Procedimiento de integración localizada de múltiples copias de un gen de interés en una cepa de Yarrowia.

Procedimiento de integración localizada de por lo menos tres copias de un gen de interés en el genoma de una cepa de Yarrowia que comprende las etapas de:

a) puesta en cultivo de una cepa de Yarrowia que comprende por lo menos tres deleciones seleccionadas de entre Ura3-302

, Leu2-270, Gut2-744 y Ade2-844, correspondiendo el fenotipo asociado a cada una de estas deleciones a una auxotrofia para dicha cepa, independientemente el uno del otro de estos por lo menos tres genes;

b) transformación de dicha cepa de Yarrowia auxótrofa con por lo menos tres vectores recombinantes que comprenden unos marcadores de selección que permiten, para dicha cepa de Yarrowia, la complementación de la auxotrofia resultante de cada una de dichas deleciones, comprendiendo dichos vectores recombinantes cada uno:

i) la secuencia de dicho gen de interés,

ii) un marcador de selección, y

iii) dos secuencias de ADN que enmarcan la secuencia de dicho gen de interés y dicho marcador de selección, siendo dichas secuencias de ADN homólogas a las secuencias que corresponden a los extremos del sitio de integración localizado en el genoma de dicha cepa de Yarrowia de manera que se permita la integración localizada de dicho vector recombinante por recombinación homóloga;

selección sobre un medio mínimo, de las levaduras que han integrado dichos por lo menos tres vectores recombinantes.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2009/051332.

Solicitante: INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE.

Nacionalidad solicitante: Francia.

Dirección: 147 Rue de l'Université 75007 Paris FRANCIA.

Inventor/es: NICAUD, JEAN-MARC, FUDALEJ,FRANCK, NEUVEGLISE,CÉCILE, BECKERICH,JEAN-MARIE.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/81 (para levaduras)
google+ twitter facebookPin it
Ilustración 1 de Procedimiento de integración localizada de múltiples copias de un gen de interés en una cepa de Yarrowia.
Ilustración 2 de Procedimiento de integración localizada de múltiples copias de un gen de interés en una cepa de Yarrowia.
Ilustración 3 de Procedimiento de integración localizada de múltiples copias de un gen de interés en una cepa de Yarrowia.
Ilustración 4 de Procedimiento de integración localizada de múltiples copias de un gen de interés en una cepa de Yarrowia.
Ver la galería de la patente con 8 ilustraciones.
Procedimiento de integración localizada de múltiples copias de un gen de interés en una cepa de Yarrowia.

Texto extraído del PDF original:

DESCRIPCIÓN

Procedimiento de integración localizada de múltiples copias de un gen de interés en una cepa de Yarrowia.

La presente invención se refiere a un procedimiento de integración localizada de por lo menos tres copias de un gen de interés en el genoma de una cepa de Yarrowia que comprende las etapas de (a) poner en cultivo una cepa de Yarrowia, comprendiendo dicha cepa una deleción de entre por lo menos tres deleciones seleccionadas de entre Ura 3-302, Leu 2-270, Gut 2-744 y Ade 2-844, correspondiendo el fenotipo asociado a cada una de estas deleciones a una auxotrofia para dicha cepa, independientemente el uno del otro de los por lo menos tres genes; (b) transformación de dicha cepa de Yarrowia así obtenida con por lo menos tres vectores recombinantes que comprenden unos marcadores de selección que permiten, para dicha cepa de Yarrowia, la complementación de la auxotrofia resultante de cada una de dichas deleciones; y (c) selección sobre un medio mínimo, de las levaduras que han integrado dichos por lo menos tres vectores recombinantes. La presente invención comprende también un procedimiento de producción de polipéptido de interés que utiliza un procedimiento de este tipo así como un procedimiento de obtención de cepa de Yarrowia modificada que comprende una deleción de entre por lo menos tres genes, correspondiendo el fenotipo asociado a cada una de estas deleciones a una auxotrofia o a un carácter dominante para dicha cepa. La levadura Yarrowia lipolytica se emplea cada vez más en la actualidad como huésped de expresión de genes de interés. Esta levadura presenta, en efecto, la especificidad de producir y segregar con una gran eficacia en el medio de cultivo unas proteínas de alto peso molecular, como las proteasas alcalinas, las proteasas ácidas o la ARNasa, pudiendo dichas proteínas entonces ser fácilmente recuperadas a partir del medio de cultivo. Para permitir la expresión de estos genes de interés, se han desarrollado precozmente diferentes tecnologías como las descritas en particular en la patente EP 0 138 508 B1 o EP 0 220 864 B1. Estas diferentes tecnologías tienen en común utilizar unos vectores denominados "integrativos" que permiten la inserción de un segmento de ADN que lleva el gen de interés en el ADN cromosómico, expresándose a continuación dicho gen de interés. Por tanto, ninguna de estas tecnologías ha podido satisfacer completamente los imperativos de la producción industrial, a saber un rendimiento y una estabilidad en el tiempo importantes. Para satisfacer mejor estos imperativos industriales, se han desarrollado nuevas tecnologías.

Así, la solicitud PCT WO 00/12729 describe una tecnología que utiliza unos vectores integrativos que comprenden una secuencia de interés flanqueada de secuencias zeta que corresponden a los LTR del retrotransposón Ylt1 de Yarrowia lipolytica. Estos vectores integrativos, cuando se utilizan en cepas de Yarrowia lipolytica desprovistas de secuencia zeta, permiten unas integraciones de múltiples copias y aleatorias en el genoma de dichas cepas. Esta tecnología particular se ha utilizado particularmente para la producción de la lipasa extracelular resistente a los ácidos LIP2 (véase la solicitud PCT WO 01/83773). Sin embargo, pareció que las cepas de Yarrowia lipolytica transformadas por LIP2 presentaban para la mayoría de ellas una estabilidad genética mediocre, generalmente inferior al 50%. Además, siendo estas cepas transformadas obtenidas tras eventos de integración aleatorios, el seguimiento de la estabilidad genética de las cepas por secuenciación de los sitios de inserción es extremadamente fastidioso. A estos problemas de estabilidad de las cepas obtenidas y de dificultad de identificar el sitio de integración preciso de la secuencia exógena se añaden unas dificultades complementarias asociadas a la ausencia de cepas de

Yarrowia lipolytica deficientes para múltiples marcadores de selección debido a la inestabilidad de estas cepas. Entre los métodos de integración de casetes de expresión, se pueden citar los que utilizan los métodos de transformación homóloga, pero estos últimos utilizan poco marcador (LEU2, URA3, LYS5) y pocas cepas multimarcadas y con unas deleciones que permiten una fuerte disminución de los porcentajes de conversión. Las cepas tienen frecuentemente unos marcadores genómicos que corresponden a unas mutaciones y poco marcador que corresponde a las deleciones. Los únicos marcadores genómicos conocidos con unas deleciones son: ura3-302 (deleción de 695 pb), ura3-41 (deleción de 41 pb), leu2-270 (deleción StuI de 681 pb). MADZAK et al. (J. of Biotech., vol. 109, p:63-81, 2004) describe así los marcadores ura3-302 y leu2-270.

Entre los vectores se pueden citar los que permiten una integración localizada, pero integrando la parte plasmídica (es decir, integración de los plásmidos a una plataforma pbR322 Madzak et al, Fems yeast research, vol. 5, p: 635- 646, 2005) o zeta (Bordes et al., J Microbiol Methods Vol. 70, p. 493-502, 2007). Existen unos vectores de autoclonación para la integración y la amplificación. Pero son dispersos y aleatorios.

Para la producción de proteína terapéutica, no es necesario ADN plasmídico y se necesita una integración localizada para identificar la inserción y verificar su secuencia. Se necesita también poder aumentar el número de copias del gen para aumentar la expresión. Los inventores han concebido un método que permite una integración localizada gracias a unos "vectores de integración" que se han construido para liberar el casete de integración (sitio raro 1) y eliminar la parte vector, que tiene unos sitios raros para introducir los marcadores de selección rápidamente (sitio raro 2) y para clonar los casetes de expresión (sitio raro 3). Unas combinaciones de vectores de integración con diferente combinación de locus/marcador. Los inventores también: - han optimizado unas condiciones de transformación para aumentar las tasas de transformación, en particular para los marcadores ADE2 y GUT2; y - han realizado la asociación de la integración y de un fenotipo para identificar rápidamente los clones interesantes que han integrado en el locus deseado los casetes de integración.

Así, los inventores han realizado en la presente memoria un método de integración de un casete de expresión en un locus que permite introducir al mismo tiempo un nuevo marcador de selección (por ejemplo, nuevo marcador genómico, nueva auxotrofia) para permitir una nueva integración con un nuevo casete de integración que posee el marcador de selección correspondiente. Debido a la posibilidad de buena eficacia de transformación, de bajas tasas de conversión, de cribado de identificación de las inserciones (lipasa para LIP2, marrón para ADE2, SUC- para URA3), es posible realizar así la cointegración (transformar con dos casetes de integración). Esto permite disminuir el tiempo necesario para la obtención de la cepa de producción. Asimismo, la inserción en sitios definidos permite una caracterización rápida de las cepas de producción, siendo la cepa final protótrofa. La cepa final ya no expresa las proteínas principales segregadas (proteasa AEP, lipasa Lip2p), presenta unas deleciones estables, una baja lisis celular y un sobrenadante limpio (pocas proteínas segregadas).

Los inventores han puesto en evidencia también la posibilidad de obtener con estos marcadores escindibles, permitiendo la escisión general de los marcadores regenerar los marcadores y así poder integrar de nuevo nuevas copias.

Para la obtención de cepas multi-marcadas, se puede introducir un marcador genómico mediante diferentes métodos. Por ejemplo, el método denominado POP IN/POP OUT utilizado en Yarrowia lipolytica para la construcción de los marcadores leu2-270, ura3-302 y xpr2-322 descritos en la revista de G. Barth et al.: Yarrowia lipolytica. En: Nonconventional Yeasts in Biotechnology A Handbook (Wolf, K., Ed.), Vol. 1, 1996, pp. 313-388. Springer-Verlag. Consiste en integrar un vector que posee una deleción del gen en el locus y después en seleccionar la escisión de este vector e identificar un clon que, por recombinación, ha eliminado el gen salvaje y conservado el gen mutado. Es un método largo, poco eficaz y que necesita también la utilización de un marcador que permita una contra-selección. Por ejemplo, la contra-selección de los clones Ura+ con 5FOA. Esta contra-selección puede introducir unas mutaciones secundarias. Se puede utilizar asimismo el método SEP (Maftahi M., Nicaud J-M., Gaillardin C. ,1996. Sticky-end polymerase chain reaction method for systematic gene disruption in Saccharomyces cerevisiae. Yeast, vol. 12, p. 859-868) que se adaptó en Yarrowia lipolytica para la interrupción sucesiva de los genes POX (Wang H. J., Le Dall M-T, Waché Y, Belin J-M, Gaillardin C, Nicaud J-M ,1999. Evaluation of Acyl CoA oxidase (Aox) isozymes function in the n-alkanes- assimilating yeast Yarrowia lipolytica. J. Bacteriol., vol. 181, p. 5140-5148). Este método es más rápido, pero necesita todavía la utilización de un marcador que permita una contra-selección. Se puede utilizar asimismo el método SEP/cre desarrollado por Fickers et al. (Fickers P., Le Dall M.T., Gaillardin C.

Thonart P. Nicaud J-M., New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica. J. Microbiol. Methods vol. 55, p. 727-737, 2003). Es un método rápido y que no necesita la utilización de un marcador que permita una contra-selección. Este método consiste en 1) seleccionar el gen de interés que se quiere eliminar, 2) construir un casete de interrupción por PCR ("Polymerase Chain Reaction") o por clonación, 3) introducir un marcador de selección que contenga a uno y otro lado una secuencia de recombinación (ventajosamente una secuencia loxP o loxR o derivada) que permita una recombinación entre sí para la eliminación del marcador (ventajosamente una secuencia de tipo loxP que permita la recombinación bajo la acción de la recombinasa cre), 4) seleccionar las cepas con el gen de interés delecionado (transformación y selección de los transformantes) y verificar la interrupción, 5) transformar con un vector que permita la expresión de la recombinasa (ventajosamente la recombinasa cre que permita la recombinación de las secuencias loxP/loxR y la eliminación del marcador), 6) el aislamiento de un clon que presente la deleción del gen de interés y que haya perdido el plásmido de expresión de la recombinasa. Pero se necesita optimizar las deleciones y los marcadores con el fin de minimizar las conversiones génicas durante la transformación. De lo anterior se desprende que no existen tecnologías de transformación que permitan integrar, de manera localizada y estable en el genoma de Yarrowia lipolytica, la secuencia de un gen de interés con el fin de obtener una expresión importante de éste.

Los inventores han puesto en evidencia ahora que la estabilidad de las cepas de Yarrowia obtenidas por transformación dependía en gran medida del número de copias integradas. Así, una cepa que presenta 8 copias integradas del gen LIP2 presenta el 70% de estabilidad, elevándose dicha estabilidad al 98% para 7 copias y al 100% para 6 copias. Asimismo, los inventores han conseguido desarrollar nuevas cepas viables de Yarrowia lipolytica que presentan una auxotrofia y, llegado el caso, un carácter dominante asociado a por lo menos tres marcadores de selección distintos, en particular seleccionados de entre los marcadores de selección Ura3, Leu2, Gut2 y Ade2. Las cepas desarrolladas y viables presentan además amplias deleciones (Ura3-302, Leu2-270, Gut2-744 y Ade2-884), en particular con las nuevas deleciones Gut2-744 y Ade2-844, permitiendo dichas deleciones limitar considerablemente la frecuencia de conversión génica (véanse los ejemplos). La utilización de unas cepas de este tipo en procedimientos de integración, en particular localizada, permite obtener mucho más rápida y simplemente unas cepas transformadas que comprendan múltiples integraciones de un gen de interés. Finalmente, los inventores han podido desarrollar un nuevo procedimiento de transformación de cepas de Yarrowia lipolytica que permite obtener unas cepas transformadas estables y que presentan un nivel interesante de producción de un polipéptido de interés. Objetivo de la invención El objetivo de la invención es remediar los inconvenientes de la técnica anterior y obtener rápidamente unas cepas sobreproductoras de un gen o de genes de interés para la producción de proteínas heterólogas y poder rápidamente verificar los casetes de expresión y caracterizar la cepa de producción. Se utilizan como microorganismos unas cepas que poseen unos marcadores de selección que permiten un nivel bajo de conversión y una gran eficacia de transformación.

Se utiliza un conjunto de vectores que permite la construcción de vectores que contengan los casetes de expresión y de vectores que contengan los casetes de integración. Se utilizan asimismo unos métodos rápidos de identificación de los transformantes que contienen la integración de los casetes de integración en los locus definidos. Finalmente, el método según la invención permite la producción de una proteína heteróloga. De manera más detallada, la invención propone un conjunto de cepas, de vectores, de marcadores de selección, de ensayos de fenotipo y de caracterización de la inserción de los casetes de inserción para la obtención rápida de las cepas sobreproductoras de un gen o de genes de interés para la producción de proteínas heterólogas, y poder verificar rápidamente los casetes de expresión y caracterizar la cepa de producción que comprende: (a) unas cepas receptoras que contienen unas deleciones de genes que confieren una auxotrofia o un defecto de crecimiento en algunos medios; (b) un conjunto de vectores de clonación que permiten la construcción de "vectores de expresión" que contienen los casetes de expresión; y un conjunto de "vectores de integración" que permite la construcción de vectores de integración; (c) unos métodos de obtención de los transformantes, de identificación de los transformantes que contienen la integración de los casetes de integración en el locus definido; y (d) un método de producción de la proteína heteróloga.

