 12/12 2/17 8/67 2.1 2.7 22 ± 13 P (0+1 contra 2) .7¶ .7ǁ .2§ .004§ .007 § Historial de fumador Nunca ha fumado 15/15 6/40 6/40 5.3 10.9 47 ± 14 Antiguo fumador 33/32 5/15 17/51 3.6 13.8 55 ± 9 Fumador habitual 54/53 3/6 39/72 2.3 4.5 30 ± 6 P (Nunca contra .006¶ .7ǁ .07§ .25§ .35 § otros) *Características de 102 pacientes con histología confirmó el cáncer pulmonar de células no pequeñas " con la enfermedad mensurable, en localmente avanzada o metastásicos, progresando o recayendo después de la quimioterapia, o contraindicaciones médicas para la quimioterapia que posteriormente fueron tratados con 250 mg gefitinib diariamente.

+ Respuesta Objetivo = respuesta Parcial y completa ‡ el estado de rendimiento fue definido como 0 = Totalmente activo, capaz de continuar todo el funcionamiento de preenfermedad sin restricción; 1 = restringido en la actividad físicamente vigorosa pero ambulatorio y capaz de realizar el trabajo de una naturaleza ligera o sedentaria, por ejemplo, el trabajo ligero de casa, el trabajo de oficina; y 2 =Ambulatorio y capaz de cualquier cuidado de sí mismo, pero incapaz de realizar cualquier actividad de trabajo, y por encima de y sobre más del 50 % de tiempo despierto (criterios de Grupo Eastern 31 Cooperative Oncology, 34) §P valores (bilaterales) calculados usando la prueba de rango logarítmico.

ǁP valores (bilaterales) calculados usando la prueba chi-cuadrada de Pearson.

¶P valores (bilaterales) calculados empleando la prueba exacta de Fisher.

FISH Y RT-PCR CUANTITATIVA

[0116] La expresión génica de EGFR también se evaluó por la reacción en cadena de la polimerasa en tiempo real cuantitativa en 63 especimenes. La expresión génica relativa era de 2,90 (intervalo = 0,17 a 28,0) en 40 especimenes con bajos números de copia del gen EGFR (disomía a baja polisomía) y 7,15 (intervalo = 0,19 a 28,3) en 23 especimenes con altos números de copias del gen EGFR (alta polisomía y amplificación génica), y fue particularmente alta entre nueve tumores con amplificación génica (promedio = 8,46, intervalo = 1,7 a 21,5). Hubo una correlación positiva significativa entre la expresión relativa y el número de copias de gen (r de Pearson = 0,33; P = 0,007), indicando que los especimenes con ganancia en los números de copia tenían mayores niveles de expresión génica.

FISH Y VARIABLES CLÍNICAS

[0117] La disomía estaba presente en el 35,3 % de casos, la baja trisomía en el 16,7 %, la alta trisomía en el 2 %, la baja polisomía en el 13,7 %, la alta polisomía en el 19,6 % y la amplificación génica en el 12,7 %.

[0118] La relación entre los resultados de FISH, la respuesta a gefitinib, tiempo hasta la progresión de la enfermedad después de gefitinib y supervivencia después de gefitinib se muestra en la Tabla 2. En la categoría de disomía, no hubo respondedores, el 75 % progresó, y el TTP medio y la tasa de supervivencia a un año fue baja (figura 1). De modo similar, se apreciaron resultados deficientes en los grupos con baja trisomía y baja polisomía, donde no hubo ningún respondedor, el 71 % y el 86 % con enfermedad progresiva, corto tiempo hasta la progresión, y pocos sobrevivientes a largo plazo. Por el contrario, en pacientes con alta trisomía y alta polisomía se identificaron respondedores, menos pacientes con enfermedad progresiva, mayor tiempo hasta la progresión y mayor supervivencia. Los pacientes con amplificación génica tuvieron un alto índice de respuesta (53,8 %), una baja tasa de enfermedad progresiva (23,1 %), mucho tiempo hasta la progresión, y una alto índice de supervivientes a largo plazo (Tabla 2; figura 1).

[0119] Los pacientes con altos números de copia del gen EGFR debido a la amplificación génica o alta polisomía se combinaron (Grupo 2) y se compararon con las categorías de FISH combinadas que tenían 2 o 3 copias génicas (Grupo 1), como se muestra en la Tabla 2. Entre los pacientes con respuesta objetiva, el 85,7 % (12/14) estaba en el Grupo 2. Además, entre los pacientes con estabilización de la enfermedad, el 38,5 % (10/26) estaba en el Grupo 2. Las tasas de OR fueron del 25 % en la categoría de alta polisomía, 54 % en la categoría de amplificación, y 36 % en el Grupo 2 combinado, que fue significativamente mayor en comparación con el Grupo 1 (2,9 %, p <0,001). Las tasas de control de la enfermedad también fueron significativamente mayores en el Grupo 2 en comparación con el Grupo 1 (66,7 % frente al 26,1 %; p <0,001). Cabe apreciarse que el grupo con alta trisomía contenía sólo a dos pacientes, ambos con un buen resultado. Si estos pacientes se combinasen con los pacientes del Grupo 2, las diferencias serían hasta más llamativas. Sin embargo, desde el punto de vista molecular, estos pacientes con menos copias génicas de EGFR parecían más estrechamente relacionados con aquellos con disomía y baja trisomía.

TABLA 2 . Tasa de respuesta objetiva. Tasa de control de enfermedad, tiempo hasta la progresión y análisis de supervivencia según los grupos de pacientes NSCLC con número ascendiente de las copias del gen del receptor de factor de crecimiento epidérmico Características Total Modelo FISH Pacientes Grupo 1 Grupo 2 Disomía Baja Alta Baja Total Alta Amplificación Total Trisomía Trisomía Polisomía Polisomía de Gen Total No. 102 36 17 2 14 69 13 33 % 100 35.3 16.7 2.0 13.7 67.6 19.6 12.7 32.4 Respuesta total No. 14 2 2 7 12 y parcial % 13.7 100 2.9 53.8 36.4 Enfermedad No. 26 9 2 16 7 3 estable % 25.5 25.0 29.4 14.3 23.2 23.1 30.3 No. 62 27 12 12 51 8 3 11 Enfermedad % 60.8 75.0 70.6 85.7 73.9 23.1 33.3 progresiva 39.2 25.0 29.4 100 14.3 26.1 60.0 76.9 66.7 Tasa de control de enfermedad Tiempo medio 2.9 2.5 3.6 9.3 2.1 2.5 6.6 6.0 6.3 de progresión (meses) % Pacientes sin 18.6 8.3 5.9 100 8.7 35.0 46.2 39.4 progresión de enfermedad a los 12 meses Media total de supervivencia 7.0 6.9 10.2 13.7 3.0 6.5 8.3 9.0 9.0 (meses) 45.1 38.9 41.2 100 14.3 36.2 65.0 61.5 63.6 Tasa Media total de supervivencia de más de 1 año [0120] En lo que concierne al tiempo hasta la progresión, los pacientes del Grupo 2 también obtuvieron más éxito que el Grupo 1. A los 12 meses, el 91 % de los pacientes del Grupo 1 había progresado en comparación con el 61 % del Grupo 2. La diferencia en el TTP por la prueba de rango logarítmico fue significativa (p <0,001) (figura 2A). La supervivencia también fue superior en los pacientes del Grupo 2 en comparación con el Grupo 1 (figura 2B). La tasa de supervivencia de uno a dos años fue del 63,6 % y el 40 % para el Grupo 2 en comparación con el 36,2 % y el 17 % para el Grupo 1. Mediante la prueba de rango logarítmico, la diferencia entre estos grupos fue estadísticamente significativa (p = 0,03).

[0121] La tabla 3 muestra la relación entre el estado del gen EGFR y las características de los pacientes. Los pacientes con amplificación génica de EGFR y alta polisomía fueron con mayor probabilidad mujeres (p = 0,037) y nunca fumadoras (p = 0,001), mientras la asociación con la histología no fue significativa. El análisis multivariante mostró que el riesgo de muerte era considerablemente inferior en pacientes del Grupo 2 (HR: 0,40, 95 % CI: 0,21- 0,76, p = 0,005) y en pacientes con adenocarcinoma o carcinoma bronquioloalveolar (HR: 0,58, 95 % CI 0,35-0,97, p = 0,03). Por el contrario, el riesgo de muerte era considerablemente más alto para pacientes con el estado funcional deficiente (PS 2) (HR 3,86, 95 % CI: 1,76-8,46, p = 0,001).

TABLA 3 – Estado de gen del receptor del factor de crecimiento epidérmico determinado por FISH y las características de los pacientes.

Características Número de Modelos FISH 1 Valor P pacientes Grupo 1 Grupo 2 Total de pacientes evaluados por FISH No.

102 69 33 % 100 67.6 32.4 No.

67 17 Hombre % 100 74.6 25.4 Género No.

19 16 0.037* Mujer % 100 54.3 45.7 Adenocarcinoma No.

54 36 18 No.

100 66.7 33.3 Bronquioloalveolar No.

9 6 3 Carcinoma % 100 66.7 33.3 Histología Carcinoma de célula No.

26 17 9 escamosa 0.7882 % 100 65.4 34.6 No.

2 1 1 % 100 50.0 50.0 Carcinoma de célula No.

11 9 2 grande % 100 81.8 18.2 Carcinoma indiferenciado No fumador No.

4 11 % 100 26.7 73.3 Hitorial de Antiguo fumador No.

33 8 fumador % 100 75.8 24.2 0.001*3 Fumador actual No.

54 14 % 100 74.1 25.9 * estadísticamente significante. El Grupo 1 1FISH incluye tumores con disomía, baja trisomía, alta trisomía y baja polisomía; El Grupo 2 FISH incluye tumores con alta polisomía y amplificación del gen.

2 Adenocarcinoma + Carcinoma Bronquioloalveolar vs. otros.

3 No fumador vs. antiguo fumador + fumador actual.

[0122] En resumen, estos estudios examinaron la correlación entre el número de copias por célula del gen EGFR y la actividad de gefitinib en NSCLC en 102 pacientes de NSCLC que habían progresado o habían recaído con la quimioterapia y se trataron con gefitinib en una dosis diaria de 250 mg. La mayoría de estos pacientes eran hombres (67 %), con el estado funcional según ECOG de 0/1 (88 %) y la edad de media era 62 años (intervalo 25-83). Adenocarcinoma fue la histología principal (52 %), seguida del carcinoma de células escamosas (26 %), carcinoma indiferenciado (11 %) y el carcinoma bronquioloalveolar (9 %). La mayoría de pacientes eran fumadores (53 %) o exfumadores (32 %). Los inventores observaron una respuesta completa (CR) y 13 respuestas parciales (PR) y 26 estabilizaciones de la enfermedad (SD), para una tasa de respuesta objetiva (OR = CR+PR) del 14 %, y una tasa de control de la enfermedad (DCR = CR+PR+SD) del 39 %. Para la población entera, el tiempo medio hasta la progresión (TTP) fue de 2,9 meses, y supervivencia media 7,0 meses. Los especimenes de tejido tumoral recogidos al diagnosticar la enfermedad antes de cualquier terapia de cáncer se usaron para la determinación del número de copias del gen EGFR por célula por hibridación de fluorescencia in situ (FISH). Se usó sonda de color dual LSI EGFR SpectrumOrange/CEP 7 SpectrumGreen (Vysis/Abbott) se usó y se puntuaron aproximadamente 100 células tumorales por espécimen. De acuerdo con el número de copias por célula del gen EGFR y el centrómero del cromosoma 7, los pacientes se clasificaron en dos grupos principales: El grupo 1 incluía 69 pacientes (68 %) sin ninguna o muy baja ganancia genómica (disomía, trisomía, baja polisomía); el Grupo 2 incluía 33 pacientes (32 %) con alta polisomía y amplificación génica. Los pacientes del Grupo 2 tenían considerablemente mejores tasas de respuesta objetiva (OR) y control de enfermedad (DCR) (OR = 36,4 %, DCR = 66,7 %) que los pacientes en el Grupo 1 (OR = 2,9 %, DCR = 26,1 %; p <0,001 para ambas comparaciones). En pacientes con amplificación génica, la respuesta objetiva se observó en el 53,8 % y el 76 % tuvo un control de la enfermedad. El tiempo medio hasta la progresión y la supervivencia total fueron significativamente mayores en el Grupo 2 (6,3 y 9,0 meses) que en el Grupo 1 (2,5 y 6,5 meses; p <0,001 y 0,03, respectivamente). En el análisis multivariante, el Grupo 2 tuvo un riesgo considerablemente inferior de muerte (Proporción de Riesgo: 0,44, 95 % CI = 0,23 a 0,82). En conclusión, la amplificación génica de EGFR y la alta polisomía identificada por FISH son indicadores moleculares sumamente eficaces para la actividad de gefitinib en NSCLC avanzado.

[0123] Los resultados de los estudios descritos en el presente documento demuestran que gefitinib es sumamente activo en pacientes con NSCLC avanzado con amplificación génica de EGFR o alto nivel de polisomía y sostiene el empleo del ensayo de EGFR-FISH para la selección de pacientes de NSCLC para la terapia de inhibidor tirosina cinasa. Se espera que la fuerte relación entre la respuesta a gefitinib y la ganancia genómica de EGFR que se detecta por FISH sea un factor poderoso para definir la elegibilidad del paciente para este fármaco. Una relación positiva entre el resultado clínico y polisomía cromosómica también sugiere que la evaluación de las secuencias centroméricas del cromosoma 7 pueden contribuir a un panel de múltiples pruebas para la predicción de la respuesta. La carencia de correlación entre pacientes con ninguna o baja ganancia genómica indica que el tratamiento no es eficaz en este conjunto de pacientes en particular, por lo tanto minimizando posiblemente la carga clínica y seguramente financiera de este enfoque terapéutico.

[0124] Los inventores también demostraron que las ganancias genómicas en el gen EGFR pueden identificarse por otras técnicas moleculares, tal como PCR cuantitativo en tiempo real, cuyos resultados se relacionan en una patrón significativo positivo con los resultados por FISH.

[0125] La cuestión puede plantearse si el aumento del número de copias de EGFR per se tiene un impacto positivo sobre el pronóstico, independiente del tratamiento. Sin embargo, parece ser el caso lo opuesto. Los inventores han indicado previamente que los pacientes con NSCLC con tumores extirpados que llevan un alto número de copias del gen EGFR tienen una tendencia a una supervivencia más corta (Hirsch y col., 2003, J. Clin. Oncol.). Así, de forma análoga a los hallazgos en el cáncer de mama para HER2 y trastuzumab (Herceptin®, Genentech/Roche), el aumento del número de copias del gen EGFR en NSCLC parece ser un rasgo de pronóstico deficiente, pero un buen indicador de la sensibilidad a inhibidores del EGFR.

Ejemplo 2 [0126] El siguiente ejemplo demuestra el uso de detección de amplificación génica de EGFR y polisomía para predecir el resultado del tratamiento de pacientes con tumores BAC con respecto a inhibidores del EGFR (en base a la cohorte SWOG).

[0127] Los subtipos del carcinoma bronquioloalveolar (BAC) de NSCLC se caracterizan por características patológicas, radiográficas y clínicas únicas (Travis y col., 1999), y parece aumentar la incidencia, en particular en mujeres no fumadoras más jóvenes (Barsky y col., 1994; Furak y col., 2003). Se ha indicado que BAC y el adenocarcinoma con rasgos BAC son particularmente sensibles a los inhibidores de la tirosina cinasa de EGFR, con tasas de respuesta del 25-30 % (Miller y col., 2003) y una supervivencia prolongada en un subconjunto de pacientes. Los inventores y colegas han indicado previamente la eficacia de gefitinib en una cohorte grande de pacientes BAC en fase avanzada tratados en un ensayo clínico prospectivo del Southwest Oncology Group (S0126) (Gandara y col., 2004). Puesto que el tejido tumoral de archivo se recogió de la gran mayoría de pacientes incluidos en el ensayo, el estudio S0126 representa un recurso patológico único para el estudio de rutas de EGFR. En base a la experiencia previa de los inventores con pacientes de NSCLC tratados con gefitinib, se especuló que el aumento del número de copias de los genes EGFR y/o HER2 detectado por FISH estaba asociado al aumento de la eficacia de gefitinib en el subconjunto de los pacientes con NSCLC que tenían BAC o adenocarcinoma con rasgos de BAC. Este ejemplo indica los resultados de este análisis en el tejido tumoral de los pacientes del estudio S0126, relacionado con el resultado clínico.

MATERIAL Y MÉTODOS

[0128] Era necesario que todos los pacientes incluidos en el estudio tuvieran BAC o adenocarcinoma con rasgos de BAC en fase IIIB (por efusión pleural) o IV histológicamente demostrado. La elegibilidad patológica se basó en una definición institucional de BAC, aunque se realizó posteriormente una revisión central usando la World Health Classification (Travis y col., 1999). Los subtipos histopatológicos de este informe se basan en esta revisión de patología central. No se aceptaron especimenes citológicos para el diagnóstico de BAC, y los no fueron elegibles pacientes con únicamente un diagnóstico citológico para S0126.

