Producción recombinante de virus adeno-asociados usando células BHK en suspensión.

Un procedimiento de producción de partículas virales de VAA recombinantes en una célula BHK que crece en suspensión,

que comprende:

coinfectar una célula BHK que crece en suspensión con (i) un primer virus del herpes simplex recombinante, deficiente en la replicación que comprende un ácido nucleico que codifica para un gen rep de VAA y un gen tapa de VAA cada uno operativamente vinculado a un promotor; y (ii) un segundo virus del herpes simplex recombinante deficiente en la replicación que comprende un ácido nucleico que codifica para un gen de interés operativamente vinculado a un promotor, estando dicho ácido nucleico flanqueado por las secuencias repetidas terminales invertidas del VAA,

en el que las células se infectan con el primer VHSr y el segundo VHSr en una proporción de 1:2 a 6:1, para una MDI combinada de entre 3 y 14, produciendo así partículas virales recombinantes de VAA en una célula BHK, en el que el número de partículas virales producidas es igual o mayor que el número de partículas virales cultivadas en un número igual de células BHK bajo condiciones adherentes.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2009/000577.

Solicitante: Applied Genetic Technologies Corporation.

Nacionalidad solicitante: Estados Unidos de América.

Dirección: 11801 Research Drive, Suite D Alachua, FL 32615 ESTADOS UNIDOS DE AMERICA.

Inventor/es: VERES,GABOR, KNOP,DAVE, THOMAS,DARBY.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • C12N15/86 SECCION C — QUIMICA; METALURGIA.C12 BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE; MICROBIOLOGIA; ENZIMOLOGIA; TECNICAS DE MUTACION O DE GENETICA.C12N MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS CONTIENEN (biocidas, productos que repelen o atraen a los animales nocivos, o reguladores del crecimiento de los vegetales, que contienen microorganismos virus, hongos microscópicos, enzimas, productos de fermentación o sustancias obtenidas por o extraídas de microorganismos o sustancias animales A01N 63/00; preparaciones de uso médico A61K; fertilizantes C05F ); PROPAGACION,CULTIVO O CONSERVACION DE MICROORGANISMOS; TECNICAS DE MUTACION O DE INGENIERIA GENETICA; MEDIOS DE CULTIVO (medios para ensayos microbiológicos C12Q 1/00). › C12N 15/00 Técnicas de mutación o de ingeniería genética; ADN o ARN relacionado con la ingeniería genética, vectores, p. ej. plásmidos, o su aislamiento, su preparación o su purificación; Utilización de huéspedes para ello (mutantes o microorganismos modificados por ingeniería genética C12N 1/00, C12N 5/00, C12N 7/00; nuevas plantas en sí A01H; reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00; nuevas razas animales en sí A01K 67/00; utilización de preparaciones medicinales que contienen material genético que es introducido en células del cuerpo humano para tratar enfermedades genéticas, terapia génica A61K 48/00; péptidos en general C07K). › Vectores virales.
  • C12N7/00 C12N […] › Virus, p. ej. bacteriófagos; Composiciones que los contienen; Su preparación o purificación (preparaciones de uso médico que contienen virus A61K 35/76; preparación de composiciones de uso médico que contienen antígenos o anticuerpos virales, p. ej. vacunas virales, A61K 39/00).
  • C12N7/02 C12N […] › C12N 7/00 Virus, p. ej. bacteriófagos; Composiciones que los contienen; Su preparación o purificación (preparaciones de uso médico que contienen virus A61K 35/76; preparación de composiciones de uso médico que contienen antígenos o anticuerpos virales, p. ej. vacunas virales, A61K 39/00). › Aislamiento o purificación.

PDF original: ES-2751999_T3.pdf

 

Patentes similares o relacionadas:

Métodos para mejorar la eficiencia de la transducción vectorial en linfocitos T, del 27 de Mayo de 2020, de CELGENE CORPORATION: Un método de transducción de un linfocito T primario, que comprende: (i) poner en contacto un linfocito T primario con un compuesto que es BX795 o 2-Aminopurina; (ii) […]

Métodos para la transducción y el procesamiento de células, del 27 de Mayo de 2020, de Juno Therapeutics, Inc: Un método de transducción, que comprende incubar, en una cavidad interna de una cámara de centrífuga, una composición de entrada que comprende células y partículas […]

Productos y métodos para el tratamiento de la esclerosis lateral amiotrófica, del 27 de Mayo de 2020, de The Research Institute at Nationwide Children's Hospital: Un virus recombinante adenoasociado que comprende el ADN que codifica el ARNhc de la dismutasa de superóxido 1 (SOD1) CATGGATTCCATGTTCATGA (SEQ ID NO: […]

Composiciones promotoras, del 6 de Mayo de 2020, de UNIVERSITY OF IOWA RESEARCH FOUNDATION: Una secuencia promotora aislada que comprende un ácido nucleico de entre 500 y 1700 nucleótidos de longitud que tiene por lo menos un 98% de identidad con la SEQ […]

Métodos mejorados para producir terapias celulares adoptivas, del 22 de Abril de 2020, de Bluebird Bio, Inc: Un método in vitro para producir un producto terapéutico de células T que comprende: a) proporcionar una población de células mononucleares […]

Vectores lentivirales, del 8 de Abril de 2020, de IP2IPO Innovations Limited: Un vector lentiviral pseudotipado con hemaglutinina-neuraminidasa (HN) y proteínas de fusión (F) de un paramixovirus respiratorio, en el que dicho vector lentiviral comprende […]

Ingeniería del genoma multiplex mediante CRISPR, del 8 de Abril de 2020, de The Regents of the University of Colorado, a body corporate: Un casete sintetizado que comprende: (i) al menos un casete de edición que comprende (a) una región homóloga a una región objetivo de […]

Un sistema de administración y expresión de terapia génica adenoviral dependiente de linfocitos T colaboradores, del 1 de Abril de 2020, de BAYLOR COLLEGE OF MEDICINE: Un sistema de administración y expresión de la terapia génica que comprende al menos un vector adenoviral dependiente de linfocitos T colaboradores que […]

Utilizamos cookies para mejorar nuestros servicios y mostrarle publicidad relevante. Si continua navegando, consideramos que acepta su uso. Puede obtener más información aquí. .