Moléculas quiméricas de anticuerpo frente a RANKL-PTH/PTHrP.

Molecule quimerica del anticuerpo frente al activador del receptor de ligando de NF-KB

(RANKL)-hormona paratiroidea/proteina relacionada con la hormona paratiroidea (PTH/PTHrP), que comprende:

(a) un anticuerpo que se une a RANKL; y

(b) un primer peptido de PTH/PTHrP;

en la que el peptido de PTH/PTHrP este unido covalentemente al anticuerpo, y en la que la molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP (i) inhibe la uni6n de RANKL a un activador del receptor de NF-KB (RANK) y (ii) se une a un receptor PTH-1 y/o a un receptor PTH-2.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2006/044199.

Solicitante: AMGEN INC..

Nacionalidad solicitante: Estados Unidos de América.

Dirección: ONE AMGEN CENTER DRIVE THOUSAND OAKS CA 91320 ESTADOS UNIDOS DE AMERICA.

Inventor/es: BOONE, THOMAS, CHARLES, SHEN,WENYAN, KOSTENUIK,PAUL.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/705 (Receptores; Antígenos celulares de superficie; Determinantes celulares de superficie)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Inmunoglobulinas, p. ej. anticuerpos mono o policlonales > C07K16/28 (contra receptores, antígenos celulares de superficie o determinantes celulares de superficie)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen antígenos... > A61K39/395 (Anticuerpos (aglutininas A61K 38/36 ); Inmunoglobulinas; Inmunosuero, p. ej. suero antilinfocitario)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > C07K19/00 (Péptidos híbridos (Inmoglobulinas híbridas compuestas   solamente de inmoglobulinas C07K 16/46))
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > AGRICULTURA; SILVICULTURA; CRIA; CAZA; CAPTURA; PESCA > CRIA; AVICULTURA, PISCICULTURA, APICULTURA; PESCA;... > Cría u obtención de animales, no prevista en otro... > A01K67/027 (Nuevas razas de vertebrados)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > ACTIVIDAD TERAPEUTICA ESPECIFICA DE COMPUESTOS QUIMICOS... > Medicamentos para el tratamiento de problemas del... > A61P19/10 (para la osteoporosis)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/635 (Hormona paratiroidea (parathormona); Péptidos relacionados con la hormona paratiroidea)

PDF original: ES-2453365_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Moldculas quimericas de anticuerpo frente a RANKL-PTH/PTHrP

Campo

Se proporcionan moloculas quimericas que comprenden anticuerpos que se unen at activador del receptor de

ligando de NF-x13 (RANKL) y peptidos de la hormona paratiroidea/protefna relacionada con la hormona paratiroidea (PTH/PTHrP) (moldculas quimericas de anticuerpo frente a RANKL-PTH/PTHrP) . Tambien se describen composiciones y metodos para el tratamiento de enfermedades Oseas.

Antecedentes

El tejido Oseo proporciona soporte para el cuerpo e incluye minerales (incluyendo calcio y fOsforo) , una matriz de

protefnas de coldgeno y no de coldgeno, y celulas. El tejido Oseo vivo muestra un equilibrio dindmico entre la formaciOn de hueso, que se denomina deposicion, y la degradacion del hueso, que se denomina resorciOn. En este equilibrio estan implicados tres tipos de celulas encontradas en el hueso, osteocitos, osteoblastos y osteoclastos. Los osteoblastos promueven la formacion de tejido Oseo mientras que los osteoclastos estan asociados con la resorciOn. La resorcion, o la disoluciOn de matriz Osea y minerales, es un proceso rapido y eficaz en comparaciOn con la formacion osea y puede liberar grandes cantidades de minerales desde el hueso. Los osteoclastos estan implicados en la regulaciOn de la remodelaciOn normal de tejido esqueldtico y en la resorciOn inducida por hormonas. Por ejemplo, la resorciOn se estimula mediante la secrecion de la hormona paratiroidea en respuesta a concentraciones decrecientes de ión calcio en fluidos extracelulares. Por el contrario, la inhibiciOn de la resorciOn es una fund& de calcitonina. Ademds, los metabolitos de la vitamina D alteran la capacidad de respuesta del hueso a la hormona paratiroidea y calcitonina.

El activador del receptor de ligando de NF-x13 (RANKL; tambien denominado ligando de osteoprotegerina, u OPGL) , que es un miembro de la familia de TNF de citocinas, promueve la formacion de osteoclastos mediante la uniOn al activador del receptor de NF-K13 (RANK, tambien denominado receptor de diferenciación y activacion de osteoclastos, u ODAR) . La osteoprotegerina (OPG) , por otro lado, inhibe la formacion de osteoclastos secuestrando

RANKL e impidiendo la asociación de RANKL con RANK. Por tanto, la cantidad de RANKL asociado con RANK se corresponde con el equilibrio entre deposicion y resorcion oseas.

Tras la madurez del esqueleto, la cantidad de hueso en el esqueleto refleja el equilibrio (o desequilibrio) de formación ósea y resorción &ea. La masa ósea maxima se produce tras la madurez del esqueleto antes de la cuarta decada. Entre las docadas cuarta y quinta, el equilibrio se desplaza y predomina la resorcion osea. La inevitable

disminucion de la masa Osea con el paso de los afios comienza antes en mujeres que en hombres y se acelera de manera distintiva tras la menopausia en algunas mujeres (principalmente las de ascendencia caucasica y asiatica) .

La hormona paratiroidea (PTH) se secreta en respuesta a hipocalcemia. La PTH activa los osteoclastos, posiblemente a trues de la union a y la activaciOn del receptor PTH1. La activaciOn del receptor PTH1 conduce a la secreciOn de RANKL, que estimula la resorcion osea y un aumento de los niveles de calcio serico.

De manera paradOjica, la administraciOn intermitente de PTH o protefna relacionada con PTH (PTHrP) puede provocar realmente un aumento de la densidad Osea. Este aumento se debe a la activaciOn de osteoblastos, que aumentan la formaciOn Osea, ademds de la activacion de osteoclastos, que aumentan la resorcion &ea. Cuando la de activacion osteoblastos supera la activacion de osteoclastos, el resultado neto es un aumento de la densidad ósea. Sin embargo, la estimulaciOn fuerte de los osteoblastos se ha asociado con osteosarcoma en ratones.

La osteopenia es un estado que se refiere generalmente a cualquier disminuciOn de la masa Osea por debajo de niveles normales. Un estado de este tipo puede surgir a partir de una disminucion de la tasa de sintesis ósea o un aumento de la tasa de destrucción ósea o ambos. Una forma corniin de osteopenia es la osteoporosis primaria, tambien denominada osteoporosis postmenopausica y senil. Esta forma de osteoporosis es una consecuencia de la perdida universal de hueso con la edad y a menudo es resultado del aumento de la resorciOn Osea con una tasa

normal de formaciOn ósea. Muchas mujeres de raza blanca en los Estados Unidos desarrollan osteoporosis sintomatica. Existe una relaciOn directa entre la osteoporosis y la incidencia de fracturas de cadera, femorales, de cuello e intertrocantericas en mujeres de 45 afios y mayores. Las mujeres ancianas pueden desarrollar osteoporosis sintomatica entre las edades de 50 y 70.

El documento W02004/060386 Al da a conocer agentes terapeuticos que comprenden un dominio de modulacion

de PTH/PTHrP unido covalentemente a un vehículo, tat como un dominio Fc. El documento WO 2004/060386 da a conocer adernds que pueden usarse agonistas de PTH con semivida prolongada (por ejemplo, los unidos a los dominios de Fc) con un inhibidor de resorciOn Osea, tal como anticuerpos frente a OPG-L (RANKL) .

Sumario de la invencion

Se proporciona lo siguiente:

1. Una molecula quimerica del anticuerpo frente al activador del receptor de ligando de NF-KB (RANKL) -hormona paratiroidea/proteina relacionada con la hormona paratiroidea (PTH/PTHrP) , que comprende:

(a) un anticuerpo que se une a RANKL; y

(b) un primer *tido de PTH/PTHrP;

enla que el peptido de PTH/PTHrP esta unido covalentemente at anticuerpo, y en la que la molacula quimerica de anticuerpo frente a RANKL-PTH/PTHrP (i) inhibe la union de RANKL a un activador del receptor de NF-xEl (RANK) y

(ii) se une a un receptor PTH-1 y/o a un receptor PTH-2.

