2428 patentes, modelos y diseños de HOECHST AKTIENGESELLSCHAFT

  1. 1.-

    AISLAMIENTO DE LOS GENES DE BIOSINTESIS DE SEUDO-OLIGOSACARIDOS DE STREPTOMYCES GLAUCESCENS GLA.O Y SU USO.

    (06/2007)

    LA INVENCION TRATA DE UNA MOLECULA DE DNA QUE CONTIENE GENES PARA LA BIOSINTESIS DE ACARBOSA Y PSEUDO - OLIGOSACARIDOS HOMOLOGOS; INICIADOR DE OLIGONUCLEOTIDO PARA LA AMPLIFICACION POR PCR DE LA MOLECULA; PROTEINAS QUE SE OBTIENEN POR LA EXPRESION DE LOS GENES LOCALIZADOS EN LA MOLECULA; VECTORES Y CELULAS HOSPEDADORAS QUE CONTIENEN LA MOLECULA DE DNA ANTES CITADA; PROTEINAS QUE SE CODIFICAN MEDIANTE LA MOLECULA DE DNA; PROTEINAS QUE SE EXPRESAN MEDIANTE LOS CITADOS VECTORES EN LAS CITADAS CELULAS HOSPEDADORAS; PROCEDIMIENTO PARA LA PREPARACION DE ACARBOSA MEDIANTE LA INCLUSION Y/O EXCLUSION DE LOS GENES CARACTERIZADOS EN LOS CORRESPONDIENTES...

  2. 2.-

    ACIDOS ALFA-IMINOHIDROXAMICOS Y CARBOXILICOS N-SUSTITUIDOS, CICLICOS Y HETEROCICLICOS.

    (04/2007)
    Ver ilustración. Inventor/es: SCHUDOK, MANFRED, THORWART, WERNER, SCHWAB, WILFRIED, HAASE, BURKHARD, BARTNIK, ECKART, WEITHMANN, KLAUS-ULRICH. Clasificación: A61K31/47, C07D405/12, C07D217/26.

    LOS COMPUESTOS DE FORMULA (I) SON APROPIADOS PARA LA PRODUCCION DE MEDICAMENTOS PARA EL TRATAMIENTO DE ENFERMEDADES, EN LAS CUALES ESTA IMPLICADA UN AUMENTO DE LA ACTIVIDAD DE LAS METALOPROTEINASAS DESTRUCTORAS DE LA MATRIZ.

  3. 3.-

    PROTEINA QUE SE UNE A ATP Y A ACIDOS NUCLEICOS CON PROPIEDADES DE HELICASA Y ATPASA.

    (12/2006)
    Inventor/es: KIRSCHBAUM, BERND, DR., MULLNER, STEFAN, DR., BARTLETT, ROBERT, DR. Clasificación: G01N33/50, C12N15/55, C12Q1/42, C12P21/02, C12N9/14, C12N15/61, C12N9/90, C12Q1/533, C12N15/11.

    LA PRESENTE INVENCION TIENE COMO OBJETO LA IDENTIFICACION Y CARACTERIZACION BIOMOLECULAR Y BIOQUIMICA DE UNA PROTEINA DE UNION AL ATP Y A LOS ACIDOS NUCLEICOS CON LAS CARACTERISTICAS DE HELICASA Y ATPASA, ASI COMO UN PROCEDIMIENTO PARA SU OBTENCION Y UTILIZACION EN SISTEMAS FARMACOLOGICAMENTE RELEVANTES DE ENSAYOS Y PRUEBAS.

  4. 4.-

    NUEVOS PROFARMACOS PARA LA TERAPIA DE TUMORES Y ENFERMEDADES INFLAMATORIAS.

    (08/2006)
    Ver ilustración. Inventor/es: BOSSLET, KLAUS, DR., CZECH, JORG, DR., GERKEN, MANFRED, DR., STRAUB, RAINER, DR., MONNERET, CLAUDE, DR., FLORENT, JEAN-CLAUDE, DR., SCHMIDT, FREDERIC. Clasificación: A61P35/00, A61K47/48.

    SE DESCRIBEN COMPUESTOS CON LA FORMULA I GLICOSIL - Y [ C(=Y) - X - ]{SUB,P} - W (R){SUB,N} - Z - C (=Y) - PRINCIPIO ACTIVO (I) APLICABLES AL TRATAMIENTO DE CANCER, ENFERMEDADES AUTOINMUNES Y ENFERMEDADES INFLAMATORIAS CRONICAS COMO LA ARTRITIS REUMATOIDE.

  5. 5.-

    PROCEDIMIENTO PARA PREPARAR ACIDOS (4-ARIL-2,5-DIOXOIMIDAZOLIDIN-1-IL)-ACETICOS QUIRALES, NO RACEMICOS.

