Anticuerpos y moléculas relacionadas que se unen con proteínas de PSCA.

Un anticuerpo monoclonal o un fragmento de unión a antígeno del mismo que comprende un sitio de unión a antígeno que se une específicamente con una proteína PSCA que comprende la secuencia de aminoácidos de SEC ID Nº: 2

, y en donde el anticuerpo monoclonal comprende la secuencia de aminoácidos de la región VH de SEC ID Nº: 47 y la región VL de SEC ID Nº: 51.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2005/017412.

Solicitante: AGENSYS, INC..

Nacionalidad solicitante: Estados Unidos de América.

Dirección: 1800 Stewart Street Santa Monica, CA 90404 ESTADOS UNIDOS DE AMERICA.

Inventor/es: JAKOBOVITS, AYA, CHALLITA-EID, PIA, M., RAITANO, ARTHUR, B., JIA,XIAO-CHI, GUDAS,JEAN, MORRISON,ROBERT,KENDALL, MORRISON,KAREN JANE MEYRICK, SHAO,HUI.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > ACTIVIDAD TERAPEUTICA ESPECIFICA DE COMPUESTOS QUIMICOS... > A61P13/00 (Medicamentos para el tratamiento del aparato urinario (diuréticos A61P 7/10))
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Inmunoglobulinas, p. ej. anticuerpos mono o policlonales > C07K16/30 (de células tumorales)

PDF original: ES-2549405_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Anticuerpos y moléculas relacionadas que se unen con proteínas de PSCA Campo de la invención

La invención descrita en el presente documento se refiere a anticuerpos, asi como fragmentos de unión de los mismos y moléculas modificadas técnicamente a partir de los mismos, que se unen con proteínas, denominadas PSCA. La invención se refiere además a métodos de diagnóstico, pronóstico, profilácticos y terapéuticos y composiciones útiles en el tratamiento de cánceres que expresan PSCA.

Antecedentes de la invención

El cáncer es la segunda causa principal de muerte de seres humanos junto a la enfermedad coronaria. En todo el mundo, millones de personas mueren de cáncer cada año. Solamente en los Estados Unidos, como se indica por la Sociedad Americana del Cáncer, el cáncer provoca la muerte de más de medio millón de personas anualmente, con más de 1,2 millones de casos nuevos diagnosticados cada año. Aunque las muertes por enfermedad cardiaca se han estado reduciendo significativamente, las resultantes de cáncer generalmente están aumentando. A principios del siglo que viene, se predice que el cáncer se convertirá en la causa principal de muerte.

En todo el mundo, varios cánceres destacan como los más letales. En particular, los carcinomas del pulmón, próstata, mama, colon, páncreas, ovario y vejiga representan las causas principales de muerte por cáncer. Estos y prácticamente todos los demás carcinomas comparten una característica letal común. Con muy pocas excepciones, la enfermedad metastásica de un carcinoma es letal. Además, incluso para los pacientes con cáncer que inicialmente sobreviven a sus cánceres primarios, la experiencia habitual ha mostrado que sus vidas se alteran drásticamente. Muchos pacientes con cáncer experimentan fuerte ansiedad impulsada por la consciencia del potencial de reaparición o fallo del tratamiento. Muchos pacientes con cáncer experimentan debilidad física después del tratamiento. Además, muchos pacientes con cáncer experimentan una reaparición.

En todo el mundo, el cáncer de próstata es el cuarto cáncer más prevalente en hombres. En Norte América y el Norte de Europa, es con diferencia el cáncer más común en hombres y es la segunda causa principal de muerte por cáncer en hombres. Solamente en los Estados Unidos, más de 30.000 hombres mueren anualmente de esta enfermedad, solamente detrás del cáncer de pulmón. A pesar de la magnitud de estas cifras, aún no hay ningún tratamiento eficaz para el cáncer de próstata metastásico. La prostatectomía quirúrgica, radioterapia, terapia de ablación hormonal, castración quirúrgica y quimioterapia continúan siendo las principales modalidades de tratamiento. Desafortunadamente, estos tratamientos son ineficaces para muchas personas y se asocian con frecuencia con consecuencias indeseables.

Con respecto al diagnóstico, la falta de un marcador de tumor de próstata que pueda detectar con precisión tumores localizados, en el estadio temprano, sigue siendo una limitación significativa en el diagnóstico y mantenimiento de esta enfermedad. Aunque el ensayo del antígeno específico de próstata (PSA) en suero ha sido una herramienta muy útil, sin embargo su especificidad y utilidad general se considera en general insuficiente en varios aspectos importantes.