2. La molecula quimarica de anticuerpo frente a RANKL-PTH/PTHrP segun 1, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la que la cadena pesada comprende una secuencia

de aminoacidos que tiene at menos una identidad del 92% con la secuencia de aminoacidos expuesta en SEQ ID NO: 11.

3. La molacula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun 1 6 2, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la que la cadena ligera comprende una secuencia de aminoacidos que tiene al menos una identidad del 90% con la secuencia de aminoacidos expuesta en SEQ ID

NO: 12.

4. La molecula quimarica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de 1 a 3, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la que la cadena pesada comprende una secuencia de aminoacidos que tiene at menos una identidad del 95% con la secuencia de aminoacidos expuesta en SEQ ID NO: 11.

5. La molacula quimerica de anticuerpo frente a RANKL-PTH/PTHrP seg6n cualquiera de 1 a 4, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la que la cadena ligera comprende una secuencia de aminoacidos que tiene al menos una identidad del 95% con la secuencia de aminoacidos expuesta en SEQ ID NO: 12.

6. La molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de 1 a 5, en la que el

anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la que la cadena pesada comprende una secuencia de aminoacidos que tiene at menos una identidad del 99% con la secuencia de aminoacidos expuesta en SEQ ID NO: 11.

7. La molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de 1 a 6, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la que... [Seguir leyendo]

 


Reivindicaciones:

1. Molecule quimerica del anticuerpo frente al activador del receptor de ligando de NF-KB (RANKL) -hormona paratiroidea/proteina relacionada con la hormona paratiroidea (PTH/PTHrP) , que comprende:

(a) un anticuerpo que se une a RANKL; y

(b) un primer peptido de PTH/PTHrP;

en la que el peptido de PTH/PTHrP este unido covalentemente al anticuerpo, y en la que la molecule

quimerica de anticuerpo frente a RANKL-PTH/PTHrP (i) inhibe la unión de RANKL a un activador del

receptor de NF-KB (RANK) y (ii) se une a un receptor PTH-1 y/o a un receptor PTH-2.

2. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 1, en la que el

anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la que la cadena pesada comprende una secuencia de aminoacidos que tiene al menos una identidad del 92% con la secuencia de aminoacidos expuesta en SEQ ID NO: 11.

3. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP segOn la reivindicacien 1 o la reivindicaciOn 2, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la

quela cadena ligera comprende una secuencia de aminoacidos que tiene al menos una identidad del 90% con la secuencia de aminoacidos expuesta en SEQ ID NO: 12.

4. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a 3, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la

que la cadena pesada comprende una secuencia de aminoacidos que tiene al menos una identidad del 95%con la secuencia de aminoacidos expuesta en SEQ ID NO: 11.

5. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP seg6n cualquiera de las reivindicaciones 1 a 4, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la que la cadena ligera comprende una secuencia de aminoacidos que tiene al menos una identidad del 95% con la secuencia de aminoacidos expuesta en SEQ ID NO: 12.

6. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicacionesi a 5, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la que la cadena pesada comprende una secuencia de aminoacidos que tiene al menos una identidad del 99% con la secuencia de aminoacidos expuesta en SEQ ID NO: 11.

7. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP seg6n cualquiera de las reivindicaciones 1 a

6, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la que la cadena ligera comprende una secuencia de aminoacidos que tiene al menos una identidad del 99% con la secuencia de aminoacidos expuesta en SEQ ID NO: 12.

8. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a

7, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la quela cadena pesada comprende una secuencia de aminoacidos tal como se expone en SEQ ID NO: 11.

9. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP seg6n cualquiera de las reivindicaciones 1 a

8, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, en la que la cadena ligera comprende una secuencia de aminoacidos tal como se expone en SEQ ID NO: 12.

10. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 1, en la que el

anticuerpo comprende una cadena pesada y una cadena ligera, y en la que la cadena pesada comprende una secuencia de aminoacidos tal como se expone en SEQ ID NO: 2 desde el residuo 20 hasta el residuo 467, y la cadena ligera comprende una secuencia de aminoacidos tal como se expone en SEQ ID NO: 4 desde el residuo 21 hasta el residuo 235.

11. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a

10, en la que el primer peptido de PTH/PTHrP comprende un dominio pre-pro y un dominio de modulaciOn de PTH/PTHrP que se une a un receptor PTH-1 y/o a un receptor PTH-2.

12. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a 10, en la que el primer peptido de PTH/PTHrP este unido covalentemente a una cadena pesada.

13. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a 10, en la que el primer peptido de PTH/PTHrP este unido covalentemente a una cadena ligera.

14. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a

9, en la que el anticuerpo se selecciona de un anticuerpo Fv de cadena sencilla (scFv) , un anticuerpo Fab, 79

30

35

un anticuerpo Fab', un anticuerpo F (ab') 2, un anticuerpo frente a dominio, un nanocuerpo, un minicuerpo, un maxicuerpo y un diacuerpo.

15. Moldcula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a 10, que comprende ademds un segundo peptido de PTH/PTHrP, en la que los peptidos de PTH/PTHrP primero y segundo son iguales o diferentes.

16. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 15, en la que el segundo peptido de PTH/PTHrP comprende un dominio pre-pro y un dominio de modulaciOn de PTH/PTHrP que se une a un receptor PTH-1 y/o a un receptor PTH-2.

17. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicacion 15, en la que el anticuerpo que se une a RANKL comprende una cadena pesada y una cadena ligera, y en la que el primer peptido de PTH/PTHrP esta unido covalentemente a la cadena ligera y el segundo peptido de PTH/PTHrP esta unido covalentemente a la cadena pesada.

18. Moldcula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a 10, en la que el anticuerpo es completamente humano.

19. Moldcula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a 17, en la que el peptido de PTH/PTHrP primero y/o segundo comprende un dominio de modulacion de PTH/PTHrP seleccionado de los polipdptidos de fOrmula I:

11x12Kx14x15x16x17x18x19R x21x22x23x24x25x26x27x28xC

XNHX19X

(FOrmula I; SEQ ID NO: 13)

en la que:

X3x4x5x6x7, x2x3x4x5x6x7, x1x2x3x4x5x6x7 yxi x2 x3x4x5x6x7;

X" esta ausente o es

x10, x11, x12, x14 a

X1 a X7, X28son cada uno residuos de aminoacido seleccionados independientemente;

x29x30, x29x30x31 x29x30x31x32, x29x30x31x32x33, x29x30x31x32x33x34,

Xc esta ausente o es X29

x29x30x31x32x33x34x35 x29x30x31 x32 x33x34x36x36;

o X29 a X36 son cada uno residuos de aminoacido seleccionados independientemente;

siempre que uno o mds de x14 a X36 sean un residuo de cisteina; y en la que el peptido de PTH/PTHrP se une a un receptor PTH-1 o a un receptor PTH-2.

20. Moldcula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicacion 19, en la que:

XNes X1X2X3X4X5X6X7; X1 es un residuo hidrofilo o no funcional; X2 es V; X3 es S; X4 es E;

X5 es un residuo no funcional o bdsico; X6 es Q; X7 es L; X113 es un residuo acido o hidnifilo; X11 es un residuo no funcional o basico;

X12 es un residuo no funcional; X14 es un residuo basico o hidrOfilo; X15 es un residuo no funcional;

X16 es un residuo no funcional o hidrOfilo;

X17 es un residuo acido, hidrOfilo o no funcional; X18 es un residuo no funcional; X19 es un residuo acid° o basico;

X21es un residuo no funcional o basico; X22 es un residuo hidrofilo, dcido o aromdtico; X23 es un residuo aromatic° o lip6filo; X24 es un residuo lip6filo; X25 es un residuo hidrOfilo o basico;

X26es un residuo hidrOfilo o basico; X27 es un residuo lip6filo, basic° o no funcional; y X28 es un residuo lip6filo o no funcional, en la que el residuo no funcional es un residuo de aminoacido en forma D o L que carece de grupos acidos,

basicos y aromaticos cuando se incorpora en un polipeptido entre dos residuos de aminoacido que son 15 igualeso diferentes.

21. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicacion 19 6 20, en la que:

x30x31 x32 x33x34,

Xc es X29 X29 es un residuo hidrOfilo o no funcional; X3° es un residuo hidrOfilo o dcido;

X3'es un residuo lipofilo o no funcional;

X32 es H;

X33 es una cisteina o un residuo hidrOfilo; y

X34 es un residuo no funcional o aromatic°,

en la que el residuo no funcional es un residuo de aminoacido en forma D o L que carece de grupos acidos, 25 basicos y aromaticos cuando se incorpora en un polipeptido entre dos residuos de aminoacido que son iguales o diferentes.

22. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 19 6 20, en la que: Xc es X29X30X31; X29 es un residuo hidrofilo o no funcional;

X3°es un residuo hidrOfilo o acido; y X31 es un residuo lipofilo o no funcional, en la que el residuo no funcional es un residuo de aminoacido en forma D o L que carece de grupos acidos,

basicos y aromaticos cuando se incorpora en un polipeptido entre dos residuos de aminoacido que son iguales o diferentes. 35 23. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicacion 19 6 20, en la que: Xc es X29X30; X29 es un residuo hidrOfilo o no funcional; y

X3° es un residuo hidrofilo o acid°,

en la que el residuo no funcional es un residuo de aminoacido en forma D o L que carece de grupos acidos, 40 basicosy aromaticos cuando se incorpora en un polipeptido entre dos residuos de aminoacido que son

iguales o diferentes.

24. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 19 6 20, en la que: Xc es X29; y X29 es un residuo hidrofilo o no funcional,

enla que el residuo no funcional es un residuo de aminoacido en forma D o L que carece de grupos acidos, basicos y aromaticos cuando se incorpora en un polipeptido entre dos residuos de aminoacido que son iguales o diferentes.

25. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segOn cualquiera de las reivindicaciones 19 a 24, en la que al menos uno de X27 y X33 es cistelna.

26. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segim la reivindicaciOn 19 6 20, en la que Xc esta ausente.

27. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segOn la reivindicaciOn 19, en la que: X1 es A, S o Y; X5 es H 01;

X16es N o D; X11 es L, R o K; X12 es G, F o W; X14 es H o S; X15 es L o I;

x16es Q,

20N, S o A; X17 es S, D o L; X18 es M, L, V o Nle;

X19 es E o R; X21 es V, M, R o Nle;

X22es E o F; X" es W o F; X25 es R o H; X26 es K o H; X27 es C; y

X28es L o I.

28. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segim la reivindicaciOn 27, en la que: Xc es X28X38X31X32X33X34;

X28 es Q o A; X3° es D o E;

X31 es V o I; X33 es C; X34 es N o T; y X35 es A, F o Y.

29. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 27, en la que:

Xc es X29X35X31;

X29 es Q o A;

X35 es D o E; y

X31es V o I;

30. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicacion 27, en la que: Xc es X29X30; X29 es Q o A; y X3° es D o E.

31. Moldcula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segOn la reivindicaciOn 27, en la que:

Xc es X29; y

X29 es Q o A.

32. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 27, en la que Xc estd ausente.

33. Molocula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segOn cualquiera de las reivindicaciones 1 a 18, en la que el peptido de PTH/PTHrP primero y/o segundo comprende un dominio de modulaciOn de PTH/PTHrP seleccionado de polipeptidos de fOrmula II:

jNy JEIHN jil j12KHulós j18 j19, 21

..

11J EWLRKKLJc

(FOrmula II; SEQ ID NO: 14)

enla que: Ji j2 J3 ja j5 j2j3 j4 j5j6 0 j3 j4j5 j6;

J" esta ausente o es J1 a J8, J12, J16, j18 .21

y J son cada uno residuos de aminodcido seleccionados independientemente; es un residuo no funcional o basico; J19 es un residuo acid° o basico;

29, j29 j30, J29 J30 j31, j29 j30 J31 j32, j29 J30 J31 j32 J33 j29 J30 J31 j32 j33 J34;

Jcesta ausente o es J J29 a 24 son cada uno residuos de aminoacido seleccionados independientemente; siempre que uno o mas de J14 al residuo del extremo C-terminal del dominio de modulaciOn de PTH/PTHrP

sean un residuo de cisterna; en la quo el peptido de PTH/PTHrP se une a un receptor PTH-1 o a un receptor PTH-2, 30 enla quo el residuo no funcional es un residuo de aminoacido en forma D o L que carece de grupos acidos, basicos y aromaticos cuando se incorpora en un polipeptido entre dos residuos de aminoacido que son iguales o diferentes.

34. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 33, en la que: J" es J1J2J3J4J5J6,

J1es un residuo no funcional o aromatico; J2 es un residuo no funcional; J3 es un residuo hidrOfilo; J4 es un residuo acido; J5 es un residuo no funcional;

J6 es un residuo basico;

J7 es un residuo no funcional o arornatico;

J8 es un residuo no funcional;

J12 es un residuo no funcional o arornatico;

J16 es un residuo no funcional o hidrOfilo;

J18 es un residuo no funcional;

J21 es un residuo no funcional;

J2920212223, 134;

Jc es J29 es un residuo hidrOfilo o no funcional;

J39es un residuo hidrOfilo o acido; J31 es un residuo lipotho o no funcional; J32 es un residuo basico; J33 es un residuo acido; y J34 es un residuo arornatico.

35. Molecula quirnerica de anticuerpo frente a RANKL-PTH/PTHrP segCin la reivindicackin 34, en la que: J1 es A, S o Y; J2 es V; J3 es S; J4 es E;

J5es I; J6 es Q; J7 es L o F; J8 es M o Nle; J11 es L, R o K;

J12es G o W; J16 es N, So A; J18 es M, Me, L o V; J19 es E o R;

s

e V, M o Nle;

J29es Q o A; J39 es D o E; J31 es V o I; J32 es H; J33 es N; y

J34es F o Y.

36. Molecula quirnerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 33, en la que:

J" es J1J2J3J4J5J6; 84

J1 es un residuo no funcional o arornatico;

J2 es un residuo no funcional;

J3 es un residuo hidrofilo;

J4 es un residuo acido;

J5es un residuo no funcional; J6 es un residuo basico; J7 es un residuo no funcional o arornatico; J8 es un residuo no funcional; J12 es un residuo no funcional o arornatico;

J16es un residuo no funcional o hidrOfilo; J18 es un residuo no funcional; J21 es tin residuo no funcional; Jc es J29J39J31; J29 es un residuo hidrofilo o no funcional;

J39es un residuo hidrOfilo o acido; y J31 es un residuo lipotho o no funcional.

37. MolOcula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 36, en la que: J1 es A, S o Y; J2 es V;

J3es S; J4 es E; J5 es I; J6 es Q; J7 es L o F;

J8es M o Nle; J11 es L, R o K; J12 es G o W; J16 es N, S o A;

esrtii,

Nle, L o V;

J19es E o R; J21 es V, M o Nle; J29 es Q o A; J39 es D o E; y J31 es V o I.

38. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicacion 33, en la que: SI es J1J2J3J4J5J6; J1 es un residuo no funcional o arornatico;

J2 es un residuo no funcional;

J3 es un residuo hidrOfilo;

J4 es un residuo acido;

J5 es un residuo no funcional;

J6es un residuo basico; J7 es un residuo no funcional o arornatico; J8 es un residuo no funcional; J12 es un residuo no funcional o arornatico; J16 es un residuo no funcional o hidrOfilo;

J18es un residuo no funcional; J21 es un residuo no funcional; Jc es J29J3°; J29 es un residuo hidrofilo o no funcional; y J3° es un residuo hidrofilo o acido. 15 39. Molecula quirnerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicacion 38, en la que: J1 es A, S o Y; J2 es V; J3 es S; J4 es E;

J5es I;

J6 es Q;

J7 es L o F; J8 es M o Nle; J11 es L, R o K;

J12es G o W; J16 es N, S o A; J18 es M, Nle, L o V; J19 es E o R; J21 es V, M o Nle;

J29es Q o A; y J3° es D o E.

40. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 33, en la que: J" es J1J2J3J4J5J6; J1 es un residuo no funcional o aromatico;

J2 es un residuo no funcional; J3 es un residuo hidrOfilo; J4 es un residuo acido;

10

15

20

25

30

J5 es un residuo no funcional;

J6 es un residuo bdsico;

J7 es un residuo no funcional o arornatico; J8 es un residuo no funcional;

J12 es un residuo no funcional o arornatico; J16 es un residuo no funcional o hidrOfilo; J18 es un residuo no funcional; J21 es un residuo no funcional; Jc es J29; y

J29es un residuo hidrofilo o no funcional.

41. Molecula quirnerica de anticuerpo frente a RANKL-PTH/PTHrP segtin la reivindicacion 40, en la que:

J1 es A, S o Y; J2 es V; J3 es S;

J4es E; J5 es I; J6 es 0; J7 es La F; J8 es M o Nle;

J11es L, R o K; J12 es G o W; J16 es N, S o A; J18 es M, Nle, L o V; J19 es E o R;

J21es

V, M o Nle; y J29 es Q o A.

42. Molecula quirndrica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicacion 33, en la que:

j2 j3 j4 J5 j6;

J" es J

J1 es un residuo no funcional o arornatico;

J2 es un residuo no funcional; J3 es un residuo hidrOfilo; J4 es un residuo acido; J5 es un residuo no funcional; J6 es un residuo basico;

J7es un residuo no funcional o arornatico; J8 es un residuo no funcional; J12 es un residuo no funcional o arornatico;

J16 es un residuo no funcional o hidrofilo;

J18 es un residuo no funcional;

J21 es un residuo no funcional; y

Jc esta ausente.

43. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicackin 42, en la que: J1 es A, S o Y; J2 es V; J3 es S;

J4 es E; 10 J5es I;

J6 es Q;

J7 es L o F;

J8 es M o Nle;

J11 es L, R o K;

J12es G o W;

J16 es N, S o A;

J18 es m Nle, L o V;

J19 es E o R; y

J21 es V, M o Nle.

44. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a 18, en la que el peptido de PTH/PTHrP primero y/o segundo comprende un dominio de modulaciOn de PTH/PTHrP seleccionado de polipeptidos de formula III: oNLHo10011012Ksi015016017LFIRRF023LHHLI0c (Formula III; SEQ ID NO: 15)

enla que:

04050607,

01 020304050607, 020304050607, 0304050607,

ON esta ausente o es Y01020304050607,

050607, 05_7

U 07;

a 07, o'° a o12, 015 a 017 y 023 son cada uno residuos de aminoacido seleccionados independientemente;

029030, 029030031 029030031032, 029030031032033, 029030031032033034,

Ocesta ausente o es 029

029030031032033034036 U 026030031032033034036036;

029 a 036 son cada uno independientemente residuos de aminoacido; 014

siempre que uno o mas de al residuo del extremo C-terminal del dominio de modulacion de PTH/PTHrP sean un residuo de cisteina; y

enla que el peptido de PTH/PTHrP se une a un receptor PTH-1 o a un receptor PTH-2.

45. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 44, en la que: ON es 07; 07 es un residuo no funcional;

010

es un residuo acid° o hidrofilo;

011 es un residuo basic° o no funcional;

012 es un residuo aromatic° o no funcional; 015 es un residuo hidrOfilo o no funcional; 016 es un residuo hidrofilo;

017es un residuo acid° o no funcional;

023 es un residuo aromatico; y

Oc esta ausente,

en la que el residuo no funcional es un residuo de aminoacido en forma D o L que carece de grupos acidos, basicos y aromaticos cuando se incorpora en un polipeptido entre dos residuos de aminoacido que son

igualeso diferentes.

46. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 44, en la que: ON es 01020304050607; 01 es un residuo de aminoacido no funcional; 02 es un residuo de aminoacido no funcional;

03es un residuo de aminoacido hidrOfilo; 04 es un residuo de aminoacido acido; 05 es un residuo de aminoacido basic° o no funcional; 06 es un residuo de aminoacido hidrOfilo; 07 es un residuo no funcional;

010

es un residuo acid° o hidnifilo;

011 es un residuo basic° o no funcional;

012 es un residuo aromatic° o no funcional;

015 es un residuo hidrOfilo o no funcional;

016 es un residuo hidrOfilo;

017es un residuo acid° o no funcional; y

023 es un residuo aromatic°,

en la que el residuo no funcional es un residuo de aminoacido en forma D o L que carece de grupos acidos, basicos y aromaticos cuando se incorpora en un polipeptido entre dos residuos de aminoacido que son iguales o diferentes.

47. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segiln la reivindicaciOn 44, en la que: 01 es A; 02 es V; 03 es S; 04 es E;

05es H o I;

es Q;

es L;

010

es N o D;

011 es K o L;

012 es G, F o W;

015 es I o S;

016 es Q o N;

017 es D o L;

023 es F o W.

48. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segOn cualquiera de las reivindicaciones 1 a

18, en la que el peptido de PTH/PTHrP primero y/o segundo comprende un dominio de modulacion de PTH/PTHrP, en la que el dominio de modulaciOn de PTH/PTHrP comprende:

a) una secuencia seleccionada de SEQ ID NO: 16 a 89; o

b) una secuencia seleccionada de SEQ ID NO: 90 a 107 excepto porque uno o mas residuos en la posicion 14 al extremo C terminal del dominio de modulaciOn de PTH/PTHrP estan sustituidos por un residuo de cisteina.

49. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segtin cualquiera de las reivindicaciones 1 a

48, en la que el peptido de PTH/PTHrP primero y/o segundo comprende un dominio pre-pro y un dominio de modulaciOn de PTH/PTHrP, en la que el dominio pre-pro comprende una secuencia de aminoacidos seleccionada de SEQ ID NO: 188 a 207.

50. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicaciOn 49, en la que el

dominio pre-pro comprende la secuencia de aminoacidos de SEQ ID NO: 188 y el dominio de modulaciOn dePTH/PTHrP comprende la secuencia de aminoacidos de SEQ ID NO: 22.

51. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segtIn cualquiera de las reivindicaciones 1 a

18, en la que el peptido de PTH/PTHrP primero y/o segundo comprende la secuencia de aminoacidos de SEQ ID NO: 8 desde el residuo 32 hasta el residuo 285.

52. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP seleccionada de:

(a) una molocula quimerica de anticuerpo frente a RANKL-PTH/PTHrP que comprende un primer polipeptido que tiene una secuencia de aminoacidos de SEQ ID NO: 2 desde el residuo 20 hasta el residuo 467 y un segundo polipeptido que tiene una secuencia de aminoacidos de SEQ ID NO: 8 desde el residuo 32 hasta el residuo 285;

(b) una molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP que comprende un primer

polipeptido que tiene una secuencia de aminoacidos de SEQ ID NO: 10 desde el residuo 32 hasta el residuo 518 y un segundo polipeptido que tiene una secuencia de aminoacidos de SEQ ID NO: 4 desde el residuo 21 hasta el residuo 235; y

(c) una molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP que comprende un primer polipeptido que tiene una secuencia de aminoacidos de SEQ ID NO: 10 desde el residuo 32 hasta el

residuo518 y un segundo polipeptido que tiene una secuencia de aminoacidos de SEQ ID NO: 8 desde el residuo 32 hasta el residuo 285.

53. Molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun la reivindicacion 1, seleccionada de:

(a) una molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP que comprende un primer polipeptido que tiene una cadena pesada de anticuerpo que comprende una secuencia de aminoacidos de

SEQID NO: 11 y un segundo polipeptido que tiene una secuencia de aminoacidos de SEQ ID NO: 8 desde el residuo 32 hasta el residuo 285; y

(b) una molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP que comprende un primer polipeptido que tiene una secuencia de aminoacidos de SEQ ID NO: 10 desde el residuo 32 hasta el residuo 518 y un segundo polipeptido que tiene una cadena ligera de anticuerpo que comprende una

secuencia de aminoacidos de SEQ ID NO: 12.