    (06/2006)
    Ver ilustración. Inventor/es: HOLLA, WOLFGANG, BECK, GERHARD, KAMMERMEIER, BERNHARD, DR., KULITZSCHER, BERNDT, DL., MICHALOWSKY, JURGEN. Clasificación: C07D233/78, C07B57/00, C07D233/76.

    LA PRESENTE INVENCION TRATA DE UN PROCEDIMIENTO PARA LA FABRICACION DE COMPOSICIONES QUIRALES Y NO RACEMICAS DE LA FORMULA GENERAL I, EN LA CUAL R{SUP,1} Y R{SUP,2} TIENEN LA SIGNIFICACION DADA EN LA REIVINDICACION 1 Y REPRESENTAN PRODUCTOS INTERMEDIOS VALIOSOS PARA LA FABRICACION DE SUSTANCIAS ACTIVAS FARMACEUTICAS. EN ESTE PROCEDIMIENTO, PARA LA DISOCIACION DEL RACEMATO SE FORMA UNA SAL A PARTIR DE LA COMPOSICION RACEMICA DE LA FORMULA GENERAL I Y UNA COMPOSICION DE AMINO QUIRAL Y NO RACEMICA. LA INVENCION TRATA ADEMAS DE COMPOSICIONES DE LA FORMULA GENERAL I Y SUS ESTERES.

  6. 6.-

    DERIVADOS DEL ACIDO ASPARTICO, SU PREPARACION Y USO.

    (04/2006)
    Inventor/es: KLINGLER, OTMAR, ZOLLER, GERHARD, DR., JUST, MELITTA, DR., JABLONKA, BERND, DR.. Clasificación: A61K38/04, C07K5/06, A61K31/445, A61K31/40, C07D207/04, C07D211/06.

    DERIVADOS DEL ACIDO ASPARTICO DE FORMULA EN DONDE X ES A ES P. E. -(CH{SUB,2}){SUB,M} Y R ES P. E. CICLOHEXILAMINO; POSEEN VALIOSAS PROPIEDADES FARMACOLOGICAS.

  7. 7.-

    METODO DE TRANSCRIPCION IN VITRO PARA EL RASTREO DE PRODUCTOS NATURALES Y OTRAS SUSTANCIAS QUIMICAS.

    (04/2006)

    LA INVENCION SE REFIERE A UN PROCEDIMIENTO AUTOMATIZABLE IN VITRO PARA EL ANALISIS DE LA TRANSCRIPCION DE GENES VIRALES Y CELULARES, EL CUAL ES APROPIADO PARA LA BUSQUEDA MASIVA DE ESTRUCTURAS QUIMICAS PILOTO QUE INFLUYEN SELECTIVAMENTE EN LA ACTIVIDAD GENICA DE FORMA REPRESENTABLE RACIONAL Y ECONOMICA. EL PROCEDIMIENTO PARA LA TRANSCRIPCION IN VITRO SIN CELULAS DE UN MOLDE DE ADN, QUE CONTIENE UNA SECUENCIA DE ADN QUE SE PUEDE TRANSCRIBIR, QUE ESTA BAJO EL CONTROL DE AL MENOS UN ELEMENTO REGULADOR GENICO, SE CARACTERIZA PORQUE A) PARA LA TRANSCRIPCION SE UTILIZA UN EXTRACTO ENRIQUECIDO Y...

  8. 8.-

    ANALOGOS DE OLIGONUCLEOTIDOS 3'-DERIVATIZADOS CON AGRUPACIONES NO NUCLEOTIDICAS, SU PREPARACION Y UTILIZACION.

    (04/2006)

    Compuestos análogos a oligonucleótidos de la **fórmula** así como de sus sales fisiológicamente compatibles, caracterizados porque R1 significa hidrógeno, alquilo C1-C18, alquenilo C2- C18, alquinilo C2-C18, alquilcarbonilo C2-C18, alquenilcarbonilo C3-C19, alquinilcarbonilo C3-C19, arilo C6-C20, aril (C6-C14)-alquilo (C1-C8), o un radical de la **fórmula** ; R2 significa hidrógeno, hidroxi, alcoxi C1-C18, halógeno, azido o NH2; B representa una base usual en la química de los oligonucleótidos; a representa oxi o metileno; d, e, independientemente unos de otros, significan un número entero de 0 a 50; i significa un número entero de 1 a 10; W significa oxo, selenoxo o tioxo; V significa oxi, sulfanodiílo o...

  9. 9.-

    UTILIZACION DE ANTAGONISTAS PEPTIDICOS DE BRADIQUININA PARA LA PREPARACION DE MEDICAMENTOS.

    (11/2005)
    Inventor/es: BREIPOHL, GERHARD, DR., BICKEL, MARTIN, HENKE, STEPHAN, KNOLLE, JOCHEN DR., WIRTH KLAUSM DR., HROPOT, MAX, DR. Clasificación: A61K38/04, A61K38/08, A61P1/16.