El progreso en la identificación de marcadores específicos adicionales para cáncer de próstata se ha mejorado por la generación de xenoinjertos de cáncer de próstata que pueden recapitular diferentes estadios de una enfermedad en ratones. Los xenoinjertos de LAPC (Cáncer de Próstata de los Ángeles) son xenoinjertos de cáncer de próstata que han sobrevivido al pase en ratones inmunodeficientes combinados graves (SCID) y han mostrado la capacidad de imitar la transición de la dependencia de andrógenos a independencia de andrógenos (Klein et al., 1997, Nat. Med. 3: 402). Más recientemente los marcadores de cáncer de próstata identificados incluyen PCTA-1 (Su et al., 1996, Proc. Nati. Acad. Sci. USA 93: 7252), antígeno de membrana específica de próstata (PSM) (Pinto et al., Clin Cáncer Res 2 sep 1996 (9): 1445-51), STEAP (Hubert, et al., Proc Nati Acad Sci USA. 7 dic 1999; 96(25): 14523-8) y antígeno de células madre de próstata (PSCA) (Reiteref al., 1998, Proc. Nati. Acad. Sci. USA 95: 1735).

Aunque marcadores previamente identificados tales como PSA, PSM, PCTA y PSCA han facilitado los intentos de diagnosticar y tratar el cáncer de próstata, existe la necesidad de identificación de marcadores adicionales y dianas terapéuticas para cánceres de próstata y relacionados para mejorar adicionalmente el diagnóstico y la terapia.

El carcinoma de células renales (RCC) representa aproximadamente el 3 por ciento de los tumores malignos adultos. Una vez que los adenomas alcanzan un diámetro de 2 a 3 cm, existe potencial maligno. En el adulto, los dos tumores renales malignos principales son adenocarcinoma de células renales y carcinoma de células transicionales de la pelvis renal o el uréter. La incidencia de adenocarcinoma de células renales se estima en más de 29.000 casos en los Estados Unidos, y más de 11.600 pacientes murieron de esta enfermedad en 1998. El carcinoma de células transicionales es menos frecuente, con una incidencia de aproximadamente 500 casos al año en los Estados Unidos.

La cirugía ha sido la terapia principal para adenocarcinoma de células renales durante muchas décadas. Hasta hace poco, la enfermedad metastásica ha sido refractaria a cualquier terapia slstémica. Con los recientes desarrollos en las terapias sistémicas, particularmente inmunoterapias, el carcinoma de células renales metastásico puede enfocarse de forma agresiva en pacientes apropiados con posibilidad de respuestas duraderas. No obstante, sigue existiendo la necesidad de terapias eficaces para estos pacientes.

De todos los nuevos casos de cáncer en los Estados Unidos, el cáncer de vejiga representa aproximadamente el 5 por ciento en hombres (quinta neoplasla más común) y el 3 por ciento en mujeres (octava neoplasia más común). La incidencia está creciendo lentamente, simultáneamente con un aumento de la población mayor. En 1998, hubo una estimación de 54.500 casos, Incluyendo 39.500 en hombres y 15.000 en mujeres. La incidencia ajustada por edad en los Estados Unidos es de 32 por cada 100.000 para hombres y de ocho por cada 100.000 en mujeres. La relación hombre/mujer histórica de 3:1 puede estar reduciéndose en relación con los patrones de tabaquismo en mujeres. Hubo una estimación de 11.000 muertes de cáncer de vejiga en 1998 (7.800 en hombres y 3.900 en mujeres). La incidencia y mortalidad del cáncer de vejiga aumenta fuertemente con la edad y será un problema creciente a medida que la población envejece.

La mayoría de los cánceres de vejiga reaparecen en la vejiga. El cáncer de vejiga se combate con una combinación de resección transuretral de la vejiga (TUR) y quimioterapia o inmunoterapia intravesical. La naturaleza multifocal y recurrente del cáncer de vejiga apunta a las limitaciones de TUR. La mayoría de los cánceres invasores de músculos no se curan solamente por TUR. La cistectomía radical y la diversión urinaria son los medios más eficaces para eliminar el cáncer pero tienen una influencia innegable en la función urinaria y sexual. Continúa existiendo una necesidad significativa de modalidades del tratamiento que sean beneficiosas para pacientes con cáncer de vejiga.

En 2000 en los Estados Unidos se produjo una estimación de 130.200 casos de cáncer colorrectal, incluyendo 93.800 casos de cáncer de colon y 36.400 de cáncer rectal. Los cánceres colorrectales son los terceros cánceres más comunes en hombres y mujeres. Las tasas de incidencia se redujeron significativamente durante... [Seguir leyendo]

 


Reivindicaciones:

1. Un anticuerpo monoclonal o un fragmento de unión a antígeno del mismo que comprende un sitio de unión a antígeno que se une específicamente con una proteína PSCA que comprende la secuencia de aminoácidos de SEC ID N°: 2, y en donde el anticuerpo monoclonal comprende la secuencia de aminoácidos de la reglón Vh de SEC ID N°: 47 y la reglón VL de SEC ID N°: 51.

2. Un anticuerpo o un fragmento de acuerdo con la reivindicación 1, en donde el fragmento es un fragmento Fab, F(ab)2, Fv o sFv.