54. PolinucleOtido que codifica para una molecula quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a 53.

55. Vector que comprende un polinucleOtido que codifica para una molocula quimerica de anticuerpo frente a RANKL-PTH/PTHrP sew:in cualquiera de las reivindicaciones 1 a 53.

56. Celula huesped que comprende el vector segun la reivindicaciOn 55.

57. Metodo de producciOn de una molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP que

comprende cultivar la celula huesped segun la reivindicaciOn 56.

58. ComposiciOn farmaceutica que comprende una molecule quimerica de anticuerpo frente a RANKL

5 PTH/PTHrP segun cualquiera de las reivindicaciones 1 a 53.

59. Uso de la composicion farmaceutica segun la reivindicaciOn 58 para la preparaciOn de un medicamento

para tratar la perdida Osea en un paciente.

60. Uso segun la reivindicaciOn 59, en el que el medicamento comprende edemas at menos un agente

terapeutico seleccionado de anakinra, etanercept, infliximab, adalimumab y metotrexato.

61 . Uso segun la reivindicaciOn 59, en el que el medicamento comprende edemas al menos un anticuerpo

terapeutico seleccionado de un anticuerpo frente a Her2, un apticuerpo frente a CDC20, un anticuerpo

frente a EGFR, un anticuerpo frente a vegF, un anticuerpo frente at receptor de vegF, un anticuerpo frente

al factor de crecimiento de hepatocitos (HGF) /factor de dispersion (SF) , un anticuerpo frente al receptor del

factor de crecimiento similar a insulina (IFGR) y un anticuerpo frente a CDC33.

1 5 62. Uso segun la reivindicaciOn 59, en el que el medicamento comprende edemas al menos un agente

seleccionado de un agente contra la resorción ósea, un agente anabOlico 6seo, un agente antiinflamatorio,

un agente inmunosupresor y un agente de terapia contra el cancer.

63. Uso segun la reivindicacion 62, en el que at menos un agente de terapia contra el cancer se selecciona de

un inhibidor del receptor del factor de crecimiento epidermic° (EGFR) , un inhibidor de HER2, un inhibidor de

vegF, un inhibidor del receptor de vegF, un inhibidor del factor de crecimiento de hepatocitos (HGF) /factor

de dispersion (SF) , un inhibidor de c-Met, un inhibidor de angiopoyetina, un inhibidor de Tie2, un inhibidor

del receptor del factor de crecimiento derivado de plaquetas (PDGFR) , un inhibidor del receptor del factor

de crecimiento similar a insulina (IGFR) , un inhibidor de glicoproteinas similares a mucina, un inhibidor de

CDC20 y un inhibidor de CDC33.

25 64. Uso segtin la reivindicaciOn 59, en el que el medicamento comprende edemas at menos un agente

terapeutico seleccionado de un factor morfogenetico oseo, factor de crecimiento transformante 13 (TGF-I3) ,

un inhibidor de interleucina-1 (IL-1) , IL-1ra, anakinra, un inhibidor de INFa, un receptor de TNFa soluble,

etanercept, un anticuerpo anti-TNFa, infliximab, adalimumab, una prostaglandina, un bisfosfonato,

alendronato, fluoruro, calcio, un farmaco antiinflamatorio no esteroideo (AINE) , un inhibidor de COX-2,

celecoxib, rofecoxib, un inmunosupresor, metotrexato, leflunomida, un inhibidor de serina proteasa, un

inhibidor de la proteasa de leucocitos secretores (SLPI) , un inhibidor de IL-6, un anticuerpo frente a IL-6, un

inhibidor de IL-8, un anticuerpo frente a IL-8, un inhibidor de IL-18, una proteina de uniOn a IL-18, un

anticuerpo frente a IL-18, un modulador de la enzima convertidora de interleucina-1 (ICE) , un factor de

crecimiento de fibroblastos (FGF) , un modulador de FGF, un antagonista de PAF, un factor de crecimiento

35 de queratinocitos (KGF) , una molecule relacionada con KGF, un modulador de KGF; un modulador de

metaloproteinasa de matriz (MMP) , un modulador de la &cid° nitric° sintasa (NOS) , un modulador del

receptor de glucocorticoides, un modulador del receptor de glutamato, un modulador de los niveles de

lipopolisacdridos (LPS) , una noradrenalina, un mimetic° de noradrenalina y un modulador de noradrenalina.

65. Uso segun la reivindicacion 59, en el que la perdida Osea esta asociada con al menos un estado

seleccionado de un estado inflamatorio, un estado autoinmunitario, artritis reumatoide y cancer.

66. Uso segtin la reivindicaciOn 59, en el que la perdida osea este asociada con cancer, y en el que el

medicamento comprende edemas al menos un agente terapeutico seleccionado de un inhibidor del receptor

del factor de crecimiento epidermic° (EGFR) , un inhibidor de HER2, un inhibidor de vegF, un inhibidor del

receptor de vegF, un inhibidor del factor de crecimiento de hepatocitos (HGF) /factor de dispersion (SF) , un

45 inhibidor de c-Met, un inhibidor de angiopoyetina, un inhibidor de Tie2, un inhibidor del receptor del factor de

crecimiento derivado de plaquetas (PDGFR) , un inhibidor del receptor del factor de crecimiento similar a

insulina (IGFR) , un inhibidor de glicoproteinas similares a mucina, un inhibidor de CDC20 y un inhibidor de

CDC33.

67. Uso segtin la reivindicacion 59, en el que la perdida Osea esta asociada con cancer, y en el que el

medicamento comprende edemas at menos un anticuerpo seleccionado de un anticuerpo frente a Her2, un

anticuerpo frente a CDC20, un anticuerpo frente a EGFR, un anticuerpo frente a vegF, un anticuerpo frente

al receptor de vegF, un anticuerpo frente at factor de crecimiento de hepatocitos (HGF) /factor de dispersion

(SF) , un anticuerpo frente al receptor del factor de crecimiento similar a insulina (IFGR) y un anticuerpo

frente a CDC33.

55 68. Uso segun la reivindicaciOn 59, en el que la perdida ósea esta asociada con cancer, y en el que el

medicamento es para la administracien con al menos un agente de terapia contra el cancer seleccionado de

radioterapia y quimioterapia.

69. Molecule quimerica de anticuerpo frente a RANKL-PTH/PTHrP segun cualquiera de las reivindicaciones 1 a 53 o la composiciOn farmaceutica segiin la reivindicaciOn 54 para su uso en el tratamiento de pOrdida ósea en un paciente.

70. ComposiciOn farmacOutica para su uso segun la reivindicacion 69, en la que la composición comprende edemas al menos un agente terapeutico seleccionado de anakinra, etanercept, infliximab, adalimumab y metotrexato.

71. Composición farmaceutica para su uso segtIn la reivindicaciOn 69, en la que la composición comprende edemas al menos un anticuerpo terapeutico seleccionado de un anticuerpo frente a Her2, un anticuerpo frentea CDC20, un anticuerpo frente a EGFR, un anticuerpo frente a vegF, un anticuerpo frente al receptor de vegF, un anticuerpo frente al factor de crecimiento de hepatocitos (HGF) /factor de dispersion (SF) , un anticuerpo frente al receptor del factor de crecimiento similar a insulina (IFGR) y un anticuerpo frente a

CDC33.

72. ComposiciOn farmaceutica para su uso segun la reivindicaciOn 69, en la que la composición comprende

edemasal menos un agente seleccionado de un agente contra la resorción Osea, un agente anabOlico dose°, un agente antiinflamatorio, un agente inmunosupresor y un agente de terapia contra el cancer.