    LA INVENCION SE REFIERE A LA UTILIZACION DE ANTAGONISTAS DE LA BRADICININA PARA PREPARAR MEDICAMENTOS PARA EL TRATAMIENTO DE ENFERMEDADES HEPATICAS FIBROGENETICAS CRONICAS (CIRROSIS Y FIBROSIS HEPATICAS) Y ENFERMEDADES HEPATICAS AGUDAS Y PARA PREVENIR COMPLICACIONES, EN PARTICULAR PARA LA PROFILAXIS O EL TRATAMIENTO DE HIPERTONIA PORTAL, EPISODIOS DE DESCOMPENSACION COMO ASCITIS, EDEMA, SINDROME HEPATORRENAL, GASTROPATIA Y COLOPATIA HIPERTENSIVAS, ESPLENOMEGALIA Y COMPLICACIONES HEMORRAGICAS DEL TRACTO GASTROINTESTINAL POR HIPERTONIA PORTAL, CIRCULACION COLATERAL E HIPEREMIA Y UNA CARDIOPATIA A CONSECUENCIA DE UN TRASTORNO CIRCULATORIO HIPERDINAMICO CRONICO Y SUS CONSECUENCIAS.

  10. 10.-

    PREPARADO DE COMBINACION PARA EL TRATAMIENTO DE LA DEMENCIA, QUE CONTIENE AL MENOS UN COMPUESTO QUE TIENE ACTIVIDAD INHIBIDORA DE LA ACETILCOLINESTERASA O MUSCARINICA Y UN COMPUESTO QUE AUMENTA LOS NIVELES DE ADENOSINA ENDOGENA EXTRACELULAR.

    (11/2005)
    Inventor/es: RUDOLPHI, KARL, SCHUBERT, HANS-PETER, DR., NIMMESGERN, HILDEGARD, DR. Clasificación: A61P43/00, A61K45/06.

    UN PREPARADO COMBINADO QUE CONTIENE UN COMPUESTO QUE MUESTRA UNA ACCION INHIBIDORA DE LA ACETILCOLINAESTERASA O UN EFECTO MUSCARINERGO Y UN COMPUESTO QUE AUMENTA EL NIVEL DE ADENOSINA EXTRACELULAR ENDOGENA, ES IDONEO PARA EL TRATAMIENTO DE LA DEMENCIA.

  11. 11.-

    UTILIZACION DE INHIBIDORES DEL INTERCAMBIADOR CELULAR DE NA+/H+ (NHE) PARA LA PREPARACION DE UN MEDICAMENTO PARA LA NORMALIZACION DE LOS LIPIDOS SERICOS.

    (10/2005)
    Inventor/es: KLEEMANN, HEINZ-WERNER, LANG, HANS-JOCHEN, KRAMER, WERNER, FALK, EUGEN, JANSEN, HANS-WILLI, SCHWARK, JAN-ROBERT, JUNG, OLIVER, SCHAFER, HANS-LUDWIG, LINZ, WOLFGANG, SCHOLKENS, BERNWARD. Clasificación: A61K45/00, A61K31/22, A61P3/06, A61K45/06, A61K31/155, A61K31/455.

    LOS PRINCIPIOS ACTIVOS IDENTIFICADOS COMO INHIBIDORES DEL INTERCAMBIADOR CELULAR NA + /H + SE UTILIZAN PARA LA PREPARACION DE UN MEDICAMENTO PARA NORMALIZAR LOS LIPIDOS DEL SUERO. SE UTILIZAN PARA LA PREPARACION DE UN MEDICAMENTO PARA BAJAR EL NIVEL DE GRASAS EN LA SANGRE Y LAS ENFERMEDADES CAUSADAS POR ELLO ASI COMO EL SINDROME DE DISFUNCION ENDOTELIAL, Y ENFERMEDADES CAUSADAS POR ELLO.

  12. 12.-

    SALES DEL ETILESTER DEL ACIDO 3-(2-(4-(4-(AMINO-IMINO-METIL)-FENIL)-4-METIL-2 ,5-DIOXO-IMIDAZOLIDIN-1-IL)-ACETILAMINO)-3-FENIL-PROPIONICO.

    (10/2005)
    Ver ilustración. Inventor/es: BECK, GERHARD, STILZ, HANS, ULRICH, RADAU, MANFRED, DR. Clasificación: A61K31/415, C07D233/78.

    LA PRESENTE INVENCION TRATA DE UNAS SALES DE 3 XO IMIDAZOLIDINA PROPIONICO IDO MALEICO. LA INVENCION SE REFIERE TAMBIEN A SUS SALES COMPATIBLES FISIOLOGICAMENTE, AL PROCEDIMIENTO PARA SU PRODUCCION Y SU USO EN MEDICAMENTOS.

  13. 13.-

    MEZCLAS DE ADUCTOS DE EPOXIDO/AMINA Y COPOLIMEROS.