3. Un anticuerpo o un fragmento de acuerdo con las reivindicaciones 1 o 2, en donde el anticuerpo o el fragmento se acoplan con un marcador detectable, una toxina, un agente terapéutico o un agente quimioterapéutlco.

4. Un hlbrldoma que produce un anticuerpo monoclonal de acuerdo con la reivindicación 1.

5. Un hlbrldoma de acuerdo con la reivindicación 4, en donde el hlbrldoma está depositado en la Colección Americana de Cultivos Tipo (ATCC) N° de Referencia PTA-6701.

6. Un pollnucleótldo que codifica una secuencia que comprende una reglón variable de cadena ligera y una región variable de cadena pesada de un anticuerpo de acuerdo con una cualquiera de las reivindicaciones 1 o 2.

7. Un pollnucleótldo de acuerdo con la reivindicación 6, que codifica la cadena ligera y la cadena pesada de un anticuerpo de acuerdo con una cualquiera de las reivindicaciones 1 o 2.

8. Un vector que comprende un pollnucleótldo de acuerdo con las reivindicaciones 6 o 7.

9. Una célula transfectada con un vector de acuerdo con la reivindicación 8.

10. Un método para producir un anticuerpo como se ha definido en la reivindicación 1, o un fragmento de unión a antígeno del mismo, que comprende:

cultivar una célula, en donde:

(a) la célula se ha transfectado con un vector que comprende un polinucleótldo que codifica una secuencia que comprende la región variable de cadena ligera de un anticuerpo de acuerdo con una de las reivindicaciones 1 y 2 y un vector que comprende un polinucleótido que codifica una secuencia que comprende la región variable de cadena pesada de un anticuerpo de acuerdo con las reivindicaciones 1 o 2; o

(b) una célula transfectada con un vector de acuerdo con la reivindicación 8; por el que se produce el anticuerpo o un fragmento de unión a antígeno del mismo.

11. Una composición farmacéutica que comprende un anticuerpo, o un fragmento Fab, F(ab)2, Fvo sFvde acuerdo con una cualquiera de las reivindicaciones 1 a 3.

12. Una composición farmacéutica de acuerdo con la reivindicación 11, en donde la composición es para el tratamiento de cáncer de cánceres que expresan PSCA.

13. Una composición farmacéutica de acuerdo con la reivindicación 12, en donde el cáncer es cáncer de próstata, páncreas, vejiga, riñón, colon, pulmón, ovario o mama.

14. Un agente antineoplásico para reducir el crecimiento tumoral de células tumorales que expresan PSCA, en donde dicho agente antineoplásico comprende una combinación de un anticuerpo, o un fragmento de unión a antígeno del mismo de acuerdo con una de las reivindicaciones 1 y 2, y un agente quimioterapéutico.

15. Un agente antineoplásico para uso de acuerdo con la reivindicación 14, en donde el tumor es un tumor de cáncer de próstata, pancreático, de vejiga, de riñón, de colon, de pulmón, de ovario o de mama.

16. Un agente antineoplásico para uso de acuerdo con la reivindicación 14, en donde dichos anticuerpo o fragmento se acoplan con un marcador detectable que es un radioisótopo, un quelante metálico, una enzima, un compuesto fluorescente, un compuesto bioluminiscente o un compuesto quimioluminiscente.

17. Un agente antineoplásico para uso de acuerdo con la reivindicación 16, en donde el radioisótopo es 212B¡, 131l, 90Y, 186Re,211 At, 125l, 1*Re, 153Sm, 213B¡, 32P o Lu.

18. Un agente antineoplásico para uso de acuerdo con la reivindicación 14, en donde agente quimioterapéutico es ricina, cadena A de ricina, doxorrubicina, daunorrubicina, un maitansinoide, taxol, bromuro de etidio, mitomicina, etopósido, tenopósido, vincristina, vinblastina, colchicina, dihidroxi antracin diona, actinomicina, toxina diftérica, exotoxina de Pseudomonas (PE) A, PE40, abrina, cadena A de abrina, cadena A de modeccina, sarcina alfa, gelonina, mitogelina, retstrictocina, fenomicina, enomicina, curicina, crotina, caliqueamicina, inhibidor de Saponaria offícinalis, glucocorticoide, auristatinas, auromicina, itrio, bismuto, combrestatina, duocarmicinas, dolostatina, cc1065 o un cisplatino.

19. Uso de un anticuerpo o un fragmento de unión a antígeno del mismo de acuerdo con una cualquiera de las reivindicaciones 1 a 3, para la preparación de un medicamento para uso en un método para inhibir el crecimiento de una célula cancerosa que expresa una proteína PSCA que comprende la secuencia de aminoácidos de SEC ID N°: 2 en un sujeto.