En consecuencia, un primer objeto de la invención se refiere a un procedimiento de integración localizada de por lo menos tres copias de un gen de interés en el genoma de una cepa de Yarrowia que comprende las etapas de: a) puesta en cultivo de una cepa de Yarrowia que comprende por lo menos tres deleciones seleccionadas de entre Ura3-302, Leu2-270, Gut2-744 y Ade2-844, correspondiendo el fenotipo asociado a cada una de estas deleciones a una auxotrofia para dicha cepa, independientemente el uno del otro de estos por lo menos tres genes; b) transformación de dicha cepa de Yarrowia auxótrofa con por lo menos tres vectores recombinantes que comprenden unos marcadores de selección que permiten, para dicha cepa de Yarrowia la complementación de la auxotrofia resultante de cada una de dichas deleciones, comprendiendo dichos vectores recombinantes cada uno: i) la secuencia de dicho gen de interés, ii) un marcador de selección, y iii) dos secuencias de ADN que enmarcan la secuencia de dicho gen de interés y dicho marcador de selección, siendo dichas secuencias de ADN homólogas a las secuencias que corresponden a los extremos del sitio de integración localizado en el genoma de dicha cepa de Yarrowia de manera que permitan la integración localizada de dicho vector recombinante por recombinación homóloga; selección sobre un medio mínimo, de las levaduras que han integrado dichos por lo menos tres vectores recombinantes.

Se describe también un procedimiento de integración localizada y se caracteriza por que los genes que presentan una deleción asociada a un fenotipo de auxotrofia o de carácter dominante se seleccionan: - para los marcadores de auxotrofia, de entre los genes URA2, LEU2, GUT2, ADE2, HIS y LYS5; y - para los caracteres dominantes, de entre el gen del resistencia a la higromicina HYG4, y los genes MDR3, KanMX, HPH y Tn5ble.

En un modo de realización preferido, dicha cepa comprende además por lo menos una deleción de un gen asociado a un carácter dominante seleccionado de entre el gen de resistencia a la higromicina HPH (HYG), y los genes MDR3, KanMX, y Tn5ble, siendo el más preferido el gen HYG. En un modo de realización preferido, la etapa b), el sitio de integración localizado en el genoma de dicha cepa de Yarrowia se selecciona de entre los genes URA3, LEU2, ADE2, LIP2, LIP7, LIP8, AXP, GUT2 y XPR2.

Ventajosamente, la deleción URA3 corresponde a la deleción Ura3-302 bien conocida por el experto en la materia y descrita en particular en MADZAK et al. (2004). Ventajosamente, la deleción LEU2 corresponde a la deleción Leu2-270 también bien conocida por el experto en la materia y descrita en particular en MADZAK et al. (2004).

Ventajosamente, la deleción GUT2 corresponde a la deleción Gut2-744 descrita en los ejemplos. Gut2-744 corresponde a una deleción completa de ORF del gen GUT2 (SEC ID nº 4), estando dicha deleción presente en las cepas mutantes FF-Lug (CNCM-3911) y FF-luga (CNCM-3913). Después de la escisión, en el genoma de Yarrowia, entre las secuencias promotoras y terminadoras de GUT2, permanece la secuencia SEC ID nº 11.

Ventajosamente, la deleción ADE2 corresponde a la deleción Ade2-844 descrita en los ejemplos. Ade2-844 corresponde a una deleción completa de ORF del gen ADE2 (SEC ID nº 3), estando dicha deleción presente en las cepas FF-Lua (CNCM-3912) y FF-luga (CNCM-3913). Después de la escisión, en el genoma de Yarrowia, entre las secuencias promotoras y terminadoras de ADE2, permanece la secuencia SEC ID nº 12.

Por medio mínimo, se entiende en la presente memoria un medio que no comprende los elementos para los cuales la cepa de Yarrowia es auxótrofa, o que permite, llegado el caso, la selección de la cepa. Unas cepas de Yarrowia son bien conocidas por el experto en la materia. A título de ejemplo preferido de dichas cepas, se pueden citar las cepas de Yarrowia lipolytica. La técnica de transformación de una levadura por integración localizada de un gen es una técnica de biología molecular utilizada frecuentemente. En esta técnica, un fragmento de ADN se clona en un vector, se introduce en la célula a transformar, integrándose entonces dicho fragmento de ADN por recombinación homóloga en una región específica del genoma receptor (ORR-WEAVER et al., Proc. Natl. Acad. Sci. USA, vol. 78, p. 6354-6358, 1981). Dichos procedimientos de transformación son bien conocidos por el experto en la materia y están descritos en particular en ITO et al. (J. Bacteriol., vol. 153, p. 163-168, 1983) en KLEBE et al. (Gene, vol. 25, p. 333-341, 1983) y en GYSLER et al. (Biotechn. Techn., vol. 4, p. 285-290, 1990). En la medida en la que este evento de recombinación es raro, se insertan unos marcadores de selección entre las secuencias que aseguran la recombinación con el fin de permitir, después de la transformación, aislar las células en las que se ha producido la integración del fragmento mediante la puesta en evidencia de los marcadores correspondientes. Los marcadores de selección que permiten la complementación de una auxotrofia, también denominados comúnmente marcadores de auxotrofia, son bien conocidos por el experto en la materia.

El marcador de selección URA3 es bien conocido por el experto en la materia. Más específicamente, una cepa de

Yarrowia cuyo gen URA3 (SEC ID nº 1 para Yarrowia lipolytica, dicha secuencia es también accesible por el número de acceso Yali0E26719g en la dirección «http://cbi.labri.fr/Genolevures/index.php#»), que codifica para la orotidina- 5'-fosfato descarboxilasa, está inactivado (por ejemplo por deleción), no será capaz de crecer en un medio no suplementado con uracilo. La integración del marcador de selección URA3 en esta cepa de Yarrowia permitirá entonces restaurar el crecimiento de esta cepa sobre un medio desprovisto de uracilo. El marcador de selección LEU2 descrito en particular en la patente US nº 4.937.189 es también bien conocido por el experto en la materia. Más específicamente, una cepa de Yarrowia cuyo gen LEU2 (Yali0E26719g; SEC ID nº 2 para Yarrowia lipolytica), que codifica para la β-isopropilmalato deshidrogenasa, está inactivado (por ejemplo por deleción), no será capaz de crecer en un medio no suplementado con leucina. Como anteriormente, la integración del marcador de selección LEU2 en esta cepa de Yarrowia permitirá entonces restaurar el crecimiento de esta cepa en un medio no suplementado con leucina. El marcador de selección ADE2 es también bien conocido por el experto en la materia en el campo de la transformación de la levadura. Una cepa de Yarrowia cuyo gen ADE2 (SEC ID nº 3 para Yarrowia lipolytica, YALI0B23188g), que codifica para la fosforibosilaminoimidazol carboxilasa, está inactivado (por ejemplo por deleción), no será capaz de crecer en un medio no suplementado con adenina. De nuevo, la integración del marcador de selección ADE2 en esta cepa de Yarrowia permitirá entonces restaurar el crecimiento de esta cepa en un medio no suplementado con adenina.

El gen GUT2 codifica para la glicerol-3-fosfato deshidrogenasa (SEC ID nº 4, para Yarrowia lipolytica, YALI0B13970g) y su inactivación (por ejemplo por deleción) conlleva la incapacidad para el mutante resultante de crecer en un medio no fermentable cuya fuente de carbono corresponde a glicerol.

Entre los genes de resistencia que podrán ser utilizados como marcadores de selección para conferir a la cepa Yarrowia un fenotipo que presenta un carácter dominante, se pueden citar: - El gen MDR3 originario del ratón que codifica para la P-glicoproteína y, cuando está expresado en una cepa de Yarrowia, confiere una resistencia al FK520 (agente antifúngico e inmunosupresor; RAYMOND et al., Mol.

Cell. Biol., vol. 14, p. 277-286, 1994).

- El módulo KanMX, que contiene la secuencia kanr procedente del transposón Tn903 de Escherichia coli

fusionada a las secuencias transcripcionales del gen TEF del hongo filamentoso Ashbya gossypi , o a cualquier promotor o terminador de transcripción funcionales, confiere a una cepa de Yarrowia la resistencia a la geneticina (G418; WACH et al., Yeast, vol. 10, p. 1793-1808, 1994).

- El gen HPH (HYG), originario de un plásmido de Escherichia coli, permite la resistencia a la higromicina B (GRITZ & DAVIES, Yeast, vol. 8, p. 667-668, 1992; CORDERO OTERO & GAILLAIRDIN, Applied Microbiol and Biotechnologie, vol. 46, p. 143-148, 2004).

- El gen Tn5ble, procedente de Escherichia coli, permite que la levadura transformada adquiera una resistencia a la fleomicina (WENZEL et al., Yeast, vol. 8, p. 667-668, 1992).

Otros marcadores que se pueden utilizar en el procedimiento según la invención están también descritos por BARTH & GAILLARDIN (The dimoorphic fungus Yarrowia lipolytica. En: Non conventional yeasts in biotechnology (Wolf K. Ed.). Springer-Verlag, Berlin, p. 313-388, 1996). En un modo de realización también preferido, el procedimiento de integración localizada según la invención se caracteriza por que en la etapa b), el sitio de integración localizado en el genoma de dicha cepa de Yarrowia se selecciona de entre los genes URA3, LEU2, ADE2, LIP2, LIP7, LIP8, AXP, GUT2 y XPR2. Preferentemente, el procedimiento de integración localizada se caracteriza por que en la etapa b), el sitio de integración en el genoma de dicha cepa de Yarrowia se selecciona de entre los genes cuya ruptura confiere un fenotipo fácilmente detectable (visualizable, medible), en particular de entre los genes URA3, ADE2, LIP2, LIP8, AXP. Así, según un modo de realización preferido, en la etapa b), el sitio de integración localizada en el genoma de dicha cepa de Yarrowia se selecciona de entre los genes URA3, LEU2, ADE2, LIP2, LIP8 y AXP.

El gen LIP2 (SEC ID nº 5 para Yarrowia lipolytica) se puede utilizar como locus de inserción. El gen LIP2 que codifica para una lipasa extracelular (PIGNEDE et al., J. Bacteriol., vol. 182(10), p. 2802-10, 2000) que hidroliza preferentemente los triglicéridos de cadena larga de los restos oleicos. Una cepa de Yarrowia cuyo gen LIP2 está inactivado (por ejemplo por deleción), presentará una actividad lipasa reducida (baja actividad lipasa extracelular, bajo halo de hidrólisis sobre placa de Petri de la tributirina).

El gen LIP8 (SEC ID nº 6 para Yarrowia lipolytica) se puede utilizar como locus de inserción. El gen LIP8 codifica para una triacilglicerol hidrolasa. Una cepa de Yarrowia cuyo gen LIP8 está inactivado (después de inactivar LIP2) no presentará ningún halo de hidrólisis de la tributirina sobre placa YNBT y ninguna actividad lipasa (FICKERS et al., Fungal Genetics and Biology, vol. 42, p. 264-274, 2005).

El gen AXP (SEC ID nº 7 para Yarrowia lipolytica) se puede utilizar como locus de inserción. El gen AXP codifica para una proteasa ácida extracelular normalmente expresada cuando el pH del medio es inferior 4. Una cepa de Yarrowia cuyo gen AXP está inactivado (por ejemplo por deleción), presentará sobre placa YNBcaseína a pH ácido un halo de hidrólisis de la caseína disminuido y una actividad proteasa disminuida (GLOVER et al., Microbiology, vol. 143, p. 3045-54, 1997).

El gen XPR2 codifica para una proteasa alcalina extracelular expresada cuando el pH del medio es superior a 6. Una cepa de Yarrowia cuyo gen XPR2 (SEC ID nº 8 para Yarrowia lipolytica) está inactivado (por ejemplo por deleción), presentará en placa YNBcaseína a pH6 un halo de hidrólisis de la caseína disminuido y una actividad proteasa disminuida (DAVIDOW et al., J. Bacteriol., vol. 169, p. 4621-9, 1987).

A título de ejemplo, se puede citar la cepa de Yarrowia lipolytica depositada el 4 de febrero de 2008 de acuerdo con el tratado de Budapest en la Collection nationale de Culture de Microorganismes (CNCM), INSTITUT PASTEUR, 25 rue du Docteur Roux, 75724 PARIS CEDEX 15, Francia bajo el número CNCM-3912.

A título de ejemplo, se puede citar la cepa de Yarrowia lipolytica depositada el 4 de febrero de 2008 de acuerdo con el tratado de Budapest en la Collection nationale de Culture de Microorganismes (CNCM), INSTITUT PASTEUR, 25 rue du Docteur Roux, 75724 PARIS CEDEX 15, Francia bajo el número CNCM-3911. Ventajosamente, dicha cepa de Yarrowia comprende cuatro genes que presentan independientemente entre sí una deleción asociada a un fenotipo de auxotrofia o de carácter dominante, preferentemente seleccionados de entre los genes URA3, LEU2, GUT2 y ADE2. La presente solicitud se refiere asimismo a la cepa de Yarrowia lipolytica depositada el 4 de febrero de 2008 de acuerdo con el tratado de Budapest en la Collection nationale de Culture de Microorganismes (CNCM), INSTITUT PASTEUR, 25 rue du Docteur Roux, 75724 PARIS CEDEX 15, Francia bajo el número CNCM-3913. Según un modo de realización preferido del procedimiento según la invención, éste permite la integración localizada de 3 a 10 copias del gen de interés, preferentemente de 4 a 8 copias y, de manera particularmente preferida, de 5 a 7 copias de dicho gen de interés.

Ventajosamente, el procedimiento según la invención comprende la transformación de dicha cepa de Yarrowia auxótrofa con tres a diez vectores recombinantes, preferentemente de 4 a 8 vectores recombinantes y, de manera particularmente preferida, de 5 a 7 vectores recombinantes.

Los vectores recombinantes utilizados en la etapa b) podrán comprender además uno o varios marcadores de selección distintos de los que permiten, para dicha cepa de Yarrowia, la complementación de la auxotrofia y, llegado el caso, del carácter dominante resultante de las deleciones entre por lo menos los tres genes. Las secuencias que codifican para el marcador de selección y las del gen de interés comprenden además los elementos necesarios para su expresión en una cepa de Yarrowia. Dichos elementos corresponden en particular a unas secuencias promotoras y terminadoras activas en una cepa de Yarrowia. Preferentemente las secuencias promotoras y terminadoras utilizadas pertenecen a unos genes diferentes con el fin de minimizar los riesgos de recombinación no deseada en el genoma de la cepa de Yarrowia.

Dichas secuencias promotoras son bien conocidas por el experto en la materia y pueden corresponder en particular a unos promotores inducibles o constitutivos. A título de ejemplo de promotores que se pueden utilizar en el procedimiento según la invención, se puede citar en particular el promotor de un gen de Yarrowia lipolytica que está reprimido en gran medida por la glucosa y que es inducible por los ácidos grasos o los triglicéridos tal como el promotor POX2 del gen de acil CoA oxidasa 2 de Yarrowia lipolytica y el promotor del gen LIP2 descrito en la solicitud PCT WO 01/83773. Se puede utilizar también el promotor del gen FBA1 del gen de la fructosa-bisfosfato aldolasa (US 2005/0130280), el promotor del gen YAT1 del gen transportador del amonio (US 2006/0094102 A1), el promotor del gen GPAT del gen de la glicerol-3-fosfato O-aciltransferasa (US 2006/0057690 A1), el promotor del gen TEF (US 2001/6265185) y el promotor híbrido hp4d (WO 9641889).

Dichas secuencias terminadoras son también bien conocidas por el experto en la materia y se pueden citar a título de ejemplo de secuencias terminadoras que se pueden utilizar en el procedimiento según la invención la secuencia terminadora del gen PGK1, la secuencia terminadora del gen LIP2 descrito en la solicitud PCT WO 01/83773.