73. ComposiciOn farmaceutica para su uso segun la reivindicaciOn 72, en la que el al menos un agente de terapia contra el cancer se selecciona de un inhibidor del receptor del factor de crecimiento epidermic° (EGFR) , un inhibidor de HER2, un inhibidor de vegF, un inhibidor del receptor de vegF, un inhibidor del factorde crecimiento de hepatocitos (HGF) /factor de dispersion (SF) , un inhibidor de c-Met, un inhibidor de angiopoyetina, un inhibidor de Tie2, un inhibidor del receptor del factor de crecimiento derivado de plaquetas (PDGFR) , un inhibidor del receptor del factor de crecimiento similar a insulina (IGFR) , un inhibidor

de glicoproteinas similares a mucina, un inhibidor de CDC20 y un inhibidor de CDC33.

74. Composición farmaceutica para su uso segun la reivindicacion 69, en la que la composición comprende

edemasal menos un agente terap6utico seleccionado de un factor morfogenetico 6seo, factor de crecimiento transformante f (TGF-13) , un inhibidor de interleucina-1 (IL-1) , IL-1ra, anakinra, un inhibidor de TNFa, un receptor de INFa soluble, etanercept, un anticuerpo anti-TNFa, infliximab, adalimumab, una prostaglandina, un bisfosfonato, alendronato, fluoruro, calcio, un tarmac° antiinflamatorio no esteroideo (AINE) , un inhibidor de COX-2, celecoxib, rofecoxib, un inmunosupresor, metotrexato, leflunomida, un

inhibidor de serina proteasa, un inhibidor de la proteasa de leucocitos secretores (SLPI) , un inhibidor de IL6, un anticuerpo frente a IL-6, un inhibidor de IL-8, un anticuerpo frente a IL-8, un inhibidor de IL-18, una proteina de uniOn a IL-18, un anticuerpo frente a IL-18, un modulador de la enzima convertidora de

interleucina-1 (ICE) , un factor de crecimiento de fibroblastos (FGF) , un modulador de FGF, un antagonista de PAF, un factor de crecimiento de queratinocitos (KGF) , una molecule relacionada con KGF, un

modulador de KGF; un modulador de metaloproteinasa de matriz (MMP) , un modulador de la Oxido nitric° sintasa (NOS) , un modulador del receptor de glucocorticoides, un modulador del receptor de glutamato, un modulador de los niveles de lipopolisacdridos (LPS) , una noradrenalina, un mimetic° de noradrenalina y un modulador de noradrenalina.

75. Composicion farmaceutica para su uso segun la reivindicaciOn 69, en la quo la perdida () sea esta asociada

conal menos un estado seleccionado de un estado inflamatorio, un estado autoinmunitario, artritis reumatoide y cancer.

76. Composicion farmaceutica para su uso segun la reivindicacion 69, en la quo la perdida osea esta asociada con cancer y la composicion comprende edemas al menos un agente terapeutico seleccionado de un inhibidor del receptor del factor de crecimiento epidermic° (EGFR) , un inhibidor de HER2, un inhibidor de

vegF, un inhibidor del receptor de vegF, un inhibidor del factor de crecimiento de hepatocitos (HGF) /factor de dispersión (SF) , un inhibidor de c-Met, un inhibidor de angiopoyetina, un inhibidor de Tie2, un inhibidor del receptor del factor de crecimiento derivado de plaquetas (PDGFR) , un inhibidor del receptor del factor de crecimiento similar a insulina (IGFR) , un inhibidor de glicoproteinas similares a mucina, un inhibidor de CDC20 y un inhibidor de CDC33.

77. Composición farmaceutica para su uso segun la reivindicaciOn 69, en la quo la perdida Osea esta asociada con cancer y en la que la composición comprende edemas al menos un anticuerpo seleccionado de un anticuerpo frente a Her2, un anticuerpo frente a CDC20, un anticuerpo frente a EGFR, un anticuerpo frente a vegF, un anticuerpo frente al receptor de vegF, un anticuerpo frente al factor de crecimiento de hepatocitos (HGF) /factor de dispersiOn (SF) , un anticuerpo frente al receptor del factor de crecimiento

similara insulina (IFGR) y un anticuerpo frente a CDC33.

78. Composicion farmaceutica para su uso segun la reivindicacion 69, en la quo la perdida ósea esta asociada con cancer y en la quo la composicion es para la administracion con al menos un agente de terapia contra el cancer seleccionado de radioterapia y quimioterapia.

FIGURA 1

ADNc de la cadena pesada de aRANKL-1 blen denominado a0PGL-1)

3. TOGAGT TTGGGACTGG CTGGCTTTTT CTA AAAAGG

TGT GAGGTGCAGC TGTTGGAGTC TGGGGGAGGC TTGGTACAGC GGGGGTC

121 CCTGAGACTC TCCTGTGCAG CCirdTGGATT CACCTTTAGC AGCTATGCCA TGAGCTGOGT

181 CCGCCAGGCT CCAGGGAAGG GGCTGGAGTG GGTCTCAGGT ATTACTGGGA GTGGTGGTAG

241 TACATACTAC GCAGACTCCG TGAAGGGCCG GTTCACCATC .TCCAGAGACA ATTCCAAGAA

301 CACGCTOTAT CTGCAAATGA ACAGCCTGAG AGCCGAGGAC ACGGCCGTAT ATTACTGTGC

361 GAAAGATCCA GGGACTACGG TGATTATGAG TTOGTTCGAC cccTcopocc AGGGAACCCT

421 GGTCACCGTC TCCTCAGCCT CCACCAAGGG CCCATCGOTC TTCCCCCTGG CGCCCTGCTC

481 CAGGAGCACC TCCGAGAGCA CAGCGOCCCT'GGGCTGCCTG GTCAAGGACT ACTTCCCCGA

541 ACCGOTOACG GTGTCGTGGA ACTCAGGCGC TCTGACCAGC GOCOTOCACA CCTTCCCAGC

601 TGTCCTACAG TCCTCAGGAC TCTACTCCCT , CAGCASCGTG GTGACCGTGC CCTCCAGCAA

661 CTTOGGCACC CAGACCTACA CCTGCAACGI: AGATCA.CAAG CCCAGCAACA CCAAGGTGGA

721 CAAGACAGTT GAGCGCAAAT'GTTGTGTCGA.GTGCCCACCG TGCCCAGCAC CACCTGTGGC

781 AGGACCGTCA GTCTTCCTCT TCCCCCCAAA ACCCAAGGAC ACCCTCATGA TCTCCCGOIAC

841 CCCTGAGGTC ACGTGCGTGG TGGTGGACGT GAGCCACGAA GACC6CGAGG TCCAGTTCAA

901 CTGOTACGTG GACOGCGTGG AGGT3CATAA TGCCAAGACA AAGCCACGGG AGGAGCAGTT

961 CAACAGCACG TTCCUTGTGG TCAGCGTCCT CACCGTTGTG CACCAGGACT GGCTGAACGG

1021 CAAGGAGTAC AAGTGCAAGG TCTCCAACAA AGGCCTCCCA GCCCCCATCG AGAAAACCAT 1081 CTCCAAAACC'AAAGGGCAGC CCCGAGAACC ACAGGTGTAC ACCCTGCCCC CATCCCOGGA 2141 GGAGATGACC AAGAACCAGG TCAGCCTGAC CTGCCTGGTC AAAGGCTTCT ACCCCAOCGA 1201 CATCGCCGTG .GAGTGGGA, GA GCAATGGGCA GCCGGAGAAC AAcTACAAOA CCACACCTCC 1261 CATGCTGGAC TCCGACl2GCT CCTTCTTCCT CTACAGCAAG CTCACCGTGG ACAAGAOCAO 1321 GaGGCAGCAG GGGAACGTCT TCTCATGCTC CGTGATGCAT GAGGCTCTGC ACAACCACTA 1381 CACGCAGAAGAacercricce TGTCTCCOGG TAAATGATAA OTCGAC (SEQ ID NO 1)

FIGURA 2

Secuencia de aminoacidos de la cadena pesada de aRANKL-1 (tamblen denominado a0PGL-1)