20. Uso de acuerdo con la reivindicación 19, en donde el anticuerpo o el fragmento de unión a antígeno del mismo se acopla con un agente citotóxico o un marcador detectable.

21. Uso de acuerdo con la reivindicación 20, en donde el anticuerpo o el fragmento se acopla con un marcador detectable que es un radioisótopo, un quelante metálico, una enzima, un compuesto fluorescente, un compuesto bioluminiscente o un compuesto quimioluminiscente.

22. Uso de acuerdo con la reivindicación 21, en donde dicho radioisótopo es 212B¡, 131 153Sm, 213B¡, 30 * 32P o Lu.

90Y, 186Re, 211At, 125l, 188Re,

23. Uso de acuerdo con la reivindicación 20, en el que el agente citotóxico es ricina, cadena A de ricina, doxorrubicina, daunorrubicina, un maitansinoide, taxol, bromuro de etidio, mitomicina, etopósido, tenopósido, vincristina, vinblastina, colchicina, dihidroxi antracin diona, actinomicina, toxina diftérica, exotoxina de Pseudomonas (PE) A, PE40, abrina, cadena A de abrina, cadena A de modeccina, alfa sarcina, gelonina, mitogelina, retstrictocina fenomicina, enomicina, curicina, crotina, caliqueamicina, inhibidor de Saponaria offícinalis, glucocorticoide, auristatinas, auromicina, itrio, bismuto, combrestatina, duocarmicinas, dolostatina, cc1065 o un cisplatino.

24. Uso de acuerdo con una cualquiera de las reivindicaciones 19 a 23, en donde la célula cancerosa es una célula de cáncer de próstata, páncreas, vejiga, riñón, colon, pulmón, ovario o mama.

25. Un anticuerpo o un fragmento de unión a antígeno del mismo de acuerdo con una cualquiera de las reivindicaciones 1 a 3, para uso en un método para tratar el cáncer en un sujeto, en donde el cáncer expresa la proteína PSCA.

26. Un anticuerpo o un fragmento de unión a antígeno del mismo para uso de acuerdo con la reivindicación 25, en donde el cáncer es cáncer de próstata, páncreas, vejiga, riñón, colon, pulmón, ovario o mama.

27. Un anticuerpo o un fragmento de unión a antígeno del mismo para uso de acuerdo con las reivindicaciones 25 o 26, en donde dichos anticuerpo o fragmento de unión a antígeno del mismo se administran junto con un agente quimioterapéutico, radiación o ambos.

28. Un anticuerpo o un fragmento de unión a antígeno del mismo para uso de acuerdo con la reivindicación 27, en donde el anticuerpo monoclonal se administra antes, durante o después de comenzar la administración del agente quimioterapéutico o la radiación o ambos.

29. Un anticuerpo o un fragmento de unión a antígeno del mismo para uso de acuerdo con la reivindicación 28, en donde el anticuerpo monoclonal se administra entre 1 y 60 días antes de comenzar la radioterapia y/o la quimioterapia.

30. Un anticuerpo o un fragmento de unión a antígeno del mismo para uso de acuerdo con la reivindicación 27, en

donde el agente quimioterapéutico se selecciona del grupo que consiste en cisplatino, dacarbazina (DTIC),

dactinomicina, mecloretamina (mostaza de nitrógeno), estreptozocina, ciclofosfamida, carmustina (BCNU), lomustina (CCNU), doxorrubicina (adriamicina), daunorrubicina, procarbacina, mitomicina, citarabina, etopósido, metotrexato, 5-fluorouracilo, vinblastina, vincristina, bleomicina, paclitaxel (taxol), docetaxel (taxotere), aldesleuquina, asparaginasa, busulfán, carboplatino, cladribina, dacarbazina, floxuridina, fludarabina, hidroxiurea, ifosfamida, ¡nterferón alfa, leuprolide, megestrol, melfalán, mercaptopurina, plicamicina, mitotano, pegaspargasa, pentostatina, pipobromán, plicamicina, estreptozocina, tamoxifeno, tenipósido, testolactona, tioguanina, tiotepa, mostaza de uracilo, vinorelbina, clorambucilo, taxol y combinaciones de los mismos.

Figura 1A. La secuencia de ADNc (SEC ID N°: 1) y aminoácidos (SEC ID N°: 2) de PSCAv.1 La secuencia Kozak se muestra en negrita, la metionina de partida está subrayada.