Cuando el producto del gen de interés está destinado a ser segregado por la célula huésped, dicho inserto comprende además unas señales de control de la secreción de dicho producto. Se puede utilizar con este fin unas secuencias señal funcionales en las cepas de Yarrowia, por ejemplo la totalidad o parte de la secuencia prepro del gen LIP2 descrito en la solicitud PCT WO 01/83773. El gen de interés codifica para un polipéptido que se desea producir en gran cantidad en la cepa de Yarrowia

transformada. Dicho polipéptido corresponde preferentemente a un polipéptido heterólogo, como por ejemplo la L-asparaginasa de Erwinia chrysanthemi (SEC ID nº 9) o de Escherichia coli (SEC ID nº 10), pero puede también corresponder a un polipéptido autólogo como la lipasa LIP2 de Yarrowia lipolytica descrita anteriormente. Según un modo de realización particular del procedimiento según la invención, las etapas b) de transformación de la cepa de Yarrowia y c) de selección sobre medio mínimo, se efectúan separadamente para cada uno de dichos por lo menos tres vectores recombinantes. Según un modo de realización más preferido, el procedimiento de integración localizada según la invención se caracteriza por que en la etapa b), las transformaciones con por lo menos los tres vectores recombinantes se realizan de manera independiente y sucesivamente con cada uno de los vectores recombinantes, o simultáneamente con el conjunto de dichos vectores recombinantes, y por que el conjunto de estas transformaciones está seguido de una etapa c) de selección sobre un medio mínimo de las levaduras que han integrado el conjunto de dichos vectores recombinantes.

Según un modo de realización también preferido, el procedimiento según la invención se caracteriza por que el marcador de selección está enmarcado por unas secuencias que permiten su escisión después de la integración localizada de dicho vector recombinante. Se describe también un procedimiento según la invención, en el que el marcador de selección está enmarcado por unas secuencias que permiten su escisión después de la integración localizada de dicho vector recombinante. El procedimiento según la invención permite entonces reutilizar un mismo marcador de selección, en particular un marcador de auxotrofia, para otra integración localizada durante una nueva etapa de transformación.

Dichas secuencias que permiten la escisión y la eliminación, en una cepa de Yarrowia, de una secuencia enmarcada son bien conocidas por el experto en la materia. A título de ejemplo, se puede citar la utilización de dos secuencias idénticas o similares, denominadas secuencias repetidas directas (SRD), con el fin de obtener un evento de recombinación como se describe en la patente EP 0 994 192 B1 o en la patente EP 0 635 574 B1. A título de ejemplo, se puede citar el sistema «Cre-lox» tal como se describe en la patente EP 0 220 009 B1, en el que las secuencias equivalentes a las secuencias repetidas directas son, en este caso, unas secuencias específicas denominadas «lox» y la escisión de la secuencia de ADN comprendida entre las dos secuencias «lox» se efectúa en presencia de una recombinasa «Cre» expresada por un vector de expresión. Otros sistemas equivalentes y que utilizan otras recombinasas específicas son también conocidos por el experto en la materia, en particular el procedimiento descrito en la patente EP 0 814 165 B1. Según otro aspecto, la presente invención tiene por objeto un procedimiento de producción de un polipéptido codificado por un gen de interés, caracterizado por que comprende: A) un procedimiento de integración localizada según la invención; B) una etapa d) de cultivo de la cepa de Yarrowia modificada obtenida mediante el procedimiento según cualquiera de las reivindicaciones 1 a 10 en un medio de cultivo líquido que comprende unas fuentes asimilables de carbono, de nitrógeno y de sales inorgánicas con el fin de permitir el crecimiento de dicha cepa transformada de Yarrowia, y C) la recuperación de dicho polipéptido de interés expresado a partir de las células Yarrowia o del medio de cultivo obtenido en la etapa B).

Ventajosamente, el procedimiento según la invención comprende una etapa e), después de la etapa C), de purificación de dicho polipéptido codificado por el gen de interés.

Esta etapa e) de purificación se puede efectuar o bien después de la lisis celular o bien, ventajosamente, a partir del medio de cultivo en el que está segregado por las células, mediante técnicas clásicas, conocidas en sí mismas, por ejemplo por precipitación fraccionada seguida de una o varias etapas de cromatografía. Las células de Yarrowia transformadas susceptibles de ser obtenidas por el procedimiento de acuerdo con la invención también forman parte de la presente invención.

Así, la presente invención se refiere también a una cepa de Yarrowia auxótrofa susceptible de ser obtenida mediante el procedimiento según la invención, comprendiendo dicha cepa por lo menos tres deleciones seleccionadas de entre Ura3-302, Leu2-270, Gut2-744 y Ade2-844, correspondiendo el fenotipo asociado a cada una de estas deleciones a una auxotrofia dominante para dicha cepa, independientemente el uno del otro de estos por lo menos tres genes. Según otro aspecto, la presente invención se refiere a un procedimiento de obtención de una cepa modificada de Yarrowia con por lo menos tres vectores que permiten llegar a una cepa de Yarrowia que comprende por lo menos tres deleciones seleccionadas de entre Ura 3-302, Leu 2-270, Gut 2-744 y Ade 2-844, y caracterizada por que, independientemente el uno del otro de estos por lo menos tres genes, el fenotipo asociado a cada una de estas deleciones corresponde a una auxotrofia o a un carácter dominante para dicha cepa. Preferentemente en este caso, la cepa comprende además por lo menos un gen asociado a un fenotipo de carácter dominante seleccionado de entre: el gen de resistencia a la higromicina HPH (HYG), y los genes MDR3, KanMX y Tn5ble, siendo el gen HYG también el más preferido de los genes de resistencia. Se describe asimismo una cepa de Yarrowia auxótrofa y, llegado el caso, que presenta un carácter dominante adquirido, susceptible de ser obtenida mediante el procedimiento de obtención de una cepa modificada de Yarrowia según la invención, comprendiendo dicha cepa una deleción en por lo menos tres genes de su genoma y caracterizada por que, independientemente el uno del otro de estos por lo menos tres genes, el fenotipo asociado a cada una de estas deleciones corresponde a una auxotrofia o a un carácter dominante para dicha cepa. Cada una de las preferencias definidas para el número de genes delecionados, los genes seleccionados para la deleción tales como las definidas para la etapa a) del procedimiento de integración según la presente invención, también se prefieren para este procedimiento.

Ventajosamente, dicha cepa de Yarrowia obtenida por este procedimiento es una cepa de Yarrowia lipolytica. Preferentemente, dicha cepa de Yarrowia auxótrofa comprenderá por lo menos una mutación entre los genes URA3, LEU2 y ADE2 o URA3, LEU2 y GUT2.

A título de ejemplo, se pueden citar las cepas de Yarrowia lipolytica depositadas el 4 de febrero de 2008 de acuerdo con el tratado de Budapest en la Collection nationale de Culture de Microorganismes (CNCM), INSTITUT PASTEUR, 25 rue du Docteur Roux, 75724 PARIS CEDEX 15, Francia bajo los números CNCM I-3911 y CNCM I-3912.

Según un segundo modo de realización preferido, la cepa de Yarrowia auxótrofa utilizada en el procedimiento según la invención comprende una mutación entre cuatro genes necesarios para el crecimiento de dicha cepa, estando estos tres genes seleccionados de entre grupo que comprende URA3, LEU2, ADE2, LIP2, LIP7, LIP8, AXP, GUT2 y XPR2.

Preferentemente, dicha cepa de Yarrowia auxótrofa comprenderá por lo menos una mutación entre los genes URA3, LEU2, ADE2 y GUT2. A título de ejemplo se puede citar la cepa de Yarrowia lipolytica depositada el 4 de febrero de 2008 de acuerdo con el tratado de Budapest en la Collection nationale de Culture de Microorganismes (CNCM), INSTITUT PASTEUR, 25 rue du Docteur Roux, 75724 PARIS CEDEX 15, Francia bajo el número CNCM I-3913. La presente invención se entenderá mejor con la ayuda de las figuras y de sus leyendas y del complemento de descripción dado a continuación, que se refiere a ejemplos no limitativos de obtención de cepas transformadas de Yarrowia lipolytica de acuerdo con la invención.

Leyendas de las figuras

Figura 1: Representación esquemática de la construcción de "casete de integración" localizada de "casete de expresión". 1) El gen de interés está clonado en un vector de expresión, 2) el casete de expresión está liberado por una digestión I-SceI, 3) y después está clonado en diferentes vectores de integración, 4) los casetes de integración son liberados por una digestión NotI, purificados y utilizados para transformar una cepa de integración. Figura 2: Representación esquemática del vector de clonación. 1) el vector de clonación comprende un promotor fuerte seguido de sitios de restricción única para la clonación del gen de interés, de un terminador de transcripción, y a uno y otro lado de un sitio raro para permitir la escisión del casete de expresión, 2) el vector pVC de base contiene un multi-sitio compuestos de sitios ClaI, BamHI, KpnI y AvrII, la secuencia terminadora del gen LIP2 (LIP2term) con, a uno y otro lado, el sitio raro I-CeuI, 3) el vector de expresión contiene el promotor pPOX2 clonado en los sitios ClaI y BamHI, 4) el casete de expresión se obtiene por clonación de múltiples sitios del gen de interés, por ejemplo BamHI-AvrII, y después una digestión del vector de expresión por I-CeuI.

Figura 3: Representación esquemática del vector de integración y obtención del casete de integración localizada. 1) el vector de integración contiene una región aguas arriba del locus de inserción (región P, por promotora) y una región aguas abajo del locus de inserción (región T, por terminadora) con, a uno y otro lado, un sitio raro 1 para la escisión del casete de integración. Entre las regiones P y T están presentes dos sitios raros, el sitio raro 2 para la inserción del marcador de selección, y el sitio raro 3 para la inserción del casete de expresión. Figura 4: Representación esquemática de los vectores de integración para una integración aleatoria. I) representación esquemática del vector que comprende un sitio raro 1 que se puede utilizar para liberar el casete de expresión de la parte plásmido, un sitio raro 2 para la clonación del marcador de selección para Y. lipolytica.

Contiene un promotor entre los sitios ClaI y BamHI (en este caso el promotor pPOX2), el terminador del gen LIP2 y las regiones Zeta para una integración aleatoria (véase la patente de amplificación). La serie JMP61 presenta la secuencia de direccionamiento de la lipasa Lip2. II) Representación esquemática de los vectores de integración para una integración aleatoria construida con el sitio NotI como sitio raro 1 y el sitio I-SceI como sitio raro 2 utilizado para la inserción de los marcadores URA3. LEU2. Hyg, GUT2 y ADE2.

Figura 5: expresión de la asparaginasa en las cepas que contienen diferente número de copias del gen. A) análisis sobre gel de electroforesis NuPAGE al 10% y coloración con azul coloidal (equivalente a 30 µl de sobrenadante), B) análisis sobre gel de electroforesis NuPAGE al 10%, transferencia y detección por transferencia Western con un anticuerpo anti-asparaginasa (equivalente a 10 µl de sobrenadante). La banda a corresponde a la proteína no glicosilada y la banda b corresponde a la proteína mono-glicosilada. L1, cepa receptora FF-luga; L2, cepa 5LAsp1 : ade2 :: GUT2-Asp, 1 copia; L3, cepa 6LAsp1 : ade2 :: GUT2-Asp, 1 copia; L4, cepa 15LAsp2 : ade2 :: GUT2-Asp lip2 :: URA3-Asp, 2 copias; L5, cepa 21LAsp2 : ade2 :: GUT2-Asp lip2 :: URA3-Asp, : 2 copias; L6, cepa ILAsp3 : ade2 :: GUT2-Asp lip2 :: URA3-Asp leu2 :: ADE2-Asp : 3 copias; L7, cepa 2LAsp4 : ade2 :: GUT2-Asp lip2 :: URA3-Asp leu2 :: ADE2-Asp ura3 :: LEU2-Asp : 4 copias.

Figura 6: Análisis fenotípico Suc+/Suc- para verificar la inserción en el locus URA3. Los transformantes obtenidos con el casete de integración localizada en el locus URA3 se ensayan por estría sobre placas de medio rico en glucosa (YPD) y sacarosa (YPS). Las cepas receptoras Suc+ FF-lug, FF-lua y FF-luga se utilizan como control.

Figura 7: Análisis fenotípico Lip+/Lip- para verificar la inserción en el locus LIP2. Los transformantes obtenidos con el casete de integración localizada en el locus LIP2 se cultivan en medio rico en ácido oleico (YPD2O2). La actividad lipasa en el sobrenadante de las cepas contiene diferentes copias de la asparaginasa. La cepa receptora Lip+ FF-luga se utiliza como control. Cepas con 1 copia en el locus ADE2 (ade2 :: GUT2-Asp) : 5LAsp1 y 6LAsp1; cepas con 1 copia en el locus ADE2 y 1 copia en el locus LIP2 (ade2 :: GUT2-Asp, lip2 :: URA3-Asp) : 14LAsp2, 15LAsp2, 16LAsp2, 17LAsp2 y 21 LAsp2. Figura 8: Determinación del número de copias de los genes LIP2 y Asp por RT-qPCR en los transformantes.

Ejemplos

Ejemplo 1: Cepas utilizadas en los ejemplos Las cepas utilizadas en el procedimiento de la invención se derivan de una cepa salvaje de Yarrowia lipolytica, en particular de la cepa salvaje Yarrowia lipolytica W29 (ATCC 20460, clasificada bajo CLIB89 en la colección del CIRM (Centre International de Ressources Microbiennes). Así, se pueden utilizar nuevas cepas mutantes que se derivan de la cepa Yarrowia lipolytica ATCC 20460 por medio de la cepa Po1d [cepa auxótrofa para la leucina (Leu-) y el uracilo (Ura-)], descrita en la revista de G. Barth et al.: Yarrowia lipolytica. En: Nonconventional Yeasts in Biotechnology A Handbook (Wolf, K., Ed.), Vol. 1, 1996, p. 313- 388. Springer-Verlag. Está clasificada bajo CLIB139 en la CIRM. La obtención de estas nuevas cepas receptoras (FF-lu, FF-lug (CNCM I-3911), FF-lua (CNCM I-3912), FF-luga (CNCM I-3913)) se describirá más adelante.

Obtención de las cepas La obtención de las cepas mutantes receptoras que se pueden utilizar en el procedimiento de la invención se puede llevar a cabo a partir de la cepa Po1d, que se deriva de la cepa salvaje Yarrowia lipolytica W29. La cepa Po1d es una cepa auxótrofa para la leucina (leu-) y el uracilo (ura-). Está descrita en la revista de G. Barth et al.: Yarrowia

lipolytica. En: Nonconventional Yeasts in Biotechnology A Handbook (Wolf, K., Ed.), Vol. 1, 1996, p. 313-388. Springer-Verlag, Berlin, Heidelberg, Nueva York. Está clasificada bajo CLIB139 en la colección del CIRM. La obtención de las cepas mutantes que se pueden utilizar en el procedimiento de la invención se puede llevar a cabo mediante la inserción de deleción de gen que confiere una auxotrofia o que confiere un defecto de crecimiento sobre ciertos medios, cuyo gen presenta una deleción, si es posible una deleción que no se pueda revertir, ventajosamente que corresponda a una deleción completa del gen, cuyo gen correspondiente pueda ser utilizado como marcador de selección para la selección de los transformantes que han integrado los casetes de integración. Las deleciones presentarán una deleción importante con respecto al casete correspondiente utilizado para la construcción de los marcadores de selección, con el fin de disminuir la tasa de conversión. 1. Deleción del gen GUT2 (∆gut2-744), construcción del marcador GUT2 y obtención de la cepa mutante FF-lug (CNCM I-3911). 1.1 Deleción del gen GUT2 (∆gut2-744) Para obtener esta cepa, se puede proceder de la siguiente manera: 1) se selecciona el gen de interés que se quiere eliminar; 2) se construye un casete de interrupción por clonación o por PCR ("Polymerase Chain Reaction") amplificando la región aguas arriba del gen (región "promotora" simbolizada por P) y la región aguas abajo del gen (región "terminadora", simbolizada por T); 3) se introduce un marcador de selección que contiene a uno y otro lado una secuencia de recombinación (ventajosamente una secuencia loxP o loxR o derivada) que permite una recombinación entre sí para la eliminación del marcador (ventajosamente una secuencia de tipo loxP que permite la recombinación bajo la acción de la recombinasa cre); 4) se transforma con el casete de interrupción y se seleccionan las cepas con el gen de interés delecionado (transformación y selección de los transformantes) y se verifica la interrupción del gen; 5) se transforma con un vector que permite la expresión de la recombinasa (ventajosamente la recombinasa cre que permite la recombinación de las secuencias loxP/loxR y la eliminación del marcador); 6) se aísla un clon que presenta la deleción del gen de interés y que ha perdido el plásmido de expresión de la recombinasa.

