Método y composiciones para el funcionamiento potenciado del efector antitumoral de células T.

Un receptor antígeno quimérico (CAR) que está codificada por el ADN de la SEQ ID NO: 37

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2009/055029.

Solicitante: CITY OF HOPE.

Nacionalidad solicitante: Estados Unidos de América.

Dirección: 1500 East Duarte Road DuarteCalifornia 91010 ESTADOS UNIDOS DE AMERICA.

Inventor/es: JENSEN, MICHAEL.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > AZUCARES; SUS DERIVADOS; NUCLEOSIDOS; NUCLEOTIDOS;... > C07H21/00 (Compuestos que contienen al menos dos unidades mononucleótido que tienen cada una grupos fosfato o polifosfato distintos unidos a los radicales sacárido de los grupos nucleósido, p. ej. ácidos nucleicos)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > A61K48/00 (Preparaciones medicinales que contienen material genético que se introduce en las células del cuerpo vivo para tratar enfermedades genéticas; Terapia génica)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/435 (de animales; de humanos)
google+ twitter facebook

Texto extraído del PDF original:

DESCRIPCIÓN

Método y composiciones para el funcionamiento potenciado del efector antitumoral de células T Declaración relacionada con la investigación patrocinada por el gobierno federal

Esta invención se hizo con el apoyo gubernamental en la forma del Cancer Center Support Grant no. P30- CA33572-21 del Department of Health and Human Services, National Institutes of Health de los Estados Unidos. El gobierno de los Estados Unidos tiene ciertos derechos en la invención.

Antecedentes de la invención 1. Campo técnico

La invención se relaciona con el campo de la biomedicina y específicamente con métodos útiles para la terapia del cáncer. En particular, la invención se relaciona con un receptor de antígeno quimérico (CAR) para estrategias inmunoterapéuticas de CTL específicas para el cáncer, que incluyen el uso de los linfocitos T genéticamente modificados que expresan inmunorreceptores quiméricos en el tratamiento de tumores de cerebro humanos y otros tipos de cáncer.

2. Descripción de la técnica anterior Se han investigado inmunoterapias basadas en células T específicas para tumores para el tratamiento antitumoral, sin embargo, las células T sufren del problema de que no sobreviven ni permanecen activas in vivo durante un período lo suficientemente largo. Frecuentemente las células T, transferidas de forma adoptiva no tienen la potencia y duración deseadas para matar células tumorales. Por lo tanto, hay una necesidad en la técnica para terapias de cáncer específicas de tumores con funcionamiento antitumoral a largo plazo.

Las inmunoterapias dirigidas al cáncer tradicionalmente se centran en la obtención de respuestas de CD8+ CTL. Sin embargo, la estimulación de las respuestas de células T CD4+ (auxiliares) también es importante para la inmunoterapia exitosa contra el cáncer. Las células T CD4+ pueden influir en las respuestas de CTL específicas de tumores naturales, directa o indirectamente, a través de condicionamiento de antígeno profesional que presenta células a través de CD40-CD40L, y a través de la producción de citoquinas tales como IL2 e IFN-γ. Los mecanismos efectores citocidas utilizados por las células T CD4+ son mediados, ya sea a través de la liberación de citoquinas que activan los receptores de muerte en la superficie de células tumorales, o a través de contacto directo de células donde Fas/FasL, el ligando que induce la apoptosis relacionado con TNF (TRAIL), o rutas dependientes de perforina granzima median la apoptosis de células tumorales. Estas células auxiliares pueden aumentar la temprana expansión clonal y la generación de efectores de CTL CD8+ primarios, y también puede afectar tanto la generación como la expansión de células T CD8+ de memoria funcional.

La activación completa de las células T CD4+ naturales requiere tanto de una señal específica del antígeno a través del acoplamiento del complejo receptor/CD3 de células T con complejos clase II de péptido/MHC apropiados como de señales coestimuladoras. Estas señales coestimuladoras por lo general son suministradas por ligandos que se expresan selectivamente en células que presentan antígenos especializados. Se cree que la coestimulación de células T ayuda a mantener la tolerancia a los antígenos propios normales expresados por los tejidos que no suministran esta señal secundaria. Puesto que la mayoría de las células tumorales, similar a los tejidos normales, no expresan MHC clase II o moléculas coestimuladoras, es lógico pensar que también ellos normalmente no promueven la estimulación de las células T CD4+ directamente. Esta teoría está apoyada por varios estudios que han demostrado una inmunidad antitumoral mediada por células T potenciada por la vacunación con células tumorales que fueron transfectadas con el ligando B7-1 coestimulador.

Mientras que la alteración de la expresión de células tumorales de las moléculas coestimuladoras es una manera de ayudar a conducir la activación de células T, serían muy deseables estrategias alternativas, particularmente estrategias que involucren el permitir que la célula T reciba y actúe sobre las señales coestimuladoras sin la necesidad de ligandos coestimuladores reales.

La WO2008/095141 divulga células T reguladoras redirigidas dotadas con especificidad hacia un antígeno objetivo seleccionado o ligando y su uso en la supresión de enfermedades autoinmunes. La US2003/0171546 A1 se refiere a inmunorreceptores de transmembrana quiméricos para redireccionar la especificidad de antígeno de las células T, con aplicación al tratamiento de una variedad de cánceres. En particular, la US2003/0171546 A1 divulga un receptor de antígeno quimérico (CAR) específico del tumor con un dispositivo de señalización coestimulador de CD28. La US2005/0113564 A1 divulga un método para potenciar la actividad de un receptor de antígeno quimérico contra un tumor, que comprende adicionar ya sea un CD28 o un dominio de señalización de 4-1BB a dicho receptor.

Resumen de la invención

De acuerdo con lo anterior, la presente invención provee un receptor de antígeno quimérico (CAR) como se reivindica en la reivindicación 1 más adelante, para el funcionamiento efector antitumoral potenciado de las células T CD4 y CD8+ para inmunoterapia del cáncer. Los inmunorreceptores de transmembrana quimérica (denominados receptores de antígeno quimérico o "CARs") comprenden un dominio extracelular, una región transmembrana y un dominio de señalización intracelular. El dominio extracelular está constituido de un ligando de receptor soluble (que es específico para un antígeno tumoral objetivo u otra molécula de la superficie celular del tumor) enlazado a una región de soporte opcional capaz de atar el dominio extracelular a una superficie celular. El dominio de señalización intracelular contiene el dominio de señalización de la cadena zeta del complejo CD3 humano (CD3) y los dominios de señalización coestimuladora de CD28 y de 4-1BB. El dominio extracelular contiene un elemento de reconocimiento que permite que el CAR, cuando se expresa en la superficie de una célula T, para dirigir la actividad de células T a aquellas células que expresan un receptor o ligando para el cual este elemento de reconocimiento es específico. Por ejemplo, un CAR que contiene un dominio extracelular que contiene un elemento de reconocimiento específico para un antígeno tumoral puede dirigir la actividad de células T a las células tumorales que portan este antígeno. La región intracelular permite a la célula T recibir señales coestimuladoras. Los dominios de señalización coestimuladores son CD28 y 4-1BB. El receptor quimérico humano comprende una región transmembrana de CD4, un Fc de IgG4 humano y un receptor de IL13 o ligando que es específico del tumor. La molécula de IL13 contiene la mutación E13Y, como en IL13-CD28-41BBζ.

Las realizaciones de la invención también abarcan los linfocitos T aislados que expresan el CAR discutido aquí. Además, las realizaciones de la invención incluyen métodos de inmunoterapia del cáncer que comprende administrar a un paciente en necesidad del mismo tales linfocitos T, que incluyen como tratamientos para cualquiera de los siguientes tipos de cáncer: glioblastoma, meduloblastoma, cáncer de seno, cáncer de cabeza y cuello, cáncer de riñón, cáncer de ovario, sarcoma de Kaposi, leucemia mielogenosa aguda, y enfermedades malignas de linaje B.

Breve descripción de los dibujos

La Figura 1 es una representación esquemática de las moléculas de proteína del receptor de antígeno quimérico (CAR) de IL13ζ e IL13-CD28-41BBζ.

La Figura 2 muestra las ubicaciones de cebadores de ejemplo para la construcción de CAR de IL13ζ en la secuencia de IL13 nativa como se indica. Las flechas indican la posición de los cebadores en la secuencia de IL13.

Figura 3 (dada como las figuras 3A-3C) provee una secuencia de nucleótidos que codifican la IL13 zetaquina de ejemplo (SEQ ID NO: 5, cadena superior; SEQ ID NO: 6, cadena inferior). Los segmentos de ADN en la secuencia incluyen el péptido de señalización alfa GM-CSFR (SEQ ID NO: 7), IL13 (E13Y) (SEQ ID NO: 8), IgG4 (SMP) (SEQ ID NO: 9), CD4tm (SEQ ID NO: 10) y CD3zeta (SEQ ID NO:11). La secuencia completa de aminoácidos se provee como SEQ ID NO: 4.

La Figura 4 es un mapa del vector IL13zetaquina/HyTK-pMG. Una secuencia de ejemplo de tal vector se provee en la Figura 5.

Figura 5 (dada como las figuras 5A-5L) provee la secuencia de un vector de ADN plásmido de ejemplo (SEQ ID NO: 13, cadena superior; SEQ ID NO: 14, cadena inferior). Una secuencia de aminoácidos de IL13zetaquina (SEQ ID NO: 15) y una secuencia de aminoácidos de HyTK (SEQ ID NO: 16) también se indican. Los segmentos de ADN que componen la secuencia completa incluyen hEF1p (nucleótidos 6-549; SEQ ID NO: 41), IL13 zetaquina (nucleótidos 690-2183; SEQ ID NO: 42), sv40pAn tardío (nucleótidos 2230-2498; SEQ ID NO: 43), Ori ColEl (nucleótidos 2499- 3245; SEQ ID NO: 44), SpAn (nucleótidos 3246-3432; SEQ ID NO: 45), HCMV 1Aprom (nucleótidos 3433-4075; SEQ ID NO: 46), HyTK (nucleótidos 4244-6319; SEQ ID NO: 47) y BGh pAna (nucleótidos 6320-6618; SEQ ID NO: 48).

La Figura 6 contiene dos representaciones esquemáticas de constructos de plásmido lineales del CAR de ejemplo. La Figura 6A muestra un constructo de IL13ζ y la Figura 6B muestra un constructo de IL13 CD28-41BBζ.

La Figura 7 muestra el análisis de transferencia Western de lisados celulares derivados de células T CD4+ transfectadas en forma simulada, por IL13ζ- e IL13-CD28-41BBζ para la expresión del CAR utilizando un mAb específico de CD3ζ antihumano de ratón.

La Figura 8 es un panel de ocho análisis de citometría de flujo que comparan el fenotipo de las células CD4+ en volumen que expresan IL13ζ- e IL13- CD28-41BBζ.

La Figura 9 es un panel de seis gráficos que muestran los resultados de citometría de flujo de tinción de la superficie de HLA-A2 y HLA-DR (moléculas MHC), IL13Rα2 y las moléculas coestimuladoras CD80, CD86, CD137 y-L (4- 1BBL) (histogramas rellenos) como se indica, en comparación con controles de isotipo (histogramas abiertos) en las células objetivo de glioma U87.