1 MKAVLLALLMAGXjAL

1 agggagaggcagtgaccATOAAGGCTGTGCTGCTTGCCCTGTTGATGGCAGGCTTGGCCC 16 QPGTALLCYSCKAQVSNEDC

61 tgcagccaggcactgccctgctgtgctactcctgcaaagcccaggtgagcaacgaggact

36 LQVENCTOliGEQCWTARIRA 121 GCCTGCAGGTGGAGAACTGCACCCAGCTGGGGGAGCAGTGCTGGACCGCGCGCATCCGCG 56 VGLLTVISKGCSLNCVDDSQ 181 CAGTTGGCCTC CTG ACCGTCATC AGCAAAGGC TGCAGCTTGAACTG CGTGG ATGACTC AC 76 DYYVGKKNITCCDTDLCNAS 241 AGGACTACTACGTGGG CAAG AAG AACAT CACGTGCTGTGACACCGACTTGTGCAACGCCA 96 GAHALQPAAA I LALLPALGL 301 GCGGGGCCCATGCCCTGCAGCCGGCTGCCGCCATCCTTGCGCTGCTCCCTGCACTCGGCC 116 LLWGPGQL*

361 TGCTGCTCtTGGGGACCCGGCCAGCTATAGgctCtggggggccccgctgcagcccacactg 4 21 gg t g t gg t gccccaggcct t tgtgceaet cctcacagaacctggcccag tgggagcc t gt 481 cctggttcct gaggcacatcc taacgcaag t ttgacca tgtatgt 11 gcacccct 11 tce 541 ccnaac cct gacct tcccatgggcctt ttccagga t tcccacccg gcaga tcag 1111 ag 601 tgacacagatccgcc tgcagat ggcccctccaa ccc t ttc tgt tgctgtttccat ggccc 661 agca 111 tccaccct taaccctgtgttc aggca ct te t tcccc caggaagcct tccct ge 721 ccaccccatttatgaa ttgagcca gg tt tggtccg t gg tgt cccccgcacccagcagggg 781 acaggcaa tcaggagggcccagtaaaggc t gaga tgaagtggact gagtagaactggagg 841 acaagag t tgacgtga gttcc tgggag tttccagagatggggcc tggaggcet ggaggaa 901 ggggcca ggcct cacat ttg tggggctcccgaatggcagcc t ga gcacagcg taggcc c t 961 taataaacacctgttggataagccaaaaaa

Figura 1B. La secuencia de ADNc (SEC ID N°: 3) y aminoácidos (SEC ID N°: 4) de PSCA v.2 La secuencia Kozak se muestra en negrita, la metionina de partida está subrayada.

1 M K

1 11 tgaggccatataaagtcacct gaggccc te t ccaccacaqcccaccagtgaooATGAA 3AVLLALLMAGLAI-QPGTA LI.

61 GGCTGTGCTGCTTGCCCTGTTG ATGGCAGGCTTGGCCCTGC AGCCAGGCACTGCCCTGCT 23CYSCKAQVSNEOCLQVENCT 121 GTGCTACTCCTGCAAAGCCCAGGTGAGCAACGAGGACTGCCTGCAGGTGGAGAACTGCAC 43QLGEQCHTAR1 RAVGLLTV I 181 CCAGCTGGGGGAGCAGTGCTGGACCGCGCGCATCCGCGCAGTTGGCCTCCTGACCGTCAT

63SKGCSLNCVDDSQDYYVGKK 241 CAGC AAAGGCT GCAGCT TGAACTGCGTGGATGACTCACAGGACTACT ACGTGGGCAAGAA 83NITCCDTDLCRASGAHALQP 301 GAACATCAC GTGCTGTGACACCGACTT GTGCAACG C CAGCGGGGCC CATGCC CTGCAGCC 103 AAAILALLPALGLLLKGPGQ 361 GGCTGCCGCCATCCTTGCGCTGCTCCCTGCACTCGGCCTGCTGCTCTGGGGACCCGGCCA 123 L *

421 GCTATAGgctctggggggccccgctgcagcccacactgggtgtggtgccccaggcetctg 481 tgccactcctcaeacacccggcccagtgggagcctgtcctggttcctgaggcacatccta 541 acgcaagtctgacca tgtatgtctgcgcccctgtcccccaccctgaccctcccatggccc 601 tctceaggactcccacccggcagatcggctctat tgacacagatccgcctgcagatggcc 661 cctccaaccotctctgctgctgtt tecatggcccagoattotccacccttaaccctgtgc 721 tcaggcacctcttcccGoaggaagocttccctgcccaccccatctatgactUgagccagg 781 tctggtccgtggtgtccccegcacccagcaggggacaggcactcaggagggcccggtaaa 841 ggctgaga tgaagt ggactgagtagaact ggaggacaggagt cgacg tgagt tcctggga 901 g te teca gaga tggggcctggaggcc tggaggaaggggccaggcctcacattcg tggggc 961 tccctgaatggcagcctcagcácagogtaggcccttaataaacacctgttggataagcca

Figura 1C. La secuencia de ADNc (SEC ID N°: 5) y aminoácidos (SEC ID N°: 6) de PSCA v.3 La secuencia Kozak se muestra en negrita, la metionina de partida está subrayada.