[0129] Era necesario que los pacientes tuvieran un estado funcional según SWOG de 0-2. La evaluación previa al estudio incluía: historia y examen físico; recuento sanguíneo completo con cálculo diferencial y plaquetas, químicas séricas de fosfatasa alcalina, SGOT o SGPT, LDH y albúmina; radiografía de tórax; TC de tórax, hígado y glándulas suprarrenales. Fue necesaria una gammagrafía ósea y/o TC del cerebro o MRI únicamente si se indicó clínicamente en base a los síntomas y al criterio médico. Los pacientes con una historia de metástasis cerebral no eran elegibles para el presente estudio. Las mujeres embarazadas o lactantes no eran elegibles, y las mujeres y hombres de potencial reproductor estaban incapacitados para participar a menos que aceptasen usar método anticonceptivo eficaz. Los pacientes elegibles no tenían ninguna otra neoplasia previa excepto cáncer de piel de células basales o células escamosas tratado adecuadamente, cáncer cervical in situ, cáncer en estadio I o II tratado adecuadamente del cual el paciente estaba en remisión completa, o cualquier otro cáncer que no había aparecido en el paciente durante al menos cinco años.

[0130] Todos los pacientes fueron informados de la naturaleza investigacional de este estudio y firmaron un consentimiento escrito informado conforme al comité de revisión institucional local y las directrices federales. Todos los pacientes tenían la enfermedad mensurable o evaluable.

[0131] El estudio consistió en 137 pacientes elegibles divididos en dos cohortes: pacientes que no habían recibido quimioterapia (N = 101), y aquellos con tratamiento de quimioterapia previo (N = 36); un paciente murió antes del inicio del tratamiento. Los pacientes se trataron con gefitinib diario oral a una dosis de 500 mg/día hasta la progresión o toxicidad prohibitiva. Las características de los pacientes fueron edad media de 68 años (rango 34-88), distribución masculina/femenina 45 %-51 %, estado funcional 0-1/2 al 89 % 11 %, y estadio IIIB/IV el 11 %/89 %.

[0132] El diagnóstico histopatológico y la subtipificación de BAC se realizaron en secciones teñidas por hematoxilina- eosina por lectura de consenso por dos de los autores (WAF y FRH) usando los criterios conformes con la WHO (Travis y col., 1999). Para cada paciente, se cortaron secciones de tejido embebido en parafina de 4 m seriadas que contenían células malignas representativas. El número de copias celular se investigó por FISH usando la sonda LSI EGFR SpectrumOrange/CEP 7 SpectrumGreen de acuerdo con los protocolos descritos en otra parte (Hirsch y col., 2003, J. Clin. Oncol.; Hirsch y col., 2002, Br. J. Cancer). Usando el corte teñido por HE de referencia de la sección adyacente donde se identificaron los focos tumorales dominantes, los números de copias de los genes EGFR y HER2 y las sondas de los cromosomas 7 y 17 se evaluaron y se registraron independientemente en al menos 100 núcleos no solapantes con morfología intacta. El análisis por FISH se realizó independientemente por dos observadores (MVG, ACX) que no sabían nada de las características clínicas de los pacientes. De acuerdo con la frecuencia de las células tumorales con el número específico de copias de los genes EGFR o HER2 y los centrómeros de los cromosomas 7 y 17, los pacientes se clasificaron en dos estratos: FISH negativo, con ninguna o baja ganancia genómica (4 copias del gen en >40 % de las células) y FISH positivo, con alto nivel de polisomía (4 copias del gen en 40 % de las células) o amplificación génica, que se define por la presencia de estrechos agrupamientos génicos y una relación gen/cromosoma por célula de 2, o 15 copias de los genes por célula en 10 % de las células analizadas.

Métodos Estadísticos:

Definiciones de los Resultados

[0133] La evaluación de la respuesta se realizó por criterios convencionales (RECIST) (Therasse y col., 2000). Sólo los pacientes con enfermedad mensurable se incluyeron en la evaluación de la respuesta, mientras que el análisis de supervivencia incluyó a todos los pacientes. Los datos de supervivencia se analizaron desde el día en el que el paciente comenzó el tratamiento de gefitinib hasta la muerte. La supervivencia total (OS) se calculó como el tiempo desde el registro al estudio S0126 hasta la muerte por cualquier causa o último contacto. La supervivencia sin progresión (PFS) se calculó como el tiempo desde el registro al estudio S0126 a la progresión de enfermedad o hasta la muerte por cualquier causa o último contacto.

Métodos de Análisis

[0134] Las curvas de supervivencia se estimaron por el método de límite de producto (Kaplan y Meier; 1958) y se comparó usando la prueba de rango logarítmico (Mantel, 1966). Se usó la regresión de riesgo proporcional de Cox para evaluar la influencia de FISH de EGFR y factores de pronóstico convencionales sobre los resultados de supervivencia y para estimar proporciones de riesgo (Cox, 1972). Se incluyeron todos los modelos multivariante usando métodos de regresión gradual retrógrada. Todas las covariables univariadas significativas se incluyeron en la selección gradual.

RESULTADOS

[0135] El Protocolo S0126 incluía 145 pacientes, de los cuales 8 no eran elegibles y uno no recibió el tratamiento de protocolo, dejando 136 pacientes elegibles para el análisis. Entre estos, 81 pacientes tenían tejido tumoral disponible para el análisis génico de EGFR mediante análisis por FISH (Tabla 4) y 56 tenían tejido disponible para el análisis génico de HER2 por FISH.

TABLA 4 – Datos Demográficos de la Cohorte de FISH en comparación con la Cohorte total de S0126 según SWOG.

Características Grupo S0126 EGFR/FISH (N=81) (N=136) Positivo Negativo Total Mujeres 69 (51%) 13 (50%) 28 (51%) 41 (51%) Hombres 67 (49%) 13 (50%) 27 (49%) 40 (49%) Fumadores 97 (71%) 20 (77%) 39 (71%) 59 (73%) No fumadores 39 (29%) 6 (27%) 16 (29%) 22 (27%) PS=0 62 (46%) 13 (50%) 22 (40%) 35 (43%) PS=1 59 (43%) 11 (42%) 23 (42%) 34 (42%) PS=2 15 (11%) 2 (8%) 10 (18%) 12 (15%) ADC 11 (11%) 5 (20%) 2 (4%) 7 (9%) ADC con BAC 34 (34%) 8 (32%) 16 (29%) 24 (30%) BAC Mucinas 17 (17%) 1 (4%) 13 (24%) 14 (18%) BAC no- Mucinas 37 (37%) 11 (44%) 24 (44%) 35 (44%) [0136] No hubo ninguna diferencia estadística del género, condición de fumador, el estado funcional y la histología entre la cohorte total de S0126 y la subcohorte de 81 pacientes que se sometieron al análisis por FISH de EGFR (Tabla 4). De forma análoga, no se observó ninguna diferencia estadística se observó en el resultado de supervivencia entre la población total de S0126 y la subcohorte de FISH de EGFR (figura 4A). Por lo tanto, la subcohorte de FISH de EGFR parecía representativa de la población total de S0126.

[0137] Se muestra el número de pacientes en cada categoría de FISH de EGFR en la Tabla 5. Todos, 26/81 pacientes (32 %) dieron positivo para el FISH de EGFR, y no hubo ninguna diferencia significativas entre los grupos positivos y negativos de FISH de EGFR en cuando a género, histología, condición de fumador o estado funcional (Tabla 4). Para el análisis de respuesta, 55 de los 81 pacientes de FISH de EGFR tenía una enfermedad mensurable. En el grupo positivo de FISH, 5 de 19 pacientes (26 %) tenían una respuesta objetiva y 12 pacientes (63 %) tenían control de la enfermedad (respuesta objetiva o enfermedad estable), mientras que en el grupo negativo por FISH, 4 de 36 pacientes (11 %) tenían respuesta objetiva (p = 0,14) y 14 pacientes (39 %) tenían control de la enfermedad (p = 0,087) (Tabla 5).

TABLA 5. Resultado del tratamiento de acuerdo con los estratos por FISH de EGFR.

Resultado No.

TTP (mo) Supervivencia 1-año de EGFR FISH pts.

RSP (%)1 DCR (%)1 (95% CI) Media (mo) supervivencia (%) FISH negativo 4/36 (11%) 14/36 4 (2-5) 4 (2-5) 42% (39%) (29%-55%) FISH positivo 26 5/19 (26%)* 12/19 9 (3-20) >18*** 81% (63%)** (65%-96%) TOTAL 81 9/55 (16%) 26/55 4 (2-6) 14 (8-19) 54% (47%) (43%-65%) 1Limitado al subgrupo de pacientes con enfermedad mesurable. *p= 0.15, ** p= 0.087 *** Supervivencia Media aún no alcanzada.

[0138] Los 81 pacientes elegibles con tejido tumoral evaluable para el análisis por FISH de EGFR se incluyeron en el análisis de supervivencia. Las curvas de supervivencia sin progresión y de supervivencia total para pacientes con tumores positivos y negativos por FISH se muestran en las figuras 4B y 4C, respectivamente. El tiempo de supervivencia sin progresión medio para pacientes con FISH negativa era 4 meses (95 % C.I.: 2, 5) frente a 9 meses (95 % C.I.: 3, 20) para pacientes con FISH positiva con una proporción de riesgo de 1,67 (p = 0,072) (95 % CI: 0,96, 2,91, p = 0,072) (figura 4B). El tiempo de supervivencia medio para pacientes con FISH negativa era de 8 meses (95 % C.I.: 6, 15). Mientras la supervivencia media para pacientes con FISH positiva aún no se ha alcanzado, se acerca a los 18 meses, con una proporción de riesgo de 2,02 (95 % CI: 1,03, 3,99, p = 0,042) (figura 4C).

[0139] Las tasas de respuesta y la supervivencia también se analizaron en lo que respecta a subtipos histológicos. Entre los 8 pacientes con adenocarcinoma, se observaron pacientes que no respondieron al tratamiento, pero 2 pacientes tenían la enfermedad estable (DCR 2/8 = 25 %). Sin embargo, entre 27 pacientes con adenocarcinoma con rasgos de BAC, 5 pacientes (19 %) consiguieron respuesta y 12 pacientes (44 %) la enfermedad estable (DCR 17/27 = 63 %). En el grupo BAC no mucinoso, 6 de 20 pacientes (30 %) tuvo respuesta y 8 pacientes (40 %) tuvieron enfermedad estable (DCR 14/20 = 70 %), mientras en el grupo BAC mucinoso ninguno de los 11 pacientes tuvo respuesta ni enfermedad estable (chi cuadrado p = 0,0004).

[0140] Se usó un modelo de regresión de Cox multivariante (Tabla 6) para evaluar la posibilidad de que el efecto del número de copias de EGFR por FISH sobre la supervivencia podía explicarse por otros factores de pronóstico convencionales. El número de copias de EGFR por FISH dejó un factor de pronóstico significativo tanto para la supervivencia total (p = 0,0261) como para la supervivencia sin progresión (p = 0,034) después de contar con la condición de fumador, sexo, histología y estado funcional.

TABLA 6 – Análisis Multivariante para la supervivencia total en pacientes con datos para todas las variables (N=80 pacientes) Variable Nº. Pacientes (%) Tasa de riesgo (95% Valor-P CI) Fumadores Antiguos/Actuales 58 (73%) 3.72 (1.67-8.30) 0.0013 Adenocarcinoma 7 (9%) 4.86 (1.69-14.01) 0.0034 Estado de rendimiento 12 (15%) 4.24 (1.95-9.25) 0.0003 BAC Mucinas 14 (18%) 2.86 (1.43-5.73) 0.0030 EGFR FISH negativo 55 (69%) 2.50 (1.12-5.62) 0.0261

DISCUSIÓN

[0141] Este estudio demuestra que el aumento del número de copias del gen EGFR detectado por FISH está relacionado con una mejora de la supervivencia después de la terapia de gefitinib en pacientes con BAC en fase avanzada y adenocarcinoma con rasgos BAC, un subconjunto de NSCLC que puede servir como modelo para el estudio de rutas de EGFR debido a sus características biológicas subyacentes (Gandara y col., 2004). En el estudio actual, aproximadamente un tercio de los pacientes tuvo un aumento del número de copias del gen EGFR, y estos pacientes también tuvieron una tendencia a mayores tasas de respuesta y un tiempo más largo hasta la progresión después de la terapia de gefitinib. Mientras que la evaluación de la respuesta RECIST no puede aplicarse comúnmente en pacientes con BAC porque la infiltración pulmonar difusa no puede medirse, sin desear quedar ligado a teoría alguna, los inventores creen que la diferencia significativa en la supervivencia entre pacientes con tumores positivos y negativos a FISH de EGFR apoyan fuertemente la hipótesis de que el aumento de número de copias de genes está relacionado con el aumento de la eficacia de gefitinib. Hay muy poca información en la bibliografía en cuanto a la supervivencia para pacientes con BAC avanzado. En un estudio de Breathnach y col.

(Breathnach y col., 1999), se analizaron 28 pacientes con BAC avanzado tratados con quimioterapia o radioterapia. El tiempo de supervivencia medio desde el principio del tratamiento inicial era de 11,7 meses (95CI 8,7-16,7). En un estudio según SWOG anterior (S9714) que evaluó paclitaxel en BAC avanzado, la supervivencia media fue de 12 meses (West y col., 2005). En el estudio actual, el tiempo de supervivencia medio para el grupo positivo para FISH aún no se ha alcanzado, pero se aproxima a 18 meses frente a 8 meses para el grupo negativo para FISH. Los inventores y colegas han notificado previamente que el aumento del número de copias del gen EFGR estaba relacionado con un pronóstico deficiente en pacientes con NSCLC extirpado quirúrgicamente (Hirsch y col., 2003, J. Clin. Oncol.). En este estudio, los inventores verifican que el aumento del número de copias del gen EFGR es un marcador positivo predictivo para una mejor supervivencia bajo la influencia de terapia de gefitinib. Estas observaciones son similares a los datos indicados para pacientes de cáncer de mama con amplificación génica de HER2, que tienen un mal pronóstico, pero una mayor probabilidad de beneficiarse de trastuzumab (Herceptin®) (Slamon y col., 2001).

[0142] Los datos demográficos y de supervivencia se compararon entre la población positiva para FISH de EGFR y la población total del estudio, y no se observó ninguna diferencia en cuanto a factores de pronóstico conocidos, tales como el género, condición de fumador, estado funcional o histología. Además, no hubo ninguna diferencia en la supervivencia total entre la población total y la cohorte del ensayo por FISH.

[0143] El foco de este ejemplo es el valor profético de FISH de EGFR para la supervivencia en pacientes con BAC en fase avanzada. La correlación con otros métodos de evaluación de la viabilidad biológica de EGFR y rutas de transducción de señal asociadas, tales como niveles de proteína de EGFR, análisis de mutación de EGFR y medida de marcadores corriente abajo como AKT Y MAPK se analiza en otra parte en el presente documento y puede describirse adicionalmente con respecto a BAC avanzado. Los niveles MAPK, como se evaluó por inmunohistoquímica (IHC), predicen la sensibilidad frente a gefitinib en tumores BAC (Gandara y col., 2004) y pueden incluirse como un biomarcador adicional en los métodos del presente documento.

[0144] Las implicaciones clínicas de estos hallazgos son considerables con respecto a la selección del paciente para la terapia con inhibidores de la tirosina cinasa de EGFR (EGFR TKI). BAC es una entidad de enfermedad que parece estar aumentando de incidencia (Barsky y col., 1994; Furak y col., 2003). Mientras que estudios preliminares han demostrado tasas de respuesta relativamente altas para inhibidores del EGFR en pacientes con BAC y sus subtipos histológicos (West y col., 2005; Patel y col., 2003; Miller y col., 2004), ningún estudio ha demostrado aún el beneficio en la supervivencia de estos agentes en esta población de pacientes. El estudio actual demostró un beneficio de supervivencia significativa en pacientes positivos para FISH de EGFR lo que indica que puede usarse un aumento del número de copias del gen EGFR detectado por FISH como un marcador para evaluar el potencial de supervivencia en pacientes para ser tratados con EGFR-TKI. La tecnología por FISH es aplicable para uso clínico, ya que el análisis se realiza en un material embebido en parafina habitual.

Ejemplo 3 [0145] El siguiente ejemplo demuestra el uso de expresión de proteína de EGFR, la expresión de Akt fosforilada y la combinación de estos marcadores con números de copias del gen EGFR y la mutación de EGFR para predecir el resultado a la terapia del inhibidor del EGFR en pacientes con NSCLC (cohorte Italiana).