    (10/2005)
    Inventor/es: EPPLE, ULRICH, DR., MARTEN, MANFRED, KUBILLUS, UWE, DR., OSWALD, HARALD. Clasificación: C09D163/00, C09D133/00, C09D133/06, C09D167/00, C08G18/32, C08G59/18, C08G18/64, C08G59/64.

    ADUCTOS ALIFATICOS DE EPOXIDO Y AMINA CON UNA PROPORCION EN MASA DE AL MENOS EL 20 % EN UNIDADES DE EPOXIDO O AMINA ALIFATICA, QUE CONTIENEN AL MENOS UN ATOMO DE CARBONO TERCIARIO O CUATERNARIO; SE OBTIENEN POR REACCION DE MONOEPOXIDOS CON MONOO DIAMINAS, O DIEPOXIDOS CON MONOAMINAS. SE UTILIZAN COMO LIGANTES PARA RECUBRIMIENTOS ECOLOGICOS, OPCIONALMENTE MEZCLADOS CON OTROS LIGANTES HIDROXIFUNCIONALES, Y COMO COMPONENTE REACTIVO EN LOS CORRESPONDIENTES PEGAMENTOS Y SELLANTES.

  14. 14.-

    INOSITOLGLICANOS CON ACTIVIDAD INSULINICA.

    (08/2005)
    Ver ilustración. Inventor/es: FRICK, WENDELIN, MULLER, GUNTER, DR.. Clasificación: A61K31/70, C07H3/04, C07H3/06.

    SE DESCRIBEN COMPUESTOS DE FORMULA I, EN DONDE A ES EL GRUPO H )(OH) , (C SUB,1} S(O)(OR SUP,1}) R SUP,1}R SUP,2}N (C SUB,1} ,4}) A 6 SUSTITUIDO O NO Y R ES INOSITOL SUSTITUIDO O NO. LOS COMPUESTOS DE FORMULA I SIRVEN PARA EL TRATAMIENTO DE LA DIABETES MELLITUS O DIABETES NO DEPENDIENTES DE LA INSULINA.

  15. 15.-

    COMPUESTOS ANULARES DE SIETE MIEMBROS, CONDENSADOS SUSTITUIDOS CON SULFONAMIDO CON ACTIVIDAD BLOQUEANTE DEL CANAL DE POTASIO.

    (06/2005)
    Ver ilustración. Inventor/es: BRENDEL, JOACHIM, LANG, HANS-JOCHEN, GERLACH, UWE. Clasificación: A61K31/335, C07C311/07, C07D313/08.

    LA PRESENTE INVENCION HACE REFERENCIA A COMPUESTOS CON LA FORMULA I, EN LA QUE X1, X2, X3, X4, Y1, Y2, Y3, Y4, R , R Y R TIENEN LOS SIGNIFICADOS CITADOS EN LOS ANEXOS, A SU OBTENCION Y A SU APLICACION , ESPECIALMENTE COMO MEDICAMENTOS. ESTOS COMPUESTOS ACTUAN SOBRE EL CANAL DE POTASIO ABIERTO MEDIANTE ADENOSINMONOFOSFATO CICLICO (CAMP), O BIEN SOBRE EL CANAL I KS , Y SON IDONEOS COMO MEDICAMENTOS ACTIVOS, POR EJEMPLO, EN LA PROFILAXIS Y TERAPIA DE ENFERMEDADES CORONARIAS, ESPECIALMENTE ARRITMIAS, EN EL TRATAMIENTO DE ULCERA DE ESTOMAGO E INTESTINO O EN EL TRATAMIENTO DE DIARREAS.

  16. 16.-

    PROCEDIMIENTO PARA LA OBTENCION DE INSULINA MEDIANTE CROMATOGRAFIA EN LIQUIDO A ALTA PRESION.

    (06/2005)
    Inventor/es: OBERMEIER, RAINER, DR., LUDWIG, JURGEN, SABEL, WALTER, DL. Clasificación: C07K14/62, C07K1/18.

    SE DESCRIBE UN PROCESO PARA LA OBTENCION DE INSULINA, EN EL QUE LA SEPARACION SE REALIZA CON MATERIAL DE INTERCAMBIO CATIONICO ACIDO ESTABLE A LA PRESION, SIENDO ESTA DE 1,1 MPA A 40 MPA.

  17. 17.-

    4-AMINO-2-UREIDO-5-CARBOXAMINAS , PROCEDIMIENTOS PARA SU PREPARACION, MEDICAMENTOS QUE CONTIENEN ESTOS COMPUESTOS, Y SU USO.

    (05/2005)
    Ver ilustración. Inventor/es: JAHNE, GERHARD, SCHAFER, HANS-LUDWIG, BOGER, HANS GEORG, DR., HOFFMANN, AXEL, DR., KRASS, NORBERT, DR. Clasificación: A61K31/505, C07D403/04.

