CIP 2015 : C12N 15/117 : Acidos nucleicos que tienen propiedades inmunomoduladoras, p.ej. que contienen motivos CpG.

CIP2015 > C > C12 > C12N > C12N 15/00 > C12N 15/117[3] > Acidos nucleicos que tienen propiedades inmunomoduladoras, p.ej. que contienen motivos CpG.
Notas[t] desde C01 hasta C14: QUIMICA
C SECCION C — QUIMICA; METALURGIA.
C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.
C12N MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN (biocidas, productos que repelen o atraen a los animales nocivos, o reguladores del crecimiento de los vegetales, que contienen microorganismos virus, hongos microscópicos, enzimas, productos de fermentación o sustancias obtenidas por o extraídas de microorganismos o sustancias animales A01N 63/00; preparaciones de uso médico A61K; fertilizantes C05F ); PROPAGACION,CULTIVO O CONSERVACION DE MICROORGANISMOS; TECNICAS DE MUTACION O DE INGENIERIA GENETICA; MEDIOS DE CULTIVO (medios para ensayos microbiológicos C12Q 1/00).
C12N 15/00 Técnicas de mutación o de ingeniería genética; ADN o ARN relacionado con la ingeniería genética, vectores, p. ej. plásmidos, o su aislamiento, su preparación o su purificación; Utilización de huéspedes para ello (mutantes o microorganismos modificados por ingeniería genética C12N 1/00, C12N 5/00, C12N 7/00; nuevas plantas en sí A01H; reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00; nuevas razas animales en sí A01K 67/00; utilización de preparaciones medicinales que contienen material genético que es introducido en células del cuerpo humano para tratar enfermedades genéticas, terapia génica A61K 48/00; péptidos en general C07K).
C12N 15/117 · · · Acidos nucleicos que tienen propiedades inmunomoduladoras, p.ej. que contienen motivos CpG.

CIP2015: Invenciones publicadas en esta sección.

  1. 1.-

    Un ácido ribonucleico de doble cadena (ARNdc) aislado que comprende una cadena sencilla compuesta de poli(ácido ribocitidílico4-29uridílico) y una cadena opuesta compuesta de poli(ácido riboinosínico) de tal manera que las dos cadenas no forman un dúplex en la posición de la base uracilo, de modo que dichas cadenas están parcialmente hibridadas, caracterizado por que: el ARNdc tiene un peso molecular de aproximadamente 250 kDa a aproximadamente 320 kDa y es resistente a la desnaturalización en condiciones que son capaces de separar las cadenas de poli(ácido riboinosínico) y poli(ácido ribocitidílico) hibridadas.

  2. 2.-

    Un oligonucleótido inmunoestimulante que comprende: un dominio de activación de TLR en 5' y al menos dos regiones palindrómicas, siendo una región palindrómica una región palindrómica en 5' de al menos 6 nucleótidos de longitud y conectada a una región palindrómica en 3' de al menos 8 nucleótidos de longitud mediante un espaciador, en donde el oligonucleótido incluye al menos un dinucleótido CpG no metilado, en donde el oligonucleótido tiene la fórmula 5' XP1SP2T 3', en la que X es el dominio de activación de TLR, P1...

  3. 3.-

    COMPOSICIÓN CAPAZ DE MODULAR LA ACTIVIDAD DE SIDT1 PARA EL TRATAMIENTO DE ENFERMEDADES INFECCIOSAS INFLAMATORIAS O AUTOINMUNES MEDIADAS POR IFN

    . Solicitante/s: FUNDACIÓN PÚBLICA ANDALUZA PROGRESO Y SALUD. Inventor/es:

    Composición capaz de modular la actividad de la SIDT1 para el tratamiento de enfermedades infecciosas, inflamatorias o autoinmunes mediadas por interferones (IFN), preferiblemente IFN de tipo I y III, y más específicamente para el tratamiento de la psoriasis y el lupus. Método de selección de fármacos útiles en el tratamiento de dichas enfermedades y método para la recolección de datos útiles en el diagnóstico de dichas enfermedades.

  4. 4.-

    Un antagonista de TLR que comprende un compuesto oligonucleótido inmuno regulador (IRO) que es un antagonista para uno o más TLR que tiene la estructura en la que: CG es un resto de oligonucleótido que es CpG, C*pG, C*pG* o CpG*, en el que C es citosina, C* es un derivado de nucleótido de pirimidina que es un nucleótido de pirimidina que tiene una base que no es citosina, timina o uracilo y/o un azúcar que no es ribosa ó 2'-desoxiribosa y puede estar presente en el núcleo de un oligonucleótido, G es guanosina, y G* es un derivado de nucleótido de purina que es un nucleótido de purina que tiene una base que no es guanina o adenina y/o un azúcar que no es ribosa ó 2'-desoxiribosa y puede estar presente en el núcleo de un oligonucleótido; N1-N3,...