MÉTODOS

SELECCIÓN DE PACIENTES Y DISEÑO DEL ESTUDIO

[0146] Los pacientes incluidos .en este estudio provenían de un estudio prospectivo de gefitinib (Cappuzzo y col., 2004, J Natl. Cancer Inst.) y el Estudio de Acceso Expandido de gefitinib realizando en el Bellaria Hospital (Bolonia), el Scientific Institute University Hospital San Raffaele (Milán) y el Policlinico Monteluce (Perugia). Estuvieron disponibles información clínica completa y bloques tisulares de 80 de 106 pacientes incluidos en el ensayo clínico de Akt (Cappuzzo y col., ibid.), y de 22 pacientes más en el Estudio de Acceso Expandido que se trataron consecutivamente al final del estudio Akt y se siguió del mismo modo que para los pacientes en el estudio de Akt. Estos estudios se aprobaron por la junta de supervisión ética institucional del Bellaria Hospital, y se obtuvo el consentimiento informado por escrito de cada paciente antes de la inclusión en el estudio. En el subgrupo de pacientes que participó en el Estudio de Acceso Expandido de gefitinib, se obtuvo la aprobación de la junta de supervisión institucional de acuerdo con la buena práctica médica, y se obtuvo el consentimiento información por escrito específico de cada paciente (formulario de consentimiento para el Estudio de Acceso Expandido, versión en italiano).

[0147] La elegibilidad para ambos estudios incluía NSCLC histológicamente confirmado con enfermedad medible localmente avanzada o metastásica, progreso o recaída después de la quimioterapia o con contraindicaciones médicas para la quimioterapia. Los pacientes tenían un estado funcional que variaba de grado 0 a 2. El estado funcional se definió de acuerdo con el Eastern Cooperative Oncology Group (Oken y col., 1982) y se consideró de grado 0 cuando el paciente estaba completamente activo y era capaz de realizar todas las actividades previas a la enfermedad sin restricción, grado 1 cuando el paciente estaba limitado por una actividad extenuante físicamente pero ambulatorio y capaz de realizar un trabajo de naturaleza suave o sedentaria, y grado 2 cuando el paciente era ambulatorio y era capaz de cuidar de sí mismo pero incapaz de realizar ninguna actividad laboral.

[0148] Los pacientes recibieron gefitinib (250 mg por día) y se evaluaron para determinar la respuesta de acuerdo con los criterios de Response Evaluation Criteria in Solid Tumors (Therasse y col., 2000). La respuesta tumoral se evaluó por tomografía computerizada después de 2 meses, con una evaluación confirmatoria a repetir en los pacientes que respondieron al tratamiento y en pacientes con enfermedad estable al menos 4 semanas después de la determinación inicial de la respuesta. El tiempo hasta la progresión de la enfermedad se calculó desde la fecha de inicio del tratamiento de gefitinib a la fecha de detección de la enfermedad progresiva o hasta la fecha del último contacto. La supervivencia se calculó desde la fecha del inicio de la terapia hasta la fecha de la muerte o hasta la fecha del último contacto.

PREPARACIÓN DEL TEJIDO Y ANÁLISIS DE PROTEÍNAS

[0149] Se obtuvieron especimenes de tumor antes de cualquier terapia para el cáncer y se embebieron en parafina. Las secciones seriadas (4 m) que contenían células malignas representativas se tiñeron con hematoxilina y eosina y se clasificaron en base a los criterios de la World Health Organization (Travis y col., 1999).

[0150] La expresión de la proteína de EGFR se evaluó por inmunohistoquímica usando los métodos y criterios de valoración descritos en otra parte en este documento (Hirsch y col., 2003, J. Clin. Oncol.) con el anticuerpo monoclonal clon 31G7 de EGFR anti-humano de ratón (Zymed Laboratories, Inc., San Francisco, CA). P-Akt también se detectó por inmunohistoquímica usando el anticuerpo monoclonal P-Akt anti-ratón de conejo (Ser 473) (Cell Signaling Technology, Beverly, MA, Estados Unidos), de acuerdo con el protocolo del fabricante. La expresión de P- Akt y la expresión de EGFR se puntuaron en base a la intensidad y la fracción de células positivas. La puntuación de la intensidad se definió como se indica a continuación: 0 = tinción no apreciable en las células tumorales, 1 = tinción apenas detectable en el citoplasma y/o el núcleo en comparación con los elementos estromales, 2 = tinción de color marrón fácilmente apreciable marcando claramente el citoplasma de la células del tumor y/o el núcleo, 3 = tinción de color marrón oscuro en las células tumorales oscureciendo el citoplasma y/o el núcleo, o 4 = tinción muy fuerte del núcleo y/o el citoplasma. La puntuación se basó en la fracción de células positivas (0 %-100 %). La puntuación total se calculó multiplicando la puntuación de la intensidad y la puntuación de la fracción produciendo un intervalo total de 0 a 400. Para los análisis estadísticos, las puntuaciones de 0-200 se consideraron como expresión negativa/baja, y las puntuaciones de 201-400 se consideraron como expresión positiva/alta. Este nivel de corte se basó en la concordancia con los estudios anteriores de nuestro grupos, en los que se descubrió una correlación entre el aumento de la expresión de la proteína de EGFR y el aumento del número de copias de genes (Hirsch y col., 2003, ibid.). Los ensayos inmunohistoquímicos se puntuaron conjuntamente por dos investigadores que desconocían los resultados clínicos, FISH y de la mutación en EGFR, y si se produjeron discrepancias, se hizo una puntuación de consenso por los rectores después del análisis del portaobjetos.

ANÁLISIS ESTADÍSTICO:

[0151] Las diferentes entre los grupos se compararon usando el test exacto de Fisher o el la prueba chi cuadrado de Pearson para las variables cualitativas y usando la prueba t de Student o análisis de la variación para variables continuas. La normalidad de la distribución se evaluó usando la prueba de Kolmogorov-Smirnov (Curiel y col., 1990).

El tiempo hasta la progresión, la supervivencia total y los intervalos de confianza al 95 % se calcularon y se evaluaron por el método de Kaplan-Meier (Don y col., 1991); los diferentes grupos se compararon usando la prueba de rango logarítmico. La asociación de los factores de riesgo relacionados con la supervivencia se evaluó usando el modelo de regresión del riesgo proporcional de Cox con un procedimiento de reducción gradual (Armitage y Berry, 1994). Únicamente se incluyeron en el análisis multivariable las variables con resultados significativos en el análisis univariante. El criterio para la retirada de variables fue la relación estadística de probabilidad, en base a los cálculos de probabilidad parcial máxima (valor P por defecto de 0,10 para la retirada del modelo). El diseño del estudio garantiza la independencia de las observaciones. La suposición de riesgo proporcional se probó por el análisis de la función de supervivencia logarítmica y se descubrió que se mantuvo. Todas las pruebas estadísticas fueron dobles y el significado estadístico se definió como P <0,05. Todos los análisis se realizaron usando el paquete estadístico SPSS versión 11.5 (SPSS Italia srl, Bolonia, Italia).

RESULTADOS

CARACTERÍSTICAS CLÍNICAS

[0152] El resultado clínico en base al sexo, fase, histología, estado funcional y condición de fumador, la mayor parte de los cuales se indica en la publicación anterior (Cappuzzo y col., JNCI, 2004), se muestra en la Tabla 1 (véase el Ejemplo 1). Para todo el grupo, la tasa de respuesta objetiva fue del 14 %, la tasa de progresión fue del 60 %, el tiempo medio hasta la progresión fue de 2,9 meses, la supervivencia media fue de 9,4 meses, y la supervivencia a 1 año fue del 40,7 %. El sexo femenino (diferencia media del 22.6%, 95 % CI: 6,6 a 38,6, P = 0,004) y la condición de no fumador (diferencia media del 30,8 %, 95 % CI: 5,3 a 56,3, P = 0,006) se asociaron estadísticamente de forma significativa a una mejor respuesta, y el sexo femenino (diferencia media de 3,0 meses, 95 % CI: 4,5 a 10,5 meses,

P = 0,03,), histología adenocarcinoma y bronquialveolar (diferencia media de 5,0 meses, 95 % CI: 2,8 a 7,2 meses, P = 0,03), y un estado funcional 0-1 (diferencia media de 7,4 meses, 95 % CI: 5,6 a 9,1 meses, P = 0,004) se asociaron estadísticamente de forma significativa a una mayor supervivencia.

[0153] El tiempo hasta la progresión de la enfermedad se calculó desde la fecha de inicio del tratamiento con gefitinib hasta la fecha de detección de la enfermedad progresiva o hasta la fecha del último contacto. La supervivencia se calculó desde la fecha del inicio de la terapia hasta la fecha de la muerte o hasta la fecha del último contacto. El significado estadístico y las diferencias entre los grupos se evaluaron con la prueba de rango logarítmico.

EXPRESIÓN DE PROTEÍNA DE EGFR Y RESULTADO CLÍNICO

[0154] La expresión de la proteína de EGFR se evaluó por inmunohistoquímica en 98 pacientes (datos no mostrados) y el resultado de pacientes de acuerdo con la puntuación para proteína se muestra en la Tabla 7a y la figura 3A-3B. Los pacientes con puntuaciones más bajas (0-99) no tuvieron respuesta alguna, y sólo uno tuvo enfermedad estable. Estos pacientes tenían un corto tiempo hasta la progresión (media de 2,1 meses) y una corta supervivencia media (4,5 meses) y el 27 % tuvo supervivencia a 1 año. Los pacientes con puntuaciones de 100-199 también tuvieron un resultado deficiente, con una tasa del 65 % de enfermedad progresiva, corto tiempo hasta la progresión (media de 2,3 meses), y mala supervivencia (únicamente el 35 % de los pacientes vivos al año 1). Puesto que sus resultados fueron igualmente malos, los 40 pacientes (41 %) con puntuaciones por debajo de 100 y 100-199 se combinaron (EGFR IHC-). Los pacientes con puntuaciones por inmunohistoquímica de EGFR de 200-299 y de 300-399 tuvieron resultados mucho mejores que los pacientes del grupo EGFR IHC-, y dado que tuvieron similares tasas de respuesta, tiempos de progresión y supervivencia, también se agruparon juntos (EGFR IHC+). Los pacientes EGFR IHC+, en comparación con los pacientes IHC-, tuvieron una tasa de respuesta objetiva significativamente mayor (21 % frente al 5 %, P = 0,03), menor tasa de progresión (44,8 % frente al 80 %, P <0,001), mayor tiempo hasta la progresión (5,2 frente a 2,3 meses, P = 0,001) y mayor supervivencia (11,5 frente a 5,0 meses, P = 0,01). El estado proteico no se asoció a las características clínicas (Tabla 8) pero estaba estadísticamente correlacionado de forma significativa con el número de copias de genes (Pearson r = 0,28, P = 0,006).

TABLA 7A. Expresión de la proteína de EGFR y el Resultado Clínico en 98 pacientes con NSCLC avanzado tratados con gefitininb Puntuación IHC N OR PD TTP MS (mo) 1-año (mo) Total: 98 (100%) 14 (14%) 58 (59%) 2.9 9.5 41±5 0-99 20 (20%) 0 (0%) 19 (95%) 2.1 4.5 27±10 100-199 20 (20%) 2 (10%) 13 (65%) 2.3 5.3 35±10 200-299 15 (15%) 4 (26%) 5 (33%) 8.6 15.2 71±12 300-400 43 (44%) 8 (19%) 21 (49%) 4.5 11.3 41±8 EGFR IHC ÷ (<200) 40 (41%) 2 (5%) 32 (80%) 2.3 5.0 31±7 EGFR IHC + (≥200) 58 (59%) 12 (21%) 26 (45%) 5.2 11.5 48±7 P (IHC ÷vs. IHC+) 0.03 <0.001 0.001 0.01 0.01 *Características de 102 pacientes con histología confirmada de cáncer de célula no pequeña con enfermedad mesurable, localmente avanzada o metastático progresando o recayendo después de quimioterapia, o contraindicaciones médicas para quimioterapia que fueron tratados posteriormente con 250 mg de gefitinib diariamente. OR=respuesta objetiva, PD= enfermedad progresiva, TTP=tiempo de progresión MS= media total de supervivencia. La condición de proteína por inmunohistoquímica (IHC) se definió en base a la fracción de células positivas; 0-100% e intensidad de mancha en una escala de 1-4. El recuento total se calculó multiplicando la valoración de intensidad y la valoración de fracción, haciendo una gama total de 0-400. †P valores (bilateral) calculados usando la prueba de rango logarítmico ‡P valores (bilateral) calculados usando la prueba chi-cuadrado de Pearson §P valores (bilateral) calculados usando la prueba exacta de Fisher

MUTACIÓN EN EGFR Y RESULTADO CLÍNICO

[0155] El análisis de mutación para los exones EGFR 18, 19 y 21 se realizó en un total de 89 casos de pacientes (60 especimenes con microdisección y 29 sin microdisección). Las mutaciones en EGFR se descubrieron en 15 pacientes (mutación positiva para EGFR = 17 %), 12 de especimenes de microdisección y tres de especimenes sin microdisección (P = 0,30), y consistieron en mutaciones de sentido erróneo en el exón 21 (n = 8) o deleciones pequeñas en el marco de lectura en los codones 746-753 en el exón 19 (n = 7) (Tablas 7b y 9). Todas estas mutaciones se habían descrito previamente (11-13), con la excepción de la mutación de sentido erróneo en el exón 21 (valina 851 a isoleucina, V851I), que se produjo en un paciente varón que experimentaba enfermedad progresiva.

La presencia de mutaciones en EGFR se asoció con historial como no fumador (P = 0,007). Las asociaciones con el sexto y la histología no fueron estadísticamente significativas (P = 0,10 para ambas), aunque las mutaciones fueron más frecuentes en mujeres y en pacientes con adenocarcinoma (Tabla 8).

TABLA 7B. Mutación en EGFR y Resultado Clínico en 89 pacientes con NSCLC avanzado tratados con gefitininb.