A partir del mutante FF-lu auxótrófo (Leu-, Ura-), se ha construido una cepa Y lipolytica mutante FF-lug auxótrofa para la leucina y el uracilo (Leu-, Ura-) e incapaz de utilizar el glicerol como fuente de carbono (gly-). La primera etapa es la construcción de la cepa FF-lug :: URA3 protótrofa para el uracilo (Leu-, Ura+) por deleción del gen GUT2 por el casete de interrupción gut2 :: URA3ex transformando el fragmento de PCR GUT2-PUexT (JME744) y seleccionando los Ura+ sobre YNBcasa. Se seleccionan los auxótrofos para el uracilo (Leu+, Ura-) por escisión del marcador URA3ex transformando con el vector replicativo pRRQ2 que contiene la recombinasa Cre y el marcador LEU2 (Cre-LEU2) y seleccionando los transformantes auxótrofos para el uracilo, Leu+. La pérdida del plásmido pRRQ2 se realiza mediante un cultivo sobre medio rico en YPD y por aislamiento de un clon (Leu-, Ura-, Gly-).

La representación esquemática de la construcción de estos mutantes se resume en la tabla 1 siguiente.

Tabla 1: Etapas de transformación requeridas para la producción del mutante FF-lug Etapa Operaciones de transformación Mutante a transformar Casete de transformación Mutante transformado 1 FF-lu, PO1d, Leu-, Ura- Gut2-PUexT JMY1202, Leu-, Ura+, Glygut2=PUexT 2 JMY1202, Leu-, Ura+, Gly-, Vector pRRQ2 (pKS Cre ARS68 FF-lug JMY1346, Leu-, Ura-, Glygut2-744 gut2-PUexT LEU2) El casete de interrupción para el gen GUT2 se ha construido por amplificación de la región aguas arriba (región P; YaliOB:1873518..1872400 complementaria, 1119 bp) y de la región aguas abajo (región T; Yali0B:1870468..1869652 complementaria, 817 bp), lo cual permite la deleción de ORF del gen GUT2 (YaliOB1870469..1872401) y deja una homología con el marcador de selección GUT2ex-0.5 (485 bp con la región P y 56 bp en la región T) con el fin de minimizar las conversiones génicas. Los marcadores de selección ex se presentan en la tabla 11. Las regiones P y T se amplificaron con los cebadores G3PD-P1, G3PD-P2, G3PD-T1 y G3PD-T2 (tabla 9). Los cebadores G3PD-P2 y G3PD-T1 contienen el sitio raro I-SceI para la inserción del marcador de selección escindible URA3ex. El fragmento PT se ha clonado en pGEM-T (Invitrogen) para dar el plásmido pGEM-GUT2-PT (JME743). El plásmido de interrupción pGEM-GUT2-PUexT (JME744) se ha obtenido por inserción del marcador URA3ex e el sitio I-SceI que proviene del plásmido JME507. El casete de interrupción (3245 pb) se ha obtenido por PCR con los cebadores G3PD-P1 y G3PD-T2. El producto de PCR se ha purificado sobre gel de agarosa con la ayuda del kit gel de extracción Qiagen. Las cepas se han transformado mediante el método con acetato de litio. Los transformantes Ura+ se han seleccionado sobre medio YNBcasa. Los transformantes Ura+ se obtienen con una tasa de transformación típica (Fickers, 2003). La verificación de la interrupción del gen GUT2 se ha verificado mediante PCR con los cebadores en 5' de la región P (G3PDver1) y en 3' de la región T (G3PDver2). El mutante JMY1202 gut2::URA3ex ha sido transformado después por el plásmido replicativo pRRQ2 (pKS Cre ARS68 LEU2; JME461). Los transformantes obtenidos son cribados para la escisión del marcador URA3 y la pérdida del plásmido replicativo de expresión de la recombinada cre se realiza por un cultivo sobre medio rico YPD y por aislamiento de un clon (Leu-, Ura-, Gly-). Se ha seleccionado el mutante JMY1346 (FF- lug).

La secuencia del locus gut2-844 del mutante JMY1346 se ha amplificado con los cebadores G3PDver1 y G3PDver2. Se ha secuenciado el producto de PCR de tamaño 2415 pb. La secuencia obtenida muestra la ausencia de marcador Ura3. Después de la escisión, permanecen sobre el genoma las secuencias siguientes entre P y T del locus GUT2: TGCAGCTTTCGAGAACCGACGCCTGGGACCTGTGTCTGTAGGGATAACAGGGTAATTCGCTTCG GATAACTCCTGCTATAACGAAGTTATGTAGGGATAACAG GGTAAT (SEC ID nº 11; es decir el sitio I-SceI - secuencia LoxR - sitio I-SceI). 1.2 Construcción del marcador GUT2ex Para la construcción del marcador GUT2ex, la secuencia genómica del locus GUT2 se ha amplificado con los cebadores G3PTS y G3PTR (tabla 8) y clonado en el vector pKS-LPR (Fickers et al., 2003, Journal of Microbiological Methods, vol. 55, p. 727-737) en el sitio EcoRI. Contiene 492 pb de promotor, el ORF del gen GUT2, (ORF Yali0B:1870546..1872384) y 132 bp del terminador y que corresponde a la secuencia Yali0B:1872876..1870417. Este ORF contiene 2 sitios BamHI y 1 sitio EcoRI que se han eliminado por mutagénesis dirigida introduciendo unas mutaciones silenciosas. Se han utilizado los cebadores siguientes: G3PB1S y G3PB1R para el primer sitio BamHI (ggAtcc en ggCtcc), G3PB2S y G3PB2R para el segundo sitio BamHI (ggatcC en ggatcT) y G3PE1S y G3PE1R para el sitio EcoRI (gaAttc en gaGttc) (tabla 9). El marcador puede ser insertado en los dos sentidos. Para este marcador GUT2ex0.5, se ha obtenido sólo el sentido 1 en el pKS-LPR. Después de la verificación por secuenciación, el plásmido que contiene el marcador GUT2ex0.5 modificado es JME792. Otros dos marcadores GUT2ex1.0 y GUT2ex 1.5 que contienen 1 kb y 1,5 kb del promotor respectivamente se han construido como resultado de la dificultad para obtener unos transformantes a partir del marcador GUT2ex0.5 (párrafo 1.3). Estos promotores se han amplificado a partir del ADNg (cepa E150 Yarrowia lipolytica) con los cebadores P1KB y PNHE1 y P15KB y PNHE1, respectivamente. La clonación se ha realizado por ligadura de 3 vías entre el pKS-LPR (EcoRI desfosforilado), el producto de PCR (EcoRI y NheI) y el resto del marcador GUT2ex modificado procedente de JME792 (NheI y EcoRI). El marcador GUT2ex1.0 en el sentido 1 corresponde a JME919 y en el sentido 2 corresponde a JME920. El marcador GUT2ex1.5 en el sentido 1 corresponde a JME921 y en el sentido 2 corresponde a JME922. 1.3 Transformación con los marcadores GUT2ex0.5, GUT2ex1.0 y GUT2ex1.5. Para validar la utilización del marcador GUT2ex, se ha aislado el marcador GUT2ex0.5 del plásmido JME792 (pKS- LPR-GUT2ex0.5) por digestión I-SceI y se ha insertado en el sitio I-SceI del plásmido JMP62 I-SceI (JME801) para dar lugar al plásmido JMP62Gut2-ex0.5 (JME805). El plásmido JME805 ha sido digerido por NotI y se ha utilizado para trasformar la cepa FF-lug mediante el método con acetato de litio. Los transformantes se han seleccionado sobre medio YNBcasa Glicerol al 1% suplementado con uracilo (100 mg/l). Después de varios intentos, este marcador no ha permitido obtener transformantes. En una primera fase, se ha emitido la hipótesis de una defectibilidad muy importante de la parte promotora (492 pb). Por lo tanto, se han construido otros 2 marcadores que contienen unas partes promotoras más largas (véase el párrafo 1.2) es decir el marcador GUT2ex1.0 y GUT2ex1.5. Se han obtenido los mismos resultados.

Se ha descrito en la levadura Saccharomyces cerevisiae una represión de la utilización de la glucosa en presencia de glicerol para unas cepas ∆gut2. Efectivamente, la cepa FF-lug es incapaz de crecer en presencia de las 2 fuentes de carbono antes citadas. Modificando el presente método de transformación, se han obtenido unos transformantes. Este nuevo método de transformación sigue siendo idéntico al método con acetato de litio y con polietilenglicol (Gaillardin et al. 1985) al que se añade una etapa de fase de expresión antes de la extensión de la transformación sobre medios selectivos. Esta fase de expresión se realiza de la siguiente manera: después del choque térmico a 42°C durante 10 minutos, se centrifuga el producto de la transformación a 2000 rpm durante 3 min. y se lavan las células con 2 ml de tampón TE pH8. Este lavado se repite 2 veces. Las células son recogidas después con el medio nutritivo Yeast Extract al 1%, Peptonas al 1% y dextrosa al 0,2%. Se efectúa una incubación de 16 horas a 28 grados y sin agitación. De nuevo, se centrifuga a 2000 rpm durante 3 min. y se lavan las células con 2 ml de tampón TE pH 8. Este lavado se repite 2 veces. Las células son recogidas después con 2 ml de TE y se esparcen sobre unos medios selectivos que contienen glicerol al 1% como única fuente de carbono. Los resultados de la transformación del marcador GUT2ex1.0 en la cepa FF-lug se presentan en la tabla 2 siguiente: Tabla 2: Eficacia de transformación según el método de transformación.

Método clásico sin fase de expresión Nuevo método con fase de expresión Tipo de integración aleatoria localizada aleatoria localizada Número de transformantes 14 133 615 Tasa de transformación por µg de 187 266 8215 ADN % de integración ND 75% ND 100% 2. Deleción del gen ADE2 (∆ade2-844), construcción del marcador ADE2 y obtención de las cepas mutantes FF-lua (CNCM I-3912) y FF-luga (CNCM I-3913).

2.1 Deleción del gen ADE2 (∆ade2-844) Para obtener estas cepas, se puede proceder de la siguiente manera: a partir del mutante FF-lu, se ha construido la cepa FF-lua Leu-, Ura-, Ade- y a partir del mutante FF-lug, se ha construido la cepa FF-luga Leu-, Ura-, Ade-, Gly-.

2.1a. A partir del mutante FF-lu auxótrofo (Leu-, Ura-), se ha construido una cepa Y. lipolytica mutante FF-lua auxótrofa para la leucina, el uracilo y la adenina (Leu-, Ura-, Ade-). La primera etapa es la construcción de la cepa FF-lua :: URA3 protótrofa para el uracilo (Leu-, Ura+, Ade-) por deleción del gen ADE2 por el casete de interrupción Ade2 :: URA3ex transformando el casete NotI PTAde2-Ura3Ex (JME844) y seleccionando las Ura+ sobre YNBcasa, suplementado con adenina (800 mg/l). Se seleccionan los auxótrofos para el uracilo (Leu+, Ura-, ade-) por escisión del marcador URA3ex transformando con el vector replicativo pRRQ2 que contiene la recombinasa Cre y el marcador LEU2 (Cre-LEU2) y seleccionando los transformantes auxótrofos para el uracilo, Leu+. La pérdida del plásmido replicativo pRRQ2 de expresión de la recombinasa cre se realiza mediante un cultivo sobre medio rico YPD y por aislamiento de un clon (Leu-, Ura-, Ade-). Se ha seleccionado el mutante JMY1409 (FF-lua). 2.1.b. A partir del mutante FF-lug auxótrofo (Leu-, Ura-) e incapaz de utilizar el glicerol como fuente de carbono (Gly-), se ha construido una cepa Y. lipolytica mutante FF-luga auxótrofa para la leucina, el uracilo y la adenina (Leu-, Ura-, Ade-) e incapaz de utilizar el glicerol como fuente de carbono (Gly-). La primera etapa es la construcción de la cepa FF-luga :: URA3 auxótrofa para la leucina y la adenina (Leu-, Ade-, Ura+) por deleción del gen ADE2 por el casete de interrupción ade2 :: URA3ex transformando el casete NotI PTAde2-PUra3ExT (JME844) y seleccionando los Ura+ sobre YNBcasa suplementado con adenina (800 mg/l). Se seleccionan los auxótrofos para el uracilo (Leu+, Ura-) por escisión del marcador URA3ex transformando con el vector replicativo pRRQ2 que contiene la recombinasa Cre el de marcador LEU2 (Cre-LEU2) y seleccionando los transformantes auxótrofos para el uracilo, Leu+. La pérdida del plásmido pRRQ2 se ha realizado mediante un cultivo sobre medio rico YPD y mediante el aislamiento de un clon (Leu-, Ura-, Ade-, Gly-). Se ha seleccionado el mutante JMY1404 (FF-luga).

La representación esquemática de la construcción de estos mutantes se resume en la tabla 3 siguiente.

Tabla 3: Etapas de transformación requeridas para la producción de los mutantes FF-lua y FF-luga Etapa Operaciones de transformación Mutante a transformar Casete de transformación Mutante transformado 1 PO1d, Leu-, Ura- PTade2-Ura3Ex JMY1407, Leu-, Ura+ ade2-PUexT 2 JMY1407, Leu-, Ura+ ade2-PUexT Vector pRRQ2, selección Leu+, verificación JMY1409, Leu-, Ura-, Gly-, pérdida del plásmido pRRQ2 sobre Aide-ade2-844 FF-lua YPD, aislamiento de Leu- 1b JMY1346, Leu-, Ura-, Gly-gut2-744 PTade2-Ura3Ex JMY1396, Leu-, Ura+ Gly- ade2-PUexT 2b JMY1396, Leu-, Ura+, Gly-ade2-844 Vector pRRQ2, selección Leu+, verificación JMY1404, Leu-, Ura-, Gly-, pérdida del plásmido pRRQ2 sobre Ade-, Gly-, ade2-844 YPD, aislamiento de Leu- FF-luga El casete de interrupción para el gen ADE2 (Yali0B23188g; highly similar to tr|Q9P4V1 Candida boidinii), codifica para la fosforibosil-5-aminoimidazol carboxilasa, proteína deducida de 565 aa (Yali0B:3030460..3032157, sentido) se ha construido por amplificación de la región aguas arriba (región P; Yali0B:3029011..3029931, 920 bp) y de la región aguas abajo (región T; 792 pb, Yali0B:3031871..3032662) lo cual permite la deleción del ORF del gen ADE2 Yali0B:3030460..3032157). La región eliminada es de 1939 pb (Yali0B:3029932..3031870) y que deja sólo una homología muy baja con el marcador de selección ADE2ex (O bp con la región P y 415 bp en la región T) con el fin de minimizar las conversiones génicas. El marcador ADE2ex corresponde a la región Yali0B:3029961..3032280 fragmento de 2319 pb. Los marcadores de selección ex se presentan en la tabla 11.

