1,751 Patentes de febrero de 2013 (pag. 25)

  1. 769.-

    Puente atirantado con elementos prefabricados de hormigón, del tipo de los utilizados para la realización de viaductos y pasarelas minimizando el número de pilas intermedias, caracterizado porque utiliza unos dinteles prefabricados, transversalmente dispuestos, soportados mediante tirantes desde el extremo superior de uno o varios pilonos prefabricados apoyados a su vez sobre otro dintel ubicado sobre una pila que lo solidariza con el suelo, estando dispuestas entre los dinteles, y a su mismo nivel, una o varias vigas, también prefabricadas, longitudinalmente dispuestas, que sirven de soporte para el piso del puente atirantado. La invención que se presenta aporta la...

  2. 770.-

    Reparación interior doblada. Se proporciona un método para reparar la superficie del fuselaje de un avión desde el interior para ser utilizado cuando se ha dañado la superficie del fuselaje entre un primer larguerillo y un segundo larguerillo adyacente al primero. El método comprende cuatro etapas que son: - rellenar el daño, - colocar un primer refuerzo sobre el relleno, - colocar un segundo refuerzo sobre el primer refuerzo y curvar este segundo refuerzo al menos sobre una faldilla de uno de los larguerillos, y - asegurar la segunda chapa de refuerzo. El presente método se utiliza también en el caso de que bien uno de los larguerillos o bien los...

  3. 771.-

    Dispositivo de aparato doméstico La invención parte de un dispositivo de aparato doméstico con una puerta interior , la cual comprende un cristal de puerta , con una puerta exterior , y con un soporte de puerta , el cual está previsto para, en al menos un estado de funcionamiento, soportar la puerta interior y la puerta exterior de manera móvil independientemente una de otra. Para fijar el cristal de puerta de la puerta interior de manera sencilla constructivamente, y con poca necesidad de material, se propone que el dispositivo de aparato doméstico comprenda una unidad de sujeción , la cual fije sin marco, al menos, el cristal de puerta de la puerta...

  4. 772.-

    Proceso químico para la modificación selectiva de péptidos. Procedimiento de modificación selectiva de un péptido de fórmula general para obtener un péptido de fórmula general donde [aa]n representa el extremo N-terminal del péptido con un número variable n de amino ácidos, [aa]m representa el extremo C-terminal con un número variable m de amino ácidos, y la suma de m + n es un valor entero entre 1 y 50, Y se elige entre -CH2-, -CH(alquilo)- y -C(=O)-, Z se elige entre hidrógeno o un grupo protector de amina, y [A]i se elige entre grupos donde A representa CH2, un carbono sustituido o un heteroátomo, e i representa un valor entero entre 1 y 10; caracterizado...

  5. 773.-

    1. Dispositivo para protección de calzado , caracterizado porque comprende una cobertura con una cavidad susceptible de alojar de la puntera de dicho calzado , y unas tiras de sujeción elásticas vinculadas a dicha cobertura . 2. Dispositivo para protección de calzado , según la reivindicación 1, caracterizado porque dicha cobertura consta de una zona protectora inferior susceptible de recubrir parcialmente la suela de dicho calzado , presentando dicha zona protectora inferior unas formas rugosas . 3. Dispositivo...

  6. 774.-

    1. Máquina para limpieza interior de botellas de aire comprimido que, aplicable para hacer rodar, al menos, una botella en cuyo interior se ha previsto una cierta cantidad de cristal molido u otros materiales para que, con dicho movimiento, vaya limpiando su interior de restos de oxido u otras impurezas, está caracterizada porque comprende, al menos, un mecanismo de accionamiento que hace girar dos varillas paralelas con, al menos, dos ruedas de soporte cada una de ellas que giran solidariamente con dichas varillas y sobre las que se dispone,...

  7. 775.-

    1. Excitador para inducir vibraciones en infraestructura ferroviaria, caracterizado por estar constituido por masas contrarrotantes . 2. Excitador para inducir vibraciones en infraestructura ferroviaria, de acuerdo con la reivindicación 1ª, caracterizado porque el eje de giro de las masas contrarrotantes es horizontal (giro en planos verticales). 3. Excitador para inducir vibraciones en infraestructura ferroviaria, de acuerdo con la reivindicación 1ª, caracterizado porque el radio de giro (brazo, 3) y velocidad son variables y controlables...