Mutaciones EGFR N OR PD TTP (mo) MS (mo) 1-año Total: 89 (100%) 12 (13%) 56 (63%) 2.9 9.4 41±5 Mutación Ausente 74 (83%) 4 (5%) 50 (68%) 2.6 8.4 38±6 Mutación Presente 15 (17%) 8 (53%) 6 (40%) 9.9 20.8 57±13 P (Mutación Ausente vs. Presente 0.001 0.04 0.02 0.09 0.22 TABLA 8 - Receptor de factor de crecimiento epidérmico (EGFR) y características de los pacientes con “cáncer de pulmón de células no pequeñas” según FISH, proteína y estado de la mutación génica* Estado EGFR FISH Estado proteína EGFR Mutación gen EGFR Características del Positivo, Negativo, Positivo, Negativo, Presente, Ausente, Paciente N/% N/% N/% N/% N/% N/% Total 33/32 69/68 58/59 40/41 15/17 74/83 Sexo Hombre 17/51 50/72 37/64 27/67 7/47 51/69 Mujer 16/48 19/28 21/36 13132 8/53 23/31 P .04† .70† .10† Histología Adenocarcinoma1 18/54 36/52 29/50 22/55 10/67 40/54 BronquioloalveolarA 3/9 6/9 4/7 5/12 2/13 6/8 Célula escamosaB 9/27 17/25 18/31 8/20 1/7 20/27 Célula grandeB 1/3 1/1 ½ ½ 1/1 IndiferenciadoB 2/6 9/13 6/10 4/10 2/13 7/9 P (AversusB) .78† .29† .10† Estado de rendimiento 13/39 36/52 27/47 20/50 8/53 35/47 1 13/39 28/40 27/47 12/30 5/33 31/42 2 7/21 5/7 4/7 8/20 2/13 8/11 P (0+1 versus 2) .053‡ .06‡ .60‡ Historial de fumador No fumador 11/33 4/6 10/17 5/12 6/40 7/9 Antiguo fumador 8/24 25/36 21/36 11/27 5/33 24/32 Fumador actual 14/42 40/58 27/47 24/60 4/26 43/58 P (No versus otros) .001‡ .52† .007‡ *Características de 102 pacientes con histología confirmada de cáncer de célula no pequeña con enfermedad mesurable, localmente avanzada o metastático progresando o recayendo después de quimioterapia, o contraindicaciones médicas para quimioterapia que fueron tratados posteriormente con 250 mg de gefitinib diariamente. El estado de rendimiento se definió como 0 = Completamente activo, capaz de continuar con todo el rendimiento previo a la enfermedad sin ninguna restricción; 1 = restringido en la actividad físicamente vigorosa pero ambulatorio y capaz de realizar el trabajo de una naturaleza ligera o sedentaria, por ejemplo, el trabajo ligero de casa, el trabajo de oficina ; y 2 =Ambulatorio y capaz de cualquier cuidado de sí mismo, pero incapaz de realizar cualquier actividad de trabajo, y por encima de y sobre más del 50 % de tiempo despierto (criterios de Grupo Eastern 31 Cooperative Oncology, 34) FISH = Hibridación fluorescente in situ. † P valores (bilateral) calculados usando la prueba chi-cuadrado de Pearson ‡ P valores (bilateral) calculados usando la prueba exacta de Fisher TABLA 9 Deleciones Exón 19 Proteina 739 K I P V A I K E L R E A T S P K A N EGFR 756 SEQ ID NO:4 Gen EGFR 2215 AAA ATT CCC GTC GCT ATC AAG GAA TTA AGA GAA GCA ACA TCT CCG AAA GCC AAC 2268 SEQ ID NO:5 Paciente 15 AAA ATT CCC GTC GCT ATC AAG --- --- --- --- --- TCT CCG AAA GCC AAC SEQ ID NO:6 Pacientes AAA ATT CCC GTC GCT ATC AA. --- --- --- --- .A ACA TCT CCG AAA GCC AAC 19, 30, 41 y SEQ ID NO:7 53* Paciente 57 AAA ATT CCC GTC GCT ATC AAG GAA T.. --- --- --- --- .CT CCG AAA GCC AAC SEQ ID NO:8 Paciente 75† AAA ATT CCC GTC GCT ATC AAG --- --- --- --- --- ACA TCT CCG AAA GCC AAC SEQ ID NO:9 Notas . Similar al paciente 1 en (11) t Similar a la Del-1b (12) Mutaciones Exón 21 Proteina 850 H V K I T D F G L A K L L G 863 EGFR SEQ ID NO:10 Gen EGFR 2538 CAT GTC AAG ATC ACA GAT TTT GGG CTG GCC AAA CTG CTG GGT 2589 SEQ ID NO:11 Pacientes H V K I T D F G L A K L L G 1,2, 16, 26, SEQ ID NO:12 31, 38, 100 CAT GTC AAG ATC ACA GAT TTT GGG CTG GCC AAA CTG CTG GGT (sustitución SEQ ID NO:13 2573 T>G) ‡ Paciente 3 H I K I T D F G L A K L L G (Sustitución SEQ ID NO:14 2541 G>A)# CAT ATC AAG ATC ACA GAT TTT GGG CTG GCC AAA CTG CTG GGT SEQ ID NO:15 Notas ‡ Paciente 38 predominantemente mutante # Mutación del Paciente 3 no se ha informado en la base de datos SNP Marcadores utilizados para Análisis de Mutaciones Exón 18 GACCCTTGTCTCTGTGTTCTTGT hacia SEQ ID NO:16 delante Exón 18 TATACAGCTTGCAAGGACTCTGG opuesto SEQ ID NO:17 hacia fuera Exón 18 CCAGACCATGAGAGGCCCTG opuesto SEQ ID NO:18 hacia dentro Exón 19 CACAATTGCCAGTTAACGTCTTC hacia SEQ ID NO:19 delante Exón 19 AGGGTCTAGAGCAGAGCAGC opuesto SEQ ID NO:20 hacia fuera Exón 19 GCCTGAGGTTCAGAGCCAT opuesto SEQ ID NO:21 hacia dentro Exón 21 CATGATGATCTGTCCCTCACAG hacia SEQ ID NO:22 delante Exón 21 CTGGTCCCTGGTGTCAGGAA opuesto SEQ ID NO:23 hacia fuera Exón 21 GCTGGCTACCTAAAGCCACC opuesto SEQ ID NO:24 hacia dentro [0156] Los inventores también compararon asociaciones entre estado de la mutación en EGFR, estado FISH, y nivel de expresión proteica en cada tumor con el resultado del paciente. Las mutaciones en EGFR se asociaron estadísticamente de forma significativa al estado FISH+ (P = 0,01), pero no con una alta expresión de proteína (P = 0,10). Las mutaciones génicas se asociaron estadísticamente de forma significativa a una mejor respuesta (54 % frente al 5 %, diferencia media del 47,9 %, 95 %CI: 22,2 a 73,7, P <0,001) y una mayor tiempo hasta la progresión (9,9 frente a 2,6 meses, diferencia media de 7,3 meses, 95 %CI: 2,1 a 16,7 meses, P = 0,02) (Tabla 7). Los pacientes con mutaciones en EGFR tuvieron una mejor supervivencia, aunque no fue estadísticamente significativo (media de 20,8 frente a 8,4 meses, diferencia media de 12,4 meses, 95 %CI: 1,7 a 26,4 meses, P = 0,09). Sin embargo, seis de los 15 pacientes con mutaciones (40 %), cinco de los cuales llevaban mutaciones puntuales en el exón 21 (pacientes 1, 2, 3, 16 y 100; Tablas 9 y 10) y uno de los cuales tuvo una deleción del exón 19 (paciente 41, Tablas 9 y 10) tuvieron enfermedad progresiva. Entre los ocho pacientes con mutaciones en EGFR que respondieron al tratamiento, siete eran también FISH+, mientras que cuatro de seis pacientes con mutaciones que progresaron fueron FISH- (disomía, Tabla 10). Además, entre los 21 pacientes con enfermedad estable, sólo uno presentó mutaciones en EGFR.

TABLA 10- Receptor del factor de crecimiento epidérmico (EGFR) y niveles de proteína (P)-Akt fosforilada y resultado para pacientes con cáncer de pulmón de células no pequeñas que presentan mutación en EGFR o ampliación génica* Paciente Amplificación Mutación EGFR IHC P-Akt Respuesta Tiempo de Supervivencia gen EGFR gen EGFR progresión, total, meses meses 1 - L858R - + PD 2.11 2.11 2 - L858R + - PD 2.18 +5.3 3 - V852I + + PD 4.05 4.05 4 + ND - + PD 2.2 2.73 12 + Ninguna - + SD 5.99 8.32 + Exon 19 del + + PR +5.33 +5.33 16 - L858R + - PD 1.61 3.16 19 + Exon 19 del - + PR 9.18 +18.9 26 - L858R + + PR 13.6 +26.2 - Exon 19 del + + SD 9.87 11.5 31 + L858R + + PR +17.4 +17.4 37 + Ninguna + + PD 2.66 4.05 38 + L858R + + CR 19.7 20.8 41 - Exon 19 del - + PD 2.89 5.72 51 + ND + + SD 7.7 +8.75 53 + Exon 19 del + + PR +20.7 +20.7 57 - Exon 19 del + + PR 11.3 +12.2 75 + Exon 19 del + + PR 15.6 +30.2 91 + ND + + SD 5.16 8.098 100 - L858R - ND PD 1.55 2.86 101 + ND + + PR 9.05 10.3 102 + Ninguna + + PD 3.22 3.95 *Características de 102 pacientes con histología confirmada de cáncer de célula no pequeña con enfermedad mesurable, localmente avanzada o metastático progresando o recayendo después de quimioterapia, o contraindicaciones médicas para quimioterapia que fueron tratados posteriormente con 250 mg de gefitinib diariamente. ND: no determinado; PD = enfermedad progresiva, SD = enfermedad estable, PR = respuesta parcial; CR = respuesta completa. IHC = inmunohistoquímica. amplificación del gen en EGFR + = Presencia de amplification de gen. Amplificación de gen EGFR - = Ausencia de amplificacion. EGFR IHC+ = Positivo. EGFR IHC- = Negativo. P-Akt+ = Positivo. P-Akt - = Negativo. Tiempo de progresión supervivencia + _ censados Ensayos Multivariable para EGFR [0157] Para definir qué variables predecían la supervivencia, se incluyeron en un modelo multivariable los factores que fueron significativos en el análisis univariante (sexo, histología, estado funcional, FISH y estado proteico). No se incluyeron en los análisis univariante el estado de mutación y la condición de fumador, ya que no estaban relacionados con la supervivencia (P = 0,09 y P = 0,20, respectivamente). El deficiente estado funcional (PS 2) permaneció estadísticamente relacionado de forma significativa con un aumento en el riesgo de muerte (cociente de riesgo [HR] = 3,27, 95 % CI = 1,49 a 7,17, P = 0,003), mientras que las histologías de adenocarcinoma/bronquioloalveolar (HR = 0,58, 95 % CI = 0,35 a 0,96, P = 0,035) y estado FISH (HR = 0,44, 95 % CI = 0,23 a 0,82, P = 0,01) se asociaron estadísticamente de forma significativa a una mejor supervivencia. Ni el estado proteico (HR = 0,60, 95 % CI = 0,36 a 1,01, P = 0,056) ni el sexo (HR = 1,43, 95 % CI = 0,79 a 2,6, P = 0,20) se asociaron estadísticamente de forma significativa con la supervivencia.

Asociación entre EGFR y P-Akt [0158] La evaluación de la proteína P-Akt tuvo éxito en 98 pacientes. El estado positivo para P-Akt se asoció significativamente con una mejor tasa de respuesta (21 % frente al 0 %, diferencia media del 20,6%, 95 %CI: 11,0 a 30,2, P = 0,004), la tasa de control de la enfermedad (50 % frente al 22 %, diferencia media del 28,1 %, 95 %CI: 9,5 a 46,7,P = 0,008), un mayor tiempo hasta la progresión (4,2 frente a 2,1 meses, diferencia media de 2,1 meses, 95 %CI: 0,7 a 3,4 meses, P = 0,01), pero no con la supervivencia (11,4 frente a 9,4 meses, diferencia media de 2,0 meses, 95 % CI: 1,3 a 5,3 meses, P = ,20). El estado positivo para P-Akt también se asoció significativamente con una ganancia del gen EGFR (FISH+ Pearson r = 0,30, P = 0,01) y un alto nivel de expresión de proteína (EGFR IHC+ Pearson r = 0,27, P = 0,01), pero no con la mutación en EGFR (P = 0,08).

[0159] Combinando los datos de FISH y P-Akt (Tabla 11), los inventores observaron que los pacientes con doble positivo (EGFR FISH+/P-Akt+) tuvieron una tasa de respuesta significativamente mayor (41 % frente al 3 %, diferencia media del 38,5 %, 95 %CI: 20,1 a 56,8, P<0,001) y tasa de control de la enfermedad (72 % frente al 28 %, diferencia media del 44,9 %, 95 %CI: 26,6 a 65,3, P <0,001), mayor tiempo hasta la progresión (9,0 frente a 2,5 meses, diferencia media de 6,5 meses, 95 %CI: 3,3 a 9,8 meses, P <0,001) y supervivencia (18,7 frente a 9,4 meses, diferencia media 9,3 meses, 95 %CI: 4,7 a 13,9 meses, P = 0,04) en comparación con los pacientes EGFR FISH- y/o los pacientes P-Akt-. Se observaron hallazgos similares cuando se combinaron los datos de inmunohistoquímica y mutación para EGFR con los datos de P-Akt. En comparación con pacientes EGFR- y/o P-Akt- , los pacientes EGFR IHC+/P-Akt+ tuvieron una tasa de respuesta significativamente mejor (29 % frente al 4 %, diferencia media del 25,8 %, 95 %CI: 10,9 a 40,4, P <0,001), tasa de control de la enfermedad (66% frente al 23 %, diferencia media del 43,1 %, 95 %Cl: 23,9 a 60,6, P <0,001), mayor tiempo hasta la progresión (6,2 frente a 2,3, diferencia media de 3,9 meses, 95 %CI: 1,5 a 6,3 meses, P = 0,001), y mayor supervivencia (14,9 frente 8,3 meses, diferencia media de 6,6 meses, 95 %CI: 4,0 a 9,2 meses, P = 0,03). Los pacientes de mutación en EGFR+/P-Akt+ tuvieron una tasa de respuesta significativamente mejor estadísticamente (67 % frente al 6%, diferencia media del 61,2 %, 95 %Cl: 34,0 a 88,4, P<0,001), tasa de control de la enfermedad (75 % frente al 32 %, diferencia media del 43,5 %, 95 %CI: 16,8 a 70,2, P = 0,008), mayor tiempo hasta la progresión (11,2 frente a 2,6 meses, diferencia media de 8,6 meses, 95 %CI: 3,3 a 14,0 meses, P = 0,004), y mayor supervivencia (20,8 frente a 9,3 meses, diferencia media 11,5 meses, 95 %CI: 1,1 a 24,2 meses, P = 0,044) que los pacientes de mutación en EGFR- y/o P- Akt-.

TABLA 11 – Asociación entre hibridación fluorescente in situ (FISH) del receptor de factor de crecimiento epidémico (EGFR), inmunohistoquímica (IHC) y mutación con (P)-Akt fosforilada en pacientes con cáncer de pulmón de células no pequeñas* Marcadores Nº.

de Respuesta Tasa de Tiempo Media de 1-año de pacientes/ Objectiva, control de medio de supervivenci supervivencia % N/% enfermedad, progresión, a, meses acumulada ± SD, N/% meses % EGFR FISHIP- 98/100 14/14 40/40 4.5 11.5 47±6 Akt EGFR FISH+/P- 29/30 12/41 21/72 9.0 18.7 33±9 Akt+ EGFR FISH+/P- 4/4 1/25 1.1 13.8 75±22 Akt- EGFR FISH-/P- 38/39 2/5 12/32 2.6 8.4 38±8 Akt+ EGFR FISH-/P- 27/28 6/22 2.4 6.0 57±9 Akt Cualquiera 69/70 2/3 19/27 2.5 9.4 37±6 negativo P (cualquiera - <.001 § <.001 ‡ <.001† .041† .075† versus +/+) EGFR IHC/P- 98/100 14/14 40/40 3.2 11.3 45±6 Akt EGFR 41/42 12/29 27/66 6.2 14.9 29±14 IHC+/PAkt+ EGFR IHC+/P- 17/17 5/29 1.8 9.4 35±12 Akt- EGFR IHC- 26/27 2/8 7/27 2.3 6.4 38±10 /PAkt+ EGFR IHC-/P- 14/14 1/7 2.0 4.2 54±8 Akt- Cualquiera 57/58 2/3 13/23 2.3 8.3 35±7 Negativo P (Cualquiera - <.001‡ <.001‡ .001† .029† .032† versus +/+) Mutación EGFR 85/100 12/14 32/38 2.9 10.1 43±5 /P-Akt Mutación EGFR 12/14 8167 9/75 11.2 20.8 38±10 +/P-Akt+ Mutación EGFR 2/2 1.1 3.1 40±7 +/P-Akt- Mutación EGFR 44/52 4/9 17/39 2.7 8.4 50±35 -/P-Akt+ Mutación EGFR 27/32 6/22 2.4 9.4 65±14 -/P-Akt- Cualquiera 73/86 4/5 23/31 2.6 9.3 39±6 Negativo P (Cualquiera- <.001§ .008§ .004§ .044† .116† versus +/+) *Características de 102 pacientes con histología confirmada de cáncer de célula no pequeña con enfermedad mesurable, localmente avanzada o metastático progresando o recayendo después de quimioterapia, o contraindicaciones médicas para quimioterapia que fueron tratados posteriormente con 250 mg de gefitinib diariamente. †P valores (bilateral) calculados usando la prueba log-rank. ‡P valores (bilateral) calculados usando la prueba chi-cuadrado de Pearson. §P valores (bilateral) calculados usando la prueba exacta de Fisher.

[0160] Independientemente del método de evaluación de EGFR, los pacientes que eran positivos para EGFR y negativos para P-Akt no respondieron al tratamiento con gefitinib (Tabla 11). El grupo de pacientes EGFR IHC+/P- Akt- tuvo un resultado significativamente peor que el grupo positivo para ambas proteínas, en cuanto a tasa de respuesta (0 % frente al 29 %, diferencia media del 29,3 %, 95 %CI: 15,3 a 43,2, P = 0,012), tasa de control de la enfermedad (29 % frente al 66%, diferencia media del 36,5 %, 95 %CI: 10,4 a 62,5, P = 0,011), y no tuvieron una tendencia significativa hacia un menor tiempo hasta la progresión (1,8 frente a 6,2 meses, diferencia media de 4,4 meses, 95 %CI: 2,3 a 6,4 meses, P = 0,08) y supervivencia (9,4 frente a 14,9 meses, diferencia media de 5,5 meses, 95 %CI: 1,6 a 9,3 meses, P = ,21). No se hicieron comparación con EGFR FISH y la mutación en EGFR debido al pequeño número de pacientes (es decir, 4 y 2, respectivamente) en el grupo positivo para EGFR y negativo para P- Akt.