Las regiones P y T se han amplificado con los cebadores siguientes P1ADE2, P2ADE2, T1ADE2, T2ADE2 (Tabla 9). Los cebadores P2 y T1 contienen el sitio raro I-SceI para la inserción del marcador de selección escindible URA3ex. El cebador T1 contiene también el sitio raro I-CeuI para la inserción del casete de expresión. Los cebadores P1 y T2 contienen el sitio raro NotI para la clonación en pHSS6-NotI (JME800). El fragmento PT se ha clonado en el JME800 digerido por NotI y se ha desfosforilado para dar el plásmido pADE2-PT en la orientación 1 (sentido 1, JME813) o en la orientación 2 (sentido 2, JME814). El sentido se define según la orientación del sitio I-SceI: o bien el sentido 1 con el sitio I-SceI como sentido, o bien el sentido 2 con el sitio I-SceI como complementario. El plásmido de interrupción pPTAde2-Ura3Ex (JME844) ha sido obtenido por inserción del marcador URA3ex en el sitio I-SceI del plásmido JME813. El casete de interrupción se ha obtenido por digestión NotI y purificación de la banda de 3089 pb. La cepa Pold se ha transformado mediante el método con acetato de litio. Los transformantes Ura+ se han seleccionado sobre medio YNBcasa suplementado con adenina (100 mg/l). Las concentraciones típicas necesarias para la complementación de una auxotrofia que se utilizan están generalmente comprendidas entre 100 a 200 mg/l. Los transformantes Ura+ se obtienen con una tasa de transformación baja, del orden de 50 transformantes por microgramo de ADN, el análisis de los transformantes ha revelado que contenían una conversión del marcador ura3-302 y no la deleción del gen ADE2.

Se han realizado varios ensayos de interrupción con unas concentraciones crecientes de adenina. Para obtener unas tasas de transformación superiores a 103 transformantes por µg de ADN, es necesario tener una concentración superior a 400 mg/l de adenina en los medios. La concentración utilizada para la complementación es de 800 mg/l. Es sólo con estas condiciones con las que se han obtenido unos transformantes que presentan una interrupción del gen ADE2. Al contrario que S. cerevisiae, las cepas Ade- no presentan color rosa. Por el contrario, los clones Ade- de Y. lipolytica presentan un color marrón después de varios días sobre la placa y un sobrenadante marrón en medio líquido: fenotipo que se puede utilizar para identificar que los transformantes o la integración del casete de expresión están bien integrados en el locus ADE2. Verificación de la secuencia del locus ade2-844. La secuencia del locus ade2-844 se ha amplificado con los cebadores ver1ade2 y ver2ade2 (tabla 9). Se ha secuenciado el producto de PCR de tamaño 2204 pb. La secuencia obtenida muestra la ausencia de la secuencia de marcador URA3. Además, esta verificación muestra la ausencia de la integración de los sitios NotI en 5' y 3' del casete de interrupción PUexT. Después de la escisión, sobre el genoma permanecen las secuencias siguientes entre P y T del locus ade2: TAGGGATAACAGGGTAATTATCGCTTCGGAT AACTCCTGCTATAGGAAGTTATGTAGGGATAACAGGGTAATTAACTATAACGGTCCTAAGGTAGCGA (SEC ID nº 12) es decir los sitios siguientes I-SceI - LoxR - I-SceI - I-CeuI. 2.2 Construcción del marcador ADE2ex Para la construcción del marcador ADE2ex, se ha amplificado la secuencia genómica del locus ADE2 utilizando los cebadores ADE2S y ADE2R y se ha clonado en el vector pKS-LPR (Fickers et al., 2003, Journal of Microbiological Methods, vol. 55, p. 727-737) en el sitio EcoRI. Contiene 500 bp de promotor, el ORF del gen ADE2 (Yali0B23188g) y 125 bp del terminador, y que corresponde a la secuencia Yali0B:3029961..3032280 es decir 2319 pb. Se ha eliminado el sitio EcoRI presente en el ORF del gen ADE2 modificando la gaatTc en gaatCc por mutagénesis dirigida con los cebadores ADE2ES y ADE2ER (tabla 9). Esta base modificada crea una mutación silenciosa ATT en ATC.

El marcador se puede insertar en los dos sentidos. El marcador ADE2ex en el sentido 1 corresponde a JME798 y en el sentido 2 a JME799. 2.3 Transformación con el marcador ADE2ex Para ensayar la utilización del marcador ADE2ex, se ha aislado el marcador ADE2ex del plásmido JME798 (pKS- LPR-ADE2) por digestión I-SceI y se ha insertado en el sitio I-SceI del plásmido JMP62 I-SceI (JME793) para obtener el plásmido JMP62 ADE2ex (JME862). El plásmido JME862 ha sido digerido por NotI y se ha utilizado para trasformar la cepa FF-lua mediante el método con acetato de litio. Los transformantes se han seleccionado sobre medio YNBcasa suplementado con uracilo (100 mg/l) y adenina. En la bibliografía, se describe habitualmente en unos mutantes Ade- de diferentes especies de levaduras que los medios selectivos están suplementados con adenina a una concentración de 100 a 200 mg/l. En el caso presente, para los mutantes Ade- antes citados, la concentración necesaria para un crecimiento correcto de los transformantes es de 800 mg/l. En estas condiciones, se obtienen unas tasas de transformación similares a las tasas de transformación obtenidas con el marcador URA3.

3. Deleción del gen LEU2 (marcado ∆leu2-958), obtención de las cepas mutantes FF2-lu, FF-2lug, FF2-lua y FF2- luag y construcción del marcador LEU2∆BamHI. 3.1 Deleción del gen LEU2 (∆leu2-958) Para obtener estas cepas, se puede proceder de la siguiente manera: a partir del mutante FF-lu, se ha construido la cepa FF2-lu Leu-, Ura-. De manera similar, se pueden construir unas cepas derivadas de FF-lua, FF-lug, FF-luag que presentan la deleción ∆leu2-958. A partir del mutante FF-lug, se puede construir la cepa FF2-lug Leu-, Ura-, gly-, a partir del mutante FF-lua, se puede construir la cepa FF2-lua Leu-, Ura-, ade- y a partir del mutante FF-luag, se puede construir la cepa FF2-luag Leu-, Ura-, ade-, gly-. Por ejemplo, a partir del mutante FF-lu se ha construido la cepa Y. lipolytica mutante correspondiente que presenta una deleción del gen LEU2 más importante que para el marcador genético leu2-270. La primera etapa es la construcción de la cepa FF2-lu :: URA3 protótrofa para el uracilo (Leu-, Ura+) por deleción del gen leu2-270 por el casete de interrupción leu2 :: URA3ex transformando el casete NotI procedente del plásmido pPTLeu2-Ura3Ex (JME958) que contiene este marcador y seleccionando las Ura+ sobre YNBcasa. Se seleccionan los auxótrofos para el uracilo (Leu+, Ura-) por escisión del marcador URA3ex transformando con el vector replicativo pRRQ2 que contiene la recombinasa Cre y el marcador LEU2 (Cre-LEU2) y seleccionando los transformantes auxótrofos para el uracilo, Leu+. La pérdida del plásmido pRRQ2 se realiza mediante un cultivo sobre medio rico YPD y mediante el aislamiento de un clon (Leu-, Ura-). Se puede utilizar el mismo método para obtener los mutantes FF2-lua, FF2-lug y FF2-luga. La representación esquemática de la construcción del mutante FF2-lu se resume en la tabla 4 siguiente.

Tabla 4: Etapas de transformación requeridas para la producción del mutante FF2-lu Etapa Operaciones de transformación Mutante a transformar Casete de transformación Mutante transformado a1 FF-lu, Leu-, Ura-JMY195, Po1d PTLeu2-Ura3Ex FF-IU+, leu-, Ura+ leu2-PUexT a2 FF-IU+, Leu-, Ura+, leu2-URA3 Vector pRRQ2, selección Leu+, verificación JMY1516, Lieu-, Ura-, pérdida del plásmido pRRQ2 sobre YPD, Ura-, leu2-958 FF2- aislamiento de Leu- lu El casete de interrupción para el gen LEU2 se ha construido por amplificación de la región aguas arriba (región P; Yali0C44989..Yali0C46081, 1092 pb) y de la región aguas abajo (región T; Yali0C47036..Yali0C47932, 897 pb) lo cual permite la deleción del ORF del gen LEU2 (Yali0C46082..Yali0C47035, 954 pb) y que no deja más que una homología muy reducida con el marcador de selección LEU2ex (O bp con la región P y 207 bp en la región T) con el fin de minimizar las conversiones génicas. El marcador de selección Leu2Ex presentaba una fuerte homología con el marcador genético leu2-270 (401 bp con la región P y 710 bp en la región T) ya que éste corresponde a una simple deleción StuI de 681 bp del gen LEU2. Los marcadores de selección ex se presentan en la tabla 11.

Las regiones P y T se han amplificado con los cebadores PILeu2, P2Leu2, TILeu2 y T2Leu2 (tabla 9). Los cebadores P2 y T1 contienen el sitio raro I-SceI para la inserción del marcador de selección escindible Ura3ex. El cebador T1 contiene también el sitio raro I-CeuI para la inserción del casete de expresión. Los cebadores P1 y T2 contienen el sitio raro NotI para la clonación en pHSS6-NotI (JME800). El fragmento PT se ha clonado en JME800 digerido por NotI y se ha desfosforilado para dar el plásmido pLeu2-PT en la orientación 1 (sentido 1, JME811) o en la orientación 2 (sentido 2, JME812). El sentido se define según la orientación del sitio I-SceI: o bien el sentido 1 con el sitio I-SceI como sentido, o bien el sentido 2 con el sitio I-SceI, como complementario. El plásmido de interrupción pPTLeu2-Ura3Ex (JME958) se ha obtenido mediante la inserción del marcador Ura3ex en el sitio I-SceI del plásmido JME811. El casete de interrupción se ha obtenido por digestión NotI y purificación de la banda de 3351 pb. Las cepas se han trasformado mediante el método con acetato de litio. Los transformantes Ura+ se han seleccionado sobre medio YNBcasa.

3.2 Construcción del marcador LEU2n (LEU2ex∆BamHI) Para la construcción de los casetes de expresión y de los casetes de integración, los marcadores de selección no deben contener los sitios únicos utilizados para la clonación de los genes de intereses (BamHI, HindIII, KpnI y AvrII).

Para la construcción del marcador LEU2n (LEU2ex∆BamHI), se han utilizado los cebadores Leu2-LI y Leu2-L2 para crear un "linker" que aporta la modificación ggaatT en ggaatC y que posee el sitio ApaI (Tabla 9). El plásmido pKS-LPR-Leu2 (JME509) ha sido digerido por un lado por ApaI y ScaI y, por otro lado, por BamHI y ScaI. Las bandas ApaI-ScaI de 1471 pb y BamHI-ScaI de 3300 pb se han purificado sobre gel de agarosa. Una ligación de 3 vías se ha efectuado con estas 2 bandas más el "linker" Leu2L1/Leu2L2. Se ha obtenido un plásmido que contiene el nuevo marcador LEU2n modificado LEU2ex∆BamHI (JME790). 4. Desarrollo del sistema de integración monocopia aleatorio con diferentes marcadores escindibles La construcción se ha realizado a partir de los diferentes marcadores escindibles existentes y de los marcadores obtenidos en la presente invención (Tabla 11). En una primera fase, se han construido los 2 vectores de base denominados I-SceI o JMP61 I-SceI y el JMP62 I- SceI. A partir de los vectores JMP61 leu2Ex y JMP62 leu2Ex que contienen el marcador escindible LEU2, se ha efectuado una PCR de la totalidad del plásmido con un par de cebadores: 62claS y 62claR (Tabla 9). Se ha utilizado el kit «QuikChange® Site-Directed Mutagenesis Kit» de Stratagene que permite efectuar unas mutaciones dirigidas. El principio, basado en la amplificación por PCR, utiliza unos cebadores construidos específicamente para forzar la mutación del producto de PCR. Habitualmente utilizado para cortas inserciones/deleciones o unas mutaciones puntuales, se ha utilizado este principio con el fin de eliminar el marcador Leu2Ex por recircularización del plásmido en el sitio I-SceI. Estos 2 cebadores se han construido también para eliminar los sitios BamHI y AvrII contenidos en el plásmido JMP61 Leu2Ex aguas arriba del sitio I-SceI y restaurar el sitio ClaI con el fin de permitir el intercambio del promotor por este único sitio. El producto de PCR obtenido es después digerido por la enzima de restricción DpnI que permite eliminar la hebra parental. Esta última, que proviene de una cepa de E. coli dam+ está metilada y, al contrario de la hebra nuevamente formada, será reconocida y digerida específicamente por la enzima DpnI. Después de la transformación y del cribado, se han obtenido los vectores JMP61 I-SceI y JMP62 I-SceI (Tabla 12).

Las otras construcciones (Tabla 12) se han realizado a partir de estos 2 plásmidos. Las ligaciones se han efectuado con los plásmidos digeridos por I-SceI y se han desfosforilado, y las bandas purificadas I-SceI de los diferentes marcadores escindibles a partir de los plásmidos pKS-LPR correspondientes (Tabla 11). Para el marcador escindible Leu2, se ha utilizado el plásmido JME790 que contiene el marcador LEU2n (Leu2∆BamHI).

Tabla 5: Cepas obtenidas: Cepa N° colección Genotipo

FF-lu

JMY 195, Po1d xpr2-322, leu2-270, ura3-302

FF2-lu

xpr2-322, leu2-958, ura3-302 JMY 1202 xpr2-322, leu2-270, ura3-302, gut2-PUexT

FF-lug

JMY 1346 xpr2-322, leu2-270, ura3-302, gut2-744 JMY 1407 xpr2-322, leu2-270, ura3-302, ade2-PUexT

FF-lua

JMY 1409 xpr2-322, leu2-270, ura3-302, ade2-844 JMY 1396 xpr2-322, leu2-270, ura3-302, gut2-744, ade2-PUexT

FF-luga

JMY 1404 xpr2-322, leu2-270, ura3-302, gut2-744, ade2-844

5LAsp1

1 copia ade2 :: GUT2-Asp

6LAsp1

1 copia ade2 :: GUT2-Asp

14LAsp2

2 copias ade2 :: GUT2-Asp lip2 :: URA3-Asp

15LAsp2

2 copias ade2 :: GUT2-Asp lip2 :: URA3-Asp

16LAsp2

2 copias ade2 :: GUT2-Asp lip2 :: URA3-Asp

17LAsp2

2 copias ade2 :: GUT2-Asp lip2 :: URA3-Asp

21LAsp2

2 copias ade2 :: GUT2-Asp lip2 :: URA3-Asp

1LAsp3

3 copias ade2 :: GUT2-Asp lip2 :: URA3-Asp leu2 :: ADE2-Asp.

2LAsp4

4 copias ade2 :: GUT2-Asp lip2 :: URA3-Asp leu2 :: ADE2-Asp ura3 :: LEU2-Asp 5. Construcción de los vectores de base, de clonación y de expresión.