  5. 5.-

    Un compuesto antagonista de TLR que tiene la estructura**Fórmula** en la que: CG es un resto de oligonucleótido y C es citosina o un derivado de nucleótido de pirimidina, en el que el derivado de nucleótido de pirimidina se selecciona del grupo que consiste en 5-hidroxicitosina, 5-hidroximetilcitosina, N4- alquilcitosina, N4-etilcitosina, araC, 5-OH-dC, N3-Me-dC, y 4-tiouracilo; G es guanosina o un derivado de nucleótido de purina, en el que el derivado de nucleótido de purina se selecciona del grupo que consiste en 7-deaza-G, 7- deaza-dG, ara-G, 6-tio-G, Inosina, Iso-G, loxoribina, TOG(7-tio-8-oxo)-G,...

  6. 6.-

    Un oligonucleótido para uso en la inhibición de una respuesta inmune dependiente de TLR9 y dependiente de TLR7/8 en un individuo, en que el oligonucleótido tiene menos de aproximadamente 200 bases o pares de bases y el oligonucleótido comprende una secuencia de ácidos nucleicos inmunorreguladora, en que la secuencia de ácidos nucleicos inmunorreguladora comprende (a) al menos una secuencia trinucleotídica TGC en el extremo 5' del oligonucleótido y (b) una secuencia de nucleótidos de fórmula: X1GGGGX2X3, en que X1, X2 y X3 son nucleótidos, con la condición de que si X1≥ C o A, entonces X2X3 no es AA.

  7. 7.-

    Una composición inmunoestimulante, que comprende: un oligómero de ARN aislado con una longitud de 5-40 nucleótidos que tiene una secuencia de bases que comprende al menos un 60 % de guanina (G) y uracilo (U), en la que la secuencia de bases está libre de dinucleótidos CpG; y un lípido catiónico.

  8. 9.-

    Un procedimiento para estimular la producción de una citocina proinflamatoria seleccionada entre TNF-alfa e IL-12 que comprende: poner en contacto una célula que expresa TLR8 in vitro con un oligonucleótido de ARN (ORN) que comprende: N-U-R1-R2, en el que N es un ribonucleótido y N no incluye un U, U es uracilo o un derivado del mismo, y R es un ribonucleótido en el que al menos uno de R1 y R2 es adenosina (A) o citosina (C) o derivados de los mismos y en el que R no es U a no ser que N-U-R1-R2 incluya al menos dos A, en el que el ORN es seleccionado de: GCCACCGAGCCGAAUAUACC SEC ID Nº: 11; AUAUAUAUAUAUAUAUAUAU SEC ID Nº: 12; UUAUUAUUAUUAUUAUUAUU SEC ID Nº: 13; AAUAAUAAUAAUAAUAAUAA SEC ID Nº: 16; AAAUAAAUAAAUAAAUAAAU SEC ID Nº:...

  9. 11.-

    Una composición que comprende una mezcla sustancialmente homogénea de oligonucleótidos formadores de dúplex, en la que la mezcla de oligonucleótidos formadores de dúplex se formula en un tampón de baja salinidad e incluye un soluto, en donde al menos el 50 % de los oligonucleótidos formadores de dúplex están presentes en forma monomérica o dimérica y en donde los oligonucleótidos formadores de dúplex son oligonucleótidos inmunoestimulantes que comprenden: un dominio de activación de TLR en 5' y al menos dos regiones palindrómicas, siendo una región palindrómica una región palindrómica en 5' de al menos 6 nucleótidos de longitud y conectada a una región palindrómica en 3' de al menos 8 nucleótidos de longitud tanto...

  10. 12.-

    Un compuesto inmunomodulador quimérico (CIQ) que comprende tres o más restos de ácido nucleico y uno o más restos espaciadores distintos de ácido nucleico, en el que el CIQ comprende una estructura central con la fórmula: [Nv]x---Sp en la que Sp es un espaciador multivalente unido de manera covalente a X restos de ácido nucleico seleccionados independientemente, Nv, y en la que X es al menos 3, en el que dicho espaciador no es un polipéptido, en el que al menos un resto de ácido nucleico comprende la secuencia 5'-TCG-3', en el que dicho CIQ tiene actividad inmunomoduladora.

  11. 15.-

    Proceso para producir una composición de nucleótidos que comprende un oligonucleótido, comprendiendo dichoproceso las etapas de: (a) disponer un oligonucleótido en la solución I, en el que dicho oligonucleótido comprende, como mínimo, un tramode poli G; y en el que dicha solución I comprende un pH alcalino, en el que, de manera preferente, dicho pH es de 8a 13, de manera más preferente dicho pH es 12; (b) disgregar dicho oligonucleótido, en el que dicha disgregación comprende las etapas de: (i) ajustar la temperatura de la solución I a la temperatura I, en la que dicha temperatura I es de...