La Figura 10 es una serie de inmunotransferencias que muestran los resultados de un ensayo de quinasa para determinar la cinética de la activación de JNK y p38 (3A) y AKT (3B), que se mide a través de la fosforilación de sus respectivos sustratos (esto es, P-cJun (proto-oncógeno de c-Jun fosforilado), p-GSK3 (glicógeno sintasa quinasa 3 fosforilada) y P-ATF2 (factor 2 de transcripción de activación fosforilado)).

La Figura 11 muestra la polarización de Th1 potenciada de las células T CD4+ de IL13-CD28-41BBζ+ en términos ARNm de citoquina Th1 de células T (Figura 11A) y la producción de proteína de citoquinas Th1 y Th2 (Figura 11B).

La Figura 12A provee los datos que muestran una actividad citotóxica potenciada de las células T IL13-CD28- 41BBζ+ CD4+ ( ) contra objetivos U87 en comparación con la de las células T CD4+ de IL13ζ+ ( ) en la relación indicada E:T en un ensayo de citotoxicidad de luciferasa de 4 horas (LCA). La Figura 12B muestra datos similares para las células T IL13-CD28-41BBζ+ CD4+ (barras negras) y las células T IL13ζ+ CD4+ (barras blancas) cocultivadas durante 48 horas en una relación E:T de 2:1, y luego cocultivadas de nuevo durante 48 horas adicionales después de la adición de objetivos frescos en la misma relación E:T. La Figura 12C provee los datos obtenidos con las imágenes de vídeo de las células T que expresan el CAR indicado de cocultivadas con células U87 adherentes, lo cual indica el número de células viables por imagen.

La Figura 13 provee datos de flujo que muestran el efecto antitumoral sostenido contra xenoinjertos de glioblastoma establecidos in vivo por las células T CD4+ de IL13-CD28-41BBζ+. También se muestran los resultados observados con células T transfectadas con IL13ζ y simuladas.

La Figura 14 provee la secuencia de IL13-IgG4-cd28tm-CD28gg-Zeta (CO) (SEQ ID NO: 36).

La Figura 15 proporciona la secuencia de IL13-IgG4-cd4tm-CD28-4-1BB-Zeta, también denominado aquí como IL13- CD28-41BBζ utilizada/discutida anteriormente con respecto a los ejemplos a continuación (SEQ ID NO: 37). Esta secuencia se utilizó para alterar genéticamente las células T para expresar el CAR de IL13-CD28-41BBζ como se describe y se utiliza en las figuras 1, 6, 7, 8, 10, 11, 12 y 13.

La figura 16 provee la secuencia de IL13-IgG4-cd28tm-CD28-Ox40-Zeta (SEQ ID NO: 38).

La Figura 17 provee la secuencia de IL13-IgG4-cd28tm-CD28gg-4-1BB-Zeta (SEQ ID NO: 39).

La Figura 18 provee la secuencia de IL13-IgG4-cd28tm-CD28gg^199-4-1BB-Zeta (SEQ ID NO: 40).

Descripción detallada de las realizaciones preferidas

La inmunoterapia adoptiva que utiliza linfocitos T que expresan receptores de antígenos quiméricos (CARs) específicos de tumores puede ser una estrategia terapéutica poderosa para el tratamiento del cáncer. Los CAR se componen de un elemento de reconocimiento específico extracelular (tal como un receptor que se enlaza a un antígeno tumoral) enlazado a través de un dominio transmembrana al dominio de señalización citoplásmico de CD3ζ. Por lo tanto, estos receptores son capaces tanto de unirse al antígeno como para transducir activación de células T, independiente de la restricción de MHC. Así, los CAR son inmunorreceptores "universales" que pueden tratar una población de pacientes con tumores positivos al antígeno, independientemente de su genotipo HLA.

De acuerdo con realizaciones de esta invención, los CAR contienen el dominio de señalización para CD3 y los dominios de señalización de uno o más receptores coestimulantes que promueven además el reciclaje, la supervivencia y/o expansión de células transferidas adoptivamente que expresan los CAR, además de receptores específicos que permiten a las células acoplar objetivos tales como tumores. Los dominios de señalización de los receptores coestimuladores son las porciones intracelulares de cada proteína del receptor que generan la señal de activación en la célula. Ejemplos son los aminoácidos 180-220 de la molécula CD28 nativa y los aminoácidos 214- 255 de la molécula 4-1BB nativa. Un CAR especialmente preferido comprende un elemento de reconocimiento extracelular que es específico para un receptor único de la superficie celular del cáncer, es estable in vivo y tiene una baja inmunogeneicidad. La derivación a partir de una molécula de señal celular soluble de origen natural ayuda a lograr estos objetivos.

El término "CAR" se refiere a un receptor de antígeno quimérico que es una biomolécula recombinante que contiene un dominio de reconocimiento extracelular, una región transmembrana, y un dominio de señalización intracelular. El término "antígeno", por lo tanto, no se limita a moléculas que se enlazan a los anticuerpos, sino a cualquier molécula que se puede enlazar específicamente a cualquier receptor. "Antígeno" se refiere así al dominio de reconocimiento del CAR. El dominio de reconocimiento extracelular (también denominado como el dominio extracelular o simplemente por el elemento de reconocimiento que contiene) comprende un elemento de reconocimiento que se enlaza específicamente a una molécula presente en la superficie celular de una célula objetivo. La región transmembrana ancla el CAR en la membrana. El dominio de señalización intracelular comprende el dominio de señalización de la cadena zeta del complejo CD3 humano y comprende opcionalmente uno o más dominios de señalización coestimuladoras.

Un CAR que contiene el dominio de IL13 con la mutación E13Y (IL13(E13Y)) y el dominio de señalización de la cadena zeta de CD3 se denomina aquí como "IL13ζ." Este término incluye cualquier receptor de antígeno quimérico (CAR) que contenga un dominio de reconocimiento extracelular de IL13 (un dominio que reconoce específicamente IL13Rα2 en las células tumorales) una región transmembrana, y un dominio de señalización intracelular de cadena zeta de CD3. Ejemplos no limitantes de tales CAR se proveen en los Ejemplos 8-12. Un CAR que contiene IL13(E13Y) y contiene también los dominios intracelulares coestimuladores opcionales CD28 y 4-1BB se denomina aquí "IL13-CD28-41BBζ".

Las personas expertas reconocerán que cualquier secuencia de nucleótidos que codifica IL13(E13Y) también sería adecuado para este mismo propósito. La secuencia no mutada del dominio de señalización IL13 también es adecuada. Cualquier secuencia que codifica IL13 o IL13(E13Y) incluyendo variantes con 90%, 95%, 98% o 99% de homología con la secuencia nativa se puede utilizar aquí. Tales secuencias que son útiles para reconocer específicamente un antígeno tumoral del receptor de IL13 tal como IL13Rα2, por lo tanto, incluyen las codificadas por el ácido nucleico nativo (véase Smernov et al, Gene 155:277-281, 1995, 1.995, cuyas divulgaciones se incorporan aquí como referencia), la misma secuencia de ácido nucleico que carece de la mutación E13Y, secuencias que son 95%, 98% o 99% homólogas con estas secuencias, secuencias más largas que comprenden aquellas secuencias, pero también incluyen nucleótidos adicionales en el extremo 3 'o 5', por ejemplo, cualquier número de nucleótidos o codones adicionales, tales como 3, 6, 9, 12 o más nucleótidos, o hasta aproximadamente 12, 20, 50 o 100 nucleótidos adicionales, y cualquier secuencia que codifica la misma secuencia de aminoácidos que estos ácidos nucleicos debido a la degeneración del código genético. En particular, las secuencias que son de codones optimizados (CO) para la expresión por el anfitrión deseado se contemplan como parte de la invención.

Elementos de reconocimiento solubles como los usados en esta invención se derivan de polipéptidos sintetizados de novo, como se describe para la secuencia de codificación de IL13 (E13Y) en el Ejemplo 1 o de polipéptidos de librerías combinatorias tales como librerías de despliegue de fagos o librerías sintetizadas químicamente.. Elementos de reconocimiento solubles preferidos son de origen humano y por lo tanto son no inmunogénicos, pero pueden ser adaptados en la afinidad o especificidad a través de la mutagénesis. Tras su expresión en las células T, los elementos de reconocimiento solubles son capaces de enlazarse a un elemento objetivo en la célula objetivo (por ejemplo una célula tumoral, pero no en ningún grado apreciable en las células no objetivo)), de tal manera que da como resultado la activación de células T. Así, los elementos de reconocimiento solubles que son adecuados para esta invención tienen ciertas ventajas sobre los fragmentos de anticuerpos o moléculas de adhesión celular para especificidad objetivo en los CAR de la invención, puesto que son más propensos a ser estables en el ambiente extracelular, no antigénico, y más selectivos, y por lo tanto se prefieren. Ejemplos de elementos receptores solubles adecuados incluyen factores de crecimiento autocrinos y paracrinos, quimioquinas, citoquinas, hormonas y ligandos diseñados de moléculas pequeñas artificiales que presentan la especificidad requerida. Las secuencias de ligando natural pueden ser diseñadas para incrementar su especificidad para una célula objetivo particular. La selección de un elemento de reconocimiento para uso en un CAR particular se rige por la naturaleza de la célula objetivo, y las cualidades discutió anteriormente. En una realización preferida de la invención, el CAR explota la expresión restringida al tumor de IL13Rα2 por glioma maligno, carcinoma de células renales y otros tumores mediante el uso como el elemento de reconocimiento de un mutante de IL13 (E13Y) para dirigir las células T específicamente a las células tumorales que expresan IL13Rα2. Se pueden crear elementos de reconocimiento análogos que son específicos para cualquiera de una variedad de tipos de células cancerosas que expresan selectivamente antígenos receptores o cualquier molécula específica sobre sus superficies celulares, para los que se conocen elementos de reconocimiento selectivos o pueden ser diseñados.

Ejemplos de regiones de soporte adecuado (transmembrana) para uso con la invención incluyen las regiones constantes (Fc) de inmunoglobulinas, CD8a humana, y enlazadores artificiales que sirven para mover la unidad estructural de direccionamiento lejos de la superficie celular para mejorar el acceso y el enlazamiento en las células objetivo. Una región de soporte preferido es la región Fc de una IgG (tales como IgG4). Ejemplos de dominios transmembrana adecuados incluyen los dominios transmembrana de los marcadores de leucocitos de CD, preferiblemente la de CD4 o CD28. Ejemplos de dominios de señalización del receptor intracelular incluyen el complejo receptor de antígeno de células T, preferiblemente la cadena zeta de CD3, sin embargo, cualquier región transmembrana suficiente para anclar el CAR en la membrana se puede utilizar. Las personas de experiencia son conscientes de las numerosas regiones transmembrana y los elementos estructurales (tales como regiones de aminoácidos lipofílicos) que producen dominios transmembrana en numerosas proteínas de la membrana y por lo tanto puede sustituir cualquier secuencia conveniente. Los receptores de señalización coestimuladora de células T adecuados para mejorar la función y la actividad de las células que expresan CAR incluyen, pero no se limitan a, CD28 y 4-1 BB también conocido como (CD 137), y OX-40.