1 tttgaggccatataaagteacctgaggccctctccaccacagcccaccagtgaccatgaa 61 ggctgtgctgcttgccetgttgatggcaggcttggccctgcagccaggcactgeeetgct 121 gtgctactcctgcaaagcccaggcgcagttggeetcctgaccgtcatcagcaaaggctgc 181 agcttgaactgcgtggatgactcacaggactactacgtgggcaagaagaacateacgtgc 241 tgtgacaccgacttgtgcac teggcctgc tgc tctggggacccggccagct at aggctct 301 ggggggccccgctgcagcecacactgggtgtggtgccccaggcc te tgtgccac tcc tea 361 cacacccggeecagtgggagcctgtcct ggt t cctga ggea catee taacgcaagt ctga 1 MYVCAPVPHPDP PMALSRTP

421 ooATCTATGTCTGCGCCCCTGTCCCC C ACCCTG ACCCTC CCATGG C CC T C TCC AGG ACTC 21 TRQIGSIDTDPPADGPSNPL

481 CCACCCGGCAGATCGGCTCTATTGACACAGATCCGCCTGCAGATGGCCCCTCCAACCCTC 41 CCCFHGPAFSTLWPV LRHLF

541 TCTGCTGCTGTTTCCATGGCCCAGCATTCTCCACCCTTAACCCTGTGCTCAGGCACCTCT 61 PQEAFPAKPIY DLSQV WSVV

601 T CCC CCAGGAAGCCT TCCC TGCCC ACCCCATC TATG AC T TGA GC CAGGTCTGG7 CCG TGG 81 SPAPSRGQALRRAR*

661 TGTCC CCC GCAC CC AGC AGGGG AC AGGCACT C AGGAGG GCCC GGTAAag gctgagat gaa 721 gtggactgagtagaactggaggacaggagtcgacg tgagt tcc tgggag tctccagaga t 781 ggggcctggaggcctggaggaaggggccaggcctcacattcgtggggctccctgaatgge 841 agcctcagcacagcgtaggcccttaataaacacctgttggataagcea

Figura 1D. La secuencia de ADNc (SEC ID N°: 7) y aminoácidos (SEC ID N°: 8) de PSCAv.4 La metionina de partida está subrayada.

1 gacagtgaaccctgcgctgaaggcgttggggctcctgcagttctggggcagccacaggcg 61 cccagggtttcgtgccgatcagcccaggacggtcttcccggtgcagtt tctgatgcgggg 121 agggcagtgctg cct tccggt cacea ggaccagtgc tea gcccgcctgct tgaccccc 11 181 ac ttagctggggtccaatcca t acccaafc 11 agatgat teagaega tgggat 11 gaaact 241 11 tgaactgggtgcgac 11 aagcact gccctgctgtgc tac tcc tgcaaagcccagg tga 301 geaacgaggactgcc tgcagg tggagaactgcacccagc tgggggagcagtgctggaccg 361 cgcgcat ccgcgca gttggcctcctgaocgtcat cagcaaaggc tgeaget tgaac tgcg 1 MTHRTTTWARRTSRAVTPT 421 tggATGAC TCACAGGACTACTACGTGGGC AAGAAGAACATCACGT G CTGTGACACCGAC T 20CATPAGPMPCSRLP PSL8CS 481 TGTGC AACGCCAGCGGGGCCCATGCCCTGCAGCCGGCTGCCGCCATCCTTGCGCTGCTCC 40LHSACCSGO P A S YRLWGAPL 541 CTGCACTCGGCCTGCTGCTCTGGGGACCCGGCCAGCTATAGGCTCTGGGGGGCCCCGCTG

60 Q PTLGVV P Q A S V PL LTH PAQ

601 CAGCCCACACTGGGTGTGGTGCCCCAGGCCTCTGTGCCACTCCTCACACACCCGGCCCAG

80 W E PVLVPEA H PNAS I» T M Y V C

661 TGGGAGCCTGTCCTGGTTCCTGAGGCACATCCTAACGCAAGTCTGACCATGTATGTCTGC 100 APVPHPDPPMALSRTPTRQI 721 GCCCCTGTCCCCCACCCTGACCCTCCCATGGCCCTCTCCAGGACTCCCACCCGGCAGATC

120 GSIDTDPPADGPSNP1.CCCF 781 GGCTCTATTGACACAGATCCGCCXGCAGATGGCCCC1CCAACCCTCTCTGCTGCTGTTTC 140 HGPAFSTLN PVLRHLFP.QEA 841 CATGGCCCAGCATTCTCCACCCTTAACCCTGTGCTCAGGCACCTCTTCCCCCAGGAAGCC 160 FPAilPIYDLSQVPISVVS P A P 901 T TC CCTGCCC ACCCCATCTATGACTTG AGC C AGGTCTGGTC CGTG GTGTCCCCCG CACCC

180 SRGQALRRAR*

961 AGCAGGGGACAGGCACTCAGGAGGGC CCGG TAAa g ge t gag a t ga a g t ggac t ga g t aga 1021 actggaggacaggagtcgacgtgagttcctgggagtcteeagagatggggcctggaggcc 1081 tggaggaaggggccaggcctcacattcgtggggctccctgaatggcagccteagcacagc 1141 gtaggcccttaataaacacctgttggataagcoa

Figura 1E. La secuencia de ADNc (SEC ID N°: 9) y aminoácidos (SEC ID N°: 10) de PSCA v.5 La metionina de partida está subrayada.