5.1 Vectores de base y de clonación. La construcción del vector de base se ha realizado a partir del vector JMP62 conservando sólo la parte lanzadera E. coli que proviene del plásmido pHSS6. Después de la digestión por NotI del vector JMP62, la banda de 2210 pb que contiene el origen de replicación para E. coli y la resistencia a la Kanamicina, se ha aislado y purificado y después se ha religado para formar así el vector de base denominado pHSS6-NotI (JME800). A partir del vector de base, se ha construido el vector de clonación (figura 2) por ligación de 2 "linkers" y de un fragmento de PCR que contiene las secuencias de terminación de la lipasa LIP2 de Y. lipolytica contenida en el vector JMP62. Los "linkers" se han realizado por síntesis de un par de cebador fosforilo en 5', es decir el "linker" 1 con los cebadores link1 y link11 y el "linker" 2 con los cebadores link2 y link22 (Tabla 10). Estos "linkers" crean un multisitio de clonación que contiene respectivamente los sitios ClaI y BamHI para la inserción de un promotor, los sitios BamHI/HindIII y SacII/KpnI/AvrII para la inserción del gen de interés. Se ha introducido también una secuencia «consensus» en -4 y -1 del ATG: C-4 A C A-1. Esta secuencia está presente para los genes de Y. lipolytica que codifican para unas proteínas fuertemente expresadas. Así, para una expresión con esta secuencia, la clonación del gen de interés se efectúa por HindIII y sin esta secuencia por BamHI en 5'. El fragmento de PCR (840 pb) que contiene las secuencias de terminación de LIP2 se ha obtenido con los cebadores POX2Xho y Lip2Thc. Este fragmento ha sido digerido por AvrII y NotI para obtener el fragmento de 179 pb que contiene sólo las secuencias de terminación de LIP2. Se ha añadido un sitio único HincII con el fin de permitir el intercambio de estas secuencias de terminación por AvrII y HincII. Se han introducido 2 sitios raros de la enzima de restricción I-CeuI a uno y otro lado del multisitio y de las secuencias de terminación. Este doble sitio I-CeuI permite aislar y purificar el casete de expresión para una clonación en unos vectores de integración.

Se ha realizado una ligación de 3 vías con los 2 "linkers", la banda de 179 pb AvrII/NotI y el vector de base pHSS6 NotI desfosforilado para obtener el vector de clonación denominado pVC (JME829). 5.2 Vector de expresión La construcción del vector de expresión se ha realizado a partir del vector de clonación pVC digerido por ClaI y BamHI. El promotor pPOX2 reducido (1017 pb) se ha aislado y purificado después de la digestión por ClaI y BamHI del vector JMP62 (Tabla 12). Se ha realizado una ligación del pVC y del promotor pPOX2 para obtener el vector de expresión denominado pVC-pPOX2 (JME830), Tabla 6.

Tabla 6: Vectores utilizados para la construcción del vector de expresión.

Descripción Nombre del vector N° de colección Vector de base pHSS6-NotI JME800 Vector de clonación pVC JME829 Vector de expresión pVC-pPOX2 JME830 6. Selección de los locus de inserción y principio de construcción de los vectores de integración.

Se han seleccionado los diferentes locus siguientes: 6.1 Locus Leu2-270 Se ha utilizado frecuentemente este locus como diana de integración homóloga por simple «crossing over» (por ejemplo Bordes et al., 2007), pero con este marcador genómico se obtiene una tasa elevada de conversión (corresponde a una pequeña deleción StuI de 681 pb que deja una región 5' de 401 pb (Yali0C:46411..46537) y una región 3' de 710 pb (Yali0C:46528..46948) que permite una doble recombinación con el marcador de selección LEU2 utilizado en los presentes vectores. Así, se observa generalmente una fuerte tasa de conversión durante las transformaciones del casete de expresión que contiene este marcador. Para disminuir la tasa de conversión, se ha elegido insertar en una primera etapa un casete de expresión en el locus leu2-270, con el fin de eliminar estas regiones de homología en 5' y 3'. Así, durante una inserción de un nuevo casete de expresión que contiene el marcador LEU2 en otro locus, la tasa de conversión ha disminuido mucho. Alternativamente, se puede construir una cepa con el marcador leu2-958, tal como se describe en el capítulo 3.

6.2 Locus Ura3-320 La deleción se ha realizado por doble "crossing-over" dejando sólo 21 pb en la posición 5' (Yali0E:3171873..3171893) y 108 pb en la posición 3' (Yali0E:3175134..3175241). El fragmento delecionado (695 pb) ha sido sustituido por el casete de expresión siguiente: promotor del gen XPR2 y el gen SUC2 que codifica para la invertasa de Saccharomyces cerevisiae en sentido inverso (3240 pb, Yali0E:3171894..3175133). La integración en este locus Ura3-320 permite eliminar el gen SUC2 que proviene de S. cerevisiae en la cepa de producción y efectuar un cribado simple y rápido de los transformantes Suc- (ausencia de crecimiento en medio que contiene sólo sacarosa como única fuente de carbono) tal como se describe en la figura 6.

6.3 Locus Lip2 El gen LIP2 codifica para la lipasa Lip2p de Y. lipolytica. Su expresión está inducida en presencia de ácido graso y de triglicéridos (Pignede et al., 2000). En la presente invención, la expresión de las proteínas de interés está colocada bajo el promotor fuerte e inducible pPOX2. Este promotor es también inducible por los ácidos grasos como el ácido oleico. La integración en el locus LIP2 permite invalidar el gen LIP2 y obtener la ausencia de expresión de la lipasa Lip2p en los sobrenadantes de cultivo durante la producción. Además, esto permite efectuar un cribado simple y rápido de los transformantes Lip2- (ausencia de degradación de una emulsión de tributirina visible en el medio agar o ausencia de actividad lipasa en el sobrenadante de cultivo, tal como se describe en la figura 7).

6.4 Locus Ade2 En la presente invención, se han construido nuevas cepas Ade-, así como el marcador de selección Ade2ex. Para la interrupción del gen ADE2 se han amplificado las secuencias P y T. Estas mismas secuencias se han utilizado por lo tanto en los vectores de integración. Así, no ha sido necesaria ninguna construcción suplementaria para este locus. Si la cepa receptora utilizada es FF-lug, la inserción en el locus ADE2 devuelve la Ade-, lo cual crea una nueva auxotrofia, que puede ser utilizada para introducir una copia suplementaria del gen de interés. Esta interrupción está también asociada a un fenotipo rápidamente identificable (coloración marrón de las colonias interrumpidas en medio rico en placa de Petri, coloración marrón del medio de cultivo). Esta lista o estas combinaciones de locus/marcador no son exhaustivas. Cualquier otra combinación es posible, preferentemente con un locus cuya interrupción crea un fenotipo rápidamente visualizable que permite un cribado rápido de los transformantes que han integrado correctamente el casete de expresión en el locus. Se puede seleccionar otro locus y otros marcadores o realizar otras combinaciones. 6.5 Principio de construcción de los vectores de integración El principio de la construcción de los vectores de integración está descrito en la figura 3. Los diferentes casetes de integración en unos locus definidos han sido construidos mediante una metodología idéntica. A partir del ADNg de la cepa E150, se ha amplificado la parte promotora denominada P y la parte terminadora denominada T del gen a interrumpir. Los fragmentos P y T deben, preferentemente, tener un tamaño comprendido entre 800 y 1000 pb para obtener una doble recombinación homóloga eficaz en Y. lipolytica. Los cebadores utilizados se denominan P1/P2 para el fragmento P y T1/T2 para el fragmento T seguido del nombre del locus (Tabla 9). Los cebadores P1 y T2 contienen un sitio raro 1, en este caso el sitio NotI, para permitir la clonación en el vector de base pHSS6-NotI y también para liberar el casete de expresión. Los cebadores P2 y T1 contienen otros dos sitios raros, los sitios raro 2 y raro 3, en este caso los sitios I-SceI y I-CeuI, respectivamente, lo cual permite la fusión por PCR de los 2 fragmentos y la clonación ulterior del marcador de selección en el sitio raro 2, en este caso el sitio I-SceI y del casete de expresión en el sitio raro 3, en este caso el sitio I-CeuI. La fusión por PCR está por lo tanto bien realizada a partir de una mezcla de los 2 fragmentos P y T purificados y del par de cebadores P1/T2. El fragmento PT obtenido es digerido por NotI y después se clona por ligadura en el vector pHSS6 digerido por NotI y desfosforilado. Los vectores de integración se denominan pPT seguido del nombre del locus (Tabla 7). Descripción de los fragmentos P y T de los diferentes locus: Locus Leu2-270: Las regiones amplificadas para la doble recombinación homóloga son para la región P de 1092 pb (Yali0C:44989..46081) y para la región T de 897 pb (Yali0C:47036..47932). La región que se eliminará es de 954 pb (Yali0C:46082..47035). Esta región elimina la totalidad de la región 5' del marcador Leu2 (401pb) y una parte de la región 3' (503pb). Permanece una homología de 207 pb de la región 3' del marcador Leu2.

Locus Ura3-302: Las regiones amplificadas para la doble recombinación homóloga son para la región P de 1197 pb (Yali0E:3170698..3171894) y para la región T de 1013 pb (Yali0E:3175412..3176424). La región que se eliminará es de 3516 pb (Yali0E:3171895..3175411). Esta región elimina la totalidad del casete de expresión pXPR2+SUC2 y la región 3' del marcador Ura3 (280 pb). Permanece una homología de 200 pb de la región 5' del marcador Ura3. Locus Lip2: Las regiones amplificadas para la doble recombinación homóloga son para la región P de 1123 pb (Yali0A:2185897..2187019) y para la región T de 961 pb (Yali0A:2187883..2188843). La región que se eliminará es de 863 pb (Yali0C:2187020..2187882). Esta región elimina casi la totalidad del gen LIP2. Permanece una homología de la región 3' de 148 pb del gen LIP2. Locus Ade2: Las regiones amplificadas para la doble recombinación homóloga son para la región P de 920 pb (Yali0B:3029011..3029931) y para la región T de 792 pb (Yali0B:3031871..3032662). La región que se eliminará es de 1939 pb (Yali0B:3029932..3031870) que deja sólo una homología muy reducida con el marcador de selección ADE2ex (O bp con la región P y 415 bp en la región T) con el fin de minimizar las conversiones génicas.

Para cada locus, se han amplificado las regiones P y T con la ayuda del par de cebadores denominado P1/P2 y T1/T2 seguido del nombre del locus (Tabla 9). Después, se ha realizado la fusión PT con el par P1/T2.

A partir de estos vectores pPT, se han introducido diferentes marcadores escindibles por clonación al sitio I-SceI. Este sitio permite una clonación orientada del marcador. Se ha elegido orientar el marcador en el sentido inverso del casete de expresión. Los vectores de integración obtenidos se denominan pPT seguido del nombre del locus seguido del nombre del marcador escindible insertado (Tabla 7).

Las combinaciones locus/marcador se dan sólo a título de ejemplo, son posibles diferentes combinaciones.

Tabla 7: lista de los vectores de integración

Locus

Nombre Orientación N° colección Marcador Nombre del vector N° colecció n del vector 1-Scel

LIP2

pPTLip2 Sens 1 JME806 URA3ex pPTLip2-Ura3ex JME815 GUT2-0.5ex pPTLip2-Gut2-0.5ex JME816 Sens 2 JME807

URA3

pPTUra3 Sens 1 JME809 LEU2nex pPTUra3-Leu2nex JME817 Sens 2 JME810

LEU2

pPTLeu2 Sens 1 JME811 ADE2ex pPTLeu2-Ade2ex JME818 URA3ex pPTLeu2-Ura3ex JME958 Sens 2 JME812

ADE2

pPTAde2 Sens 1 JME813 GUT2-0.5ex pPTAde2-Gut2-0.5ex JME819 URA3ex pPTAde2-Ura3ex JME844 Sens 2 JME814 JME814 7. Principio de construcción de los vectores de integración para la expresión de proteína de interés. La clonación de un gen de interés se realiza sólo en 2 etapas de clonación. La primera etapa es una sub-clonación en el vector de expresión pVC para obtener el vector pVC-gen de interés bajo el control del promotor POX2 (pueden ser utilizados otros promotores fuertes tales como por ejemplo el promotor hp4d o unos promotores inducibles). Este vector pVC-gen de interés está digerido por I-CeuI para aislar y purificar el casete de expresión. La segunda etapa es la clonación de este casete de expresión I-CeuI en los vectores de integración. El casete de integración/casete de expresión se aísla y se purifica después de la digestión por NotI antes de la transformación en Y. lipolytica (Figura 3).

Ejemplo 2: Construcción y utilización de un casete de integración/expresión para la inserción localizada de un gen que codifica para una proteína de interés terapéutico no producida por Y. lipolytica. Se ha tomado como ejemplo la proteína L-asparaginasa de Erwinia chrysanthemi.

Se introduce el gen que codifica para esta proteína en el vector pVC-pPOX2 en el sitio HindIII/AvrII. Para ello, se realiza una fusión por PCR entre la secuencia preproLIP2 y la parte de la secuencia del gen que codifica para la forma madura de la proteína L-asparaginasa. Las PCR se realizan con los cebadores preproLip2 y Lip2KR para amplificar la secuencia pre-pro-LIP2 y con los cebadores Laspsens y Lasprev para amplificar la secuencia que codifica para la proteína madura. Después, mezclando los 2 productos de PCR obtenidos, se realiza la fusión con los cebadores preproLip2 y Lasprev. El cebador preproLip2 contiene el sitio HindIII y el cebador Lasprev el sitio AvrII para la clonación del producto de la fusión en el pCV-pPOX2. Se obtiene entonces el vector pVC-pPOX2-preproLip2- LAsp (JME898) que contiene el casete de expresión de la proteína L asparaginasa (Tabla 8). A partir de este vector, se extrae el casete de expresión gracias a una digestión por la enzima de restricción I-CeuI y se purifica. Este casete se inserta entonces en los diferentes vectores de integración en el sitio I-CeuI. Los diferentes vectores de integracion/expresión obtenidos se describen en la Tabla 8.

Tabla 8: Vector de integración/expresión obtenido: Descripción Nombre del vector N° colección Vector de expresión pVC=pPOX2-LAsp JME898 Vector Int. locus Ura3 pPTUra3-Leu2nEx-LAsp JME923 Vector Int. locus Ade2 pPTAde2-Gut2-0.5Ex-LAsp JME924 Vector Int. locus Ade2 pPTAde2-Ura3Ex-LAsp JME925 Vector Int. locus Leu2 pPTLeu2-Ade2Ex-LAsp JME926 Vector Int. locus Lip2 pPTLip2-Ura3Ex-LAsp JME927 Vector Int. locus Ade2 pPTAde2-Gut2-10Ex(s1)-LAsp JME941 Vector Int. locus Ade2 pPTAde2-Gut2-1.0Ex(s2)-LAsp JME942 Vector Int. locus Ade2 pPTAde2-Gut2-1.5Ex(s1)-LAsp JME943 Vector Int. locus Ade2 pPTAde2-Gut2-l .SEx(s2)-LAsp JME944 Los casetes de integración/expresión se obtienen por digestión de la enzima de restricción NotI de los diferentes vectores de integración/expresión. Estos casetes son después extraídos y purificados con el fin de eliminar las secuencias de ADN exógeno E coli.

Ejemplo 3: Transformación de los casetes de integración/expresión de la proteína L-asparaginasa en Y. lipolytica. Se pueden introducir sucesivamente por ejemplo 4 copias del casete de expresión de la L-asparaginasa en los 4 locus antes citados en la cepa FF-luga. 1 Inserción de la primera copia en el locus ADE2. El primer casete de expresión se ha introducido por transformación de la cepa FF-luga en el locus ADE2 utilizando el casete de integración/expresión PTAde2-Gut2-1.0Ex-LAsp procedente del vector JME941. La selección de los transformantes se realiza sobre un medio selectivo YNBcasa suplementado con uracilo y con adenina y que contiene como única fuente de carbono un 1% de glicerol. Los transformantes obtenidos son insertados en este mismo medio selectivo y se verifica la integración en el locus por PCR utilizando los cebadores Verlade2 y Ver2ade2 que se encuentran aguas arriba y aguas abajo de las secuencias de integración.