    SE DESCRIBEN 4 DAS DE ACIDO ORGANICO DE LA FORMULA I, EN LA CUAL DE R{SUP,1} A R{SUP,3} TIENEN LA SIGNIFICACION DADA; TAMBIEN SE DESCRIBEN SUS SALES FISIOLOGICAMENTE COMPATIBLES Y EL PROCEDIMIENTO PARA SU FABRICACION. LAS COMPOSICIONES SON APTAS PARA EL TRATAMIENTO DE LOS TRASTORNOS DE METABOLIZACION DE LIPIDOS.

  18. 18.-

    4-AMINO-2-UREIDO-PIRIMIDIN-5-CARBOXAMIDAS , PROCEDIMIENTO PARA SU PREPARACION, MEDICAMENTOS QUE CONTIENEN ESTOS COMPUESTOS, Y SU USO.

    (05/2005)
    Ver ilustración. Inventor/es: BOGER, HANS GEORG, DR., HOFFMANN, AXEL, DR., KRASS, NORBERT, DR., RACKUR, GERHARD, DR., LEINEWEBER, MICHAEL, DR. Clasificación: A61K31/505, C07D403/04.

    SE DESCRIBEN 4 DAS DE ACIDO ORGANICO TERCIARIAS DE LA FORMULA I, EN LA CUAL DE R{SUP,1} A R{SUP,4} TIENEN LA SIGNIFICACION DADA; TAMBIEN SE DESCRIBEN SUS SALES FISIOLOGICAMENTE COMPATIBLES Y EL PROCEDIMIENTO PARA SU FABRICACION. LAS COMPOSICIONES SON APTAS PARA EL TRATAMIENTO DE LOS TRASTORNOS EN LA METABOLIZACION DE LIPIDOS.

  19. 19.-

    PROCEDIMIENTO PARA EL APROVECHAMIENTO DEL SISTEMA PROMOTOR DE PA-ADH EN UNA LEVADURA PARA LA PRODUCCION POR VIA BIIOTECNOLOGICA DE PROTEINAS HETEROLOGAS EN ALTOS RENDIMIENTOS.

    (04/2005)
    Inventor/es: HABERMANN, PAUL, ARETZ, WERNER, DR., BADZIONG, WERNER, DR., MOLLER, JORG, DR. Clasificación: C07K14/62, C07K19/00, C07K14/575, C12N15/81, C07K14/815.

    LA INVENCION TRATA DE UN NUEVO PROCEDIMIENTO PARA LA UTILIZACION DEL SISTEMA PROMOTOR ADH-II DE LA LEVADURA PARA LA PRODUCCION DE PROTEINAS HETEROLOGAS CON ELEVADO RENDIMIENTO, P. E. PARA LA OBTENCION DE HIRUDINAS, MINIPROINSULINAS, LEPTINAS O SUS DERIVADOS.

  20. 20.-

    N-HETEROCICLOS CONDENSADOS, SUSTITUIDOS CON BENCILOXI, PROCEDIMIENTO PARA SU PREPARACION Y SU USO COMO ANTAGONISTAS DEL RECEPTOR DE BRADIQUININA.

    (02/2005)
    Ver ilustración. Inventor/es: WIRTH, KLAUS, HEITSCH, HOLGER, WAGNER, ADALBERT, DR., SCHOLKENS, BERNWARD, PROF. DR.. Clasificación: A61K31/47, C07D405/12, C07D401/12, C07D215/26.

    SON OBJETO DE LA INVENCION LOS COMPUESTOS DE FORMULA (I) EN LA CUAL D ES UN RESTO DE FORMULA (II) O (III): X 1 ES N O C - R 6 X 2 ES N O C - R 7 X 3 ES N O C - R 8 B ES UN RESTO DE FORMULA (VIII) Y R 1 - R SUP,6 , X 1 - X 3 Y R - R"' QUE TIENEN EL SIGNIFICADO CITADO EN LAS REIVINDICACIONES, PROCEDIMIENTO PARA SU PRODUCCION Y SU USO COMO ADYUVANTES PARA EL TRATAMIENTO Y PREVENCION DE LA CIRROSIS HEPATICA O DE LA ENFERMEDAD DE ALZHEIMER.

  21. 21.-

    PEPTIDOS DE SCLERODERMA TEXENSE.

    (01/2005)
    Inventor/es: MARKUS, ASTRID, WINK, JOACHIM, KOGLER, HERBERT, STAHL, WILHELM, DR., STUMP, HEIKE, BACKHAUS, JURGEN. Clasificación: C12P21/02, A61K38/10, C12N1/14, C07K7/02.

