Composiciones inmunógenas para Streptococcus pyogenes.

Composición inmunógena que comprende una combinación de antígenos de GAS, consistiendo dicha combinación en dos a diez antígenos de GAS, en la que dicha combinación incluye GAS40, siendo dicho "GAS40" una proteína que comprende una secuencia de aminoácidos

(a) que tiene un 95% o más identidad con la SEQ ID NO: 1 y/o (b) que es un fragmento de al menos 200 aminoácidos consecutivos de la SEQ ID NO: 1 y en la que dicha combinación incluye GAS57, siendo dicho "GAS57" una proteína que comprende una secuencia de aminoácidos (a) que tiene un 95% o más identidad con la SEQ ID NO: 116 y/o (b) que es un fragmento de al menos 200 aminoácidos consecutivos de la SEQ ID NO: 116.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2004/024868.

Solicitante: NOVARTIS VACCINES AND DIAGNOSTICS, INC..

Nacionalidad solicitante: Estados Unidos de América.

Dirección: 4560 HORTON STREET EMERYVILLE, CA 94608 ESTADOS UNIDOS DE AMERICA.

Inventor/es: GRANDI, GUIDO, TELFORD,JOHN, BENSI,GIULIANO.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/315 (de Streptococcus (G), p. ej. Enterococci)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen antígenos... > A61K39/09 (Streptococcus)

PDF original: ES-2505695_T3.pdf

 

google+ twitter facebookPin it
Ilustración 1 de Composiciones inmunógenas para Streptococcus pyogenes.
Ilustración 2 de Composiciones inmunógenas para Streptococcus pyogenes.
Ilustración 3 de Composiciones inmunógenas para Streptococcus pyogenes.
Ilustración 4 de Composiciones inmunógenas para Streptococcus pyogenes.
Ver la galería de la patente con 8 ilustraciones.
Composiciones inmunógenas para Streptococcus pyogenes.

Fragmento de la descripción:

DETALLADA DE LA INVENCIÓN

Como se ha analizado anteriormente, en el presente documento se describen composiciones que comprenden una combinación de antígenos de GAS, en las que las combinaciones pueden seleccionarse de entre grupos de antígenos que los solicitantes han identificado como particularmente adecuados para fines de inmunización, particularmente cuando se utilizan en combinación. La invención proporciona composiciones que comprenden GAS 4.

GAS 4 y los demás antígenos de GAS del primer grupo de antígenos se describen con más detalle más adelante. Las secuencias genómicas de al menos tres cepas de GAS están a disposición del público. La secuencia genómica de una cepa M1 de GAS se presenta en Ferretti et al., PNAS (21) 98(8):4658 - 4663. La secuencia genómica de una cepa M3 de GAS se presenta en Beres et al., PNAS (22) 99(15):178 - 183. La secuencia genómica de una cepa M18 de GAS se presenta en Smooet et al., PNAS (22) 99(7):4668 - 4673. Preferentemente, los antígenos de GAS de la invención comprenden la secuencia de aminoácidos o de polinucleótidos de una cepa M1, M3 o M18 de GAS. Más preferentemente, los antígenos de GAS de la invención comprenden una secuencia de aminoácidos o de polinucleótidos de una cepa M1.