  8. 776.-

    1. Soporte para cabezales de cepillos dentales eléctricos, del tipo de los que configuran un diedro recto en el que se establecen dos alas, una fijable a la pared, quedando dispuesta verticalmente y adosada a dicha pared, mientras que la otra queda en disposición horizontal y está dotada de ranuras abiertas hacia el frente para acoplamiento de los correspondientes cepillos, siendo los brazos de los cabezales correspondientes a los cepillos dentales eléctricos de configuración tronco-cónica, incorporando las cerdas en la parte lateral del extremo...

  9. 777.-

    1. Limitador de caudal para lanzas-boquilla de agua, caracterizado por estar constituido por un cuerpo cilíndrico regular -1-, cuya parte superior está unida con un deflector -3-, y de un resalte -6-, a modo de arandela laminadora, de diámetro ligeramente inferior al diámetro interior de la parte superior de la lanza-boquilla -4-, cuyo resalte -6- está provisto de una o más entallas -7-, preferentemente rectangulares. 2. Limitador de caudal para lanzas-boquilla de agua, según la reivindicación anterior, caracterizado por presentar una...

  10. 778.-

    1. Dispositivo autónomo de generación y suministro eléctrico que comprende al menos un elemento captador y/o transformador de energía , encargado de transformar la energía recibida a través de un generador eléctrico caracterizado porque dicho elemento captador está conectado a un módulo adaptador formado por un rectificador ; y un estabilizador ; y en donde el módulo adaptador a su vez, se conecta a un bloque de control conectado con el equipo captador , y con un acumulador conectado con un inversor para alimentar la...

  11. 779.-

    1. Dispositivo externo de protección barrera frente a infecciones urogenitales y/o daños en la integridad cutánea, caracterizado por estar compuesto por tres elementos con diferentes modalidades de diseño según patología asociada o preferencia de uso, que se adhieren entre sí, siendo el primero de los elementos un soporte inicial, compuesto en poliuretano o material con idénticas características, impregnado en una de sus caras con hidrocoloide a base de carboximetilcelulosa sódica o banda de papel satinado con pegamento hipoalergénico...

  12. 780.-

    1. Soporte para plancha, aplicable a tablas de planchar, que comprende una placa resistente al calor, preferiblemente metálica, adecuada para fijarse a una tabla (T) de planchar conformando una superficie de apoyo para una plancha (P); caracterizado porque dicha placa comprende al menos un enganche para la fijación de los extremos opuestos de una correa elástica ajustable en una posición operativa, en la que dicha correa elástica forma sobre la superficie de apoyo para la plancha (P) un bucle adecuado para abrazar y presionar...

  13. 781.-

    1. Dosificador portátil para el llenado de jeringas de gran volumen, caracterizado por el hecho de que comprende un cuerpo base provisto de una región de soporte sobre la cual es fijable de manera extraíble el recipiente de la jeringa y un medio desplazable axialmente acoplable de forma extraíble al émbolo de la jeringa, estando dicho medio desplazable vinculado a unos medios de accionamiento motores eléctricos para llevar a cabo un movimiento de avance y/o retroceso del émbolo de la jeringa, incluyendo un interfaz entre los medios de...

  14. 782.-

    Procedimiento para el refinado de biodiesel, independientemente del origen de la materia prima utilizada en su fabricación; que consiste en el tratamiento del mismo con un material adsorbente (preferiblemente carbón activado) a alta temperatura. Gracias al método, se consigue: reducir el contenido en glicéridos; eliminar materia insaponificable y decolorar el biodiesel. Esta mejora de calidad origina: aumento en ésteres metílicos, descenso de viscosidad y POFF, mejor filtrabilidad, mayor cetanos y ligero aumento del poder calorífico,...

  15. 783.-

    Un aparato de funda de aguja médica que comprende: un casquillo de aguja que tiene una cánula de aguja exterior que se extiende desde el mismo a un extremodistal, una aguja interior dispuesta para su desplazamiento deslizante con la cánula de aguja exterior; y al menos una funda que es extensible desde una posición retraída hasta una posición extendida para incluirun extremo distal de la aguja interior, la funda incluye un miembro de unión dispuesto en el interior de la funda y que define superficies de uniónque forman una...