[0161] También se observaron resultados desfavorables en el grupo de pacientes negativos para EGFR pero positivos para P-Akt (Tabla 11). En comparación con el grupo de doble positivo, el grupo EGFR FISH-/P-Akt+ tuvo estadísticamente de forma significativa peor tasa de respuesta (5 % frente al 41 %, diferencia media del 36,1 %, 95 %Cl: 16,8 a 55,4, P <0,001), tasa de control de la enfermedad (32 % frente al 72 %, diferencia media del 40,8 %, 95 %CI: 18,9 a 62,8, P = 0,001), y tiempo hasta la progresión (2,6 frente a 9,0 meses, diferencia media de 6,4 meses, 95 %CI: 3,7 a 9,1 meses, P = 0,001) y una supervivencia estadísticamente no significativa más corta (8,4 frente a 18,7 meses, diferencia media de 10,3 meses, 95 %CI: 7,2 a 13,4 meses, P = 0,083). Se observaron hallazgos similares cuando se evaluó EGFR por inmunohistoquímica o para detectar mutaciones. En ambos casos, el grupo EGFR-/P-Akt+ tuvo estadísticamente de forma significativa peor tasa de respuesta (P = 0,034 y P <0,001, respectivamente, para proteína y mutación), tasa de control de la enfermedad (P = 0,002 y P = 0,025), tiempo hasta la progresión (P = 0,010 y P = 0,009) y tuvo una peor supervivencia estadísticamente no significativa (P = 0,080 y P = 0,070), en comparación con el grupo de doble positivo.

ANÁLISIS [0162] En este estudio, los inventores han mostrado que la expresión de la proteína de EGFR se asoció a una mejor tasa de respuesta, un prolongado tiempo hasta la progresión estadísticamente significativo y supervivencia. Los pacientes con puntuaciones IHC bajas (<200) tuvo un resultado tan malo como a los de bajos números de copias de genes o que carecen de mutaciones. Además, en pacientes con estado positivo para EGFR mediante cualquier medio, la presencia de fosforilación de Akt estaba relacionada significativamente con una mejor respuesta, tasa de control de la enfermedad, tiempo hasta la progresión y supervivencia. Los resultados indican que la alta expresión de la proteína de EGFR es un marcador de indicador molecular eficaz para la sensibilidad a gefitinib en pacientes con NSCLC avanzado.

[0163] La presencia de mutaciones génicas en EGFR también estaba relacionada con una mejor respuesta a gefitinib y tiempo hasta la progresión, pero la diferencia en la supervivencia no alcanzó importancia estadística. Un hallazgo interesante fue la asociación entre las mutaciones en EGFR y el aumento del número de copias de genes, un fenómeno que se describió recientemente en la línea celular de cáncer de pulmón humano H3255 (Tracy y col.,. Cancer Res, 2004; 64: 7241-44) y que probablemente es relevante para la sensibilidad a gefitinib. De hecho, entre los ocho pacientes con mutaciones en EGFR que respondieron a la terapia de gefitinib, siete también fueron FISH+, y entre los seis pacientes con mutaciones en EGFR que no respondieron a la terapia, cuatro presentaron un patrón disómico. Esta observación sugiere que el impacto de la ganancia genómica es crítico para predecir la sensibilidad a gefitinib de las mutaciones en EGFR.

[0164] Otro hallazgo importante de estos estudios fue la ausencia virtual de mutaciones en EGFR en pacientes con enfermedad estable. Entre los 21 pacientes con enfermedad estable que se evaluaron para determinar las mutaciones en EGFR, únicamente un paciente tenía una mutación de EGFR. Enfermedad estable se definió aquí como sin que haya una contracción suficiente para calificar una respuesta parcial, ni un aumento suficiente para calificar una enfermedad progresiva, que se confirmó por dos observaciones consecutivas no mayores de 4 semanas. El pequeño número de mutaciones en pacientes con enfermedad estable tiene relevancia clínica ya que los datos del ensayo BR.21 (Shepherd y col., 2004) muestran que el beneficio en la supervivencia de gefitinib no se limita a los pacientes que respondieron al tratamiento. Es posible que la mejora en la supervivencia en los pacientes tratados con gefitinib, como un conjunto, se deba a la presencia de un grupo de pacientes con un beneficio intermedio del tratamiento, tal como aquellos con enfermedad estable, que se excluirían del tratamiento con inhibidor de tirosina cinasa si el análisis de mutación se estableció como la prueba de elección para la selección de pacientes. Además, aunque estudios previos sugirieron que las mutaciones de EGFR están presentes en la gran mayoría de los pacientes que responden al tratamiento (Lynch y col., 2004; Paiez y col., 2004; Pao y col., 2004), en este estudio, los inventores observaron que 40 % de los pacientes con mutaciones de EGFR tuvieron enfermedad progresiva.

Estos resultados podrían explicarse por el hecho de que este es el primer estudio realizado en una cohorte grande y no seleccionada de pacientes tratados con gefitinib, en los cuales los resultados clínico son similar a los obtenidos en ensayos clínicos grandes con gefitinib (Fukuoka y col., 2003; Kris y col., 2003, JAMA).

[0165] En este estudio, la sensibilidad a gefitinib se asoció con una alta expresión de la proteína de EGFR; los resultados en pacientes con bajas puntuaciones de la expresión de EGFR (<200) fueron tan malos como en los pacientes con bajos números de copias de genes o que carecen de mutaciones, lo que es diferente a lo que se ha observado en estudios anteriores (Cappuzzo y col., 2003, J. Clin. Oncol.; Bailey y col., 2003; Parra y col., 2004). Las diferencias en los procedimientos de tinción y directrices para la interpretación de la evaluación del EGFR pueden ser la principal razón de conflicto en los resultados en los estudios. El tamaño y selección de muestreo del material tisular para la tinción inmunohistoquímica también puede contribuir a diferencias en los resultados para los estudios. Por ejemplo, se evaluaron tumores de únicamente 43 y 50 pacientes por Cappuzzo y col. (Cappuzzo y col., 2003, J. Clin. Oncol.) y Parra y col. (Parra y col., 2004), respectivamente. En el análisis inmunohistoquímico retrospectivo de tejido tumoral procedente de los ensayos IDEAL, se estudió menos del 40 % de la población total de pacientes (Bailey y col., 2003), mientras que en el presente estudio, más del 90 % de los pacientes tenía tejido disponible para la tinción inmunohistoquímica.

[0166] En este estudio, los inventores también descubrieron una relación entre la ruta de Akt activada (por ejemplo, la expresión de Akt fosforilada) y sensibilidad a gefitinib, una relación que también se había descrito y analizado por otros (Sordella y col., 2004; Cappuzzo y col., 2004, J Natl. Cancer Inst.). El análisis combinado del estado de EGFR y P-Akt indicó que, independiente del método de evaluación de EGFR, cuando el estado de EGFR fue positivo, la presencia de fosforilación de Akt estaba relacionada significativamente con una mejor respuesta, tasa de control de la enfermedad, tiempo hasta la progresión y supervivencia. De manera importante, se observó un mejor resultado no sólo cuando el subconjunto de pacientes EGFR+/P-Akt+ se comparó con todos los demás grupos combinados pero también cuando este subconjunto se comparó con pacientes positivos para EGFR pero negativos para P-Akt. Estos hallazgos sostienen la hipótesis de que, cuando la diana de gefitinib está presente pero la ruta anti-apoptótica no está activada, el paciente no es sensible a los efectos inhibidores de gefitinib, como se ha sugerido previamente (Cappuzzo y col., 2004, J. Natl. Cancer Inst.) y como se demuestra en modelos preclínicos (Ono y col., 2004; Bianco y col., 2003). Como se espera, el grupo EGFR+/P-Akt+ también tubo un resultado significativamente mejor en comparación con el grupo EGFR negativo y P-Akt positivo, confirmando los datos preclínicos que indican que la activación de Akt independiente de EGFR aberrante puede conducir a una resistencia a gefitinib (Bianco y col., 2003; Janmaat y col., 2003). Estos datos indican que el estado P-Akt positivo es relevante en pacientes EGFR positivo para la identificación de un subgrupo de pacientes particularmente sensibles al fármaco. En pacientes EGFR negativo, el estado P-Akt positivo puede identificar un grupo de pacientes con una posibilidad muy baja de beneficiarse del tratamiento con gefitinib.

[0167] La información concerniente a la relación entre la expresión de la proteína de EGFR y la activación de la ruta de Akt promoverá en gran medida la compresión del mecanismo de sensibilidad a gefitinib. Los inventores compararon la expresión de la proteína de EGFR y P-Akt en un subgrupo de pacientes y, en general, la expresión de las proteínas EGFR y P-Akt se encontró en las mismas poblaciones celulares (datos no mostrados), indicando que la P-Akt observada fue resultado de la actividad de EGFR. Sin embargo, en algunos casos, se encontraron discrepancias en la expresión (es decir, algunas células expresaron EGFR y no P-Akt y viceversa.), lo que puede deberse a causas biológicas o causas técnicas.

[0168] En conclusión, los resultados de este estudio demuestran que gefitinib es eficaz en pacientes con NSCLC avanzado con alta expresión de la proteína de EGFR y combinaciones de proteína/mutación EGFR, proteína EGFR/FISH. La IHC representa una prueba ideal para seleccionar pacientes candidatos con NSCLC para la terapia de gefitinib. Ya que los pacientes que tenían una alta expresión de EGFR y P-Akt tuvieron una mejor respuesta, tasa de control de la enfermedad, tiempo hasta la progresión y supervivencia, también se cree que el análisis del estado de activación de la proteína Akt es relevante para una selección de paciente apropiada.

Ejemplo 4 [0169] El siguiente ejemplo resume los resultados de los estudios que demuestran el uso de amplificación génica de HER2 y la polisomía HER2 para predecir el resultado para los inhibidores del EGFR en pacientes con NSCLC (cohorte Italiana).

[0170] En estos experimentos, se midió el número de copias del gen HER2 por célula por FISH, los niveles de proteína HER2 se midieron por inmunohistoquímica y las mutaciones en HER2 del exón 20 se evaluaron en una cohorte de 102 pacientes con NSCLC en fase avanzada tratados con gefitinib.

RESULTADOS Y CONCLUSIONES

[0171] El análisis por FISH de HER2 se completó en 102 pacientes. Los pacientes con elevado número de copias de HER2 (alta polisomía y amplificación génica: HER2 FISH+) representaron el 22,8 % de los casos y en comparación con pacientes con ninguna o poca ganancia (HER2 FISH-) tuvieron significativamente mejor respuesta objetiva (OR: 34,8 % frente al 6,4 %, p = 0,001), tasa de control de la enfermedad (DCR: 56,5 % frente al 33,3 %, p = 0,04), tiempo hasta la progresión (TTP: 9,05 frente a 2,7 meses, p = 0,02) y una tendencia hacia una mayor supervivencia (OS: 20,8 frente a 8,4 meses, p = 0,056).

[0172] La expresión de la proteína HER2 se investigó en 72 pacientes y 5 (7 %) pacientes fueron positivos para un alto nivel de expresión HER2. No se detectó ninguna asociación significativa con respuesta o supervivencia en esta cohorte pero la función clínica última de la expresión de la proteína HER2 en relación con los inhibidores de la tirosina cinasa tiene que investigarse en una publicación de estudio mayor.

[0173] El exón 20 del gen HER2 se secuenció en 89 pacientes y todos dieron negativo para mutaciones. Por lo tanto, las mutaciones en el dominio de tirosina cinasa del gen HER2 parecían ser infrecuentes y clínicamente no relevantes.

[0174] En conclusión, este estudio mostró que los pacientes con HER2 FISH+ NSCLC tienen beneficio clínico del tratamiento con TKI gefitinib, representado por mayor tasa de respuesta, tasa de control de la enfermedad y mayor tiempo hasta la progresión.

Ejemplo 5

[0175] El siguiente ejemplo resume los resultados de los estudios que demuestran el uso de amplificación génica de HER2 y polisomía junto con la amplificación génica de EGFR y polisomía para predecir resultados para inhibidores del EGFR en pacientes con NSCLC (cohorte Italiana).

[0176] En este estudio, el análisis del patrón HER2 FISH se combinó con los análisis del patrón EGFR FISH, usando la metodología que se ha descrito previamente en el presente documento.

[0177] Los resultados mostraron que los pacientes con tumores HER2 FISH+/EGFR FISH+ tenían de forma significativa mejor OR y DCR que los pacientes negativos para ambos receptores. Los pacientes con elevados número de copias de ambos genes (HER2 FISH+/EGFR FISH+) tenían la mayor OR (53,8 %) y DCR (76,9 %), y estos resultados fueron significativamente mejores que los observados en pacientes con tumores HER2 FISH- y/o EGFR FISH- (OR: 6,8 %, p<0,001; DCR: 33,0 %, p = 0,002). Los pacientes HER2 FISH+/EGFR FISH- tenían menor OR que los pacientes de doble positivo, aunque la diferencia no fue estadísticamente significativa (OR: 21,0 %, p= 0,07). No se observó diferencia en la respuesta entre pacientes HER2 FISH-/EGFR FISH+ y los pacientes de doble negativo HER2 FISH-/EGFR FISH (OR: 10,0 % frente al 1,6%, p = 0,27; DCR: 30,0 % frente al 25,4 %, p = 0,71), aunque el último grupo tuvo significativamente un peor resultado en comparación con HER2 FISH+ y/o EGFR FISH+ (OR: 1,6% frente al 28,6%, p<0,001; DCR: 25,4 frente a 57,1 %, p = 0,001).

[0178] Los pacientes con tumores HER2 FISH+/EGFR FISH+ tenían significativamente un mayor tiempo hasta la progresión y supervivencia total que los pacientes negativos para ambos receptores. en los pacientes con doble positivo HER2 FISH+/EGFR FISH+, el TTP medio y OS fueron 9,8 y 20,8 meses, respectivamente, significativamente inferiores a los observados en los grupos HER2 FISH- y/o EGFR FISH- (TTP: 2,6 meses, p = 0,007; OS: 8,3 meses, p = 0,04), y con una tendencia no significativa en comparación con los pacientes HER2 FISH- /EGFR FISH+ (TTP: 5,3 meses, p = 0,20; OS: 9,3 meses, p = 0,13). Los pacientes con tumores HER2 FISH+/EGFR FISH- tuvieron el mismo resultado deficiente que el grupo de doble negativo (TTP: 2,3 frente a 2,6 meses, p = 0,4, OS: 6,0 frente a 7,3 meses, p = 0,4).

Ejemplo 6 [0179] El siguiente ejemplo resume los resultados de estudios que demuestran el uso de amplificación génica de HER2 y polisomía de HER2 junto con la detección de los niveles de proteína de EGFR para predecir el resultado para los inhibidores del EGFR en pacientes con tumores NSCLC.

[0180] En estos estudios, el patrón HER2 FISH se combinó con la expresión de la proteína de EGFR determinada por inmunohistoquímica (IHC), usando la metodología que se ha descrito previamente en el presente documento.

[0181] Los pacientes con tumores HER2 FISH+/EGFR IHC+ tuvieron significativamente mejor OR y DCR que los pacientes negativos para ambos receptores. OR y DCR fueron significativamente mejores en pacientes de doble positivo HER2 FISH+/EGFR IHC+ en comparación con todos los demás grupos de pacientes (OR: 53,8 % frente al 7,1 %, p<0,001; DCR: 76,9 frente a 34,5, p = 0,004). Se observó una diferencia significativa en OR entre los pacientes de doble positivo y HER2 FISH-/EGFR IHC+ (OR: 11,1 %, p = 0,003). No se encontró ninguna diferencia entre los pacientes HER2 FISH+/EGFR IHC- y doble negativo HER2 FISH-/EGFR IHC-, en los que OR y DCR fueron significativamente peores que en los otros tres grupos combinados (OR: 0 % frente al 19,1 %, p = 0,009; DCR: 13,7 % frente al 51,5 %, p = 0,001).

[0182] Los pacientes con tumores HER2 FISH+/EGFR IHC+ también tuvieron significativamente un mayor tiempo hasta la progresión y supervivencia total que los pacientes negativos para ambos receptores. El TTP y la supervivencia fueron significativamente mayores en pacientes de doble positivo (HER FISH+/EGFR IHC+) en comparación con los otros tres grupos de pacientes combinados (HER2 FISH - y/o EGFR IHC-; TTP: 12,3 frente a 2,6 meses, p = 0,006; OS: 20,8 frente a 8,4 meses, p = 0,030) y con un mayor TTP estadísticamente significativo y tendencia hacia una mejor supervivencia en comparación con pacientes con tumores HER2 FISH-/EGFR IHC+ (TTP: 4,2 meses, p = 0,046; OS: 11,3, p = 0,12). Los pacientes con tumores HER2 FISH+/EGFR IHC- tuvieron resultados deficientes de forma similar a los del grupo de doble negativo (TTP: 2,3 frente a 2,1 meses, p = 0,06; OS: 3,3 frente a 5,0 meses, p = 0,39).

Ejemplo 7 [0183] El siguiente ejemplo resume los resultados de estudios que demuestran el uso de amplificación génica de HER2 y polisomía de HER2 junto con la detección de mutaciones en el gen EGFR para predecir el resultado para los inhibidores del EGFR en pacientes con tumores NSCLC.

[0184] En este ejemplo, el patrón HER2 FISH se combinó con la presencia de mutaciones en el gen EGFR determinadas por secuenciación del ADN, usando la metodología que se ha descrito previamente en el presente documento.