Como habrá varianza entre los antígenos de GAS identificados entre los tipos de M de GAS y los aislados de la cepa de GAS, las referencias a las secuencias de aminoácidos o de polinucleótidos de GAS descritas en el presente documento incluyen preferentemente secuencias de aminoácidos o de polinucleótidos con identidad de secuencia con las mismas. Las secuencias de aminoácidos o de polinucleótidos preferentes tienen un 5% o más de identidad de secuencia (por ejemplo, 6%, 65%, 7%, 75%, 8%, 85%, 9%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, 99%, 99,5% o más). Asimismo, las referencias a las secuencias de aminoácidos o de polinucleótidos de GAS descritas en el presente documento incluyen preferentemente fragmentos de esas secuencias (es decir, fragmentos que conservan o codifican las propiedades inmunitarias del antígeno de GAS). Los fragmentos de aminoácidos preferentes incluyen al menos n aminoácidos consecutivos, en los que n es 7 o más (por ejemplo, 8, 1, 12, 14, 16, 18, 2, 25, 3, 35, 4, 5, 6, 7, 8, 9, 1, 15, 2, 25 o más). Los fragmentos de polinucleótidos preferentes incluyen al menos n polinucleótidos consecutivos, en los que n es 12 o más (por ejemplo, 15, 16, 17, 18, 19, 2, 21,22, 23, 24, 25, 26, 28, 3, 35, 4, 45, 5, 6, 7, 8, 9, 1, 15, 2, 25 o más). Los fragmentos de aminoácidos o de polinucleótidos de la invención pueden no ser idénticos a las secuencias de aminoácidos o de polinucleótidos de otras bacterias (no GAS) (por ejemplo, los fragmentos no son idénticos a las secuencias en otras bacterias Streptococcus).

(1) GAS 4

GAS 4 corresponde a los números de registro del GenBank de M1 GM3621545 y GM5674449, al número de registro del GenBank de M3 Gl:2199733, al número de registro del GenBank de M18 Gl: 1974542, y también se conoce como 'Spy269' (M1), 'SpyM3_197' (M3), 'SpyM18_256' (M18) y 'prgA'. GAS 4 también se ha identificado como una supuesta proteína de exclusión superficial. Las secuencias de aminoácidos y de polinucleótidos de GAS 4 de una cepa M1 se exponen a continuación y en el listado de secuencias como las SEQ ID NO: 1 y 2.

SEQ ID NO: 1

MDLEQTKPNQVKQKIALTSTIALLSASVGVSHQVKADDRASGETKASNTHDDSLPKPETIQEAKATIDAVEKTLSQQKAE

ltelataltkttaeinhlkeqqdneqkaltsaqeiytktlasseetllaqgaehqreltatetelhnaqadqhsketai.s

eqkasisaettraqdlveqvktseqniakijjamisnpdaitkaaqtandntkalssblekakadlenqkakvkkqlteel

aaqkaalaekeaelsrlkssapstqdsivgnntmkapqgypleelkkleasgyigsasynnyykehadqiiakaspgnql

NQYQDIPADRNRFVDPDNLTPEVQNELAQFAAHMINSVRRQLGLPPVTVTAGSQEFARLLSTSYKKTHGNTRPSFVYGQP

gvsghygvgphdktiiedsagasglirhddnmyenigafndvhtvhgikrgiydsikymlftdhlhgntyghainflrvd

khnpnapvylgfstsnvgslnehfvmfpesmianhqrfwktpikavgstkdyaqrvgtvsdtiaaikgkvsslenrlsai

hqeadimaaqakvsqlqgklastlkqsdslmlqvrqlmdtkgsirtellaakakqaqleatrdqslaklaslkaalhqte

ALAEQAAARVTALVAKKAHLQYLRDFKLNPNR1QVIRERIDNTKQDLAKTTSSLLNAQEALAALQAKQSSLEATIATTEH QLTLLKTLANEKEYRHLDEDIATVPDLQVAPPLTGVKPLSYSKIDTTPLVQEMVKETKQLLEASARLAAENTSLVAEALV GQT SEMVASNAIVSKIT S SITQPSSECTS YGSGSSTT S NLIS DVDE STQRALKAGWMLAAVGLTGFRFRKESK