  16. 784.-

    Un procedimiento de producción de un cosmético en polvo que comprende: mezclar 65 a 97% en masa del componente de polvo y 3 a 35% en masa del componente oleoso en forma de aglutinante con un aparato de mezclado en seco, en el cual el aparato mezclador en seco es un aparato mezclador del tipo rotores enfrentados que tiene un primer rotor con una pluralidad de aletas y un segundo rotor con una pluralidad de aletas en una cámara mezcladora, en la cual el primer rotor y el segundo rotor están enfrentados entre sí y tienen respectivos...

  17. 785.-

    Un ARN, donde dicho ARN posee actividad contra la infección por el VIH y donde dicho ARN se selecciona delgrupo que consiste en: a) un ARN bicatenario derivado por apareamiento de SEC ID Nº: 9 y la secuencia complementaria de ésta; b) un ARN bicatenario derivado por apareamiento de un fragmento de SEC ID Nº: 9 y la secuencia complementariade éste: (ggauggugcuucaagcuaguaccaguu (SEC.ID Nº:9); donde dicho(s) fragmento (s) de SEC.ID Nº:9 en b) se seleccionan del grupo que consiste en un fragmento de 18 nt de SEC. ID Nº:...

  18. 786.-

    Procedimiento de caracterización de la dinámica de coagulación o de sedimentación de un fluido talcomo la sangre completa, una fracción de sangre o el plasma sanguíneo, que comprende: - la iluminación de una muestra de dicho fluido (ES) con un haz de luz coherente; - la adquisición de una serie temporal de imágenes de un patrón de moteado generado por la interacción entredicha muestra y dicho haz de luz espacialmente coherente; y - el tratamiento de dicha serie temporal de imágenes; caracterizado porque dicha etapa...

  19. 787.-

    Un péptido de menos de 5000 de peso molecular que comprende la secuencia aminoácida FHTYTIDWTKDAVTW donde el péptido es capaz de unirse a HLA-DRB1*04 y donde cuando está unido a HLADRB1*04 el HLA-DRB1*04 unido al péptido es capaz de identificar células T específicas para Aspergillus fumigatus.

  20. 788.-

    Una célula de combustible de óxido sólido que comprende un electrodo de ánodo , un electrodo decátodo y un electrolito entre el electrodo de ánodo y el electrodo de cátodo , caracterizada porqueel electrolito comprende una primera capa densa no porosa , una segunda capa porosa sobre laprimera capa densa no porosa y una tercera capa densa no porosa sobre la segunda capa porosa .

  21. 789.-

    Dispositivo de llenado de recipientes de productos alimenticios , por ejemplo, recipientes de yogurt, quecomprende una serie de toberas para el llenado de los recipientes con un producto alimenticio, estando cadauna de las toberas montada en un cuerpo de tobera , caracterizado porque comprende medios paraaplicar a cada una de las toberas un movimiento de traslación, según el eje (A) de la tobera, eventualmentecombinado con un movimiento de rotación alrededor de este eje, independientemente del cuerpo de tobera , demanera...

  22. 790.-

    Método y Sistema de Visión artificial a bordo de un vehículo para la detección automática de residuos de las vías públicas y envío inalámbrico de los datos captados a una unidad central en gabinete para su almacenamiento en un sistema de información y obtención de registros gráficos en tiempo real. El objeto de invención se refiere a un método y a un sistema de visión artificial que tienen la finalidad de discriminar en continuo y en tiempo real la presencia y categoría de residuos en las vías públicas, determinando...

  23. 791.-

    Pinza para manipular grandes cargas. La carga a sujetar es un bloque prismático, esférico o irregular, sujetado con la pinza por tres puntos. Cuenta con un brazo maestro conectado mediante al menos un eje a dos brazos libres , existiendo tanto en el extremo de sujeción del brazo maestro como en los extremos de sujeción de los brazos libres unos elementos de apoyo que mejoran el agarre.

  24. 792.-

    Sonotrodo para mecanizar piezas y equipo de mecanizado que comprende dicho sonotrodo. Sonotrodo para mecanizar piezas, que tiene elevada resistencia a las fuerzas de corte, que comprende un cuerpo central que tiene un tramo cilíndrico respecto a un eje central del que se prolongan transversalmente al menos dos discos separados entre sí una distancia no inferior al diámetro del tramo cilíndrico, estando a su vez dichos discos fijados perimetralmente a una carcasa , pudiendo ser acoplado un elemento portaherramientas ...