La señalización a través de CD28 se requiere para la producción y proliferación de IL2, pero no juega un papel primordial en el mantenimiento de la función y la actividad de las células T. 4-1 BB (un miembro de la familia del receptor del factor de necrosis tumoral expresado después de la activación de CD28) y OX-40 están involucrados en guiar la supervivencia a largo plazo de las células T, y la acumulación de células T. Los ligandos para estos receptores típicamente están expresados en las células que presentan antígenos profesionales, tales como células dendríticas y macrófagos activados, pero no en las células tumorales. Expresando un CAR que incorpora dominios de señalización de CD28 y/o 4-1BB en las células T CD4+ potencia la actividad y la potencia antitumoral de esas células en comparación con las que expresan un CAR que contiene solamente el dominio de señalización de CD3ζ. Preferiblemente, los CAR de la invención contienen dominios de señalización tanto CD28 como 4-1BB.

Para que el CAR apunte a las células tumorales, contienen una molécula de enlazamiento extracelular que enlaza un marcador de superficie tumoral y preferiblemente se enlaza específicamente a una molécula única de superficie del tumor. Algunos tipos de cáncer expresan o sobreexpresan moléculas del sistema inmune. Los gliomas, por ejemplo, expresan receptores de IL13, y en particular, los receptores de IL13 de alta afinidad. Sin embargo, a diferencia del complejo trimolecular del receptor de IL13 utilizado por el sistema inmune, (que consiste en el IL13Rα1, el IL4Rβ, y γc), las células de glioma sobreexpresan una cadena IL13Rα2 única capaz de enlazarse a IL 13 independientemente del requerimiento para IL4Rβ o γc44. Al igual que su homólogo IL4, el IL13 tiene actividad inmunorreguladora pleotrópica fuera del SNC. Tanto el IL13 como el IL4 estimulan la producción de IgE por los linfocitos B y suprimen la producción de citocinas proinflamatorias por los macrófagos.

Estudios detallados que utilizan autorradiografía con IL 13 radiomarcado han demostrado abundante enlazamiento de IL 13 sobre casi todos los tejidos de glioma maligno estudiados. Este enlazamiento es altamente homogéneo dentro de las secciones del tumor y en el análisis de una célula individual. Sin embargo, el análisis de la sonda molecular específico para ARNm de IL13Rα2 no detectó la expresión del receptor específico de glioma por elementos cerebrales normales y autorradiografía con IL13 radiomarcado tampoco pudo detectar el enlazamiento de IL13 específico en el SNC normal. Estos estudios sugieren que el receptor de IL13Rα1/IL4β/γc compartido no se expresa de forma detectable en el SNC normal. Por lo tanto, IL13Rα2 es un objetivo de la superficie celular muy específico para glioma y es un objetivo altamente adecuado para esta invención. Las personas con experiencia son conscientes de otros objetivos adecuados para los CAR, que se expresan o sobreexpresan en las células que van a ser direccionadas y preferiblemente no se expresan o se expresan en un grado mucho menor, en otras células. Otro ejemplo de un objetivo específico de tumor adecuados para el direccionamiento con los CAR es el receptor de IL3 (IL3R; por ejemplo, expresado en las células de leucemia mieloide aguda (AML).

El enlazamiento de citotoxinas basadas en IL13 al complejo receptor de IL13Rα1/IL4β/γc ampliamente expresado, tiene, sin embargo, el potencial de mediar toxicidades no deseadas a los tejidos normales fuera del SNC, y así limita la administración sistémica de estos agentes. Una sustitución de aminoácido en la hélice A de IL13A alfa en el aminoácido 13 de la tirosina para el ácido glutámico nativo reduce selectivamente la afinidad de IL13 con el receptor de IL13Rα1/IL4β/γc. El enlazamiento de este mutante (denominado IL13(E13Y) con IL13Rα2, sin embargo, fue incrementado en relación con el IL13 de tipo silvestre por 50 veces. Así, este análogo de IL13 mínimamente alterado incrementa simultáneamente la especificidad y afinidad de los IL13 para las células de glioma. Por lo tanto, la invención emplea un IL13 que contiene una mutación en el aminoácido 13. Sin embargo, también se puede utilizar el IL 13 que tiene la secuencia natural, y puede ser útil, particularmente en situaciones donde se van a administrar localmente las células T modificadas, tales como mediante inyección directamente en una masa tumoral.

Un tipo preferido de CAR para dirigir específicamente tumores que expresan IL13Rα2 está constituido de una citocina mutante de IL13 extracelular en la cual la proteína IL13 contiene una sustitución de tirosina para el ácido glutámico de origen natural en el aminoácido 13 de la proteína (denominado aquí IL13(E13Y)), conectado a una región de soporte de dominio Fc de bisagra de IgG4 que está fusionado con un dominio transmembrana de CD4 y una secuencia de señalización de CD3ζ citoplásmico. Véase la Figura 1, lado izquierdo. Este CAR se denomina aquí como "CAR IL13ζ ". Cuando este CAR también contiene los dominios de señalización de CD28 y el 4-1BB, se denomina como IL13-CD28-41BBζ. Véase la Figura 1, lado derecho.

De acuerdo con la presente invención, un inmunorreceptor puede ser producido por cualquier medio conocido en la técnica, aunque preferiblemente es producido utilizando técnicas de ADN recombinante. Los ácidos nucleicos que codifican las varias regiones del receptor quimérico pueden ser preparadas y ensamblados en una secuencia codificante completa mediante técnicas estándar de clonación molecular conocidas en la técnica (criba de librería genómica, PCR, la ligadura asistida por cebador, mutagénesis dirigida al sitio, etc.) como sea conveniente. La región de codificación resultante se inserta preferiblemente en un vector de expresión y se usa para transformar una línea de células huésped de expresión adecuada, preferiblemente una línea celular de linfocitos T, y lo más preferiblemente una línea celular de linfocitos T autólogos.

Brevemente, un CAR IL13ζ puede construirse usando métodos conocidos como sigue. El IL13(E13Y) de AND mutante IL13(E13Y) se puede sintetizar mediante PCR con cebadores basados en la secuencia conocida ARNm de IL13. La secuencia del gen IL13 completa se informa en Smernov et al, "Tandem arrangement of human genes for interleukin-4 and interleukin-13: resemblance in their organization." Gene 155:277-281, 1995, cuyas divulgaciones se incorporan aquí como referencia. La síntesis de novo del IL13(E13Y), se realizó utilizando el cebador de avance IL13P1 y cuatro cebadores en reverso, IL13P2, IL13P3, IL13P4, y IL13P5, mostrados en la Tabla I, más adelante, y en la Figura 2. Esta secuencia mutante IL 13, puede ser entonces modificada para contener una secuencia 5' líder, si se desea. Un anclaje de transmembrana tal como la transmembrana IgG4-CD4 humana (IgG4-CD4tm) y secuencias citoplasmáticas de la cadena de zeta CD3 (CD3ζ) también se pueden agregar al extremo 3' mediante técnicas de fusión de PCR o cualquier método conveniente. La secuencia de IL13ζ completa se da en la Figura 3 como un ejemplo de la invención. Los mismos métodos se pueden utilizar para construir moléculas equivalentes utilizando diferentes elementos de reconocimiento. El constructo final puede entonces ser ligado en cualquier vector de expresión plásmido adecuado. Un vector de expresión plásmido preferido es pMG (disponible de Invivogen™).

El CAR que contiene IL13(E13Y) dirige específicamente a las células T para direccionar las células de glioma que expresan el receptor α2 de IL13 (denominado aquí IL13Rα2), células de carcinoma renal y células de cualquier tipo de cáncer que expresan IL13Rα2 de manera independiente de MHC. Se generaron efectores de células T CD4+ antitumorales para ser redirigidos a reconocer células tumorales usando un CAR que contiene los dominios de señalización derivados de CD3-ζ, CD28 y 4-1BB. O bien el CAR IL13ζ o IL13-CD28-41BBζ se transfectaron en células T primarias humanas utilizando un vector plásmido no viral (pEK) y métodos de electroporación (Nucleofector Tecnología_ de Amaxa Biosystems_, Gaithersburg, MD). Las células T CD4+ que expresan bien sea CAR (IL13ζ o IL13-CD28-41BBζ) se compararon por su potencial para activar las rutas de señalización asociadas al efector, producen citoquinas, lisan las células objetivo y controlan el crecimiento tumoral in vivo. Los resultados mostraron que la adición de los dominios de señalización de CD28 y 4-1BB a IL13ζ potencia las funciones efectoras antitumorales de células T CD4- que expresan el CAR. Las células T efectoras que expresan el inmunorreceptor IL13-CD28-41BBζ fueron capaces de mediar señales coestimuladoras a través de las JNK, p38 y Akt quinasas en el ambiente tumoral donde se esperaría que la coestimulación sea limitante. La coestimulación forzada en las células T CD4+ primarias humanas apoya la polarización de estas células con un fenotipo Th1 de una manera que se asocia con una eficacia antitumoral sostenida tanto in vitro como in vivo. Se demostraron señales efectoras en dirección 3’ del CAR en las células T CD4+. Estas señales efectoras se correlacionaron con el desplazamiento de Th1 observado y la actividad efectora antitumoral prolongada de estas células tanto in vitro como in vivo.

La señalización de CD3ζ sola guía la activación de ERK. Esto se correlaciona bien con el hallazgo aquí que la actividad de ERK no está potenciada en células que expresan IL13-CD28-41BBζ en comparación con los controles que expresan IL13ζ (ambos CAR contienen el dominio de señalización CD3ζ). La coestimulación de CD3 con CD28 guía la activación de JNK y p38; la coestimulación de CD3 mediada por 4-1BB también involucra la activación de JNK. Tanto JNK como p38 desempeñan papeles principales en la conducción de la respuesta inmune polarizada de Th1 por las células T CD4+, incluyendo su producción de IL2, IFN-γ y TNF-α. La activación de AKT quinasa, otro componente de señalización en dirección 3’ tanto de CD28 como 4-1 BB, también está involucrada en la sobrerregulación de IL2 e INF-γ, pero no de citoquinas Th2. La asociación de un fenotipo Th1 pronunciado (véanse ejemplos, más adelante) con inducción de JNK y p38 MAP quinasa potenciada y activación sostenida de ATK (véanse ejemplos, más adelante) en células T que expresan IL13-CD28-41BBζ indica fuertemente que las unidades estructurales de señalización de CD28 y 4-1BB trabajan con el dominio de señalización de CD3 en este receptor quimérico para retener la capacidad para transducir las rutas de señalización en dirección 3’ que normalmente se asocian con estos receptores coestimuladores. Independientemente de lo fuerte que pueda ser el fenotipo de Th1 activado direccionado por señales de dominio coestimuladoras, la retención y el reciclaje de las células T CD4+ efectoras antitumorales funcionales dentro del microambiente tumoral ayuda mucho en el logro de la potencia antitumoral.