I MEFdliSWIAFL VAILROVQOE WALESGGGI, VOGGSLNI, CAASGFTFSS YAMSWVKAP , 61 GXGLE78GI TOSOGSTWA DsvioRms NDNSICNTINI, QNNSLRAEDT AVYYCAXDPG 121 TTVIMSWFDP NGOGTINTvs Sestkgpsvi plipcsrsts, estaalgclv kdyfpepvtv 181 zwnsgaltsg vhtípavlqa sglys?:ssvv tvyssnfgtq tytcnvdhkp sntkvdktve

241 rkocvecypo papvagpsv 'flfppkpkdt lmiertpevt cvvvdvshed pevqfnwyvd 301 gvevhnaktkpreeqfnatf rVvevltvVh cadvangkeyk ckvsnkglpa.piektisktk,

, 361 gqprepqvyt, ippereemtk nvqsltclvk gfypsdiave wesngqpenn ykttppmIds 421 dgsfflyskl tvdkerwqqg nvfsCsvmhe 'alhnhytqks: lielspgk (MQ ID NO: 2)

• F16\URA 3

ADNc de la cadena ligera kappa de aRANKL- (tambien denominado a0PGL-1)

TCTAGACCAC CATGGAAACC

ATACCACOGG AGAAATTGTG 221 AAAAGGCCAC.CCTCTCCTGT 181 ACCAGCAGAA ACCTGGCCAG 241 CTGGCATCCCAGACAGGTTC 301 GCAGACTGGA GCCTGAAGAT 361 GGACGTTCGG CCAAGGGACC 421 TCATCTTCCC GCCATCTGAT 481 TGAATAACTT CTATCCCAGA, 541 CGGGTAACTC CCAGGAGAGT 601 GCAGCACCCT GACGCTGAGC

TCACCCATCA aGGCCTGAGC 721 AAGTCGAC

CCAGCGCAGC TTGACGCAGT AGGaCCAGTC GCTCCCAGGC AGTGGCAGTG TTTGCAGTGt AAGGTGGAAA GAGCAGTTGA GAGGCCAAAG GTCACAGAGC AAAGCAGACT TCGCCCGTCA

TTCTCTTCCT CTCCAGGCAC AGAGTGTT66 TCCTCATCTA GGTCTaGGAC TTTACTGTCA TCAAACGAAC AATCTGGAAC TACAGTGGAA' AGGACAGCAA ACGAGAAACA CkAAGAGCTT

CCT3CTAC7C TGGCTCCCAG CCTGTCTTTG TCTCCAGGGG CGGCAGGTAC TTAGCCTGGT TGGTGCATCC AGCAGGGCCA AGACTTCACT CTCACCATCA GCAGTATGGT AOTTCACCTC TGTGGCTGCA CCATCTGTCT TGCCTCTGTT GTGTGCCTGC, GGTGGATAAC GCCCTCCAAT GGACAGCACC TACAGCCTCA 'CAAAGTCTAC GCCTGCGAAG CAACAGOGGA GAGTGTTGAT

(SE IDIkl (:0 '

FIGURA 4

Secuencia de aminoacidos de la cadena ligera kappa

de aRANKL-1 (tamblen denominado a0PGL-1)

METPAQLLFL LLIALPDTTG EIVLTQSPGT LSIaSiGERAT LSCRASQSVR

GRYLAWYQQK PGQAPRLL/Y GASSRATGIF DRFSGSGSGT DFTLTISRLE 101 PEDFAVFYCQ (AGSSPRTFG QGTKVEIKrt vaapsvfifp padeqlksgt 151 asvvclinnf ypreak;mwk vdnalqsgns gesvtegdsk dstyslsstl 201 tlskadyekh kvyacevthq glsspvtksf nrgec (SEQ ID NO: 4)

F GU

Mapa de plasmido circular de aRANKL-1-kappatpDSRal9 (tambien denominado a0PGL-1-kappa/pDSRa19)

'a0PGL-1

Xbal (4750

. Hirai (474

. -

Aceptor de 16s de SV40 EccR1 (351)

—PoliA de aFSH

• SV40 IVS

Banal (464 Ndd (883)

Dona or 16s, 19s de SV40 . Promotor de

DHFR

F1 -

Scat (119i)

pro/on de SV40 DHFR

Ecdt1 (3948)

Scal (3a35

Pv‘i (3325 NM (2028) ,

• Amp. pElF1322

FIGURA 6

apa de plasmido circular de aRANKL-1-IgG2/pDSRal9 (tambien denominado a0PGL-1-IgG2/pDSRa19)

Hindi (6167)

Sall (616 5) __Eat! (351) ctOpGL-1 1g02 —.PoHA de aFDH

lik1111 (474 ) .Promotor de Aceptor 16s de

DHFR

SV40 SV40 IVS Seal (1 195)

Barn (4641 DHFR -1-IgG2/pDSRari9 Donador 16s, 19s 6169 pb

de SV40 ° Belt (1739:

Hindi (4595) , , -- PoliA de DHFR

proton de SV40'

&cll.! 0948) Hinal (3496) _, Seal0435c" Pvtd (3325) / pf3R322 Amp

FIGURA 7 Secuencia de ADNc de synPTH

TCTAGACCAC CATGATCCCC GCCAAGGACA TGGCCAAGGT GATGATCGTG

ATGCTGGCCA TTTGTTTCCT GACCAAGAGC GATGGCAAGT CCGTGAAGAA 101 GAGATCCGTG AGCGAGATCC AGCTGATGCA CAACCTGGGC AAGCACCTGA 151 ACTCCATGGA GAGAGTGGAG TGGCTGCGCA AGAAGCTGCA GGACGTGCAC 201 AACTTCGGCG GCGC7CGCGCC C (S Q ID NO: 5)

r

FIGURA 8

Secuencla. de amlnoicidos de synPTH

M/PAKDMAKV M1VMLAICFL TKS .K RSVSEIQIMH NLGICHLNSME 51 RVEWLRKKLQ DVIINFGGGAP (SEQID NO: 6)

FIGURA 9

Secuencia de ADNc de synPTH-cadena ligera de aRANKL-1

1 GATGATCGTG• TCTAGACCAO CATGATCCCC GCC.AAGGACA TGGCCAAGGT

51 ATGCTGGCCA TTTGTTTCCT GACCAAGAGC GATGGCAAGT CCGTGAAGAA

101 GAGATCCGTG AGCGAGATCC AGCTGATGCA CAACCTGGGC AAGCACCTGA

151 ACTCCATGGA GAGAGTGGAG TGGCTGCGCA AGAAGCTGCA GGA.CGTGCAC

201 AACTTC GGCG GCGOCGCGCC CGAAATTGIV TTGACGCAGT CTCCAGGCAC

251 CCTGTCTTTG TCTCCAGGGG AAAGAGCCAC CCTCTCCTGT AGGGCCAGTC

301 AGAGTGTTCG CGGCAGGTAC TTAGCCTGGT ACCAGCAGAA ACCTGGCCAG

351 GCTCCCAGGC TCCTCATCTA TGGTGCATCC AGCAGGGCCA CTGGCATCCC

401 AGACAGGTTC AGTGGCAGTG GGTCTGGGAC AGACTTCACT CTCACCATCA

451 GCAGACTGGA GCCTGAAGAT TTTGCAGTGT TTTACTGTCA GCAGTATGGT

503. AGTTCACCTC GGACGTTCGG 'CCAAGGGACC AAGGTGGAAA TCMACGAAC

553. TGTGGCTGCA CCATCTGTCT TCATCTTCC6 GCCATCTGAT GAGCAGTTGA

601, AATCTGGAAC TGCCTCTGTT GTGTGCCTGC TGAATAACTT CTATCCCAGA

651 GAGGCCAAAG TACAGTGGAA GGTGGATAAC GCCCTCCAAT CGGGTAACTC

701 CCAGGAGAGT GTCACAGA. GC AGGACAGCAA GGACAGCACC TACAGCCTCA

753. GCAGCACCCT GACGCTGAGC AAAGCAGACT ACGAGAAACA CAAAGTCTAC

803. GCCTGCGAAG TCACCCATCA GGGCCTGAGC TCGCCCGTCA CAAAGAGCTT

851 CAACAGGGGA GAGTGTTGAG TCGAC SE () ID• NO: 7)

- FIGURA10 Secuencia de aminoacidos de synPTH-cadena Nora de aRANKLA

MIPAKDMAKV MIVMLA CFI; TKSDGKSVKK RSVSEIQLMH NLGKHLNSME Si. DVIINFGGGAPRVEWLRKKLQ EIVLTQSPGT LSLSPGERAT LSCRASQSVR .101 PGQAPRLLIYGASSRATGIP DRFSGSGSGT DFTLTISRLE