    LA INVENCION TRATA DE NUEVOS PEPTIDOS, QUE SON TEXENOMICINAS, DE SCLERODERMO TEXENSE, UN PROCEDIMIENTO PARA SU PREPARACION Y SU UTILIZACION COMO MEDICAMENTO, EN PARTICULAR COMO ANTIMICOTICO. LAS TEXENOMICINAS DE LA PRESENTE INVENCION SE CARACTERIZAN POR LA SECUENCIA DE AMINOACIDOS (I) FS - PRO - AIB - AIB - AIB - AIB - ALA - ALA - AIB - BE ALA - LEU - AIB BE ALA ALA - AIB - BE ALA - ALA - AIB - AIB - AIB - ALA ARG - OL, EN DONDE FS SIGNIFICA UN ESTER DE ACIDO OXO - GRASO, AIE ACIDO AMINOISOBUTIRICO Y ARG - OL = ARGININOL.

  22. 22.-

    REACTIVO Y METODO PARA INHIBIR LA EXPRESION DE N-RAS.

    (01/2005)
    Ver ilustración. Inventor/es: UHLMANN, EUGEN, DR., ENGELS, JOACHIM, PROF. DR., SCHERR, MICHAELA, GANSER, ARNOLD, PROF. DR. Clasificación: C12N9/00.

    ESTA INVENCION SE REFIERE A MOLECULAS DE ARN ENZIMATICO QUE ROMPEN MARN DE N DE RUPTURA NUX (N = CUALQUIER BASE, X = A, C = A, C O U), QUE PREFERIBLEMENTE PRESENTAN LAS SECUENCIAS 5' CCAACACCUGAUGAGCGUUAGCGAAACCUGCU A SUS DERIVADOS MODIFICADOS, A PRODUCTOS FARMACEUTICOS QUE CONTIENEN DICHAS MOLECULAS, PARA PREPARAR PRODUCTOS DESTINADOS AL TRATAMIENTO DE ENFERMEDADES QUE IMPLICAN CRECIMIENTO Y/O DIFERENCIACION CELULAR ANORMAL.

  23. 23.-

    COMPOSICIONES QUE CONTIENEN DERIVADOS DE AMIDA DEL ACIDO CROTONICO Y LIPOPROTEINA.

    (12/2004)
    Inventor/es: MULLNER, STEFAN, DR., BARTLETT, ROBERT, DR., HOFMANN, AXEL, DR., SAAR, KARIN, SCHORLEMMER, HANS-ULRICH, DR.. Clasificación: A61K31/44, A61K31/275, A61K38/02.

    UNA PREPARACION CONTENIENDO LIPOPROTEINAS Y UN COMPUESTO DE FORMULA I QUE ESTA INDICADA PARA EL TRATAMIENTO DE ENFERMEDADES INMUNOLOGICAS, CANCER Y EN TRANSPLANTES.

  24. 24.-

    FIBRAS DE ELECTRETO CON UNA ESTABILIDAD DE CARGA MEJORADA, EL PROCESO PARA SU PRODUCCION Y MATERIALES TEXTILES QUE CONTIENEN ESTAS FIBRAS DE ELECTRETO.

    (11/2004)
    Inventor/es: GROH, WERNER, MACHOLDT, HANS-TOBIAS, DAHRINGER, JORG, BOENING, PETER. Clasificación: D04H1/42, D01F1/10, B01D39/16, H01G7/02, D01F8/00.

    SE DESCRIBEN FIBRAS CON ESTABILIDAD DE CARGA MEJORADA, QUE CONTIENEN UN MEDIO DE CONTROL DE CARGA ORGANICO U ORGANICO METALICO, COMPUESTO DE UN MATERIAL DE FORMA PREDOMINANTE DE UN POLIMERIZADO FORMADOR DE HILOS O POLICONDENSADO Y 0,01 HASTA 30 % EN PESO (CON PREFERENCIA 0,01 HASTA 10, EN PARTICULAR 0,1 HASTA 5 % EN PESO) CON RESPECTO AL PESO DEL MATERIAL, COMO ESTA CONTENIDO EN ARCILLAS PARA PROCESOS ELECTROFOTOGRAFICOS, ASI COMO UN PROCESO PARA SU ELABORACION. SE DESCRIBEN ADEMAS MATERIALES TEXTILES, QUE CONTIENEN ESTAS FIBRAS.

  25. 25.-

    OLIGONUCLEOTIDOS ESTABILIZADOS Y SU USO.

    (11/2004)
    Inventor/es: UHLMANN, EUGEN, DR., PEYMAN, ANUSCHIRWAN, DR., MAG, MATTHIAS, HELSBERG, MATTHIAS, DR., WINKLER, IRVIN, DR., KRETZCHMAR, GERHARD, DR. Clasificación: C07H21/00, A61K31/70.

    LA INVENCION SE REFIERE A NUEVO OLIGONUCLEOTIDO ESTABILIZADO, EN DONDE SE MODIFICA AL MENOS UN NUCLEOXIDO PIRIMIDINA NO TERMINAL, ASI COMO A SU UTILIZACION COMO AGENTE DE DIAGNOSTICO O MEDICAMENTO PARA EL TRATAMIENTO DE INFECCIONES DE VIRUS, CANCER O ENFERMEDADES, EN DONDE ACTUAN LA INTEGRINA O CELULA-CELULARECEPTORES DE ADHESION.