En comparación con la activación sola mediada por CD3ζ, las células T efectoras de CD4+ que expresan el CAR IL13-CD28-41BBζ exhibieron actividad de MAPK y AKT aumentada/sostenida, producción de citoquinas Th1 sobrerregulada, y potencia citolítica potenciada contra objetivos tumorales. Por otra parte, tras la estimulación recursiva con el tumor, las células CD4+ IL13-CD28-41BBζ+ retuvieron/reciclaron su función lítica mientras que las células CD4+ IL13ζ+ fueron efectivas, pero pronto se convirtieron en anérgicas/agotadas. Estas observaciones in vitro se correlacionaron con control in vivo potenciado de xenoinjertos de glioma del SNC ortópticos establecidos en ratones inmunodeficientes mediados por células T CD4+ expandidas ex vivo transferidas de forma adoptiva que expresan el CAR coestimulador. Estos estudios demuestran por lo tanto el efecto de integrar la coestimulación con eventos de señalización de CD3ζ para activar completamente las células efectoras antitumorales CD4+ para la función sostenida en el microambiente tumoral.

Las señales coestimuladoras de CD28 y 4-1BB mediadas a través de AKT pueden inhibir la muerte celular inducida por activación a través de la sobrerregulación de las proteínas antiapoptóticas. La activación de AKT potenciada vista en las células T que expresan IL13-CD28-41BBζ se asoció con reciclaje potenciado de la actividad específica de tumor in vitro, así como el control del crecimiento tumoral in vivo prolongado. Así, el CAR coestimulador puede mejorar la duración y/o retención de la actividad antitumoral de una manera que puede mejorar significativamente la eficacia clínica de los protocolos de terapia adoptivos.

Los CAR específicos de tumores que contienen sus propios dominios coestimuladores de señalización proveen una nueva metodología para la activación de los linfocitos T contra una variedad más amplia de tumores sólidos que no expresan estos ligandos coestimuladores. IL13Rα2, por ejemplo, ha sido identificado como un objetivo de superficie celular sobreexpresado en diversos tumores humanos, incluyendo cáncer de seno, cáncer de cabeza y cuello, cáncer de riñón, cáncer de ovario y el sarcoma de Kaposi, así como gliomas. Así, las células T que expresan un CAR que contiene un zetaquina IL13 y CD28 y el 4-1BB se pueden utilizar para el tratamiento de glioblastomas (glioma) y cualquier cáncer, tal como los mencionados anteriormente, que tienen el objetivo de IL 13 en su superficie.

Los CAR que contienen CD3ζ, CD28 y 4-1 BB (y/u otros dominios de señalización coestimuladora) pueden ser dirigidos a cualquier tumor mediante la incorporación de una unidad estructural que se enlaza a un objetivo tumoral expresado en la superficie celular, por ejemplo un antígeno. Ejemplos de otros enlazanttes objetivo específicos de tumores incluyen Her2/Neu (ErbB-2), la integrina α3, CD20, CD 19, EGFRvIII, IL3Rα (CD 123), LEA, CD44v6 o cualquier objetivo específico a un tumor, preferiblemente un tumor sólido que no expresa el dominio de señalización coestimuladora el cual está contenido en el CAR. Por lo tanto, constructos para direccionar los tumores humanos de esta manera pueden incluir aquellos con especificidades para Her2/neu (ErbB-2), la integrina α3, CD20, CD19, EGFRvIII, IL3Rα (CD 123), LEA, CD44v6 o cualquier antígeno tumoral específico o de otro componente de superficie celular accesible al enlazamiento por un receptor de células T quimérico. Las personas de experiencia son conscientes de estos antígenos tumorales específicos y los receptores que pueden ser explotados para apuntar un tumor específico, y son conscientes de los tumores que pueden ser direccionados de esta manera.

Tanto las funciones efectoras de las células T CD4+ y CD8+ pueden ser disparadas a través de estos receptores, por lo tanto, estos dos tipos de células T se contemplan para uso con la invención. Las células T CD8+ que expresan los CAR IL13 de esta invención pueden ser utilizadas para lisar células objetivo y para producir IL2 en presencia de las células objetivo, entre las otras funciones de estas células. La expresión del CAR coestimulador apropiado en cualquiera o ambas células T CD4+ y CD8+ se podría utilizar para proveer la población más efectiva de células para inmunoterapia adoptiva, que consiste, por lo tanto, de cualquiera o ambas células T auxiliares y asesinas profesionales que exhiben viabilidad potenciada y/o a largo plazo y actividad antitumoral.

Los siguientes ejemplos son solamente para el propósito de ilustrar una realización de la invención.

EJEMPLOS Ejemplo 1. Transfección y expresión de receptores quiméricos específicos de IL13Rα2 en linfocitos T humanos primarios.

Para acoplar tanto el receptor de células T (TCR)- y cascadas de señalización similares a las coestimuladoras tras la interacción con el antígeno de tumor de glioma IL13Rα2, elementos de señalización derivados de CD28 y el 4- 1BB se integraron en un receptor de antígeno quimérico (CAR) de IL13-zetaquina (IL13ζ). El CAR IL13ζ preferido está compuesto de la muteína IL13(E13Y) extracelular, Fc de bisagra IgG4 humana enlazado a CD3ζ citoplásmico humano a través del dominio transmembrana de CD4 humano. Véase la Figura 1. La síntesis de novo de la secuencia de codificación de IL13(E13Y) se realizó utilizando cebadores IL13P1, IL13P2, IL13P3, IL13P4 e IL13P5. Véase la Tabla I, más adelante, y la Figura 2. La secuencia final (417bp) fue digerida en el extremo con EcoRI- BamHI, y se ligó en el plásmido pSK (Stratagene™) como ligadura 312# 3. La ligadura 312#3 se mutagenizó (kit de Stratagene™, según las instrucciones del fabricante) para reparar un nucleótido eliminado utilizando los cebadores IL13 #312 3 mut5-3 e IL13 312# 3 mut3-5 y la ligadura 312#3 como plantilla, para formar la ligadura 348#1 (IL13ζ/pSK).

La secuencia de codificación del péptido de señalización de cadena (hsp) alfa GM-CSFR humana se fusionó al extremo 5' de IL13(E13Y) por extensión de solapamiento de empalme por PCR estándar. La secuencia de hsp se obtuvo de la ligadura de plantilla 301#10 (hsp/PSK) utilizando los cebadores 5’:19hsp5’ y 3’: hsp-IL13FR. Véase la Tabla I. La secuencia de IL13 se obtuvo utilizando los cebadores 5’: hsp- IL13FF y 3’:IL13-IgG4FR, y la ligadura 312#3 como plantilla. Véase la Tabla I.

Una secuencia que codifica el Fc de IgG4, la transmembrana CD4 y las regiones citoplásmicas CD3ζ (IgG4m: zeta; nucleótidos 421-1512 de la secuencia completa de IL13ζ de la Figura 3 (SEQ ID NO: 12)) se fusionó al extremo 3' de la secuencia de fusión de IL13 al péptido de señal humana usando los mismos métodos. La secuencia IgG4m: zeta se obtuvo utilizando los cebadores 5': IL13-IgG4FF y 3': ZetaN3' (véase la Tabla 1), utilizando la secuencia R9.10 (IgG4mZeta/PSK) como plantilla. La secuencia 1119 pb IgG4m:zeta se fusionó a la secuencia de fusión hsp-IL13 utilizando las respectivas secuencias como plantillas, y los cebadores 5': 19hsp5' y 3': ZetaN3' (véase la Tabla 1), para producir una secuencia de fusión de 1522 bp hsp-1L13-IgG4m:zeta. Los extremos digirieron con XbaI-NotI, y se ligaron en pSK como ligadura 351#7, para crear el plásmido IL13ζ/pSK (4464 pb) (esto es, la secuencia IL13ζ de la Figura 3, dentro del vector de clonación pSK.

Un vector de expresión que contiene la secuencia de codificación de IL13ζ fue creado mediante la digestión de IL13ζ/PSK con XbaINotI, y la creación de extremos romos con Klenow, y ligando el fragmento resultante en el plásmido pMG^Pac (Invitrogen_) (primero preparado por abertura con SgrAI, mitigando con Klenow y desfosforilación con SAP), para producir el plásmido IL13ζ/pMG. La región de resistencia a la higromicina de IL13ζ/pMG se eliminó por digestión con NotI-NheI, y se sustituyó por la fusión de selección/suicidio de HyTK, obtenido a partir del plásmido CE7R/HyTK-pMG por digestión con NotI-NheI, para crear el vector de expresión IL13ζ/HyTK-pMG (6785 pb). Este plásmido comprende el promotor 1α del factor de elongación humano (hEF1p) en las bases 6-549, la secuencia de codificación de IL13ζ en las bases 690-2183, la señal de poliadenilación tardía del Virus de Simio 40 (SV40pAN tardío) en las bases 2230-2498, un origen de E. coli mínimo de replicación (Ori ColEl) en las bases 2499-3245, un sitio poli sintético A y de Pausa (SpAN) en las bases 3246-3432, el potenciador/promotor de CMV temprano inmediato (h CMV-1Aprom) en las bases 3453-4075, la fusión de la región que codifica la timidina quinasa con resistencia a la higromicina (HyTK) en las bases 4244-6319, y la señal de poliadenilación de la hormona de crecimiento bovina y una pausa de la transcripción (BGh pAn) en las bases 6320- 6618. El plásmido tiene un sitio de linealización de PacI en las bases 3233-3240. Todos los elementos hEF1p, SV40pAN tardío, OriColE1, SpAn, y hCMV- 1Aprom se derivaron del plásmido original pMG^Pac. En suma, IL13ζ/HyTK-pMG es un esqueleto de pMG modificado, que expresa el gen IL13ζ a partir del promotor HEF1, y la fusión de HyTK a partir del promotor de hCMV-1A. Un mapa del plásmido IL13ζ/HyTK-pMG aparece en la Figura 4. La secuencia completa del ácido nucleico del plásmido se muestra en las Figuras 5A-5L (SEQ ID NOS: 13 y 14. La secuencia del inserto IL13ζ también se da en la Figura 3 (SEQ ID NOs: 5 y 6).