  12. 17.-

    Un compuesto inmunomodulador quimérico (CIQ) que comprende dos o más restos de ácido nucleico y uno omás restos espaciadores distintos de ácido nucleico, en el que al menos un resto espaciador distinto de ácido nucleico está unido de manera covalente a dos restosde ácido nucleico, en el que dicho espaciador no es un polipéptido, en el que al menos un resto de ácido nucleico comprende la secuencia 5'-TCG-3' en la posición prima,en el que todos los restos de ácido nucleico que comprenden la secuencia 5'-CG-3' tienen una longitud menorde 8 nucleótidos, en el que dicho...

  13. 18.-

    Uso de un oligonucleótido que tiene la secuencia 5'-Xm-GTTCGTC-Yn-3' (SEQ. ID. No. 17) para la fabricación de un medicamento para potenciar la eficacia de los esteroides en un paciente refractario a esteroides, afectado por una condición inflamatoria que no responde o responde poco o de manera inadecuada a un tratamiento anti-inflamatorio, en donde X es A, T, C o G, Y es A, T, C o G, m≥0-6, n≥0-6 y en donde al menos un dinucleótido CG no es metilado y dicho oligonucleótido tiene de 8 a 100 ácidos nucleicos de longitud.

  14. 20.-

    Uso de una región no codificante del genoma del virus de la fiebre aftosa para la elaboración de un medicamento antiviral. La presente invención se refiere al uso de RNAs correspondientes a dominios altamente estructurados de las regiones no codificantes del genoma del virus de la fiebre aftosa (VFA) y al uso de secuencias que los comprenden para la elaboración de una composición farmacéutica para la profilaxis y/o el tratamiento de enfermedades causadas por virus sensibles a interferón. Los virus sensibles a interferón son virus RNA de cadena simple, como el virus de la fiebre aftosa, el virus de la estomatitis vesicular...

  15. 21.-

    Un oligonucleótido inmunoestimulador sintético, de uso como medicamento, que contiene al menos un dinucleótdo CpG no metilado, en el que el oligonucleótido es un fosfodiéster, no contiene un palíndrome de seis bases e incluye más de ocho pero no más de 100 nucleótidos.

  16. 22.-

    Un oligonucleótido para uso en la inhibición de una respuesta inmune dependiente de TLR7/8 en un individuo, enque el oligonucleótido tiene menos de aproximadamente 200 bases o pares de bases y el oligonucleótido comprendeuna secuencia inmunorreguladora, en que la secuencia inmunorreguladora comprende al menos una secuenciatrinucleotídica TGC en el extremo 5' del oligonucleótido.

  17. 24.-

    Un oligonucleótido inmunoestimulador que tiene hasta 100 nucleótidos y que comprende un motivo de secuencia no palindrómica de ácido nucleico que tiene la siguiente fórmula: TCATCATTTTGTCATTTTGTCATT(SEQ ID Nº 2)

  18. 25.-

    Molécula multimérica para la modulación de la actividad del sistema inmune humano o animal que se puede preparar mediante un procedimiento que comprende las siguientes etapas: - proporción de una secuencia de ácido oligodesoxirribonucleico 5-fosforilado en agua, - liofilización hasta que se obtiene un residuo seco y a continuación resuspensión en una solución tampón, - adición de una ADNligasa de T4, por lo que se obtiene una mezcla de reacción e - incubación de la mezcla de reacción a 37ºC durante al menos 30 minutos

  19. 27.-

    Una composición que comprende una secuencia aislada de nucleótidos fosfodiéster sintéticos 3''-OH, 5''-OH de la SEQ ID NO: 45:gggagg y que además comprende un vehículo farmacéuticamente aceptable

  20. 28.-

    SECUENCIA DE OLIGONUCLEOTIDOS INMUNOESTIMULADORES Y METODOS PARA USAR LOS MISMOS

    . Ver ilustración. Solicitante/s: DYNAVAX TECHNOLOGIES CORPORATION. Inventor/es:

    Un polinucleótido inmunomodulador que comprende: a) 5-(TCG(Nq))y(X1X2CGX2''X1''(CG)p)z en la que N son nucleósidos, y = 1, p = 0 ó 1, q = 0, 1 ó 2, y z = 2-20, X1 y X1'' son nucleósidos auto-complementarios, X2 y X2'' son nucleósidos auto-complementarios, y en la que la T del 5'' de la secuencia (TCG(Nq))y está en el extremo 5'' del polinucleótido; y b) una secuencia palindrómica de al menos 8 bases de longitud en la que la secuencia palindrómica comprende la primera (X1X2CGX2''X1'') de las secuencias (X1X2CGX2''X1''(CG)p)z.