  26. 26.-

    CROMANOS SUSTITUIDOS CON SULFONAMIDA, PROCEDIMIENTO PARA SU PREPARACION, SU USO COMO MEDICAMENTO O AGENTE DE DIAGNOSTICO, ASI COMO MEDICAMENTOS QUE LOS CONTIENEN.

    (11/2004)
    Ver ilustración. Inventor/es: BRENDEL, JOACHIM, ENGLERT, HEINRICH, CHRISTIAN, GERLACH, UWE, HERLING, ANDREAS, DR., BOHN, HELMUT, HROPOT, MAX, DR., LANG, HANS JOCHEM, DR., GOGELEIN, HEINZ, DR., BUSCH, ANDREAS, PROF. DR., GREGER, RAINER, PROF. DR. Clasificación: C07D405/12, A61K31/35, C07D311/68, C07D311/70.

    LOS CROMANOS DE FORMULA I Y DE FORMULA I A CON LOS SIGNIFICADOS DE R(A), R(B), R(C) Y R A R ESPECIFICADOS EN LAS REIVINDICACIONES, SON ESPECIALMENTE IDONEOS PARA LA FABRICACION DE UN MEDICAMENTO QUE SIRVE PARA EL BLOQUEO DEL CANAL K{SUP,+} QUE ES ABIERTO POR UNA ADENOSINA MONOFOSFATO CICLICA (CAMP); ADEMAS SIRVEN PARA LA FABRICACION DE UN MEDICAMENTO PARA LA INHIBICION DE LA SECRECION DE ACIDOS GASTRICOS; TAMBIEN PARA EL TRATAMIENTO DE LA ULCERA DE ESTOMAGO Y ZONA INTESTINAL, EN PARTICULAR DEL DUODENO, PARA EL TRATAMIENTO DE LA REFLUXOESOFAGITIS, PARA EL TRATAMIENTO DE LAS DIARREAS, PARA EL TRATAMIENTO E IMPEDIMENTO DE TODO TIPO DE ARRITMIAS, INCLUIDAS LAS ARRITMIAS VENTRICULARES Y SUPRAVENTICULARES, ASI COMO PARA EL CONTROL DE LAS ARRITMIAS RENTRY Y PARA IMPEDIR UNA REPENTINA MUERTE CARDIACA DEBIDO A UNA FIBRILACION VENTRICULAR.

  27. 27.-

    DERIVADOS DE INSULINA CON ACTIVIDAD DE UNION AL ZINC INCREMENTADA.

    (11/2004)
    Ver ilustración. Inventor/es: ERTL, JOHANN, HABERMANN, PAUL, GEISEN, KARL, SEIPKE, GERHARD. Clasificación: C07K14/62, A61K38/28.

    LOS DERIVADOS DE INSULINA CON UN NUMERO MAYOR DE ENLACES DE ZINC, DONDE Z ES UN RESTO DE HISTIDINA O UN PEPTIDO CON ENTRE 2 Y 35 RESTOS DE AMINOACIDOS CODIFICABLES GENETICAMENTE, QUE CONTIENEN ENTRE 1 Y 5 RESTOS DE HISTIDINA, SON APROPIADOS PARA LA PREPARACION DE PREPARACIONES FARMACEUTICAS PARA EL TRATAMIENTO DE LA DIABETES. LAS INSULINAS DE FORMULA I FORMAN COMPLEJOS CON EL ZINC, CONTENIENDO UN HEXAMERO DE INSULINA Y APROXIMADAMENTE ENTRE 5 Y 9 MOLES DE ZINC POR HEXAMERO.

  28. 28.-

    USO DE DERIVADOS DE ISOXAZOL Y AMIDAS DEL ACIDO CROTONICO PARA LA MODULACION DE LA APOPTOSIS.

    (11/2004)
    Ver ilustración. Inventor/es: MULLNER, STEFAN, DR., DAX, CLAUDIA, DCH. Clasificación: A61K31/44, A61P37/00, A61K31/165, A61P25/00, A61P1/00, A61P9/10, A61P13/12, A61K31/275, A61K31/42.

    LAS COMPOSICIONES DE LA FORMULA I O II SON APTAS PARA LA FABRICACION DE MEDICAMENTOS PARA LA MODULACION DE LA APOPTOSIS. ESTAS COMPOSICIONES PUEDEN EMPLEARSE PARA EL TRATAMIENTO DE INFARTOS, LA DEGENERACION NEUROLOGICA O LAS ENFERMEDADES HIPERTROPICAS.

  29. 29.-

    3-AMIDO-CROMANILSULFONIL(TIO)UREAS , PROCEDIMIENTO PARA SU PREPARACION, SU EMPLEO Y PREPARADOS FARMACEUTICOS QUE LAS COTIENEN.