El establecimiento de la integridad del constructo expresado fue confirmada por inmunotransferencia Western utilizando el clon 8D3 de anticuerpo monoclonal CD3ζ anti-humano (BD PharMingen™, San Diego, CA) para sondear lisados de células enteras derivados de células T Jurkat transfectantes estables cocultivadas en presencia o ausencia de tunicamicina, un inhibidor de la glicosilación. Los transfectantes estables de células T Jurkat (línea en volumen de Jurkat-IL13-pMG) se obtuvieron por electroporación de las células T Jurkat con el vector de expresión IL13ζ/HyTKpMG, seguidas por la selección y expansión de transfectantes positivos. Se sembraron por pozo 2x106 células de la línea en volumen de Jurkat-IL13- pMG en una placa de 24 pozos con o sin 5 µg/ml, 10 µg/ml, o 20 µg/mL de tunicamicina. La placa se incubó a 37ºC durante 22 horas. Las células fueron recolectadas de cada pozo, y cada muestra se lavó con PBS y se resuspendieron en 50 µL de regulador RIPA (PBS, NP40 al 1%, desoxicolato de sodio al 0.5%, SDS al 0.1%) que contiene inhibidor de la proteasa (1 tableta/10 ml de cóctel completo de inhibidor de proteasa). Las muestras se incubaron en hielo durante una hora, antes de ser centrifugadas a 4ºC durante 20 minutos a 14,000 rpm. Las muestras de sobrenadante de lisado centrifugado se recolectaron y se hirvieron en una relación 1:3 en volumen de regulador de muestra bajo condiciones reductoras, luego se sometieron a electroforesis en SDS-PAGE en un gel de acrilamida al 12%. Después de la transferencia a nitrocelulosa, la membrana fue entonces bloqueada en una solución de Blotto™ que contenía leche en polvo sin grasa al 4% en T-TBS (0,1% de Tween 20_ en solución salina regulada con Tris pH 8.0) durante 1 hora. La membrana fue entonces incubada con el anticuerpo monoclonal CD3ζ antihumano de ratón primario a una concentración de 0.5 µg/ml durante una hora, se lavó y luego se incubó con una dilución 1:3000 (en solución Blotto™) de anticuerpo secundario conjugado de fosfatasa alcalina de IgG anti-ratón de cabra (Kit de Bio-Rad™ ImmunoStar™) durante 1 hora. Antes del desarrollo, la membrana se lavó 4 veces adicionales en T-TBS, y luego se incubó con 3 mL de solución de sustrato de fosfatasa (Kit de Bio-Rad™ ImmunoStar™) durante 5 minutos a temperatura ambiente. La membrana se cubrió entonces con una cubierta de desarrollo de plástico (Tropix™) y se expuso a película de Rayos X. Consistente con el patrón de glicosilación conocido de IL13 humano de tipi silvestre, la movilidad electroforética de la IL13 (E13Y)zetakina expresada indica una proteína fuertemente glicosilada que, cuando se expresa en la presencia de tunicamicina, se reduce a un esqueleto de aminoácidos de aproximadamente 54 kDa.

La construcción del CAR coestimulador se inició con un constructo de HyTK-2A-IL13ζ-pcDNA3.1(+), que codifica el gen HyTK de fusión de selección/suicidio, el péptido 2A de la enfermedad de glosopeda autoescindible sintetizado de novo (TCTAGAGGAGCATGCCAGCTGTTGAATTTTGACCTTCTTAAGCTTGCGGGAGACGTC GAGTCCAACCCTGGGCCC; SEQ ID NO: 49), y la molécula IL13ζ, (Figura 3), se clonó en pcDNA3.1(+) (Invitrogen™). Para conferir resistencia al metotrexato (MTX), el gen HyTK fue reemplazado por PCR con un gen de la dihidrofolato reductasa (DHFR) (amplificado a partir de una librería de ADNc derivada de células mononucleares de sangre periférica (PBMC) que habían sido estimulados durante tres días con el anticuerpo OKT3 el cual reconoce la cadena CD3 del receptor de células T que contenía mutaciones de L22F y F33S generadas usando un Kit de Mutagénesis Dirigida al Sitio QuikChange™ (Stratagene™). El constructo DHFRdm- 2A-IL13ζ resultante fue entonces escindido con NheI y NotI, se eluyó y se ligó en el vector pEK de expresión de plásmido de mamífero digerido de manera similar. El vector PEK había sido modificado originalmente de pcDNA3.1(+) mediante la eliminación del promotor de CMV y el gen de ampicilina y reemplazándolo con el gen promotor 1α del Factor de Elongación humana (EF1p) derivado de pMG (Invivogen™) para crear el plásmido DHFRdm-2A-IL13ζ_pEK (pJ01275-9). El ADNc de CD28 fue adquirido de Invitrogen™ y la región de codificación de 4-1BB se amplificó por PCR a partir de una librería de ADNc derivada de células mononucleares de sangre periférica (PBMC) que habían sido estimuladas durante tres días con el anticuerpo OKT3 (utilizando cebadores 41BB5' y 41 BB3', véase la Tabla 1).

Las regiones de señalización intracelular de CD28 y 4-1BB (aminoácidos 180-220 y 214-255, respectivamente, de las secuencias de CD28 y 4-1BB nativas) se fusionaron mediante PCR (usando los cebadores CD4-CD28F, CD28- 4-1 -BBR, CD28-4-lbbF, y 41bb93 provistos en la Tabla I) en la unión entre la transmembrana CD4 y CD3ζ citoplasmático (aminoácidos 52-164 de las regiones CD3ζ nativas. Véase la Figura 6, que provee representaciones esquemáticas de ejemplos de IL13ζ (Figura 6A) y constructos de plásmidos lineales de IL13-CD28-41BBζ (Figura 6B). La colocación de muteína IL13 humana (E13Y), Fc de bisagra de IgG4 humana (IgG4), transmembrana CD4 humana (tm), segmentos citoplásmicos de CD3ζ humano (Zeta), citoplásmicos de CD28 (28c) y citoplasmáticos de 4-1 BB (BBC) se indican en la Figura 6. Los sitios de enzimas de restricción que se usaron para insertar los diferentes fragmentos de PCR también se indican en la Figura 6 (NheI, KpnI, NsiI, NotI), con sus locaciones de pares de bases predichas provistas en paréntesis. Como se muestra en la Figura 6A, el CAR, IL13-CD28-41BBζ, comprende el dominio citoplásmico de CD28 y el 4-1BB fusionado al de CD3ζ_ Cada constructo que se muestra en la Figura 6A tiene un dominio huIL13 que contiene la mutación E13Y que lo hace específico a IL13Rα2, un dominio Fc de bisagra de IgG4 humano (huγ4Fc), un dominio de transmembrana CD4 humana (huCD4tm) y un dominio citoplasmático de CD3 humano (huCD3ζ cyt); el CAR IL13-CD28-41BBζ tiene los dominios de señalización (sig) de CD28 y el 4-1BB insertados entre los dominios de la transmembrana CD4 y citoplásmicos de CD3. Los cebadores de PCR utilizados en la construcción de los plásmidos y utilizados en el análisis de expresión se proveen en la Tabla I.

Cultivos en volumen de células T CD4+ obtenidos por separación MACS™ usando el protocolo del fabricante (Miltenyi Biotec™ Inc.) se mantuvieron en medios RPMI con FCS al 10%, L-glutamina al 1%, regulador HEPES al 2.5%, 50 U/mL rhIL2, 10 ng/mL rhIL15 y 0.1 µM MTX. El aislamiento, la activación y la electroporación de células T humanas se realizó como sigue. Las PBMC se aislaron por centrifugación en gradiente de densidad sobre Ficoll- Paque (Pharmacia Biotech™) de sangre periférica heparinizada obtenida a partir de consentimiento de donantes sanos. Las células se resuspendieron en solución de nucleofección utilizando el kit Nucleofector de células T humanas de Amaxa™ (Amaxa™ Inc.). Se agregó plásmido (1 µg/5x106 células), y las células se sometieron a electroporación usando el Nucleofector I de Amaxa™ (Amaxa™ Inc.), programa U-14. Las células fueron entonces recolectadas en medio libre de rojo de fenol con FCS al 10%, dejándolas en reposo durante la noche, y luego se estimularon con 30 ng/ml de OKT3 y 5 ng/mL de rhIL15 en RPMI con FCS al 10% durante tres días. Los transfectantes exitosos fueron seleccionados utilizando un medio que contenía MTX 0.1 µM y 5 ng/ml de rhIL15.

La expresión de los CAR se determinó mediante análisis de inmunotransferencia con un anticuerpo específico para CD3ζ. Lisados de células enteras de células T CD4+ seleccionados de MTX en volumen (transfectadas de forma simulada, IL13ζ- e IL13-CD28-41-BBζ) se probaron para la expresión del CAR (CD3ζ quimérico) usando métodos conocidos y un anticuerpo monoclonal específico de CD3ζ antihumano de ratón disponible comercialmente, 1D3.

Como era de esperarse con tales proteínas altamente glicosiladas, se observaron múltiples bandas dentro de los pesos moleculares esperados. Véase la Figura 7.

Los niveles de CAR IL13ζ o IL13-CD28-41BBζ expresados en la superficie de las células T CD4+ se examinaron mediante la detección de IL13 enlazada a la membrana usando citometría de flujo. Véase la Figura 8. Las PBMC transfectadas con ADNc que codifican CAR IL13ζ o IL13-CD28-41BBζ se propagaron durante un promedio de 10 semanas bajo concentraciones selectivas de MTX (0.1 µM), magnéticamente ordenadas para células CD4+ por separación MACS™, y se examinaron para la expresión de superficie del CAR que contiene IL13 (Eje Y), y CD4, CD8, TCRα/β, o CD28 (eje X) como se indica. Se utilizaron MAb fluorescentes coincidentes con isotipos para establecer los cuadrantes. Estas poblaciones de células T genéticamente modificadas no fueron solamente predominantemente CD4+ y CD8, como se esperaba después de la purificación por MACS ™ basada en perlas magnéticas de células CD4+, sino que también expresaron niveles altos y equivalentes de TCR endógeno y bajos hasta a niveles indetectables de coestimuladores CD28. Véase la Figura 8.

La línea objetivo de células de tumores de glioblastoma humana IL13Rα2+ utilizada en estos estudios, U87, también fue fenotipificada para confirmar que esas células expresan MHC de clase I y clase II en su superficie y no expresan ligandos estimuladores CD80/86 o 4-1BBL. Véase la Figura 9, que muestra la tinción de la superficie de moléculas MHC HLA-A2 y HLA-DR, IL13R y moléculas coestimuladoras CD80, CD86, y CD137-L (4-1BBL) (histogramas rellenos), como se indica, en comparación con controles de isotipo (histogramas abiertos) en las células objetivo de glioma U87, como se analizó por citometría de flujo.

El análisis de citometría de flujo involucrado que evalúa la expresión de la superficie celular de los constructos de CAR de IL13 por tinción con anticuerpos monoclonales IL3 antihumanos conjugados con FITC o conjugados con PE (BD PharMingen™). El fenotipo de la superficie celular de células T humanas primaria transfectantes se ensayó con anticuerpos α/β anti-CD4, anti-CD8, y anti-TCR conjugados con FITC o con anticuerpos anti-CD28 conjugados con PE (BD PharMingen™). El fenotipo de la superficie celular de células de glioma humano U87 se ensayó con anticuerpos anti-HLA-A2, anti-HLA-DR, y anti-CD80 conjugados con FITC, o con anticuerpos anti-CD86 y anti- CD137-L (4-1BBL) conjugados con PE, en comparación con controles de isotipo conjugados con FITC y PE (BD PharMingen™). La expresión IL13Rα2 se ensayó usando IL13Rα2 antihumano de cabra (R & D Systems™) seguido de IgG anti-cabra de ratón conjugado con FITC (Jackson ImmunoResearch™).

Tabla I. cebadores de PCR para construcción de CAR.