La tasa de transformación obtenida es de 8,2·103 transformantes por µg de ADN transformado. La verificación por PCR de la integración en el locus Ade2 ha mostrado que el 100% de los transformantes han integrado el casete de expresión LAsp de este locus.

Se han conservado 2 transformantes denominados 5LAsp1 y 6LAsp1 (tabla 5). Las primeras cifras al principio del nombre dan el número del transformante y la segunda cifra al final del nombre da el número de copia del casete de expresión LAsp. 2 Inserción de la segunda copia en el locus LIP2.

El segundo casete de expresión se ha introducido por transformación del transformante 5LAsp1 en el locus LIP2 utilizando el casete de integración/expresión PTLip2-Ura3Ex-LAsp procedente del vector JME927. La selección de los transformantes se realiza sobre un medio selectivo YNBcasa suplementado con adenina y que contiene como única fuente de carbono un 1% de glucosa. Los transformantes obtenidos son aislados sobre este mismo medio selectivo y la integración en el locus se verifica por PCR utilizando los cebadores Ver1lip2 y Ver2lip2 que se encuentran aguas arriba y aguas abajo de las secuencias de integración. La tasa de transformación obtenida es de 1,1·104 transformantes por µg de ADN transformado. La verificación por PCR de la integración en el locus LIP2 ha mostrado que el 75% de los transformantes han integrado el casete de expresión LAsp en este locus. Alternativamente, la verificación de la integración del casete de expresión en el locus LIP2 se puede realizar por medición de la actividad lipasa, tal como se muestra en la figura 7. Se han conservado 5 transformantes denominados 14LAsp2, 15LAsp2,16LAsp2, 17LAsp2 y 21 LAsp2 (Tabla 5).

3 Inserción de la tercera copia en el locus LEU2. El tercer casete de expresión se ha introducido por transformación del transformante 15LAsp2 en el locus LEU2 utilizando el casete de integración/expresión PTLeu2-Ade2Ex-LAsp procedente del vector JME926. La selección de los transformantes se realiza sobre un medio selectivo YNBcasa que contiene como única fuente de carbono un 1% de glucosa. Los transformantes obtenidos son aislados sobre este mismo medio selectivo y se verifica la integración en el locus por PCR utilizando los cebadores Ver1leu2 y Ver2leu2 que se encuentran aguas arriba y aguas abajo de las secuencias de integración. La tasa de transformación obtenida es de 1,6·104 transformantes por µg de ADN transformado. La verificación por PCR de la integración en el locus LEU2 ha mostrado que el 20% de los transformantes han integrado el casete de expresión LAsp en este locus. Se ha conservado 1 transformante denominado 1LAsp3 (Tabla 5).

4 Inserción de la cuarta copia en el locus URA3. El cuarto casete de expresión se ha introducido por transformación del transformante 1LAsp3 en el locus URA3 utilizando el casete de integración/expresión PTUra3-Leu2nEx-LAsp procedente del vector JME923. La selección de los transformantes se realiza sobre un medio selectivo YNB que contiene como única fuente de carbono un 1% de glucosa. Los transformantes obtenidos son aislados sobre este mismo medio selectivo y se verifica la integración en el locus por PCR utilizando los cebadores Ver1Ura3 y Ver2Ura3 que se encuentran aguas arriba y aguas abajo de las secuencias de integración. La tasa de transformación obtenida es de 5,25·103 transformantes por µg de ADN transformado. La verificación por PCR de la integración en el locus URA3 ha mostrado que el 87% de los transformantes han integrado el casete de expresión LAsp en este locus, el 87% de los transformantes son Ura- (figura 6).

Se ha conservado 1 transformante denominado 2LAsp4 (Tabla 5). Esta última cepa contiene bien por lo menos una copia suplementaria (véase la figura 5 (gel electroforesis) y la figura 8 cuantificación por RT-qPRC. 5 Variante del procedimiento de inserción: La invención también puede ser realizada según las etapas siguientes: en una primera fase, las 4 (por ejemplo) transformaciones se realizan unas detrás de otras. En una segunda fase, se realiza el cribado de las inserciones con la ayuda de los diferentes marcadores. De allí el interés, si no se utiliza el sistema Cre-lox, de detener tantos sistemas de cribado diferentes como copias a integrar. Ejemplo 4: Análisis de la expresión de L-Asparaginasa en función del número de copia integrada.

La expresión de L-Asparaginasa se ha analizado en producción a partir de los diferentes transformantes obtenidos que contienen 1 a 4 copias. La producción se ha realizado en matraz de 250 ml que contiene 25 ml de medio rico de compuesto de Yeast Extract al 1%, de Bacto Tryptone al 2%, Glucosa al 1%, tampón fosfato de sodio 50 mM pH 6,8 y de una emulsión ácido oleico al 2% (denominado Y1T2D1O2). El ácido oleico sirve de inductor del promotor pPOX2. La expresión se analiza por gel de electroforesis en condiciones desnaturalizante y reductora a partir del sobrenadante de los cultivos. El gel de electroforesis se revela por coloración con azul coloidal y por transferencia western utilizando unos anticuerpos policlonales de conejo dirigidos contra L-Asparaginasa. Los resultados de este análisis se presentan en la figura 5.

Ejemplo 5: Cribado sobre placa de los transformantes obtenidos por inserción del casete integración/expresión en el locus URA3. Como se ha descrito anteriormente, la inserción en el locus URA3 permite eliminar el gen heterólogo SUC2 que codifica para la invertasa de S. cerevisiae. Los transformantes que han integrado el casete de expresión se vuelven entonces Suc2-. Ya no son capaces de crecer sobre sacarosa como única fuente de carbono. Los transformantes se extienden en estría sobre 2 medios ricos: YPD (glucosa al 1%) y YPS (sacarosa al 1%). Los resultados de este análisis se presentan en la figura 6. Para este cribado, se confirman los resultados obtenidos mediante análisis por PCR con los cebadores Ver1Ura3 y Ver2Ura3.

Ejemplo 6: Cribado de los transformantes obtenidos por inserción del casete integración/expresión en el locus LIP2. Como se ha descrito anteriormente, la inserción en el locus LIP2 permite eliminar el gen LIP2 que codifica para la lipasa lip2p extracelular de Y. lipolytica. Los transformantes que han integrado el casete de expresión se vuelven entonces Lip2-. Durante una producción en un medio que contiene un inductor como el ácido oleico, los transformantes no segregan ya la lipasa en el sobrenadante de cultivo. El cribado se efectúa por cultivo en un medio de producción Y1T2D1O2 durante 48 horas a 28°C y po r una agitación de 180 rpm. La presencia de la lipasa en el sobrenadante se detecta mediante un ensayo enzimático en microplaca a partir de 20 µl de sobrenadante. Los resultados de este análisis se presentan en la figura 7. Mediante este cribado, se confirman los resultados obtenidos por análisis por PCR con los cebadores Ver1Lip2 y Ver2Lip2. Ejemplo 7: Análisis de los transformantes obtenidos por RT-qPCR. El número de copias integradas se puede analizar por una PCR cuantitativa en tiempo real por amplificación específica de un amplicón (150 pb) del gen que codifica para la L-Asparaginasa. A partir de ADNg de los transformantes obtenidos, se ha efectuado una RT-qPCR con la ayuda de los cebadores LAsp1 y LAsp2 específica del gen que codifica para L-Asparaginasa y de los cebadores Act4 y Act5 específica del gen que codifica para la actina de Y. lipolytica. Esta RT-qPCR se ha realizado con la ayuda del kit LightCycler Faststart DNA Master SyBR Green I (Roche). El amplicón de la actina permite ser un gen denominado doméstico cuya expresión es conocida por no ser modificada en las condiciones ensayadas, y en este caso un gen presente en única copia en el genoma. Así, los resultados se normalizan con este amplicón. Se ha efectuado también una RT-qPCR con la ayuda de los cebadores Lip2-1 y Lip2-2 específica del gen que codifica para la lipasa Lip2p de Y. lipolytica para verificar la ausencia del gen a partir del segundo casete de expresión integrado en el locus LIP2. Los resultados de este análisis se presentan en la figura 8.

Tabla 9: Listas de los cebadores utilizados para los casetes de interrupción, las verificaciones y la construcción de nuevos marcadores.

Cebador 5'-3' S/R Sitios Leu2EX LEU2-L1 GATCTGCTAGTGTATAAGACTCTATAAAAAGGGCC S ∆BamHI LEU2-L2 CTTTTTATAGAGTCTTATACACTAGCA R ∆BamHI Cebador 5'-3' S/R Sitios Marcador PG3PTS CCGGAATTCCTGACCAGTCTCACATCCGACC S EcoRI GUT2 PG3PTR CCGGAATTCTAAAGCAGATACTCAACAACTCAGCAATAGTC R EcoRI G3PB1S GGAGCTACCGGCTCCGGTATCGC S ∆BamHI G3PB1R GCGATACCGGAGCCGGTAGCTCC R ∆BamHI G3PB2S CGGAAACGCTGGATCTTTCAACATCAAGGCC S ∆BamHI G3PB2R GGCCTTGATGTTGAAAGATCCAGCGTTTCCG R ∆BamHI G3PES GGAGCAGGAGTTCAACACCGGTGTCG S ∆EcoRI G3PER CGACACCGGTGTTGAACTCCTGCTCC R ∆EcoRI ∆GUT2 G3PD-P1 GCAGATCCACTGTCAAGCCG S G3PD-P2 GCTAGGGATAAACAGGGTAATGCGGTAGGAAAGAGAAGTTCCGC R I-SceI G G3PD-T1 GCATTACCCTGTTATCCCTAGCCGGACTATTTCCCCGCAGC S I-SceI G3PD-T2 GCAGCCAGCAGCACGTAGTAG R G3PD-Ver1 GAATGACGGGGGCAACGCAG S G3PD-Ver2 CAGCAGCCACAAATAGCAGACTGCC R pGUT2-1.0 P1KB CCGGAATTCCGTGACAACGGATGATGCTGTCACATGACG S EcoRI y 1.5 P15KB CCGGAATTCCTGTTGGCATGCACAGCTCCACTCAACG S EcoRI PNHE1 TCCCGCTAGCCGAGGTATGCAAGGACGAGTGC R NheI Locus ADE2 P1ADE2 ATAAGAATGCGGCCGCGCGAGCTGAGAGCCGATACCAAGGGAT S NotI GCGAG P2ADE2 CATTACCCTGTTATCCCTACAGACACAGGTCCCAGGCGTCGGTT R I-SceI CTCG T1ADE2 S I-SceI/I-CeuI T2ADE2 ATAGTTTAGCGGCCGCGGAAGCGTGTCAACGACATGTTCCCTCT R NotI TCATACC Ver1Ade2 CGACGATAGAGCAGGTCTCACTOTTGGGAATGCTG S Ver2Ade2 CTACAGTGACGAAGTGGACATCCCGGCTTGGACTG R Marcador ADE2S CGCGAATTCGCCTGCTTGAAAGAAGTGAGTGGTATGCTCGG S EcoRI ADE2 ADE2R CGCGAATTCCATTGCCACGACCTGTTAAAAGACAAGATGACC R EcoRI ADE2ES GCTGGCCATCCGAATCCTGGCTGCTTACGACGCC S ∆EcoRI ADE2ER GGCGTCGTAAGCAGCCAGGATTCGGATGGCCAGC R ∆EcoRI Locus Lip2 P1Lip2 ATAAGAATGCGGCCGCGTGGTACGTTTCGTCGCATCGGACGAG S NotI P2Lip2 CATTACCCTGTTATCCCTAGAGAGCTGGTACTTGGGTATCAATTG R I-SceI AGG T1Lip2 S I-SceI/I-CeuI T2Lip2 ATAGTTTAGCGGCCGCGTGGACACAAGGAAGTATGCGGTCGTCG R NotI Lip2Ver1 CTCTGTCAGTGTTCGGATAAGTCCTTAGATCACC S Lip2Ver2 CCTCACTTCTGTCACAGATGATGCATTCAACAC R Locus Leu2 P1Leu2 ATAAGAATGCGGCCGCGACACTACTCTGGCTACAGCTTGCGGTA S NotI CTG P2Leu2 CATTACCCTGTTATCCCTAGCTCGAATAACATTCACAGGCTTGGT R I-SceI G T1Leu2 CTAGGGATAACAGGGTAATTAACTATAACGGTCCTAAGGTAGCGA S I-Scel/I-CeuI GGTGT GTTTGTAGTGGAGGACAGTGGTACG T2Leu2 ATAGTTTAGCGGCCGCGTACTGAACCGACTTTGGTGCTTGCACT R NotI C Leu2Ver1 CTCCACGCTAATGCCCATCATACTCTGTTTGGC S Leu2Ver2 CCTGGCGTTACAAAGCCGAGGGAGACAGCCTTGAC R Locus Ura3 P1Ura3 ATAAGAATGCGGCCGCGGTGACACTGCACTATTGGTTTGCTTCT S NotI GATG P2Ura3 CATTACCCTGTTATCCCTAGTCGAGCTTCGTAGGAGGGCATTTTG R I-SceI GTGG T1Ura3 S I-SceI/I-CeuI T2Ura3 ATAGTTTAGCGGCCGCCTATGCTACGAGCGTCGGATTCACCACA R NotI G Ura3Ver1 GGCACACTGCTCACTATCGCAGGCTGCAACAATG S Ura3Ver2 CCTGACTCGTCTCGATACTCAAGACCTCATTGACGC R Tabla 10: Lista de los cebadores utilizados para la construcción del vector pVC y la PCR cuantitativa, RT-qPCR.

Cebador 5'-3' S/R Sitios

Poli linker

Link1 GGCCGCTAACTATAACGGTCCTAAGGTAGCG S

pVC

Link11 CCGAATCGATTCGCTACCTTAGGACCGTTATAGTTAGC R Link2 AATCGATTCGGATCCCACAATGAAGCTTCCCCGCGGTAC S Link22 CTAGGTACCGCGCGGAAGCTTCATTGTGGGAT R Lip2Thc TATCAAATGCGGCCGCTTCGCTACCTTAGGACCGTTATAGT R NotI TAACACGATTCGATTTGTCTTAGAGGAACGC POX2Xh o GAGTAATGCTCGAGTATCGAAGTCTTGTACC S XhoI

JMP62

62claS S

ISceI

62claR CACTTGTTCGTCTTGTGGGAATCGATTCTAGGGATAACAGGGT R AATATCGC

Gen

preproLi p2 CGCGGATCCCACAATGAAGCTTTCCACCATCCTTTTCACAGCC S BamHI

LAsp

TGCGCTAC HindIII Lip2KR TCGCTTCTGGAGAACTGCGGCCTC R LAspsen s S LAsprev CCACCTAGGCTAGTAGGTGTGGAAGTACTCCTGGATG R AvrII

qPCR

LIP2-1 TACTCTTGGTCAGCCCAT S

Lip2

LIP2-2 AGAAGGGCACTTGAGGGA R

qPCR

Act4 TATTGCCGAGCGAATGC S

Act

Act5 CTTGGAGATCCACATCTGC R

qPCR

LAsp1 GCTGAACGACCGAATTGG S

LAsp

LAsp2 GTGGTGTGCAGCTTGTC R Tabla 11: Lista de los marcadores escindibles construidos.