SEQ ID NO: 2

ATGGACTTAGAACAAACGAAGCCAAACCAAGTTAAGCAGAAAATTGCTTTAACCTCAACAATTGCTTTATTGAGTGCCAG

TGTAGGCGTATCTCACCAAGTCAAAGCAGATGATAGAGCCTCAGGAGAAACGAAGGCGAGTAATACTCACGACGATAGTT

TACCAAAACCAGAAACAATTCAAGAGGCAAAGGCAACTATTGATGCAGTTGAAAAAACTCTCAGTCAACAAAAAGCAGAA

CTGACAGAGCTTGCTACCGCTGTGñCAAAAACTAC'IGCTGAAA7CAACCACTTAAAAGAGCA3CAAGATAATGAACAAñA

AGCTTTAACCTCTGCACAAGAAATTTACACTAATACTCTTGCAAGTAGTGAGGAGACGCTATTAGCCCAAGGAGCCGAAC

ATCAAAGAGAGTTAAGAGCTACTGAAACAGAGCTTCATAATGCTCjGAGOAGATCAACAT'TCAAAAGAGACTGCATTGTCA

GAACAAAAAGCTAGCATTTCAGCAGAAACGACTCGAGCTCAAGATTTAGTGGAACAAGTCAAAACGTCTGAACAAAATAT

TGC-AAGCTCAATGCTATGATTAGCAATCCTGATGCTATCACGAAAGCAGCTCAAACGGCTAATGATAATACñAAAGCAT

taagctcagaattggagmggc^aaagctgacttagaaaa'icaaaaagctaaagttaaaaagcaattgactgaagagttg

GCAGCTCAGAAACtCTGCTCTAGCAGAAAAAGAGGCAGAACTTAGtCGTCT'TAAATCCTCAGCTCCGTCTACTCAAGATAG

cattgtgggtaataatacgatgaaagcaccgcaaggctatcctcttgaagaacttaaaaaattagaagctagtggttata

IIGGATCAGCTAGTTACAATAATTATTñCAAAGAGCATGCAGATCAAATTATTGCCAAAGCTAGTCCAGGTAATCAATTA

AATCAATACCAAGATATTCCAGCAGATCGtAaXCGCTTTGTTGATCCCGATAATTTGACACCAGAAGTGCAAAATGAGCT

agcgcagtttgcagctcacaigattaa-iagtgtaagaagacaattaggtctaccaccagttactgttacac-caggatcac

AAGAATTTCCAAGATrACTTAGTACCAGCTATAAGAAAACrGATGGTAATACAAGACCATCATTTGTCTACGGACAGCCA

ggggtatcagggcat-atggtgttgggcctcatc-ataaaactattattgaagagtctgccgsagcgtcagggctcattcg