SEQ ID NO: Nombre del cebador Secuencia del Cebador (5’-3’) IL3P1 17 IL3P2 18 IL3P3 19 IL3P4 IL3P5 21 IL13 312#3 CAACCTGACAGCTGGCATGTACTGTGCAGCCCTGGAATC 22 mut5-3 IL13 312#3 GTTGGACTGTCGACCGTACATGACACGTCGGGACCTTAG 23 mut3-5 5’:19hsp5’ ATCTCTAGAGCCGCCACCATGCTTCTCCTGGTGACAAGCCTTC 24 3’: hsp-IL13FR GAGGGAGGCACAGGGCCTGGGATCAGGAGGAATG 5’: hsp-IL13FF CATTCCTCCTGATCCCAGGCCCTGTGCCTCCCTC 26 3’: IL13-IgG4FR GGGACCATATTTGGACTCGTTGAACCGTCCCTCGC 27 5’: IL13-IgG4FF GCGAGGGACGGTTCAACGAGTCCAAATATGGTCCC 28 3’: ZetaN3’ ATGCGGCCGCTCAGCGAGGGGGCAGG 29 41BB5’ ATCGAATTCGCCGCCACCATGGGAAACAGCTGTTACAAC 41BB3’ GATAAGCTTATCGATTCACCACATCCTCCTTCAGTT 31 CD4-CD28F CATTGGGCTAGGCATCTTCTTCAGGAGTAAGAGGAGCAGGCTC 32 CD28-4-1BBR GTTTCTTTCTGCCCCGTTTGCCACCTCCGGAGCGATAGGCTGCGAAG 33 CD28-4-1BBF CTTCGCAGCCTATCGCTCCGGAGGTGGCAAACGGGGCAGAAAGAAAC 34 4-1BB93’ GTTGCGGCCGCTCACAGTTCACATCCTCCTTCTTCTTC Ejemplo 2. Potenciación de la señalización las MAPK de JNK y p38 con señalización AKT sostenida por IL13-CD28- 41BBζ.

Las células T estimuladas por el acoplamiento del complejo TCR-CD3 junto con los receptores auxiliares CD28 o el 4-1BB son conocidos por conducir señales a través de AKT, así como las proteínas quinasas activadas por mitógenos (MAPKs). Para investigar la capacidad de los CAR coestimuladores para influir estas rutas efectoras en dirección 3’, se utilizaron ensayos de quinasa in vitro para evaluar y comparar la actividad de los miembros de la familia AKT y MAPK ERK, JNK y p38 en células T CD4+ que expresan IL13ζ- e IL13-CD28-41BBζ después del acoplamiento de las células objetivo U87. La línea de glioma humano, U87, se obtuvo de ATCC (Rockville, MD).

Todas las líneas tumorales son adherente, y se cultivaron en DMEM (Irvine Scientific™) suplementado con FCS al 10% inactivado por calor, HEPES 25 mM, y L-glutamina 2 mM. Las células T CD4+ que expresan CAR IL13ζ o IL13- CD28-41BBζ se incubaron con células de glioma U87 durante los tiempos indicados en la Figura 10 antes del ensayo.

Después de que las células T CD4+ que expresan IL13ζ- o IL13-CD28-41BBζ se estimularon con células objetivo tumorales durante hasta 48 horas (Figura 10A) o 72 horas (Figura 10B), los niveles de los sustratos de proteína total de JNK, p38 y Akt (esto es, cJun, ATF2, y GSK3, respectivamente) y los sustratos fosforilados (P-cJun, P-ATF2, y P- GSK3, respectivamente) se midieron mediante inmunotransferencia Western. El aumento de veces en la fosforilación de cada sustrato, como una medida de la actividad de quinasa, se indica en la parte inferior de cada grupo en la Figura 10.

Se realizó un ensayo de quinasa en estado sólido no radiactivo usando un método modificado de Hibi et al., "Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain." Genes Dev. 7:2135-2148,1993. Usando lisados de células T que habían sido separados de células objetivo por centrifugación suave (1000 rpm, <3 minutos), la quinasa seleccionada se inmunoprecipitó durante la noche a 4ºC utilizando anticuerpos específicos para ERK1/2, JNK, p38, y AKT (Cell Signaling Technology Inc. ™). Los complejos inmunoprecipitados se lavaron en regulador de lisis (PBS con NP40 al 1%, SDS al 0.1%, y desoxicolato de sodio al 0.5%) y regulador de quinasa (Tris 25 mM, pH 7.5, que contenía MgCl2 10 mM y EGTA2 mM), y el ensayo se realizó a 30ºC durante 30 minutos, usando 1 µg de sustrato en presencia de ATP 10 µM.

Las proteínas de fusión de glutationa S-transferasa (GST): GST-ELK, GST-ATF2 y GST-GSK3 (Cell Signaling Technology™ Inc.), y GST-cJun(1-79) (como se describe en Chang et al., Cell 124:601-613, 2006) se utilizaron como los sustratos para los ensayos de ERK, p38, AKT, y JNK quinasa, respectivamente. Los productos resultantes se resolvieron en 12% de NuPAGE™ (Invitrogen™) de acuerdo con métodos estándar y se transfirieron a membrana de nitrocelulosa utilizando el Xcell II Blot Module™ (Invitrogen™). Las transferencias se sondearon con anticuerpos para fosfo-ELK, ATF2, cJun y GSK3 (Cell Signaling Technology Inc™) para detectar proteínas y anticuerpos de fusión de GST fosforilados a GST (BD PharMingen™) para detectar la cantidad total de sustrato. Las inmunoprecipitaciones fueron entonces incubadas con anticuerpos específicos de inmunoglobulina de conejo conjugado con IRDye 680 de ratón conjugado con IRDye800 (LI-COR™). El regulador de bloqueo (adquirido de LI- COR™) se utilizó para pretratar transferencias y para la dilución de anticuerpos. Las transferencias fueron vistas y se registraron utilizando un Odyssey™ Infrared Imaging System (LICOR ™) y las intensidades de la banda se cuantificaron utilizando el software v2.0 Odyssey™ (LI-COR™). La fosforilación de sustrato, una medida de la actividad de la quinasa, se cuantificó y se normalizó a las correspondientes cantidades detectadas de quinasa inmunoprecipitada y el sustrato total de quinasa. La actividad de la quinasa relativa de las células T CD4+ de IL13ζ + en t = 0 se le dio un valor arbitrario de 1.0; los guiones (-) indican la multiplicidad de diferencias <1.0 (véase Figura 10).

El ensayo de quinasa fue capaz de detectar la actividad de JNK y p38 MAPK potenciada y la actividad prolongada de la AKT quinasa en las células T CD4+ de IL13-CD28-41BBζ después del cocultivo con células de glioma U87. Como se muestra en la Figura 10, la activación de JNK y p38 fue más fuerte en las células T CD4+ que expresan IL13-CD28-41BBζ que en aquellas que expresan IL13ζ. Véase la Figura 10. En contraste, la activación de otro MAPK, ERK, fue comparable entre los dos tipos de células. Se observó activación de AKT en ambas poblaciones de células T, pero se elevó solamente hasta las 24 horas en las células IL13ζ+ mientras que las células IL13-CD28- 41BBζ+ desplegaron elevada actividad de AKT por hasta 72 horas o más. Véase la Figura 10B. Así, AMBOS CAR fueron efectivos, pero los dominios coestimuladores en el CAR IL13-CD28-41BBζ produjeron actividad de AKT más sostenida en comparación con la observada con el CAR IL13ζ.

Ejemplo 3. Polarización de Th1 refuerza las señales de coestimulación de efectores de CD4+ redirigidos al tumor.

Debido a que la actividad de p38 ha sido detectada en Th1 pero no en las células Th2, y se sabe que la activación de JNK/p38 induce la producción de Th1 de citoquinas TNF-α y IFN-γ asociadas, se investigó el efecto de la función coestimuladora de CD28 y el 4-1BB en la inducción mediada por el CAR de las citoquinas asociadas a Th1. Las células T CD4+ modificadas genéticamente (106 células) que expresan IL13ζ o IL13-CD28-41BBζ se cocultivaron en placas de cultivo de tejidos de 24 pozos con diferentes células estimuladoras (5 x 105 células) en 2 mL de medio de cultivo. Las células estimuladoras fueron células de glioma U87 (U87), las células de mieloma de ratón NS0 parentales (NS0), células NS0 que expresan establemente IL13Rα2 de superficie (NS0-IL13Rα2) o células NS0 que expresan establemente OKT3 unida a la membrana (NS0-OKT3) como se indica en la Figura 11A.

Se utilizó RT-PCR cuantitativa en tiempo real (qPCR) para medir los niveles de ARNm relativos después del cultivo. Para el análisis de la expresión génica, se aisló el ARN celular total de los transfectantes de células T CD4+ utilizando un kit RNeasy™ (Qiagen™). La transcripción reversa de 5 µg de ARN total en un volumen de 30 mL (que contenía 1x regulador de transcriptasa reversa, oligo dT 2.5 mM, dNTP 0.25 mM, ditiotreitol 0.01 M, 20 U de Rnasin y 200 U de transcriptasa reversa de SuperScript™ II RNase H (Invitrogen™)) se utilizaron para sintetizar ADNc. Las muestras se incubaron a 42ºC durante 1 hora y la transcriptasa reversa fue entonces inactivada por calentamiento de 5 minutos a 70ºC. Dando como resultado ADNc, equivalente a 0.2 µg de ARN total, se sometió a análisis por qPCR utilizando mezcla maestra de PCR de SYBR Green (Applied Biosystems ™) y los cebadores diseñados por sistema de detección de PCR en tiempo real de DNA Engine Opticon 2™ (MJ Research Inc™). Las secuencias de cebadores de los genes probados IL2 e IFN-γ son los siguientes: IL2 de avance: CAAGAATCCCAAACTCACCAG, SEQ ID NO: 50; IL2 en reverso: CGTTGATATTGCTGATTAAGTCC, SEQ ID NO: 51; IFN-γ de avance: ATCCCAGTAATGGTTGTCCTGCCT, SEQ ID NO: 52; IFN-γ en reverso: TCTTGCTTAGGTTGGCTGCCTAGT, SEQ ID NO: 53. El valor promedio del umbral del ciclo (CT) del ARNm de ciclofilina (como se describe en Chang et al, "The E3 ubiquitin ligase itch couples JAK activation to TNFalpha-induced cell death by inducing c-FLIP(L) turnover." Cell 124:601-613, 2006) se utilizó para normalizar los genes probados. Los valores promedio de CT se determinaron mediante mediciones de qPCR por triplicado para cada gen en cada condición experimental.