GRYLAWYWK 151 QYGSSPRTFGPEDFAVPYCO QGTKVEIKRT VAAPSVFIFP PSDEQLKSGT 201 YPREAKVQWKASVVCLLNNF VDNALQSGNS QESVTEQDSK DSTYSLSSTL 251 KVYACEVTHQTLSKADYEKH GLSSPVTKSF NRGEC (SEQ ID NO: 8)

•,

FIGURA 11 Secuencla de A Nc de synPTH-cadena pesada de aRANKL-1

101 GAGATCCGTG

151, ACTCCATGGA

201 AACTTCGGCG

251, CTTGGTACAG

301 TCACCTTTAG

GGGCTGGAGT

401 CGCAGACTCC'

451 ACACGCTGTA

501 TATTACTOTO

551 CCCCTGGOGC

601 GCCCATCGOT

651 ACAGCGGCCC

701 GGTGTCGTGG

751 CTGTCCTACA

001 CCCTCCAGCA

851 GCCCAGCAAC

901 AGTGCCCACC

954 TTCCCCCCAA

1001 CACGTGCGTG

1051 ACTGGTACGT

1101 GAGGAGCAGT

1151 GCACCAGGAC 1201 AAGGCCTCCC 1251 CCCCGAGAAC 1301 CAAGAACCAG 1351 ACATCOCCOT

1401. ACCACACCTC

1451 GCTCACCGTG

1501 CCGTGATGCA

1551 CTGTCTCCGG

AOCGAGATCC GAGARTGGAG GCOCCGC'OCC CCTGGGGGGT CAGCTATGCC GGGTCTCAGG OTGAAGGGCC TCTGCAAATG CGAAAGATCC CAGGGAACCC CTTCCCCCTO TGGGCTGCCT AACTCAGGCG GTCCTCAGGA ACTTCGGC4C ACCAAGGTGG GTGCCCAGCA AACCCAAGGA GTGGTGGACG GOACGGCGTO TCAACAGCAC TGGCTGAACG AaCCCCCATC CACAGOTGTA GTCAGCCTGA OGAGTGGGAG CCATOCTGGA GACAAGACGA TGAGGCTCTG

AAATGAGT

AGCTGATGCA TGGCTGCGCA CGAGGTGCAG CCCTGAGACT ATGAGCTGGG TATTACTGGG OGTTCACCAT

AACAGCCTGA AGGGACTACG TGGTCACCGT

GCGCCCTGCT GGTCAAGGAC- CTCTGACCAG CTCTACTCCC CCAGACCTAC AdmGACAGT CCACCTGTGG CACCCTCATG TGAGCCACGA GAGGTGCATA GTTCCGTGTG GCAAGGAGTA GAGAAAACCA CACCCTGCCC CCTGCCTGGT AGCAATGGGC CTCCGACGGC GOTOGCAOCA CACAACCACT CGAC

CAACCTGGGC AGAAGCTGCA CTOTTOGAGT CTCCTGTGCA TCCOCCACA3C AGTGGTGGTA CTCCAGAGAC GAGCCGAGGA GTGATTATGA CTCCTCAGCC CCAGGAGCAC TACTTCCCCG CGGCGTGCAC TCAGCAGCGT ACCTGCAACG TGAGCGCAAA CAGGACCGTC ATCTCCCGGA AGACCCCGAG ATGCCAAGAC GTCAGCGTCC CAAGTGCAAG TCTCCAAAAC CCATCCCGCG CAAAGGC, TTC AGCCGGAGAA TCCITCTTCC GOGGAACGTC ACACGCAGAA

AAGCACCTGA

GGACGTGCAC

CTOCOGGAG9

GCCTCTGGAT

TCCAGGGAAG

GTACATACTA

AATTCCAAGA

CACGGCCGTA GTTGGTTCGA , TCCACCAAGG CTCCGAGAGC AACCGGTGAC ACCTTCCCAG GGTGACCGTG

TAGATCACAA

TerTGTOTCG

AGTCTTCCTC

CCCCTGAGGT

GTCCAGTTCA

AAAGCCACGO

TCACCGTTOT

GTCTCCAACA

CANAGGOCAG

AGGAGATGAC

TACCCCAGCG

CAACTACAAG

TCTACAGCAA

tIrTexirce?

GAGCCTCTCC

.84) ID NO: 9)

FIGURAl2 Secuencia de aminoacidos de synPTH-cadena pesada de aRANKL-1

MIPAKDMAKV 51 RVEWLRKKLQ 01 EYAMSWVRQA 151 LQMNSLRAED

201. , FPLApCSRST 251 SSGLYSLSSV 301 CPAPPVAGPS 351 DVEVHNAXT 401 APIEKTISKT1 451 EWESNGQPEN, 501 EALHNHYTQK

MIVELAICFL DVHNFGGGAP PGKGLEWVSG "TAVYYCAKDP SESTAGALCL VTVPSSNFGT VFLFPPKPKD KPREEQFNST KGQPREPQVY VYKTTPPMLD

SLSLSP6K'

TKSDGKSVKK EVQLLESGGG ITGSGGSTYY GTTVIMSWFD' VKDYFPEPVT QTYTCNVDHK TLNISRTPEV FRVVSVLTVV TLPPSREEMT SDGSFFLYSK

RSVSEIOLMH NLGICHLNSME LVQPGGSLRL SCAASGFTFS ADSVKGRFTI SRDNSKNTLY PWGQGTLVTV SSASTKGPSV VSWNSGALTS GVHTFPAVLQ PSNTKVDK VT'ERKCCVECPP TCVVVDVSHE DPEVQFNWYV HQDWLNGKEY KCKVSNKGLP KNQVSLTCLV KGFYPSDIAV

LTVDKSRWQQ GNVFSCSVMH. (SEQ ID NO 10)

FIGURA 13 Mapa de plasmido circular de synPTH-ccRANKL-1-kappa/pDSRa20

Sal 69 anti RANKL-1 ka &still (4963

PoIIAdeaFSH

synPTH Xbat4750

Ace deSV40 40 WS motor de DHFR

Donador 168, 1 V40

synPTH-anti RANKL-1 kappa pro/onl de SV40 5623 pb

FIGURA14

Mapa de plasmido circular de synPTH-allANKL-1-IgG2/pDSRa20

So, I (6318

PollA de aFSH

anti FIANKIel IgG2

Er4) 5 ( (53 de DHFR

BUM (4

0-4

synPTH Xbal (.4750

synPTH-anti RANKL-1 IgG2

ArAptor les de Sv40

6323Pb

SV40 IVS Donador les, 191 de SV40 PoflAds DHFR

toiatsso>

Putt! (3325) peR322 Amp

NO CO u) a to a to CD get 10 itt 'V' CI C'si (NI

v: qe: 41:

( mum) opezpo! oppo

1111/111111M1111111111111 flhlIIlHllllflhiHJAIJ 11111111111 I.

11111111111111111111111111I11111111111111

Min 11111111M1M111111111111.11HIMI

111111H11111111117.11111111 1111111111111111111, 11

n P—EZCZW= I-E=ST0

ttVX???.?ett

- 1, E. 1 t4

N El

i 4 i11111111111111111111 0 E

iz 1---= -5-` C ‘, 0

////./ r/1/4/14 14:it

rt* 44.4 ■ '!.tr" ot-' 14, E

I

0 r.!1 .—0

1Z pJ •--INEEMEZIE

30 S It!CO it) 0 110 0 3l) 0 it) CI

IS: ck! csi ct co) ce) N N N