    (10/2004)
    Ver ilustración. Inventor/es: ENGLERT, HEINRICH, CHRISTIAN, GERLACH, UWE, LINZ, WOLFGANG, MANIA, DIETER, DR., GOGELEIN, HEINZ, PROF. DR., KLAUS, ERIK, DR. Clasificación: C07D405/12, A61K31/35, C07D311/58, C07D311/70.

    LA PRESENTE INVENCION TRATA DE 3 AMIDO CROMANILSULFONIL(TIO)UREAS DE FORMULA I, QUE SON VALIOSAS SUSTANCIAS ACTIVAS DE MEDICAMENTOS INDICADOS PARA EL TRATAMIENTO DE AFECCIONES CARDIACAS Y DEL SISTEMA CIRCULATORIO, EN ESPECIAL PARA EL TRATAMIENTO DE ARRITMIAS, PARA PREVENIR LA MUERTE REPENTINA POR INFARTO O PARA INFLUIR EN UNA MENOR CONTRABILIDAD DEL CORAZON. TRATA ASIMISMO DE UN PROCEDIMIENTO PARA LA FABRICACION DE ESTAS UREAS, DE SU EMPLEO Y DE PREPARACIONES FARMACEUTICAS QUE LAS CONTIENEN.

  30. 30.-

    DIASTEREOISOMERO DEL ESTER 1-(ISOPROPOXICARBONILOXI)-ETILICO DEL ACIDO 3-CEFEM-4-CARBOXILICO Y PROCEDIMIENTO PARA SU PREPARACION.

    (10/2004)

    SE DESCRIBEN DIASTOMEROS REABSORBIBLES ENTEROS DEL ESTER ETIL (6R, 7R) (METOXIMINO) ACIDO CARBOXILICO I Y SUS SALES INOFENSIVAS FISIOLOGICAS ASI COMO SALES PURAS DE DIASTOMERO DE LOS COMPUESTOS DE LA FORMULA II DONDE HX ES UN ACIDO MONO O MULTIBASICO Y DONDE X ES UN ANION INOFENSIVO FISIOLOGICO ORGANICO O INORGANICO, ASI COMO UN PROCESO PARA LA FABRICACION DE ESTE COMPUESTO DE LA FORMULA I O II CARACTERIZADO PORQUE POR MEDIO DE LA ADICION CONJUNTA DE EQUIVALENTE 1 DE UNA SOLUCION DE MEZCLAS DE DIASTOMEROS DE LA FORMULA III CON EQUIVALENTES 0,2 RA EL DIASTOMERO SOLUBLE MAS DIFICIL DE LA FORMULA GENERAL IV Y SE SEPARA A TRAVES DE FILTRACION,...

  31. 31.-

    QUINOLIN-2-CARBOXAMIDAS SUSTITUIDAS, SU PREPARACION Y SU USO COMO INHIBIDORES DE LA PROLIL-4-HIDROXILASA.

    (10/2004)
    Inventor/es: BARINGHAUS, KARL-HEINZ, WEIDMANN, KLAUS, DR., TSCHANK, GEORG, DR., BICKEL, MARTIN. Clasificación: A61K31/47, C07D215/48, C07D215/16, C07D215/60.

    LA INVENCION TRATA DE AMIDAS SUSTITUIDAS DEL ACIDO QUINOLIN-2CARBOXILICO DE FORMULA I SU OBTENCION Y UTILIZACION Y PRODUCTOS INTERMEDIOS, QUE APARECEN DURANTE LA OBTENCION DE COMPUESTOS DE FORMULA I. LOS COMPUESTOS DE LA INVENCION SE UTILIZAN COMO INHIBIDORES DE LA PROLIL-4-HIDROLASA Y COMO MEDICAMENTO PARA EL TRATAMIENTO DE ENFERMEDADES FIBRICAS.

  32. 32.-

    METALOCENOS.

    (08/2004)

    LA PRESENTE INVENCION SE REFIERE A UN NUEVO METALOCENO CON LA FORMULA GENERAL (I) DONDE M ES UN METAL DE LOS GRUPOS IVB, VB O VIB DEL SISTEMA PERIODICO DE LOS ELEMENTOS, ESPECIALMENTE TI, ZR Y HF, X ES IGUAL O DISTINTO, UN ATOMO DE HIDROGENO, UN GRUPO HIDROCARBURO C SUB,1} - C SUB,40}, COMO UN ALQUILO C SUB,1} C SUB,10}, ALCOXI C SUB,1} - C SUB,10}, ARILO C SUB,6} C SUB,10}, OXIARILO C SUB,6} - C SUB,10}, ALQUENILO C SUB,2} C SUB,10}, ARILALQUILO C SUB,7} - C SUB,40}, ALQUILARILO C SUB,7} - C SUB,40}, O ARILALQUENILO C SUB,8} - C SUB,40}, UN GRUPO OH,...

1 · > · 3 · 5 · 10 · 19 · 38 · >>