  25. 793.-

    Un conjunto de recipiente, tal como una caja Petri o una placa de contacto para su uso como dispositivo de toma de muestras para microorganismos, incluye un elemento de base, una tapa y un mecanismo de bloqueo que proporciona un acoplamiento de bloqueo seguro entre la tapa y el elemento de base. El mecanismo de bloqueo está diseñado de modo que no se bloquea a menos que se aplique una fuerza compresiva específica aplicada de manera intencionada, y que puede desacoplarse fácilmente de su acoplamiento de bloqueo sin la necesidad...

  26. 794.-

    Prensa mecánica adaptada para procesos de conformado, particularmente de conformado en caliente, que comprende unos troqueles (2b, 3b) adaptados para conformar una pieza, un motor, un cigüeñal acoplado al motor a través de unos medios de transmisión un mecanismo de biela-manivela que acopla uno de los troqueles (2b, 3b) al cigüeñal , y al menos un casquillo de lubricación fijado al mecanismo de biela-manivela . El casquillo de lubricación comprende en una superficie interior, una primera zona adaptada para lubricar...

  27. 795.-

    Sistema de gestión remota de contadores de un servicio de pago. Dicho sistema se compone de nodos terminales, concentradores, routers, redes inalámbricas de acceso, red troncal y servidor de aplicación. El sistema propuesto en la presente invención permitirá la lectura del consumo en tiempo real e interacción con los contadores, mejorando tanto el servicio prestado al usuario como el funcionamiento del negocio de la empresa suministradora del servicio medido por dichos contadores (por ejemplo, un servicio de abastecimiento...

  28. 796.-

    La invención se refiere a un conectador para conexiones de datos, en particular del tipo de RJ, con un elemento de enganche para asegurar una conexión a un conectador contrapuesto o conjugado. A fin de simplificar una desconexión del conectador y el conectador contrapuesto, incluso cuando la conexión está asegurada por la conexión de enganche, la invención hace posible que el conectador esté dotado de un extremo de agarre (5, 5') que está configurado para trasladar o transferir el elemento de enganche desde...

  29. 797.-

    Torre que comprende una base de torre , un segmento de torre unido a la base de torre con libertad de pivotamiento para poder pasar de una primera posición (P1) sustancialmente horizontal a una segunda posición sustancialmente vertical, y/o viceversa, y un mecanismo para provocar un cambio de posición del segmento de torre . El mecanismo se acciona manualmente y comprende un actuador para provocar el cambio de posición del segmento de torre , un multiplicador asociado al actuador, y al menos un cable de tensado que...

  30. 798.-

    Equipo generador de perturbaciones eléctricas en la red conectada a un sistema de generación de energía eléctrica, como por ejemplo un aerogenerador o planta solar, para ensayar la respuesta de los generadores ante perturbaciones en la red, entendiendo perturbaciones como huecos de tensión, sobretensiones, saltos de fase y cambios de frecuencia, que comprende un transformador trifásico o tres monofásicos de tomas variables conectados en serie entre el sistema colector y el generador, encargándose este transformador de...

  31. 799.-

    Colector de acoplamiento rápido adaptado a sistemas de calefacción o a sistemas sanitarios que comprende al menos un par de módulos acoplables entre sí, cada uno de los cuales comprende un conducto de entrada y un conducto de salida , en donde al menos uno de los módulos comprende en el conducto de salida un alojamiento adaptado para alojar el conducto de entrada del otro módulo , unos medios de conexión rápida dispuestos en al menos un extremo de cada módulo adaptados para acoplar ambos módulos entre...

  32. 800.-

    Uso de un agonista del receptor ObRb para el tratamiento de traumatismos del Sistema Nervioso Central y/o del dolor neuropático. La presente invención se refiere al uso de un agonista del receptor ObRb o al uso de la leptina o al uso de la secuencia nucleotídica que la codifica, para la fabricación de un medicamento para el tratamiento de traumatismos del Sistema Nervioso Central (SNC) y/o del dolor neuropático, preferiblemente para el tratamiento de la Lesión Medular Espinal (LME). También se refiere al uso de un...

<< · 13 · 19 · 22 · 23 · < · 25 · > · 28 · 32 · 40 · >>