1 gaeag tgaaccctgcgc tgaaggcgt tggggctcctgcagttetggggcagccacaggcg

61 cccaggg 111 cgtgccgatcagcccaggacgg te t tcccggtgcagt t tctgatgcgggg

121 agggcagtgc tgcct t ccggtcaccaggaccagtgctcageccgcctgc ttgaccccctt

181 act tagetggggtcca a teca tacccaat t tagatgat teagaegat ggga 111 ga a ac t 241 ttt gaactgggtgcgac tt a agcact gccctgctg tgctactcctgcaaageccaggtga 301 gcaacgaggactgcctgcaggtggagaactgcacccagctgggggagcag tgctggaccg

361 cgcgcatccgt gag tggggggacgacagccgccaggcc t aggtctctgccactgaact at 421 taatcttt ctggccatctg t ccgca tctgtgtgc tgt tt t cct t cea cctg tccccgacc 481 cg t cccgcacctgcaccoccaacaat cacccagca tctgtccctcca geca tce tcct cc 541 atctgccactcctccactcatctgtccetccceatcctccatcttccactcctccaccca 601 tctgtccctccecatecctgagctcacfctactcactcaccccatttctgacgctcagcgg 661 gtggtecatctgcctcggacatctggátagggctgagaccagggccgagaccaggccctc 721 gcactgcttgcaatcctgaggccagcccagggggactetagagcattaggcagggtggga 781 caggaggaggcctggggcaggtcaggcaggtgagcacacagggcagccccatccccggat 841 cccgctgctccccaggcgcagttggcctcctgaccgtcateagcaaaggctgcagcttga

1 mthrtttwarrtsravt

901 a ct gcg t ggATGACTC AC AGGACT ACT ACGTGGG CAAGAAGAACATCACGT G C TG TGñC A 18PTCAT' PAGPMPCSRLPPSLR 961 C CGACT TGTGCAACGC C AGCGGGGC CCATGCCCT G C AGCCG GCTGCCGCC ATCCTTGCGC 38 CS LHS AC C $ GDPAS Y R L W G A

1021 tgctccctgcactcggcctgctgctctggggacccggccagctacaggctctggggggcc

58PLQPTLGVV PQASVPLLTH P 1081 C CG CT GCAGCCCACACTGGGT GTGGTGCCCCAGGCCTCTGT GCC ACTCCrCAC ACACCCG 78AQWEPVLVPEAHPNASLTMY 1141 GCC CAGTGGGAGCCTGTCCTGGT TCCT GAG GC AC AT C CTAACGCAAGTCTGACCATGTAT 98 VCAPVPH PD PPMALSRT PTR 1201 GTCTGCGCCCCrGTCC CCCACCCTG AC CCTCCC AT GGCCCTCTCC AGGAC T C C C AC CC GG 118 oigsidtdppadgpsnplcc

1261 CAGATCGGCTCTATTGACACAGATCCGCCTGCAGATGGCCCCTCCAACCCTCTCTGCTGC 138 CE'HGPAFSTLNPVLRH l. PPQ 1321 TGTTTCCATGGCCCAGCATTCTCCACCCTTAACCCTGTGCTCAGGCACCTCTTCCCCCAG 158EAFPAHP1 Y O LSQVWSVVS P 1381 G AAGCC TTOCCTGCCCACCCC ATCTATGñC T T G AG CCAGGT CTGGTCCGTGGTGTCCCCC 178APSRGQALRRAR*

1441 G C ACCCAGCAG G GGAC AGGCACTCAGGAGGGC CCGGTAAa ggctgagatgaagtggactg 1501 agtagaactggaggacaggagtcgacgtgagttcctgggagtctccagagatggggcctg 1561 gaggcctggaggaaggggccaggccteacattcgtggggctccctgaatggcagcctcag 1621 cacagcgtaggcccttaataaacacctgttggataagcca

Figura 1F. La secuencia de ADNc (SEC ID N°: 11) y aminoácidos (SEC ID N°: 12) de PSCAv.6 La secuencia Kozak se muestra en negrita, la metionina de partida está subrayada.