AAATGATGATAACATGTACGAGAATATCGGTGCTTTTAACGATGTGCATACTGTGAAGGGTA'nAAACGTGGTATTTATG

ACAGTATCAAGTATAIGCTC'TTTAGAGATCATTTACACGGAAATACATACGGCCATGCTATTAACTTTTTACGTGTAGAT

AAACATAACCCTAATGCGCCTGTTTACCTTSGATTTTCAACCAGCAATGTAGGATCTTTGAATGAACACTTTGTAATGTT

TCCAGAGTCTAACATTGCTAACCATCAACGCTTTAATAAGACCCCTAGAAAAGCCGTGGGAAGTACAAAAGATTATGCCC

AAAGAGTAGGCACTGTATCTGATACTATrGCAGCGATCAAAGGAAAAGTñAGCTCATTAGAAAATCGTITGTCGGCTATT

CATCAAGAAGCTGATATTñTGGCAGCCCAAGCTAAAGTAAGTCAACTTCAAGGTñAATTAGCAAGGACACTTAAGCAGrC

AGACAGCTTAAATCTCCAAG'IGAGACAATTAAATGATACTAAAGGGTCTTTGAGAACAGAATTACTAGCAGCTAAAGCAA

aacaagcacaactcgaagctactcgtgatcaatcattagctaagctagcatcgttgaaagccgcagigcaCCagacagaa

GCCTTAGCAGAGCAAGCCGCAGCCAGAGTGACAGCACTGGTGGCTAAAAAAGCTCATTTGCAATATCTAAGGGACTTTAA

ATTGAATCCTAACGGCCTYCAAGTGATACGTGAGCGCATTGATAATACTAAGCAAGATTTGGCTAAAACTACCTCATCTT

TGTTAAATGCACAAGAAGCTGTAGCAGCCTTACAAGCTAAACAAAGCAGTCTAGAAGCTACTATTSCTACCACAGAACAC

cagtígacttygcttaaaaccttagctaacgaaaaggaatatcc-ccacttagacgaagatatagctactgtgcctgattt gcAagtagctccacctcttacgggcg'j-aaaaccggtatcatatagtaagataqatactactccgcttgt?caagaaatgg TT AAAGAAACGAAACAACTAT TAG2ÍAGC TT C AGCAAGAT TAGCT GG T GAAAAT ACAAGTC11GT AGCAGAAGCGCTTGT T GGCCAAAGCICTGAAATGGTAGCAAG,AA`rGCCATTGTGTCTAAAATCACATCTXCGATTACTGAGCCCTCATCU'AAGAC ATCTIATGGCTCAGGATCTTCTACAACGAGCAATGTCATTTCTGATGTTGATGAAAGTACYCAAAGAGCTCITAAAGCAG

gagtcgtcatgttggcagctgtcggcctcacaggatygaggttccgtaaggaatctaagtga

Las proteínas GAS 4 para su uso con la invención comprenden una secuencia de aminoácidos: (a) que tiene un 95% o más identidad (por ejemplo, 96%, 97%, 98%, 99%, 99,5% o más) con la SEQ ID NO: 1; y/o (b) que es un fragmento de al menos n aminoácidos consecutivos de la SEQ ID NO: 1, donde n es 2 o más (por ejemplo, 25 o más). Estas proteínas GAS 4 incluyen variantes (por ejemplo, variantes alélicas, homólogos, ortólogos, parálogos, mutantes, etc.) de la SEQ ID NO: 1. Los fragmentos preferentes de (b) comprenden un epftopo de la SEQ ID NO: 1. Otros fragmentos preferentes carecen de uno o más aminoácidos (por ejemplo,... [Seguir leyendo]

 


Reivindicaciones:

1. Composición inmunógena que comprende una combinación de antígenos de GAS, consistiendo dicha combinación en dos a diez antigenos de GAS, en la que dicha combinación incluye GAS4, siendo dicho "GAS4" una proteína que comprende una secuencia de aminoácidos (a) que tiene un 95% o más identidad con la SEQ ID NO: 1 y/o (b) que es un fragmento de al menos 2 aminoácidos consecutivos de la SEQ ID NO: 1 y en la que dicha combinación incluye GAS57, siendo dicho "GAS57" una protema que comprende una secuencia de aminoácidos (a) que tiene un 95% o más identidad con la SEQ ID NO: 116 y/o (b) que es un fragmento de al menos 2 aminoácidos consecutivos de la SEQ ID NO: 116.

2. Composición según la reivindicación 1, en la que dicho antigeno GAS4 comprende una secuencia de aminoácidos que comprende una primera región con superenrollamiento y una segunda región con superenrollamiento.

3. Composición según la reivindicación 1, en la que el antígeno GAS4 comprende una secuencia de aminoácidos que comprende una primera región con superenrollamiento.

4. Composición según la reivindicación 3, en la que dicha región con superenrollamiento comprende una secuencia de aminoácidos que comprende la SEQ ID NO: 12.

5. Composición según la reivindicación 2, en la que dicha segunda región con superenrollamiento incluye una región con cremallera de leucina.

6. Composición según la reivindicación 5, en la que la segunda región con superenrollamiento comprende una secuencia de aminoácidos que comprende la SEQ ID NO: 13.

7. Composición según cualquiera de las reivindicaciones anteriores para uso terapéutico.

8. Método de fabricación de cualquiera de las composiciones inmunógenas según las reivindicaciones 1 a 6.

9. Kit que comprende un primer componente que comprende cualquiera de las composiciones inmunógenas según las reivindicaciones 1 a 6.