Marcador Nombre del vector N° colección ADE2 pKS-LPR-Ade2 (sentido 1) JME798 pKS-LPR-Ade2 (sentido 2) JME799 GUT2-0.5 pKS-LPR-Gut2-0.5 (sentido 1) JME792 GUT2-1.0 pKS-LPR- Gut2-1.0 (sentido 1) JME919 pKS-LPR- Gut2-1.0 (sentido 2) JME920 GUT2-1.5 pKS-LPR-Gut2-1.5 (sentido 1) JME921 pKS-LPR- Gut2-1.5 (sentido 2) JME922 LEU2 pKS-LPR-Leu2 (sentido 2)* JME509 LEU2n pKS-LPR-Leu2∆BamHI (sentido 2) JME790 URA3 pKS-LPR-Ura3 (sentido 1)* JME507 HYG pKS-LPR-hph (sentido 2)* JME508

* Fickers et al., Journal of Microbiological Methods 55 (2003) 727-737 Tabla 12: Lista de los vectores de integración aleatoria, series JMP61 y JMP62.

Nombre del vector N° colección JMP61 I-SceI JME793 JMP61 Leu2nEx JME794 JMP61 Ura3Ex JME795 JMP61 HygEx JME796 JMP61 Gut2-0.5Ex JME797 JMP61 Ade2Ex JME861 JMP62 I-Scel JME801 JMP62 Leu2nEx JME802 JMP62 Ura3Ex JME803 JMP62 HygEx JME804 JMP62 Gut2-0.5Ex JME805 JMP62 Ade2Ex JME862

Listado de secuencias <110> INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE (INRA) NICAUD, Jean-Marc FUDALEJ, Franck NEUVEGLISE, Cecile BECKERICH, Jean-Marie <120> PROCEDIMIENTO DE INTEGRACIÓN LOCALIZADA DE MÚLTIPLES COPIAS DE UN GEN DE INTERÉS EN UNA CEPA DE YARROWIA

<130> 354141D26198 <150> FR 0850736 <151> 2008-02-05 <160> 77 <170> PatentIn versión 3.3 <210> 1 <211> 4844 <212> ADN <213> Yarrowia lipolytica <400> 1 <210> 3 <211> 1698 <212> ADN <213> Yarrowia lipolytica <400> 3 <210> 4 <211> 1839 <212> ADN <213> Yarrowia lipolytica <400> 4 <210> 5 <211> 5304 <212> ADN <213> Yarrowia lipolytica <400> 5 <210> 7 <210> 9 <211> 173 <212> PRT <213> Erwinia chrysanthemi <400> 9 <210> 10 <211> 348 <212> PRT <213> Escherichia coli <400> 10 <210> 11 <211> 109 <212> ADN <213> secuencia artificial <220> <223> Fragmento de PCR <400> 11 <210> 12 <211> 98 <212> ADN <213> secuencia artificial <220> <223> Fragmento de PCR <400> 12 <210> 13 <211> 35 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 13 gatctgctag tgtataagac tctataaaaa gggcc <210> 14 <211> 27 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 14 ctttttatag agtcttatac actagca 27 <210> 15 <211> 31 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 15 ccggaattcc tgaccagtct cacatccgac c 31 <210> 16 <211> 41 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 16 ccggaattct aaagcagata ctcaacaact cagcaatagt c 41 <210> 17 <211> 23 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 17 ggagctaccg gctccggtat cgc 23 <210> 18 <211> 23 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 18 gcgataccgg agccggtagc tcc 23 <210> 19 <211> 31 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 19 cggaaacgct ggatctttca acatcaaggc c 31 <210> 20 <211> 31 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 20 ggccttgatg ttgaaagatc cagcgtttcc g 31 <210> 21 <211> 26 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 21 ggagcaggag ttcaacaccg gtgtcg 26 <210> 22 <211> 26 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 22 cgacaccggt gttgaactcc tgctcc 26 <210> 23 <211> 20 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 23 gcagatccac tgtcaagccg <210> 24 <211> 45 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 24 gctagggata aacagggtaa tgcggtagga aagagaagtt ccgcg <210> 25 <211> 41 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 25 gcattaccct gttatcccta gccggactat ttccccgcag c 41 <210> 26 <211> 21 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 26 gcagccagca gcacgtagta g 21 <210> 27 <211> 20 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 27 gaatgacggg ggcaacgcag <210> 28 <211> 25 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 28 cagcagccac aaatagcaga ctgcc <210> 29 <211> 39 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 29 ccggaattcc gtgacaacgg atgatgctgt cacatgacg 39 <210> 30 <211> 37 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 30 ccggaattcc tgttggcatg cacagctcca ctcaacg 37 <210> 31 <211> 32 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 31 tcccgctagc cgaggtatgc aaggacgagt gc 32 <210> 32 <211> 48 <212>. ADN <213> secuencia artificial <220> <223> cebador PCR <400> 32 ataagaatgc ggccgcgcga gctgagagcc gataccaagg gatgcgag 48 <210> 33 <211> 48 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 33 cattaccctg ttatccctac agacacaggt cccaggcgtc ggttctcg 48 <210> 34 <211> 77 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 34 <210> 35 <211> 51 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 35 atagtttagc ggccgcggaa gcgtgtcaac gacatgttcc ctcttcatac c 51 <210> 36 <211> 35 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 36 cgacgataga gcaggtctca ctgttgggaa tgctg <210> 37 <211> 35 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 37 ctacactgac gaagtggaca tcccggcttg gactg <210> 38 <211> 41 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 38 cgcgaattcg cctgcttgaa agaagtgagt ggtatgctcg g 41 <210> 39 <211> 42 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 39 cgcgaattcc attgccacga cctgttaaaa gacaagatga cc 42 <210> 40 <211> 34 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 40 gctggccatc cgaatcctgg ctgcttacga cgcc 34 <210> 41 <211> 34 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 41 ggcgtcgtaa gcagccagga ttcggatggc cagc 34 <210> 42 <211> 43 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 42 ataagaatgc ggccgcgtgg tacgtttcgt cgcatcggac gag 43 <210> 43 <211> 48 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 43 cattaccctg ttatccctag agagctggta cttgggtatc aattgagg 48 <210> 44 <211> 71 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 44 <210> 45 <211> 44 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 45 atagtttagc ggccgcgtgg acacaaggaa gtatgcggtc gtcg 44 <210> 46 <211> 34 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 46 ctctgtcagt gttcggataa gtccttagat cacc 34 <210> 47 <211> 33 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 47 cctcacttct gtcacagatg atgcattcaa cac 33 <210> 48 <211> 47 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 48 ataagaatgc ggccgcgaca ctactctggc tacagcttgc ggtactg 47 <210> 49 <211> 46 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 49 cattaccctg ttatccctag ctcgaataac attcacaggc ttggtg 46 <210> 50 <211> 75 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 50 <210> 51 <211> 45 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 51 atagtttagc ggccgcgtac tgaaccgact ttggtgcttg cactc <210> 52 <211> 33 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 52 ctccacgcta atgcccatca tactctgttt ggc 33 <210> 53 <211> 35 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 53 cctggcgtta caaagccgag ggagacagcc ttgac <210> 54 <211> 48 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 54 ataagaatgc ggccgcggtg acactgcact attggtttgc ttctgatg 48 <210> 55 <211> 49 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 55 cattaccctg ttatccctag tcgagcttcg taggagggca ttttggtgg 49 <210> 56 <211> 70 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 56 <210> 57 <211> 45 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 57 atagtttagc ggccgcctat gctacgagcg tcggattcac cacag <210> 58 <211> 34 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 58 ggcacactgc tcactatcgc aggctgcaac aatg 34 <210> 59 <211> 36 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 59 cctgactcgt ctcgatactc aagacctcat tgacgc 36 <210> 60 <211> 31 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 60 ggccgctaac tataacggtc ctaaggtagc g 31 <210> 61 <211> 38 <212> ADN <213> artificiel sequence <220> <223> cebador PCR <400> 61 ccgaatcgat tcgctacctt aggaccgtta tagttagc 38 <210> 62 <211> 39 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 62 aatcgattcg gatcccacaa tgaagcttcc ccgcggtac 39 <210> 63 <211> 32 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 63 ctaggtaccg cggggaagct tcattgtggg at 32 <210> 64 <211> 72 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 64 <210> 65 <211> 31 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 65 gagtaatgct cgagtatcga agtcttgtac c 31 <210> 66 <211> 51 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 66 gcgatattac cctgttatcc ctagaatcga ttcccacaag acgaacaagt g 51 <210> 67 <211> 51 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 67 cacttgttcg tcttgtggga atcgattcta gggataacag ggtaatatcg c 51 <210> 68 <211> 51 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 68 cgcggatccc acaatgaagc tttccaccat ccttttcaca gcctgcgcta c 51 <210> 69 <211> 24 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 69 tcgcttctgg agaactgcgg cctc 24 <210> 70 <211> 52 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 70 gaggccgcag ttctgcagaa gcgagccgac aagctgccca acattgtgat tc 52 <210> 71 <211> 37 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 71 ccacctaggc tagtaggtgt ggaagtactc ctggatg 37 <210> 72 <211> 18 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 72 tactcttggt cagcccat 18 <210> 73 <211> 18 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 73 agaagggcac ttgaggga 18 <210> 74 <211> 17 <212> ADN <213> secuencia artificial <220> <223> amorcé PCR <400> 74 tattgccgag cgaatgc 17 <210> 75 <211> 19 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 75 cttggagatc cacatctgc 19 <210> 76 <211> 18 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 76 gctgaacgac cgaattgg 18 <210> 77 <211> 17 <212> ADN <213> secuencia artificial <220> <223> cebador PCR <400> 77 gtggtgtgca gcttgtc 17

REIVINDICACIONES

1. Procedimiento de integración localizada de por lo menos tres copias de un gen de interés en el genoma de una cepa de Yarrowia que comprende las etapas de: a) puesta en cultivo de una cepa de Yarrowia que comprende por lo menos tres deleciones seleccionadas de entre Ura3-302, Leu2-270, Gut2-744 y Ade2-844, correspondiendo el fenotipo asociado a cada una de estas deleciones a una auxotrofia para dicha cepa, independientemente el uno del otro de estos por lo menos tres genes; b) transformación de dicha cepa de Yarrowia auxótrofa con por lo menos tres vectores recombinantes que comprenden unos marcadores de selección que permiten, para dicha cepa de Yarrowia, la complementación de la auxotrofia resultante de cada una de dichas deleciones, comprendiendo dichos vectores recombinantes cada uno: i) la secuencia de dicho gen de interés, ii) un marcador de selección, y iii) dos secuencias de ADN que enmarcan la secuencia de dicho gen de interés y dicho marcador de selección, siendo dichas secuencias de ADN homólogas a las secuencias que corresponden a los extremos del sitio de integración localizado en el genoma de dicha cepa de Yarrowia de manera que se permita la integración localizada de dicho vector recombinante por recombinación homóloga; selección sobre un medio mínimo, de las levaduras que han integrado dichos por lo menos tres vectores recombinantes.

2. Procedimiento de integración localizada según la reivindicación 1, caracterizado por que dicha cepa comprende además una deleción de un gen asociado a un carácter dominante seleccionado de entre el gen de resistencia a la higromicina HPH (HYG), y los genes MDR3, KanMX, y Tn5ble, siendo el gen HYG el más preferido. 3. Procedimiento de integración localizada según una de las reivindicaciones 1 o 2, caracterizado por que en la etapa b), el sitio de integración localizado en el genoma de dicha cepa de Yarrowia se selecciona de entre los genes URA3, LEU2, ADE2, LIP2, LIP7, LIP8, AXP, GUT2 y XPR2.

4. Procedimiento de integración localizada según la reivindicación 3, caracterizado por que en la etapa b), el sitio de integración localizado en el genoma de dicha cepa Yarrowia se selecciona de entre los genes URA3, LEU2, ADE2, LIP2, LIP8 y AXP.

5. Procedimiento según cualquiera de las reivindicaciones 1 a 4, caracterizado por que las etapas b) de transformación de la cepa de Yarrowia y c) de selección sobre el medio mínimo se efectúan separadamente para cada uno de dichos por lo menos tres vectores recombinantes. 6. Procedimiento de integración localizada según una de las reivindicaciones 1 a 4, caracterizado por que en la etapa b), las transformaciones con por lo menos los tres vectores recombinantes se realizan de manera independiente y sucesivamente con cada uno de los vectores recombinantes, o simultáneamente con el conjunto de dichos vectores recombinantes, y por que el conjunto de estas transformaciones está seguido de una etapa c) de selección sobre un medio mínimo de las levaduras que han integrado el conjunto de dichos vectores recombinantes.

7. Procedimiento según una de las reivindicaciones 1 a 6, caracterizado por que dicha cepa es una cepa de Yarrowia lipolytica. 8. Procedimiento según cualquiera de las reivindicaciones 1 a 6, caracterizado por que dicha cepa de Yarrowia comprende cuatro genes que presentan independientemente el uno del otro una deleción asociada a un fenotipo de auxotrofia o de carácter dominante, seleccionados preferentemente de entre los genes URA3, LEU2, GUT2 y ADE2. 9. Procedimiento según cualquiera de las reivindicaciones 1 a 7, caracterizado por que la etapa b) de transformación se efectúa con tres a diez vectores recombinantes.

10. Procedimiento según cualquiera de las reivindicaciones 1 a 9, caracterizado por que el marcador de selección está enmarcado por unas secuencias que permiten su escisión después de la integración localizada de dicho vector recombinante. 11. Procedimiento de producción de un polipéptido codificado por un gen de interés, caracterizado por que comprende las etapas siguientes: d) cultivar la cepa de Yarrowia modificada obtenida mediante el procedimiento según cualquiera de las reivindicaciones 1 a 10 en un medio de cultivo líquido que comprende unas fuentes asimilables de carbono, de nitrógeno y de sales inorgánicas, de manera que se permita el crecimiento de dicha cepa transformada de Yarrowia; y e) recuperar dicho polipéptido de interés expresado a partir de las células Yarrowia o el medio de cultivo obtenido en la etapa d).

12. Procedimiento de obtención de una cepa modificada de Yarrowia, caracterizado por que comprende una etapa en la que se transforma dicha cepa de Yarrowia con por lo menos tres vectores que permiten llegar a una cepa de Yarrowia que comprende por lo menos tres deleciones seleccionadas de entre Ura3-302, Leu2-270, Gut2-744 y Ade2-844, correspondiendo el fenotipo asociado a cada una de estas deleciones a una auxotrofia o a un carácter dominante para dicha cepa, independientemente el uno del otro de estos por lo menos tres genes.

13. Procedimiento según la reivindicación 12, caracterizado por que dicha cepa comprende además por lo menos un gen asociado a un fenotipo de carácter dominante seleccionado de entre el gen de resistencia a la higromicina HPH (HYG), y los genes MDR3, KanMX, y Tn5ble, siendo el gen HYG el más preferido. 14. Cepa de Yarrowia auxótrofa susceptible de ser obtenida mediante el procedimiento según una de las reivindicaciones 12 y 13, comprendiendo dicha cepa por lo menos tres deleciones seleccionadas de entre Ura3-302, Leu2-270, Gut2-744 y Ade2-844, correspondiendo el fenotipo asociado a cada una de estas deleciones a una auxotrofia o a un carácter dominante para dicha cepa, independientemente el uno del otro de estos por lo menos tres genes.

15. Cepa de Yarrowia según la reivindicación 14, caracterizada por que se selecciona de entre el grupo que consiste en la cepa de Yarrowia lipolytica depositada el 4 de febrero de 2008 de acuerdo con el tratado de Budapest en la Collection nationale de Culture de Microorganismes (CNCM), INSTITUT PASTEUR, 25 rue du Docteur Roux, 75724 PARIS CEDEX 15, Francia bajo los números CNCM 1-3911 y CNCM I-3912 y la cepa de Yarrowia lipolytica depositada el 4 de febrero de 2008 de acuerdo con el tratado de Budapest en la Collection nationale de Culture de Microorganismes (CNCM), INSTITUT PASTEUR, 25 rue du Docteur Roux, 75724 PARIS CEDEX 15, Francia bajo el número CNCM 1-3913.