El ARNm total de células T se recogieron a las 0 horas (Figura 11A, barras blancas), a las 7 horas (Figura 11A, barras negras) y a las 24 horas (Figura 11A, barras sombreadas) para el análisis por qPCR de los ARNm humanos indicados. * Indica un p < 0.05 en comparación con los valores de 7 horas de células T CD4+ que expresan IL13ζ utilizando una prueba t de Student no apareada. La línea de mieloma de ratón NS0 se sometió a electroporación con bien sea IL13Rα2-IMPDH2_pMG (pJ00659), lo que confiere la expresión del antígeno objetivo de IL13Rα2 y la resistencia al ácido micofenólico (MPA) o OKT3-IMPDH2_pcDNA3.1(+) (pJ01056), lo que confiere la expresión de la molécula OKT3 de entrecruzamiento por CD3 (y así células T estimuladoras) junto con resistencia a MPA, y luego se clonó en la presencia de 6 µM de ácido micofenólico (MPA) y se exploró para la expresión del transgen IL13Rα2 humano. Para los experimentos en que se utilizó U87 y células tumorales NS0-IL13Rα2, n = 3; para el experimento en que se utilizó células tumorales NS0-OKT3 y NS0, n = 1.

Los niveles de ARNm de IL-2 e INF-γ fueron mayores en las células T de IL13-CD28-41BBζ que en las células T de IL13ζ después del cultivo con células de glioblastoma U87. Véase la Figura 11A. No se observó inducción de ARNm de IL2 o INF-γ con cualquier población de células T cuando se cocultivaron con células NS0. La estimulación por células NS0 que expresan transgenes de IL13Rα2 restauró la inducción de ARNm de IL2 e INF-γ en las células T que expresan IL13-CD28-41BBζ pero no en IL13ζ, lo que indica que los genes de inducción de citoquinas eran dependientes de IL13Rα2. Las cantidades relativas de ARNm de IL2 e INF-γ inducido se correlacionan directamente con los niveles de expresión de superficie de IL13Rα2 en U87 y las células NS0 que expresan transgenes; el nivel U87 es más alto que el de las células NS0-IL13Rα2. En contraste, la inducción de los genes IL2 e INF-γ en las células T de IL13ζ fue similar al que se vio en las células T de IL13-CD28-41BBζ cuando cada población fue cocultivada con células NS0 que expresan de manera estable OKT3 enlazada a la membrana, una molécula de inmunoglobulina agonista que activa las células T a través del acoplamiento de CD3ε. Estos resultados indican que la inducción inferior de ARNm de IL2 e INF-γ mediada por el acoplamiento de IL13ζ con IL13Rα2 no se debe a un defecto intrínseco en estas células T, sino a la carencia de dominios coestimuladores de CD28 y el 4-1BB dentro del CAR.

Para cuantificar las cantidades de proteínas de citoquina de Th1 versus Th2 liberadas de las células T que expresan CAR, los sobrenadantes de estos cocultivos se ensayaron para el contenido de citoquinas. Después de una incubación de 24 horas, los sobrenadantes del cultivo de IL13ζ+ (barras blancas) o IL13-CD28-41BBζ+ (barras negras) se recolectaron y se ensayaron para citoquinas de Th1 y Th2 por arreglo de perlas citométricas múltiples utilizando el kit 17-Plex Panel™ humano según las instrucciones del fabricante (Bio-Rad Laboratories). Véase la Figura 11B.

Glioma U87 o células NS0 de IL13Rα2+ estimularon más liberación de citoquinas Th1 (IL2, IFN-γ, TNF-α y GM-CSF) y menos liberación de citoquinas Th2 (IL5, IL10 e IL13) de células T de CD28-41BBζ que de células T de IL13ζ. Los niveles equivalentes de citocinas Th1 y Th2 fueron producidos por células T CD4+ que expresan IL13ζ- e IL13-CD28- 41BBζ cultivadas con células NS0 que expresan OKT3, lo que indica que estas células permanecen no polarizadas tras la activación policlonal a través de CD3 endógeno. Los niveles de citoquinas estaban todos bajos hasta indetectables cuando las células T fueron cultivadas con células NS0 parentales. Los niveles de la IL-4 de citoquina Th2 también estaban bajos hasta indetectables cuando las células T fueron cultivadas con cualquiera de las líneas celulares tumorales. En general, estos datos muestran que la presencia de dominios coestimuladores de CD28 y 4- 1BB dentro del CAR ayuda a controlar la transcripción y secreción de células T CD4+ de citoquinas similares a Th1.

Ejemplo 4. Incremento en actividad lítica antitumoral de reciclaje en las células TCD4+ de IL13-CD28-41BBζ.

Para determinar si el CAR coestimulador afectó a la actividad citotóxica específica tumoral de las células T CD4-, se realizaron ensayos citolíticos luminiscentes (LCA) para detectar la actividad de luminiscencia del transgen de luciferasa de luciérnaga (ffLuc) de las células tumorales in vitro. Este ensayo se realizó como se ha descrito por Brown et al., "Biophotonic cytotoxicity assay for high-throughput screening of cytolytic killing." J. Immunol. Meth. 297:39-52, 2005, con 0.14 mg/mL de D-luciferina y usando un luminómetro Victor2™. Brevemente, se analizó la actividad de luminiscencia del transgén de ffLuc de las células tumorales in vitro por LCA con 0.14 mg/ml de D- luciferina (Xeonogen™) utilizando un luminómetro Victor2 ™. Véase la Figura 12A, que muestra actividad citotóxica potenciada de las células T CD4+ de IL13-CD28-41BBζ+ ( ) contra objetivos U87 en comparación con las células T CD4+ de IL13ζ+ ( ) en la relación E:T indicada después de 4 horas. La media ± SE de valores por triplicado se indican; * Indica un p < 0.05 usando una prueba t de Student no apareada.

Después de 4 horas de cocultivo con células objetivo U87 transfectadas con ffLuc, las células de IL13-CD28-41BBζ mostraron un potenciamiento estadísticamente significativo en la actividad lítica en comparación con las células de IL13ζ. Si el cocultivo se extendió a 48 horas, no se observó ninguna diferencia en la actividad citotóxica entre las células que expresan IL13ζ y IL13-CD28-41BBζ (100% de lisis específica se alcanzó con ambas células). Los datos en la Figura 12B indican lisis específica mediante ensayo por LCA después de 48 horas de cocultivo en una relación E:T de 2:1, y luego otra vez después de la adición de objetivos frescos durante otras 48 horas de cocultivo a una relación E:T de 2:1. La media ± SE de valores por triplicado se indican; * Indica un p < 0.05 (prueba t de Student apareada) comparando las células T CD4+ de IL13-CD28-41BBζ (barras negras) con las células T CD4+ de IL13ζ+ (barras blancas) en el cocultivo indicado.

Los niveles de ARNm de perforina y granzima B fueron igualmente sobrerregulados en las células de IL13ζ y de IL13-CD28-41BBζ, lo que sugiere que estas células T que expresan CAR pueden utilizar mecanismos similares de asesinato. Sin embargo, si se agregaron objetivos de ffLuc frescos para una segunda ronda de 48 horas de cocultivo con las mismas células CD4 T que expresan CAR las células de IL13 CD28-41BBζ despliegan significativamente mayor actividad lítica que las células de IL13ζ (Figura 12B ). Esto sugiere que el CAR coestimulador afecta beneficiosamente la duración y/o reciclaje de la actividad mortal de células T CD4.

Para examinar adicionalmente este fenómeno, se analizó la viabilidad de las células tumorales U87 durante el cocultivo con células T de IL13ζ o de IL13 CD28-41BBζ utilizando microscopía con lapso de tiempo en vídeo (VTLM) de cocultivos de 6x105 células de glioma U87 adherentes con células T CD4+ que expresan 1.2x106IL13ζ- o IL13- CD28-41BBζ. Los cultivos se lavaron 45 horas después y luego se recultivaron con células de glioma U87 frescas (6x105). El número de células tumorales viables se representaron sobre 42 horas (la primera matanza) y de 45 horas a 139 horas (la segunda matanza). Véase la Figura 12C.

La formación de imágenes se llevó a cabo simultáneamente en un cuarto caliente a 37ºC en cuatro microscopios Eclipse TS100™ (Nikon™ Inc.), cada uno equipada con una lámpara de tungsteno-halógeno, filtro GIF (verde), condensador de NA ELWD 0.3, Plan Fluor™ 4x/0.13 PhL DL lente objetivo corregido a infinito, adaptador de montura C sin lente D10NLC 1x (Diagnostic Instruments™) y cámara CCD 1/2" de video VCB 3524 B/W RS-170 (Sanyo™ Norte America Corp.). Para recolectar los datos, se agregaron 1.2x106 células T (en 200 µL de solución salina equilibrada de Hank suplementada con 0.1% de albúmina de suero humano) a matraces T-25 que contenían 6x105 células U87 adherentes (sembradas 1 día antes en 3 x 105 células/matraz). Los matraces fueron mantenidos equilibrados en la platina del microscopio durante 30 minutos antes de la formación de imágenes. La rata de adquisición de lapso de tiempo estaba en intervalos de 2 minutos. Varios marcos de células tumorales solos fueron adquiridos en cada vídeo, seguido de la adición de las células T. Las células combinadas fueron entonces registradas de forma continua durante 80 horas. Después de la adición de las células T, cada matraz fue gaseado con 5% de CO2 durante 10 segundos y sellado sella con parafilm para asegurar el buen control de pH (bicarbonato en HBSS) y el enfoque estable, respectivamente. Las imágenes fueron adquiridas mediante el Organizador de Cámara COH VTLF y digitalizadas a 640x480 píxeles con una tarjeta de agarre de cuadros de 4 canales Matrox™.

El reconteo de células tumorales viables se realizó a intervalos de ≤ 10 horas utilizando el comando "Contar manualmente objetos" en MetaMorph™ 6.33 (Universal Imaging/Molecular Devices™ Corp.). Todos los conjuntos de datos se importaron en MetaMorph™ y se guardaron como pilas Meta-Morph™ y películas en formato AVI.

La capacidad de cualquiera de las células T CD4+ modificadas genéticamente para matar las células tumorales durante las primeras 42 horas de cocultivo fue sustancialmente la misma (casi 100% de las células U87 murieron en horas). Sin embargo, en el segundo encuentro con células tumorales U87, las células T de IL13-CD28-41BBζ recuperadas conservaron una mayor actividad citolítica que las células T de IL13ζ. Es importante destacar que la enumeración de las células T antes de la adición de las células U87 para un segundo tiempo reveló que no hubo diferencias significativas en el número de células. Adicionalmente, los ensayos basados en CFSE realizados durante 72 horas de cocultivo con células U87 no revelaron diferencias en la proliferación de células T de IL13ζ o de IL13- CD28-41BBζ in vitro. Esto demuestra que la mayor actividad citolítica tras la adición de objetivos frescos no se debió a la presencia de más asesinos, pero si a una capacidad potenciada de los asesinos individuales para funcionar. En conjunto, estos datos muestran que el CAR coestimulador apoya el reciclaje y la retención de la función de células T CD4.

Ejemplo 5. Eliminación potenciada de tumores in vivo mediante células T CD4+ de IL13-CD28-41BBζ.