[0185] Los pacientes con tumores HER2 FISH+/mutación en EGFR+ tuvieron la mejor OR y DCR (87,5 % para ambos), que fue significativamente mayor que en los pacientes HER2 FISH- y/o mutación en EGFR- (OR: 5,0 %, p<0,001; DCR: 31,3 %, p = 0,003). Entre los 7 pacientes HER2 FISH-/mutación EGFR+, un solo paciente respondió (OR: 14,2 %) y un solo paciente tuvo estabilización de la enfermedad (DCR: 28,5 %). En el grupo HER2 FISH+/mutación EGFR-, ningún paciente respondió y DCR fue del 27,2 %. Estos resultados no fueron diferentes de los observados en pacientes de doble negativo HER2 FISH-/mutación EGFR- (OR: 4,8 %, p = 1,0; DCR: 32,2 %, p = 1,0), en los que OR fue significativamente pero que en los otros grupos combinados (OR: 30,8 %, p = 0,002).

[0186] Los pacientes con tumores HER2 FISH+/mutación EGFR+ tuvieron significativamente un mayor TTP y OS en comparación con otros pacientes combinados (TTP: 15,5 frente a 2,6 meses, p = 0,003; OS: no alcanzado frente a 8,3, p = 0,001), pero también en comparación con los pacientes HER2 FISH-/mutación EGFR+ (TTP: 2,8 meses, p = 0,004; OS: 5,7, p = 0,030). El grupo de pacientes mutación EGFR-/HER2 FISH+ tuvo el peor resultado en cuanto a TTP (2,3 meses) y OS (6,5 meses).

Ejemplo 8 [0187] En base a estos estudios que combinan la cohorte del estudio Italiano y el estudio 0126 del Southwest Oncology Group se da un apoyo adicional del papel pronóstico de la prueba individual, así como combinaciones de pruebas:

(1) Apoyo del aumento del número de copias del gen EGFR como marcador predictivo para el efecto clínico de los inhibidores del EGFR en pacientes con NSCLC

[0188] La University of Colorado Cancer Center ha realizado análisis de laboratorio de dos ensayos clínicos. Para hacer un análisis estadístico más sustancial y potente, los inventores han analizado el conjunto de datos combinados, que incluye el conjunto de 204 pacientes con NSCLC. Un estudio de Italia (102 pacientes), en el que los pacientes con cáncer de pulmón de células no pequeñas (NSCLC) habían sido tratados con gefitinib 250 mg a diario después del fallo de al menos un régimen de quimioterapia anterior. El otro estudio clínico se realiza por el Southwest Oncology Group (SWOG) en 136 pacientes con carcinoma bronquioloalveolar (BAC) o adenocarcinoma con rasgos BAC. Las Tablas 12 y 13 muestran la caracterización de los pacientes combinados y el estado de EGFR IHC, EGFR FISH, mutación en EGFR, Akt fosforilada y KRas.

TABLA 12 Grupo Italiano Grupo S0126 Total Hombre 68 (65%) 48 (48%) 116 (57%) Mujer 36 (35%) 52 (52%) 88 (43%) Fumador Antiguo/Actual 89 (86%) 73 (73%)* 162 (79%) No fumador 15 (14%) 27 (27%) 42 (21%) Estado de rendimiento 0-1 91 (87%) 86 (86%) 177 (87%) Estado de rendimiento 2 13 (13%) 14 (14%) 27 (13%) Adenocarcinoma 55 (53%) 44 (45%) 99 (49%) BAC 9 (9%) 54 (55%) 63 (31%) Célula grande 2 (2%) 2 (1%) Célula escamosa 26 (25%) 26 (13%) Indiferenciado 12 (12%) 12 (6%) Enfermedad fase III 14 (13%) 7 (7%) 21 (11%) Enfermedad fase IV 90 (87%) 89 (93%) 179 (89%) Resultado Total 13% 17% 15% Tasa de control de enfermedad 39% 48% 43% Tiempo medio de Progresión 3 (2-4) 4 (3-6)* 3 (3-4) Supervivencia media 9 (6-11) 14 (10-18)* 11 (8-14) 1 año de supervivencia 41% (31-51) 55% (45-64) 48% (41-55) *p<0.05 TABLA 13 EGFR EGFR EGFRF EGFRFI EGFR EGFR M- PAKT+ PAKT - KRAS+ KRAS- IHC+ IHC - ISH + SH - M+ Hombre 68/121 45/79 30/59 77/124 18/43 72/113 72/127 30/57 25/36 57/102 (56%) (57%) (51%) (62%) (42%) (64%) (57%) (53%) (69%) (57%) Mujer 53/121 34/79 29/59 47/124 25/43 41/113 27/57 11/36 44/102 (44%) (43%) (49%) (38%) (58%) (36%) 55/127 (47%) (31%) (43%) (43%) Valor p Chi Valor p Chi Valor p Chi Valor p Chi cuadrado= Valor p Chi cuadrado= 0.915 cuadrado= 0.149 cuadrado= 0.014 0.608 cuadrado= 0.185 Fumador Actual 99/121 59/79 42/59 104/124 30/43 96/114 26/127 12/57 33/36 80/102 /antiguo (82%) (75%) (71%) (84%) (70%) (84%) (20%) (21%) (92%) (78%) No fumador 22/121 20/79 17/59 20/124 13/43 18/114 45/57 3/36 22/102 (18%) (25%) (29%) (16%) (30%) (16%) 101/127 (79%) (8%) (22%) (80%) valor p chi- valor p chi- valor p chi- valor p chi-cuadrado = valor p chi- cuadrado = 0.226 cuadrado = 0.046 cuadrado = 0.045 0.928 cuadrado = 0.076 Adenocarcinoma 58/120 38/78 31/58 54/124 24/42 58/112 59/126 26/57 21/36 45/101 (48%) (49%) (53%) (44%) (57%) (52%) (47%) (46%) (58%) (45%) BAC 36/120 27/78 15/58 43/124 13/42 27/112 43/126 19/57 14/36 29/101 (30%) (35%) (26%) (35%) (31%) (24%) (34%) (33%) (39%) (29%) 1/120 1/78 1/58 1/124 0/42 1/112 1/126 1/57 0/36 1/101 Célula Grande (1%) (1%) (2%) (1%) (0%) (1%) (1%) (2%) (0%) (1%) 18/120 8/78 9/58 17/124 2/42 19/112 17/126 8/57 1/36 18/101 Célula Escamosa (15%) (10%) (16%) (14%) (5%) (17%) (13%) (14%) (3%) (18%) 7/120 4/78 2/58 9/124 3/42 7/112 6/126 3/57 0/36 8/101 Indiferenciado (6%) (5%) (3%) (7%) (7%) (6%) (5%) (5%) (0%) (8%) valor p chi- valor p chi- valor p chi- valor p chi-cuadrado = valor p chi- cuadrado = 0.867 cuadrado = 0.536 cuadrado = 0.347 0.984 cuadrado = 0.051 [0189] Como se muestra en la Tabla 14 (véase a continuación), en el estudio, 183 pacientes tenían análisis por FISH realizados, y 52 pacientes (32 %) eran "FISH-positivos" para EGFR (tuvieron alta polisomía o amplificación génica). La tasa de "respuesta total" fue del 33 % para el grupo positivo para FISH frente al 6% para el grupo FISH-negativo (disomía, trisomía y baja polisomía) (p<0,001). La tasa de "control de la enfermedad" (respuesta objetiva + enfermedad estable) fue del 65 % en el grupo FISH positivo frente al 30 % en el grupo FISH negativo (p<0,001). El tiempo hasta la progresión (TTP) fue una media de 9 meses (95 % CI 5-10) para el grupo FISH positivo frente a 3 meses (95 % CI 2-3) para el grupo FISH negativo (p<0,001). La supervivencia media fue de 18 meses (95 % CI 14- 21) en el grupo FISH positivo frente a 8 meses (95 % CI 6-11) en el grupo FISH negativo (p = 0,002) y la tasa de supervivencia a 1 año fue del 68 % (95 % CI 56-80 %) en el grupo FISH positivo frente al 37 % (95 % CI 29-46%) en el grupo FISH negativo .

[0190] En conclusión, este análisis de datos combinados demostró de forma estadísticamente significativa una mejor respuesta, control de la enfermedad, tiempo hasta la progresión y supervivencia para pacientes con un aumento número de copias del gen EGFR ("FISH positivo") en comparación con pacientes FISH negativo. Estos análisis, que ahora incluyen 183 pacientes sostienen los resultados individuales de la cohorte del estudio Italiano (Cappuzzo y col., 2005 JNCI) y el estudio del Southwest Oncology Group (Hirsch y col., JCO in press 2005).

(2) Apoyo de la expresión de la proteína de EGFR detectada por inmunohistoquímica como un marcador predictivo para el efecto clínico de los inhibidores del EGFR en pacientes con NSCLC.

[0191] Como se muestra en la Tabla 14, la expresión de la proteína de EGFR se midió en 203 pacientes por inmunohistoquímica. La proteína EGFR se consideró positiva en 121 pacientes (61 %). La respuesta total en los pacientes positivos para EGFR fue del 22 % frente al 5 % en el grupo negativo para EGFR (p = 0,002) y la tasa de control de la enfermedad fue del 56% frente al 27 % (p<0,001). El tiempo hasta la progresión fue de 5 meses (95 % CI 3-7) frente a 3 meses para los pacientes negativos para EGFR (p = 0,006), y la supervivencia media fue de 14 meses (95 % CI 11-21) frente a 7 meses (5-10) (p = 0,003). Las tasas de supervivencia a un año fueron del 56% (95 % CI 47-65 %) para el grupo positivo para EGFR frente al 37 % (26-48 %) para el grupo negativo para EGFR.

[0192] En conclusión, la expresión de la proteína de EGFR determinada por inmunohistoquímica pronosticó significativamente una mejor respuesta, tasa de control de la enfermedad, supervivencia media y supervivencia a 1 año después del tratamiento con el inhibidor de EGFR en comparación con el grupo de pacientes negativo para EGFR.

TABLA 14 Nº.

OR DC TTP MS 1-año OS pacientes FISH + 59 (32%) 33% 65% 9 (5-10) 18 (14-21) 68% (56%-80%) FISH - 124 (68%) 6% 30% 3 (2-3) 8 (6-11) 37% (29%-46%) valor p< 0.001 valor p< 0.001 valor p< 0.001 valor p= 0.002 IHC + 121 (61%) 22% 56% 5 (3-7) 14 (11-21) 56% (47%-65%) IHC - 79 (40%) 5% 27% 3 (2-3) 7 (5-10) 37% (26%-48%) valor p= 0.002 valor p< 0.001 valor p= 0.006 valor p= 0.003 Mutación EGFR + 43 (28%) 39% 52% 3 (2-11) 13 (6-21) 52% (37%-68%) Mutación EGFR - 113 (72%) 7% 37% 3 (2-4) 11 (7-13) 46% (37%-55%) valor p< 0.001 valor p= 0.151 valor p= 0.180 valor p= 0.210 P-AKT + 127 (69%) 20% 49% 4 (3-5) 13 (10-16) 52% (43%-61%) P-AKT - 57 (31%) 2% 33% 3 (2-5) 8 (6-14) 41% (28%-54%) valor p= 0.005 valor p= 0.10 valor p= 0.09 valor p= 0.34 Mutación KRAS + 36 (26%) 7% 39% 3 (2-4) 11 (6-23) 49% (33%-66%) Mutación KRAS - 102 (74%) 19% 40% 3 (2-4) 12 (8-15) 50% (40%-60%) valor p= 0.237 valor p= 0.99 valor p= 0.890 valor p= 0.890

(3) La combinación de la evaluación de la proteína EGFR por inmunohistoquímica y el número de copias del gen EGFR por FISH predicen fuertemente un buen resultado después de terapia con el inhibidor de EGFR, y pueden

usarse pacientes con resultado "negativo" para tanto la proteína EGFR como el número de copias del gen EGFR por FISH para seleccionar pacientes de cáncer de pulmón que no tendrán ningún beneficio clínico de los inhibidores del EGFR en pacientes con NSCLC

[0193] A partir del análisis de datos combinado se dan dos resultados claros: [0194] Como se muestra en la Tabla 15, entre 42 pacientes que eran tanto "EGFR FISH-positivo" como "EGFR IHC- positivo", la tasa de respuesta fue alta, 41 %, y el 76% tenía control de la enfermedad. El tiempo hasta la progresión para el grupo de pacientes con "doble positivo" fue de 9 meses (95 % CI 6-16 meses), la supervivencia media fue de 21 meses (95 % CI 15-21) y la supervivencia a 1 año fue del 77 % (95 % CI 63-90). Por el contrario, los valores correspondientes para el grupo de pacientes con "doble negativo" (pacientes con "EGFR FISH negativo" y "EGFR IHC-negativo") fueron una tasa de respuesta del 2 %, una tasa de control de la enfermedad del 17 %, el tiempo hasta la progresión fue de 2 meses, la supervivencia media fue de 6 meses y la supervivencia a 1 año fue del 30 %. Hubo una diferencia estadísticamente significativa (p<0,001) en todos los parámetros.

TABLA 15 – Resultados de combinación FISH e IHC (n=179 pacientes) Nº.

RSP DCR TTP (mo) MS (mo) 1-año pacientes FISH+/IHC+ 42 41% 76% 9 (6-16) 21 (15-21) 77% (63-90) valor p- valor p- valor p- valor p- *<0.001 *<0.001 *<0.001 *<0.001 FISH+o IHC+ 83 10% 43% 3 (2-5) 11 (7-15) 44% (33-55) FISH-/IHC- 54 2% 17% 2 (2-3) 6 (4-8) 30% (18-43) *valor p de FISH+ / IHC + versus otros dos grupos [0195] En conclusión, los pacientes con cáncer de pulmón, cuyos tumores expresan fuertemente tanto la proteína EGFR (detectada por inmunohistoquímica) como un aumento del número de copias del gen EGFR (detectado por FISH) tienen una alta tasa de respuesta, una tasa de control de la enfermedad y una supervivencia significativamente prolongada después de la terapia con el inhibidor de EGFR en comparación con pacientes con valoraciones de "doble negativo".

[0196] Los pacientes con NSCLC, que eran "doble negativo" (ninguna/baja sobreexpresión de la proteína EGFR y ninguna/baja ganancia del gen EGFR) tendrán menores probabilidades de beneficiarse de la terapia con el inhibidor de EGFR y no han de ofrecerse a esta terapia.

[0197] Por lo tanto, la combinación del ensayo EGFR FISH- y IHC debe usarse para seleccionar pacientes con NSCLC que obtendrán un beneficio y aquellos sin ningún beneficio clínico esperado de la terapia EGFR.

(4) Combinación de mutación en EGFR y expresión de la proteína de EGFR

[0198] Como se muestra en la Tabla 16, entre los 28 pacientes con prueba positiva tanto para mutación en EGFR como expresión de la proteína de EGFR, la tasa de respuesta para los pacientes con prueba de doble positivo fue del 50 %, la tasa de control de la enfermedad fue del 60 %, el tiempo hasta la progresión fue de 10 meses, la supervivencia media fue de 21 meses y la supervivencia a 1 año fue del 63 %. Los valores correspondientes para pacientes con prueba de doble negativo fue del 12 %, 25 %, 2 meses, 7 meses y 37 %.

TABLA 16 – Resultados de combinación de mutación en EGFR y IHC (n=152 pacientes) Nº.

RSP DCR TTP (mo) MS (mo) 1-año pacientes EGFR+/IHC+ 28 50% 60% 10 (2-16) valor 21 (10-21) 63% (45-81) valor p- valor p- p-*=0.04 valor p- *<0.001 *=0.086 *=0.006 EGFR+o IHC+ 77 12% 47% 3 (2-5) 12 (8-15) 50% (39-61) EGFR-/IHC- 47 2% 25% 2 (2-3) 7 (5-12) 37% (23-51) *valor p de EGFR+ / IHC + versus otros dos grupos [0199] En conclusión, la combinación de mutación en EGFR y expresión de la proteína de EGFR puede usarse para seleccionar pacientes de cáncer de pulmón, que obtendrán un beneficio de aquellos que probablemente no se beneficiarán de la terapia con el inhibidor de EGFR.

(5) Combinación de la expresión de la proteína de EGFR y expresión de la proteína AKT (fosforilada) como indicador

del resultado para los inhibidores del EGFR en pacientes con NSCLC

[0200] Como se muestra en la Tabla 17, ciento ochenta y dos pacientes tuvieron una prueba positiva para la expresión de la proteína de EGFR (detectada por IHC) y la expresión de AKT fosforilada (detectada por IHC). Se descubrió una prueba con doble positivo en 78 pacientes, y tenían una tasa de respuesta del 30 %, una tasa de control de la enfermedad del 64 %, un tiempo hasta la progresión de 6 meses, una supervivencia media de 16 meses y una supervivencia a 1 año del 63 %.