1 11 tgaggccata taaagtcacctgaggccc tctccaccacagcccaccagtgacca tg aa 1 MAGLAEQPGTALL

%

61 ggctgtgctgcttgccctgtt gATGGCAGGCTTG GCCCTGCAGCCAGGCACTG C C C TG CT 14CYSCKAQVSNEDCLQVENCT 121 GTGCTACTCCTGCAAAGCCCAGGTGAGCAACGAGGACTGCCTGCAGGTGGAGAACTGCAC

34 QLGEQCWTARI RAVGLLTVI 181 CCAGCTG GGGGAGCAGT GCTGGACCGCGCGCATCCGCGCAGTTGGCCT CCTG ACCGTCAT 54 SKGCSlNCVDDSQDYlTVGKK 241 CAGCAAAGGCTGC AGCTTGAACTGCGTGGATGACTCACAGGACTACTACGTGGGCAAGAA 74NITCCCTDLCNASGARAtQP 301 GAACATCACGTGCTGTGACACCGACTTGTGCAACGCCAGCGGGGCCCATGCCCTGCAGCC 94 A A A I LALLPALGLLLWGPGQ 361 GGCTGCCGCCATCCTTGCGCTGCTCCCTGCACTCGGCCTGCTGCTCTGGGGACCCGGCCA 114 L *

421 GCT ATAGgct ct ggggggccccgct gcagcccacact gggtg tggt gccccaggcc te t g 481 tgccactcctcacacacccggcccag tgggagcctgtcct ggt t cc tgaggc acatcc ta 541 acgcaagtctgaccat gt at gtct gcgcccc tgt eccccacectgaccctccca tggccc 601 tctccaggac t cccacccggcaga tcggctc ta t bgacacagatccgcctgcagatggcc 661 cctccaaccc tctctgctgctgtt teca tggcccagca t tctccaccct taaccc tgtgc 721 tcaggcacctct tcccccaggaagect tccctgccca ccccat ctatgac ttgagccagg 781 tctggtccgtgg tg tcccccg cae cea ge a ggggaca ggcact caggagggcccggt aaa 841 ggctgagatgaagtggactgagtagaactggaggacaggagtcgacgtgagt tcctggga 901 gtctccagagatggggcctggaggcctggaggaaggggecaggcctcacattcgtggggc 961 tccctgaatggcagcctcagcacagcgtaggcccttaataaacacctgttggataagcca

Figura 1G. Variantes de SNP de PSCAv.2, PSCAv.7 a v.18

Variante

Posición de ácido nucleico

Variación de ácido nucleico

Variación de aminoácido

PSCA v.7

C/T

Variante silenciosa

PSCA v.8

A/C

Variante silenciosa

PSCA v.9

C/G

Variante silenciosa

PSCAv.10

C/T

Variante silenciosa

PSCAv.ll

563

C/T

Variante silenciosa

PSCA v. 12

567

G/A

Variante silenciosa

PSCA v. 13

627

G/A

Variante silenciosa

PSCAv.14

634

T/G

Variante silenciosa

PSCA v.15

835

G/A

Variante silenciosa

PSCA v.16

847

G/A

Variante silenciosa

PSCAv.17

878

G/A

Variante silenciosa

PSCA v.18

978

C/G

Variante silenciosa

Figura 1H. Variantes de SNP de PSCA v.4, PSCA v.19 a v.30

Variante

Posición

de ácido nucleico

Variación de ácido nucleico

Posición de aminoácido

Variación de aminoácido

PSCA v.19

521

CAT

P/L

PSCA v.20

578

A/C

Y/S

PSCA v.21

649

C/G

H/D

PSCAv.22

653

CAT

P/L

PSCA v.23

717

C/T

Variante silenciosa

PSCAv.24

721

G/A

A/T

PSCAv.25

781

G/A

G/S

PSCAv.26

788

T/G

I/S

PSCAv.27

989

G/A

R/Q

PSCA v.28

1001

G/A

Variante silenciosa

PSCA v.29

1032

G/A

Variante silenciosa

PSCA v.30

1132

C/G

Variante silenciosa

10 69 * 177

PSCAv.1 --------mf------

1 107 A 215

PSCAv.2 --------W------

1 107 a142

PSCAv.3 ------

1 261 469

PSCAv.4 ^-----

(108) (215)

1 261 ^

PSCA v.5 ü¡¡l£-----------------------------------KSÜ

(108) (215)

Tamaño

de producto de PCR resultante de los cebadores A + B

985 1020

88S

(1020)

1174

(1020)

1660

425pb

425 pb

300pb

425 pb

910pb

**(Ver fórmula)**

M = Marcador

Vejiga

Cerebro

Corazón

Riñón

Hígado

Pulmón

Próstata

Bazo

Músculo esquelético

Testículo

Páncreas

Colon

Estómago

Cáncer de próstata

Cáncer de vejiga

Cáncer de riñón

Cáncer de colon

Cáncer de pulmón

Cáncer de ovario

Cáncer de mama

Metástasis de cáncer

Cáncer de páncreas

PSCAv.1

PSCAv.2

PSCAv.3

10 69

1 107

1 107

1261

PSCA v.4

Tamaño

de producto de PCR resultante de los cebadores C +B

**(Ver fórmula)**

460 pb

945 pb