TABLA 17 – Resultados de combinación P-AKT e IHC (n=182 pacientes) Nº.

RSP DCR TTP (mo) MS (mo) 1-año pacientes P-AKT+/IHC+ 78 30% 64% 6 (4-10) valor 16 (12-21) 63% (51-74) valor p- valor p- p-*<0.001 valor p- *<0.001 *=0.003 *=0.004 P-AKT+o IHC+ 84 6% 34% 3 (2-3) 8 (6-14) 43% (32-54) P-AKT-/IHC- 23 0% 21% 2 (2-4) 6 (5-9) 30% (12-49) *valor p de P-AKT+ / IHC + versus otros dos grupos [0201] Por el contrario, entre los 23 pacientes con prueba de doble negativo, ninguno tuvo respuesta objetiva, el 21 % tuvo control de la enfermedad, el tiempo hasta la progresión fue de 2 meses, la supervivencia media fue de 6 meses y la supervivencia a 1 año fue del 30 %. En todos los parámetros del resultado clínico mencionados hubo una diferencia estadística (p<0,05) entre el grupo de doble positivo y el grupo de doble negativo.

[0202] En conclusión, la combinación de la expresión de la proteína de EGFR detectada por IHC y AKT fosforilada detectada por IHC puede usarse para seleccionar pacientes de cáncer de pulmón, que obtendrán muy probablemente un beneficio clínico de la terapia con el inhibidor de EGFR, y aquellos, pacientes que probablemente no tendrán ningún beneficio clínico de tal tratamiento.

(6) Combinación del aumento del número de copias de genes detectado por FISH y mutaciones en EGFR como indicador para el resultado a los inhibidores del EGFR en pacientes con NSCLC.

[0203] Como se muestra en la Tabla 18, se estudiaron conjuntamente los 143 pacientes tanto para determinar el número de copias del gen EGFR como las mutaciones en EGFR.

TABLA 18 –Resultados de combinación de mutación FISH y en EGFR (n=143 pacientes) No. pts RSP DCR TTP (mo) MS (mo) 1-año FISH+/EGFR+ 17 69% 69% 16 (3-20) valor NR 67% (71-100) valor p- valor p- p-*=0.004 valor p- *<0.001 *=0.031 *=0.003 FISH+o EGFR+ 46 15% 45% 3 (2-5) 10 (5-14) 45% (30-59) FISH-/EGFR- 80 3% 29% 3 (2-3) 10 (6-13) 42% (31-53) *valor p de FISH+/EGFR + versus otros dos grupos [0204] Entre los 17 pacientes, que tenían pruebas con doble positivo, la tasa de respuesta fue del 69 %, la tasa de control de la enfermedad fue del 69 %, el tiempo hasta la progresión fue de 16 meses, la supervivencia media no se había logrado aún, pero excedió 20 meses, y la supervivencia a 1 año fue del 67 %. Todos estos parámetros eran estadísticamente mejores de forma significativa que los resultados de los pacientes con las pruebas de doble negativo. Tuvieron una tasa de respuesta del 3 %, una tasa de control de la enfermedad del 29 %, un tiempo hasta la progresión de 3 meses, una supervivencia media de 10 meses y una supervivencia a 1 año del 42 %.

[0205] En conclusión, la combinación del aumento del número de copias del gen EGFR detectado por FISH y las mutaciones en EGFR puede usarse para seleccionar los pacientes, que tendrán un beneficio clínico de la terapia con el inhibidor de EGFR. (7) Combinación del aumento del número de copias del gen EGFR, la expresión de la

proteína de EGFR y la mutación en EGFR predice un resultado clínico superior a la terapia con el inhibidor de EGFR en pacientes con NSCLC.

[0206] Como se muestra en la Tabla 19, el análisis de datos combinado de la cohorte Italiana y la cohorte del estudio del Southwest Oncology Group demostró que entre los 12 pacientes, que tenían pruebas de triple positivo había una tasa muy alta de respuesta del 78 %, una tasa de control de la enfermedad del 78 %, un tiempo hasta la progresión de 20 meses, una supervivencia media, que no se alcanzó pero excedía de 20 meses, y una supervivencia a 1 año del 100 %.

TABLA 19 FISH IHC Mut EGFR n OR DCR TTP OS 1-año de supervivencia + + + 12 78% 78% 20 (11-20) NR 100% + + - 22% 61% 5 (3-12) 15 (6-16) 64% (42-86) + - + 50% 50% 3 (2-9) NR 60% (17-100) - + + 12 22% 44% 4 (2-7) 11 (3-11) 42% (1470) + - - 8 0% 39% 2 (1-6) 9 (1-9) 38% (7-66) - + - 39 3% 41% 3 (2-5) 11 (8-18) 49% (33-64) - - + 6 0% 0% 2 (1-2) 3 (1-3) 0% (0-30) - - - 37 3% 21% 2 (2-3) 6 (4-12) 37% (21-52) [0207] En conclusión, la combinación del aumento del número de copias del gen EGFR detectado por FISH, la expresión de la proteína de EGFR detectada por IHC y las mutaciones en EGFR pueden usarse para seleccionar pacientes, que tendrán un buen resultado clínico después de la terapia con el inhibidor de EGFR.

(8) La combinación del número de copias del gen EGFR, la expresión de la proteína de EGFR y la expresión de AKT

fosforilada predice un resultado clínico superior después de la terapia con el inhibidor de EGFR de pacientes con NSCLC.

[0208] Como se muestra en la Tabla 20, en el análisis de datos combinado de la cohorte Italiana y la cohorte del estudio del Southwest Oncology Group se demostró que los pacientes con pruebas de triple positivo tenían una alta tasa de respuesta del 43 %, una tasa de control de la enfermedad del 80 %, un tiempo hasta la progresión de 12 meses, una supervivencia media aún no alcanzada, pero que excedía de 20 meses y la supervivencia a 1 año del 84 %.

TABLA 20 FISH IHC Mut EGFR n OR DCR TTP OS 1-año de supervivencia + + + 34 43% 80% 12 (9-19) NR 84% (70-97) + + - 4 0% 67% 9 (2-9) 18 (5-18) 75% (33-100) + - + 15% 46% 3 (2-6) 14 (3-19) 53% (28-79) - + + 13% 47% 4 (2-6) 11 (6-15) 43% (26-59) + - - 2 0% 0% 2 (NA) 9 (NA) 0% (0-69) - + - 23 6% 50% 4 (2-7) 9 (7-9) 47% (27-68) - - + 32 4% 18% 2 (2-3) 6 (4-10) 29% (13-44) - - - 17 0% 14% 2 (2-5) 6 (4-12) 29% (8-51)

(9) El análisis multivariable demuestra que tanto el aumento del número de copias del gen EGFR como el aumento

de la expresión de la proteína de EGFR son factores pronóstico/predictivos independientes para el resultado de la supervivencia en pacientes con NSCLC tratado con inhibidores del EGFR:

[0209] El análisis multivariable incluía datos de la cohorte del estudio Italiano y el estudio clínico 0126 del Southwest Oncology Group demostró que tanto el aumento del número de copias del gen EGFR detectado por FISH como el aumento de la expresión de la proteína de EGFR detectada por IHC eran factores pronóstico/predictivos independientes para la supervivencia (Tabla 21). El análisis multivariable se basa en un análisis univariable inicial que incluye marcadores clínicos y biológicos que usa métodos de regresión gradual retrógrada. Todas las covariedades significativas desde el punto de vista univariable se incluyeron en la sección gradual.

TABLA 21 –Análisis multivariabledefactores pronóstivo/predictivos en 179 pacientes NSCLCtratados con gefitinib.

VARIABLE

Nº. pacientes

HR

p-valor

Fumador habitual/antiguo 142 2.68 0.0005 Estado de rendimiento 2 24 3.64 0.0001 FISH - 120 1.87 0.006 IHC - 71 1.70 0.007 [0210] En conclusión, cada uno de los marcadores: Puede usarse el análisis del número de copias del gen EGFR detectado por FISH, la expresión de la proteína de EGFR detectada por IHC y expresión de AKT activada (fosforilada), el número de copias del gen HER2 y la mutación en el EGFR para la selección de pacientes de cáncer de pulmón, que tendrán una buena respuesta médica después de la terapia con el inhibidor de EGFR. El análisis de datos combinado realizado en base a los dos estudios mostró que las combinaciones de ensayos proporcionan una predicción muy alta de qué pacientes se beneficiarán de los inhibidores del EGFR y los que no. La combinación del análisis del número de copias del gen EGFR por FISH y la expresión de la proteína de EGFR por IHC demostró una predicción muy fuerte para el aumento de la respuesta, aumento del tiempo hasta la progresión y una prolongación significativa de la supervivencia (media de 21 meses) en comparación con los resultados de pacientes no seleccionados. Los datos también mostraron que los pacientes con un bajo o ningún número de copias del gen EGFR (FISH negativo) y ninguna o baja expresión de la proteína de EGFR no se beneficiaron de la terapia con el inhibidor de EGFR ya que no hubo respondedores y únicamente un paciente se clasificó con enfermedad estable. Sin embargo, el tiempo hasta la progresión fue muy corto y la supervivencia media en este grupo fue de 6 meses. El grupo de pacientes con pruebas de "doble negativo" tenía un resultado similar a los pacientes tratados con placebo en el estudio Canadiense, BR-21, en el que un grupo similar de pacientes con NSCLC avanzado, que no habían tenido éxito en al menos un régimen de quimioterapia anterior, se asignaron al azar a placebo o erlotinib (Tsao y col., JCO 23: 165:622S #7007). Por lo tanto, en los estudios de los inventores, se demuestra que una combinación de dos pruebas aplicables clínicas establecidas (FISH y IHC) tendrá un valor significativo para la selección de pacientes de cáncer para inhibidores del EGFR.

Ejemplo 9 [0211] El siguiente ejemplo demuestra que el número de copias de los genes EGFR y HER2 detectados por FISH se asocian a la sensibilidad con respecto a Cetuximab (C225, Erbitux™, BMS/Imclone) en líneas celulares de NSCLC.

[0212] Los estudios realizados en 25 líneas celulares de NSCLC mostraron que 5 líneas eran sensibles a Cetuximab (CI50 <1 uM) y 20 líneas eran resistentes (CI50 >1 uM). Las cinco líneas celulares sensibles, a saber H827, H3255, H358, H2279 y Calu 3, mostraron amplificación génica de EGFR y/o HER2 por FISH. Por el contrario, entre las 20 líneas de NSCLC que eran resistentes a Cetuximab, ninguna tenía amplificación génica de EGFR o HER2 y sólo 6 tenían alta polisomía para EGFR y/o HER2. La distribución de las líneas de NSCLC con el alto nivel de ganancia genómica y ningún/bajo nivel de ganancia genómica era considerablemente diferente entre las líneas sensibles a Cetuximab y resistentes Cetuximab (chi cuadrado 10,84, p <0,001). Estos resultados apoyan la conclusión de que el estado del número de copias de los genes EGFR y HER2 es un indicador de sensibilidad frente a la terapia con anticuerpos.

[0213] Todas las referencias citadas se incorporan en el presente documento íntegramente por referencia. U.S. Provisional Patent Application (Solicitud de Patente Provisional EEUU), num. de serie 60/575,789, presentada el 27 de mayo del 2004, se incorpora de forma específica e íntegra en el presente documento por referencia.

REFERENCIAS [0214] Arteaga, Sem Oncol 2002;29:3-9.

Andrecheck et al. Proc Natl Acad Sc USA 2000; 97:3444-49.

Annitage and Berry, Statistical Methods in Medical Research. Blackwell Scientific Publication Limited, Oxford, 1994.

Bailey et al., Lung Cancer 2003;41 :s71 (abstr).

Barsky et al., Cancer 73: 1163-1170, 1994 Bartlett et al., J Pathol 2003; 199:411-7.

Baselga et al., J Clin Oncol. 2002;20:4292-302.

Bianco et al., Oncogene 2003;22:2812-22 Breathnach et al., Cancer 86: 1165-1173, 1999 Cappuzzo et al., J Clin Oncol 2003;21:2658-63.

Cappuzzo et al., Proc Am Soc Clin Oncol 2004;23:3004.

Cappuzzo et al., Natl Cancer Inst 2004;96:1133-41.

Cappuzzo et al., JNatl Cancer Inst, in press.

Ciardello and Tortora, Clin Cancer Res 2001;7:2958-70.

Ciardiello et al., Clin Cancer Res 2000;6:2053-63.

Cox, J R Stat Soc B 1972;34:187-220.

Datta SR, Genes and Development 1999; 13:2905-27.

Demetri et al., N Engl J Med 2002; 347:472-80.

Druker et al., N Engl J Med 2001; 344:1031-7.

Frederick et al., Cancer Res 2000; 60, 1383-87.

Fukuoka et al., J Clin Oncol. 2003;21:2237-46.

Furak et al., European J Cardio-Thoracic Surgery 23:818-823, 2003.

Gandara et al., Clin Cancer Res 10: 4205-4209, 2004.

Giaccone et al., J Clin Oncol 2004;22:777-84 Herbst et al., J Clin Oncol. 2002;20:3815-25.

Herbst et al., Proc Am Soc Clin Oncol 23;617, 2004.

Hidalgo et al., J Clin Oncol. 2001;19:3267-79.

Hirsch et al., Lung Cancer 2003;41 Suppl 1:S29-42.

Hirsch et al., Br J Cancer 86: 1449-1456, 2002 Hirsch et al., J Clin Oncol 2003;21:3798-807.

Hirsch et al., Lung Cancer 2003;41 Suppl 1:S29-42.

Janmaat et al., Clin Cancer Res 2003;9:2316-26.

Kaplan and Meier, J Am Stat Assoc 1985;53:457-81.

Kelly et al., J Clin Oncol. 2001;19:3210-8.

Kris et al., JAMA 2003;290:2149-58.

Kris et al., Lung Cancer 2000; Suppl 1;29:233 abstract.

Levitt and Koty, Investig New Drugs 1999;7:213-26.

Levitzki and Gazit, Science 1995;267:1782-8.

Lynch et al., N Engl J Med 2004; 350:2129-39 Mantel N, Cancer Chemother Rep 50:163-170, 1966.

Miller et al., J Clin Oncol. 2004;22:1103-9.

Miller et al., Proc Am Soc Clin Oncol 2003;22 (abstract 2491).

Non-small cell Lung Cancer Collaborative Group. BMJ 1995;311:899-909.

Oken et al., Am J Clin Oncol 1982; 5:649-655.

Ono et al., Mol Cancer Ther 2004;3:465-72 Paez et al., Science 2004; 304:1497-1500.

Pao et al., PNAS 2004;101: 13306-11.

Parkin, Lancet Oncology 2001, 2:533-43.

Parra et al., Brit J Cancer, 91: 208-212, 2004.

Patel et al., Lung Cancer 41:S56, 2003 (suppl 2).

Perez-Soler et al., J Clin Oncol 2004;22:3238-47.

Perez-Soler et al., Proc. Am. Soc. Clin. Oncol., 20: 310a 2001.

Ranson et al., J Clin Oncol. 2002;20:2240-50.

Reissmann et al., J Cancer Res Clin Oncol 1999;125:61-70.

Rosell et al., Clin Cancer Res 2004;10:1318-25.

Salomon et al., Crit Rev Oncol Hematol 1995;19:183-232.

Salomon et al., Signal 2001;2:4-11.

Schiller et al., N Engl J Med 2002;346:92-8.

Shepherd et al., Proc Am Soc Clin Oncol 2004;23 (abstract).

Slamon et al., N Engl JMed 2001; 344:783-92.

Slamon et al., Science 235:177-182, 1987.

Sordella et al., Science 2004;305:1163-7 Therasse, J Nat Cancer Inset 2000;92:205-16.

Tracy et al., Cancer Res 2004; 64:7241-44.

Travis et al., Histological typing of lung and pleural tumors. Third edition, Berlin: Springer, 1999.

Vogel et al., J Clin Oncol 2002;20:719-26.

West et al., Advanced bronchioloalveolar carcinoma: a phase II trial of paclitaxel by 96-h infusion (SWOG 9714): a Southwest Oncology Group study. Ann Oncol, in press [0215] Pese a que varios modos de realización de la presente invención han sido descritos detalladamente, es evidente que a los expertos en la técnica se les ocurrirán las modificaciones y adaptaciones de dichos modos de realización . Sin embargo, se debe comprender expresamente que dichas modificaciones y adaptaciones se encuentran dentro del marco de la invención presente, tal y como se establece en las reivindicaciones siguientes.

LISTADO DE SECUENCIAS [0216] <110> Garcia, Mariela Bunn Jr., Paul Cappuzzo, Federico Franklin, Wilbur Hirsch, Fred <120> Methods for Prediction of Clinical Outcome to Epidermal Growth Factor Receptor Inhibitors by Cancer Patients <130> 2848-70-PCT <150> 60/575,789 <151> 2004-05-27 <150> 60/677,852 <151> 2005-05-03 <160> 24 <170> PatentIn version 3.3 <210> 1 <211> 19 <212> DNA <213> Homo sapiens <400> 1 tccgtctctt gccgggaat 19 <210> 2 <211> 20 <212> DNA <213> Homo sapiens <400> 2 ggctcaccct ccagaacctt 20 <210> 3 <211> 21 <212> DNA <213> Homo sapiens <400> 3 acgcattccc tgcctcggct g 21 <210> 4 <211> 18 <212> DNA <213> Homo sapiens <400> 4 <210> 5 <211> 54 <212> DNA <213> Homo sapiens <400> 5 aaaattcccg tcgctatcaa ggaattaaga gaagcaacat ctccgaaagc caac 54 <210> 6 <211> 36 <212> DNA <213> Homo sapiens <400> 6 aaaattcccg tcgctatcaa gtctccgaaa gccaac 36 <210> 7 <211> 39 <212> DNA <213> Homo sapiens <400> 7 aaaattcccg tcgctatcaa aacatctccg aaagccaac 39 <210> 8 <211> 39 <212> DNA <213> Homo sapiens <400> 8 aaaattcccg tcgctatcaa ggaatctccg aaagccaac 39 <210> 9 <211> 39 <212> DNA <213> Homo sapiens <400> 9 aaaattcccg tcgctatcaa gacatctccg aaagccaac 39 <210> 10 <211> 14 <212> DNA <213> Homo sapiens <400> 10 <210> 11 <211> 42 <212> DNA <213> Homo sapiens <400> 11 catgtcaaga tcacagattt tgggctggcc aaactgctgg gt 42 <210> 12 <211> 14 <212> PRT <213> Homo sapiens <400> 12 <210> 13 <211> 42 <212> DNA <213> Homo sapiens <400> 13 catgtcaaga tcacagattt tgggcgggcc aaactgctgg gt 42 <210> 14 <211> 14 <212> PRT <213> Homo sapiens <400> 14 <210> 15 <211> 42 <212> DNA <213> Homo sapiens <400> 15 catatcaaga tcacagattt tgggctggcc aaactgctgg gt 42 <210> 16 <211> 23 <212> DNA <213> Homo sapiens <400> 16 gacccttgtc tctgtgttct tgt 23 <210> 17 <211> 23 <212> DNA <213> Homo sapiens <400> 17 tatacagctt gcaaggactc tgg 23 <210> 18 <211> 20 <212> DNA <213> Homo sapiens <400> 18 ccagaccatg agaggccctg 20 <210> 19 <211> 23 <212> DNA <213> Homo sapiens <400> 19 cacaattgcc agttaacgtc ttc 23 <210> 20 <211> 20 <212> DNA <213> Homo sapiens <400> 20 agggtctaga gcagagcagc 20 <210> 21 <211> 19 <212> DNA <213> Homo sapiens <400> 21 gcctgaggtt cagagccat 19 <210> 22 <211> 22 <212> DNA <213> Homo sapiens <400> 22 catgatgatc tgtccctcac ag 22 <210> 23 <211> 20 <212> DNA <213> Homo sapiens <400> 23 ctggtccctg gtgtcaggaa 20 <210> 24 <211> 21 <212> DNA <213> Homo sapiens <400> 24 gctggctgac ctaaagccac c 21

REIVINDICACIONES

1. Procedimiento para seleccionar un paciente que padece cáncer que es razonable o no beneficiarse de una administración terapéutica de un inhibidor de EGFR, comprendiendo el hecho: A) De detectar en una muestra de células tumorales que provienen de un paciente, un cambio del número de copias de gen escogido en el grupo constituido: I) De una amplificación del gen del receptor de factor de crecimiento de la epidermis (EGFR); Ii) de una polisomía del gen EGFR; Iii) de una amplificación del gen de receptor de tipo receptor de tirosina kinase humana (HER2); y Iv) de una polisomía del gen HER2; B) De comparar el número de copias del gen EGFR y/o HER2 en la muestra de células tumorales del paciente con un número de copias del gen EGFR y/o HER2 que proviene de células tumorales que son sensibles o resistentes a un inhibidor de EGFR, y C) De seleccionar al paciente como siendo razonable beneficiarse de una administración terapéutica del inhibidor de EGFR, si el número de copias del gen EGFR y/o HER2 en las células tumorales del paciente es estadísticamente similar o superior al número de copias del gen EGFR y/o HER2 en células tumorales que son sensible a un inhibidor de EGFR, o si un número de copias del gen EGFR y/o HER2 en las células tumorales del paciente es estadísticamente superior al número de copias del gen EGFR y/o HER2 en células tumorales que son resistentes a un inhibidor de EGFR; o D) De seleccionar al paciente como siendo razonable beneficiarse de una administración terapéutica del inhibidor de EGFR, si el número de copias del gen EGFR y/o HER2 en las células tumorales del paciente es estadísticamente inferior al número de copias del gen EGFR y/o HER2 en células tumorales que son sensibles a un inhibidor de EGFR, o si el número de copias de gen EGFR y/o HER2 en las células tumorales del paciente es estadísticamente similar o inferior a un número de copias del gen EGFR y/o HER2 en células tumorales que son resistentes a un inhibidor de EGFR.

2. Procedimiento de la reivindicación 1, en el cual la etapa de detección de la amplificación o de la polisomía del gen EGFR se efectúa utilizando una sonda nucleotídica que se hibrida con el gen EGFR.

3. Procedimiento de la reivindicación 1, en el cual la etapa de detección de la amplificación o de la polisomía del gen HER2 se efectúa utilizando una sonda nucleotídica que se hibrida con gen HER2.

4. Procedimiento de la reivindicación 2 ó 3, en el cual la etapa de detección comprende además el hecho de utilizar una sonda nucleotídica que se hibrida con secuencias centroméricas del cromosoma 7.

5. Procedimiento de la reivindicación 2 ó 3, en el cual la etapa de detección comprende además el hecho de utilizar una sonda nucleotídica que se hibrida con secuencias centroméricas del cromosoma 17.

6. Procedimiento de la reivindicación 2, en el cual la etapa de detección comprende el hecho de utilizar una sonda nucleotídica quimera que se hibrida con el gen EGFR y con las secuencias centroméricas del cromosoma 7.

7. Procedimiento de la reivindicación 3, en el cual la etapa de detección comprende el hecho de utilizar una sonda nucleotídica quimera que se hibrida con el gen HER2 y con las secuencias centroméricas del cromosoma 17.

8. Procedimiento de la reivindicación 1, en el cual la etapa de detección comprende el hecho de detectar el número de copias del gen EGFR o del gen HER2 por célula tumoral en una o varias células tumorales en la muestra.

9. Procedimiento de la reivindicación 1, en el cual la etapa de detección de la amplificación del gen EGFR comprende el hecho de detectar la amplificación del gen EGFR por célula tumoral en una o varias células tumorales en la muestra.

10. Procedimiento de la reivindicación 1, en el cual la etapa de detección de la amplificación del gen HER2 comprende el hecho de detectar la amplificación del gen HER2 por célula tumoral en una o varias células tumorales en la muestra.

11. Procedimiento de la reivindicación 1, en el cual la etapa de detección comprende el hecho de detectar dos elementos cualquiera entre La amplificación del gen EGFR; La polisomía del gen EGFR; La amplificación del gen HER2; Y la polisomía del gen HER2.

12. Procedimiento de la reivindicación 1, en el cual la etapa de detección comprende el hecho de detectar tres elementos cualquiera entre La amplificación del gen EGFR; La polisomía del gen EGFR; La amplificación del gen HER2; y La polisomía del gen HER2.

13. Procedimiento de la reivindicación 1, en el cual la etapa de detección comprende el hecho de detectar la totalidad de los cuatro elementos entre la amplificación del gen EGFR; la polisomía del gen EGFR; la amplificación del gen HER2; y la polisomía del gen HER2.

14. Procedimiento de la reivindicación 1, en el cual la etapa de detección comprende el hecho de detectar a la vez la etapa de amplificación y de polisomía del gen EGFR.

15. Procedimiento de la reivindicación 14, en el cual la etapa de detección comprende además el hecho de detectar la amplificación del gen HER2.

16. Procedimiento de la reivindicación 14, en el cual la etapa de detección comprende además el hecho de detectar la polisomía del gen HER2.

17. Procedimiento de la reivindicación 1, en el cual la etapa de detección comprende el hecho de detectar a la vez la amplificación del gen HER2 y la polisomía del gen HER2.

18. Procedimiento de la reivindicación 17, en el cual la etapa de detección comprende además el hecho de detectar la amplificación del gen EGFR.

19. Procedimiento de la reivindicación 17, en el cual la etapa de detección comprende además el hecho de detectar la polisomía del gen EGFR.

20. Procedimiento de la reivindicación 1, en el cual la etapa de detección comprende el hecho de detectar a la vez la polisomía del gen EGFR y la polisomía del gen HER2.

21. Procedimiento de una cualquiera reivindicaciones 1 - 20, en el cual la etapa de detección se efectúa por una hibridación fluorescente in situ (FISH).

22. Procedimiento de una cualquiera de las reivindicaciones 1 a 21, en el cual el número de copias del gen EGFR y/o HER2 en células tumorales que son sensibles o resistentes a un inhibidor de EGFR ha sido predeterminado.

23. Procedimiento de la reivindicación 1, en el cual un paciente que tiene una muestra de tumor con 3 copias o más del gen EGFR en menos de cerca del 40 % de células es poco razonable o no que responda a un tratamiento con inhibidor de EGFR.

24. Procedimiento de la reivindicación 1, en el cual un paciente que tiene una muestra de tumor aproximadamente con cuatro copias o más gen EGFR en cerca del 40 % o más células es razonable que se beneficie de un tratamiento con el inhibidor de EGFR.

25. Procedimiento de la reivindicación 1, en el cual un paciente es razonable que se beneficie de un tratamiento con el inhibidor de EGFR, cuando el paciente tiene una muestra de tumor con agrupamientos del gen EGFR o: A) Una relación de copias del gen EGFR sobre copias del cromosoma 7 por célula de aproximadamente 2 o más; o B) Una media aproximadamente de 15 copias o más del gen EGFR por célula en cerca del 10 % o más de células analizadas.

26. Procedimiento de la reivindicación 1, en el cual un paciente que tiene una muestra de tumor con tres copias o más del gen HER2 en menos de cerca del 40 % de células es poco razonable o no que responda a un tratamiento con el inhibidor de EGFR.

27. Procedimiento de la reivindicación 1, en el cual un paciente que tiene una muestra de tumor aproximadamente con cuatro copias o más del gen HER2 en cerca del 40 % o más células es razonable que se beneficie de un tratamiento con el inhibidor de EGFR.

28. Procedimiento de la reivindicación 1, en el cual un un paciente es razonable que se beneficie de un tratamiento con el inhibidor de EGFR, cuando el paciente tiene una muestra de tumor con grupos del gen HER2 o: A) Una relación de copias del gen HER2 sobre copias del cromosoma 17 por célula de aproximadamente 2 o más; o B) Una media aproximadamente de 15 copias o más del gen HER2 por célula en cerca del 10 % o más de células analizadas.

29. Procedimiento de la reivindicación 1, en el cual la selección del paciente en la etapa (d) teniendo como base la amplificación o teniendo como base la polisomía del gen EGFR es invertida si el paciente es seleccionado como siendo razonable que se beneficie de una administración terapéutica del inhibidor de EGFR teniendo como base la amplificación o teniendo como base la polisomía del gen HER2.

30. Procedimiento de la reivindicación 1, en el cual la selección del paciente en la etapa (c) teniendo como base la amplificación o teniendo como base la polisomía del gen EGFR y la selección positiva del paciente teniendo como base la amplificación o teniendo como base la polisomía del gen HER2 aumenta la probabilidad de que el paciente responderá a un tratamiento con el inhibidor de EGFR con relación a una selección del paciente en la etapa (c) teniendo como base la amplificación o teniendo como base la polisomía solo del gen EGFR.

31. Procedimiento de cualquiera de las reivindicaciones 1 a 30, comprendiendo además el hecho: A) De detectar la expresión de una proteína Akt fosforilada en la muestra de células tumorales que proviene del paciente; B) De seleccionar a los pacientes que tienen células tumorales que expresan la proteína Akt fosforilada y que tienen un número de copias del gen EGFR que es estadísticamente similar o superior al número de copias del gen EGFR en células tumorales que son sensibles a un inhibidor de EGFR como siendo razonable que se beneficien de una administración terapéutica del inhibidor de EGFR, o C) De seleccionar a los pacientes que tienen células tumorales que expresan la proteína Akt fosforilada y que tienen un número de copias del gen EGFR que es estadísticamente similar o inferior a un número de copias del gen EGFR en células tumorales que son resistentes a un inhibidor de EGFR como siendo razonable que no se beneficien de una administración terapéutica del inhibidor de EGFR.

32. Procedimiento de la reivindicación 31, en el cual el nivel de expresión de la proteína Akt fosforilada es detectado utilizando la inmunohistoquímica (IHC).

33. Procedimiento de la reivindicación 31, en el cual la etapa de detección comprende el hecho de detectar la polisomía de EGFR y la expresión de la proteína AKT fosforilada.

34. Procedimiento de cualquiera de las reivindicaciones 1 a 33, comprendiendo además una etapa de detección de mutaciones en los exones 18, 19 y 21 del gen EGFR, donde la detección de una o de varias mutaciones en el gen EGFR predice además que el paciente se beneficiará de un tratamiento con el inhibidor de EGFR.

35. Procedimiento de cualquiera de las reivindicaciones 1 a 34, en el cual el paciente tiene un cáncer del pulmón.

36. Procedimiento de cualquiera de las reivindicaciones 1 a 34, en el cual el paciente tiene un carcinoma de pulmón de células no pequeñas (NSCLC).

37. Procedimiento de cualquiera de las reivindicaciones 1 a 34, en el cual el paciente tiene un carcinoma bronquiolo-alveolar (BAC) o adenocarcinomas con características de BAC.

38. Procedimiento de cualquiera de las reivindicaciones 1 a 37, en el cual el inhibidor de EGFR es el gefitinib.

39. Procedimiento de cualquiera de las reivindicaciones 1 a 37, en el cual el inhibidor de EGFR es el eroltinib.

40. Procedimiento de cualquiera de las reivindicaciones 1 a 37, en el cual el inhibidor de EGFR es el cetuximab.

41. Utilización de un kit de dosificación para el procedimiento de las reivindicaciones 1 a 20, un kit de dosificación que comprende: A) Un medio para detectar en una muestra de células tumorales un nivel de un biomarcador o de una combinación de biomarcadores escogido en el grupo constituido: I) De un nivel de amplificación del gen de receptor de factor de crecimiento de la epidermis (EGFR); Ii) de un nivel de polisomía del gen EGFR; Iii) de un nivel de amplificación del gen de receptor de tipo receptor de tirosina quinasa humana (HER2); y Iv) de un nivel de polisomía del gen HER2; B) Una muestra escogida en el grupo constituida: I) De una muestra de control para detectar la sensibilidad al inhibidor de EGFR; Ii) de una muestra de control para detectar la resistencia al inhibidor de EGFR; Iii) de informaciones que contienen un nivel de muestra predeterminado por el biomarcador que ha sido correlacionado con la sensibilidad al inhibidor de EGFR; y Iv) de informaciones que contienen un nivel de muestra predeterminado por el biomarcador que ha sido correlacionado con la resistencia al inhibidor de EGFR.

42. Utilización de la reivindicación 41, en la cual el kit de dosificación comprende además por lo menos un medio para detectar por lo menos una mutación en el gen EGFR.

43. Utilización de la reivindicación 41, en la cual el medio para detectar en un elemento cualquiera entre (a)( i) a (a)( iv) comprende una sonda nucleotídica que se hibrida con una parte del gen.

44. Utilización de la reivindicación 43, en la cual la sonda nucleotídica se hibrida con una parte del cromosoma 7 humano o del cromosoma 17 humano.

45. Utilización de la reivindicación 41, en la cual el medio para detectar en (a)(i) o (a) (ii) comprende una sonda nucleotídica que se hibrida con una parte de un gen EGFR y con una parte del cromosoma 7 además del gen EGFR.

46. Utilización de la reivindicación 41, en la cual el medio para detectar en (a) (iii) o (a) (iv) comprende una sonda nucleotídica que se hibrida con una parte de un gen HER2 y con una parte del cromosoma 17 además del gen HER2.

47. Utilización de una cualquiera de las reivindicaciones 41 a 46, en la cual un medio de detección está para una utilización en la hibridación fluorescente in situ (FISH).

48. Utilización de una cualquiera de las reivindicaciones 41 a 47, en la cual el medio para detectar comprende un marcador detectable.

49. Utilización de una cualquiera de las reivindicaciones 41 a 47, en la cual el medio para detectar está inmovilizado sobre un substrato.