La capacidad de los CAR con dominios de señalización de CD28 y 4-1BB para potenciar la eficacia antitumoral de las células T CD4+ se estableció usando tumores U87 establecidos en un modelo de xenoinjerto murino ortotópico. Para los estudios in vivo, las células U87 se transfectaron con ffluc-zeocin_cDNA3.1(+) (pJ00778, un plásmido que expresa una fusión de proteína de la enzima luciferasa de luciérnaga y el gen de resistencia a los fármacos zeocina) e IL2 (2) _HyTk-pMG (pJ00976 , un plásmido que expresa la citoquina IL2 y el gen de fusión de selección/suicidio HyTK) usando oligofectimina (Invitrogen ™) de acuerdo con las instrucciones del fabricante y luego se clonaron en presencia de 0.2 mg/ml de zeocina y 0.1 mg/ml de higromicina.

Para producir el modelo de xenoinjerto de glioma ortotópico, los ratones fueron tratados como sigue. Un día después de la irradiación con 250 rads, se anestesiaron ratones macho NOD-Scid de 6 a 8 semanas de edad, se afeitaron y se inmovilizaron con restricción con aparato estereotáctico adaptador para ratón/rata neonatal Cunningham™ (Stoelting™). Los ratones recibieron entonces una inyección guiada estereotácticamente de tumor (glioma U87) 2 mm lateral y 0.5 mm anterior al bregma a lo largo de 3-5 mm. Las células tumorales U87- ffLucZeo/IL2+ (2 x 105 células/ratón), se suspendieron en 2 µL de RPMI libre de fenol (Irvine Scientific, Irvine, CA), se inyectaron a una profundidad de 2.5 mm desde la duramadre. Siete días después de la inoculación del tumor, 106 células T que expresan bien sea IL13ζ IL13-CD28-41BBζ fueron suministradas (transferidas de forma adoptiva) en 2 µL al tumor coordenadas en el cerebro. Los animales de control recibieron solamente PBS ("control simulado"). Los agujeros Burr fueron sellados con cera para hueso y la incisión cerradas con pegamento Nexaband™. Los animales recibieron una inyección subcutánea de 0.1 mg/kg de Buprenex™ para la recuperación postquirúrgica. En este modelo, los tumores comienzan a desaparecer espontáneamente en 13-14 días después de la inyección debido a la recuperación del sistema inmune endógeno, así que los experimentos fueron completados por el día 12.

El crecimiento del tumor ortotópico se puede cuantificar de forma no invasiva mediante la monitorización de señales de flujo de ffLuc derivadas de tumores en células de glioblastoma U87 establecidos que expresan de forma estable la luciferasa de luciérnaga (ffLuc) e IL2 humana. La actividad de luciferasa in vivo se detectó utilizando formación de imágenes de tumores biofotónicos in vivo en ratones con el Sistema de Formación de Imágenes In vivo de Xenogen™ (IVIS) como se describió previamente por Kahlon et al., "Specific recognition and killing of glioblastoma multiforme by interleukin 13- zetakine redirected cytolytic T cells." Cancer Res. 64:9160-9166,2004. Brevemente, para monitorizar el fujo de ffLuc, los ratones fueron inyectados por vía intraperitoneal con 4.29 mg de D-luciferina, anestesiados (1.5 L/min de oxígeno + 4% de isoflurano), y la emisión de luz se midió durante un tiempo de integración de 1 minuto a 14 minutos después de la inyección de luciferina. El flujo (fotones/segundo) se cuantificó como conteos totales medidos con el tiempo en la región de interés. Véanse los resultados en la Figura 13. Los valores del eje Y representan la media I SD de los niveles de flujo totales de los tumores ffLuc+ de control y los grupos tratados (n = 6 para cada grupo) en los días indicados después del injerto del tumor. "Tx" indica tratamiento con células T transferidas de forma adoptiva.

Antes de la transferencia adoptiva de células T CD4+ que expresan CAR, todos los ratones presentaban niveles incrementados de las señales de flujo de ffLuc derivadas del tumor como se esperaba (véase la Figura 13; se comparan los días 2 y 6 después del injerto del tumor). Dos días después de la transferencia adoptiva (Tx), los niveles de flujo de ffLuc tumoral se redujeron en los ratones tratados ya sea con células T que expresan IL13ζ o IL13-CD28-41BBζ, en comparación con los ratones recibieron tratamiento simulado. Sin embargo, 5 días después del tratamiento con células T (día 12 después del injerto), las señales de flujo de tumores en los ratones tratados con células T de IL13-CD28-41BBζ se mantuvieron bajas, mientras que las señales de flujo de los ratones tratados con células T de IL13ζ habían aumentado a un nivel similar al del grupo tratado simulado (control). Los dominios de señalización coestimuladores de CD28 y el 4-1BB así potenciaron y/o prolongaron el control del crecimiento tumoral mediante las células T genéticamente redirigidas.

Ejemplo 6. Preparación de las células T adecuadas para terapia.

Los linfocitos T se obtuvieron de un paciente mediante leucaféresis, y las células T autólogas fueron alteradas genéticamente para expresar el CAR, luego, se administraron de nuevo al paciente para lograr la terapia anticáncer.

Para preparar las células T de IL13ζ+ adecuadas para uso terapéutico, las células mononucleares se separaron de la sangre sometida a leucoféresis por centrifugación sobre Ficoll™ de grado clínico. Las PBMC se lavaron dos veces en solución salina regulada con fosfato estéril que contenía EDTA 0.526 mM y luego una vez en PBS estéril, y se suspendieron en medio de cultivo que consistía de RPMI 1640 HEPES, 10% de FCS inactivado por calor, y L- glutamina 4 mM. Las células T presentes en las PBMC del paciente se activaron policlonalmente mediante la adición de Orthoclone OKT3™ (30 ng/ml) al cultivo. Los cultivos de células fueron entonces incubados en frascos de cultivo de tejido T-75 ventilados en la incubadora designada del sujeto de estudio. Veinticuatro horas después de la iniciación del cultivo, se agregó IL2rh a 25 U/ml. Tres días después de la iniciación del cultivo, las PBMC se recolectaron, se centrifugaron y se resuspendieron en regulador de electroporación hipotónica a 20x106 células/ml. Veinticinco microgramos del plásmido IL13ζ/HyTK-pMG, junto con 400 µL de suspensión celular, se agregaron a una probeta estéril de electroporación de 0.2 cm. Cada probeta se somete a un único pulso eléctrico de 250 V/40 µs y de nuevo se incuba durante diez minutos a temperatura ambiente. Las células supervivientes se recolectaron de de las probetas, se agruparon, y se resuspendieron en medios de cultivo que contenían 25 U/mL de IL2rh. Los matraces se colocaron en la incubadora de cultivo de tejidos designado del paciente. Tres días después de la electroporación, se agregó la higromicina a las células a una concentración final de 0.2 mg/mL. Las PMBC electroporadas se cultivaron durante un total de 14 días con los medios y la suplementación de IL2 cada 48 horas.

La clonación de CD8+ CTL resistentes a la higromicina a partir de PBMC del paciente activada con OKT3 electroporada se inició en el día 14 de cultivo. Brevemente, las PBMC viables del paciente se agregaron a una mezcla de 100x106 PBMC alimentadoras irradiadas criopreservadas y 20x106 TM-LCL irradiadas (células linfoblastoides transformadas con EBV que actúan como células alimentadoras) en un volumen de 200 mL de medio de cultivo que contiene 30 ng/mL de OKT3 y 50 U/ml de IL2rh. Esta mezcla se sembró 0.2 ml en cada pozo de 10 placas de clonación de 96 pozos. Las placas se envolvieron en lámina de aluminio para disminuir la pérdida por evaporación y se colocan en la incubadora de cultivo de tejidos designado del paciente. El día 19 de cultivo, cada pozo recibió higromicina a una concentración final de 0.2 mg/mL. Los pozos se inspeccionaron visualmente para excrecencia celular en un microscopio invertido en el Día 30 y los pozos positivos fueron marcados para la reestimulación.

El contenido de cada pozo de clonación con el crecimiento celular se transfirieron individualmente a matraces T-25 que contienen 50x106 PBMC irradiadas, 10x106 LCL irradiadas, y 30 ng/mL de OKT3 en 25 mL de medios de cultivo de tejidos. En los días 1, 3, 5, 7, 9, 11, y/o 13 después de la reestimulación, los matraces recibieron 50 U/ml de IL2rh y 5 ml medio fresco cuando fue necesario. En el día 5 del ciclo de estimulación, los matraces también se suplementaron con higromicina 0.2 mg/ml. Catorce días después de la siembra, las células se recolectaron, se contaron y se volvieron a estimular en matraces T-75 que contenían 100 x 106 PBMC irradiadas, 20 x 106 TM-LCL irradiadas y 30 ng/ml de OKT3 en 50 mL de medio de cultivo de tejidos. Los matraces recibieron adiciones al cultivo de IL2rh e higromicina como se delineó más arriba.

Las CTL seleccionadas para expansión para su posible uso en terapia se analizaron por inmunofluorescencia en un clasificador de células activado por fluorescencia, utilizando anticuerpos WT/31 (aβTCR), Leu 2A (CD8), y OKT4 (CD4) monoclonales conjugados con FITC para confirmar el fenotipo del clon (αβTCR+, CD4-, CD8+, e IL13 +). Los criterios para la selección de clones para uso clínico incluyen uniforme TCR αβ+, CD4-, CD8+ y + IL13 en comparación con anticuerpo conjugado con PE/FITC de control de isotipo. Un sitio único de integración cromosómica del vector de plásmido se confirmó por análisis de transferencia Southern. El ADN de clones de células T genéticamente modificadas se rastreó con una sonda de ADN específica para el vector de plásmido.

La expresión de IL13-CD28-41BBζ se determinó mediante transferencia western para detectar la proteína del receptor quimérico usando el anticuerpo de cadena zeta anti- CD3ζ descrito anteriormente de acuerdo con métodos estándar. Brevemente, los lisados de células enteras de clones de células T transfectadas se generaron mediante la lisis de 2 x 107 células lavadas en 1 mL de regulador RIPA (PBS, 1% de NP40, 0.5% de desoxicolato de sodio, 0.1% de SDS) que contenía 1 tableta/10 mL de Cóctel Inhibidor Completo de Proteasa. Después de una incubación de 80 minutos en hielo, se recolectó sobrenadante de lisado de células completas centrifugadas y se hirvieron en un volumen igual de regulador de carga bajo condiciones de reducción y luego se sometió a electroforesis en SDS- PAGE en un gel de acrilamida al 12% prefabricado. Después de la transferencia a nitrocelulosa, la membrana fue entonces bloqueada en solución Blotto™ que contenía 4% de leche en polvo sin grasa en T-TBS (0.1% de Tween 20™ en solución salina regulada con Tris, pH 8.0) durante una hora. Las membranas se lavaron en T-TBS, luego se incubaron con el anticuerpo primario 8D3 monoclonal CD3ζ antihumano de ratón (Pharmingen™) a una concentración de 0.5 µg/mL durante una hora. Después de cuatro lavados adicionales en T-TBS, las membranas se incubaron con una dilución 1:3000 (en solución Blotto™) de anticuerpo secundario conjugado con fosfatasa alcalina de IgG antirratón de cabra durante 1 hora. Antes de la adición de sustrato, las membranas fueron enjuagadas en T- TBS, luego se incubaron con 3 mL de solución de sustrato de fosfatasa (kit Bio-Rad™ ImmunoStar ™) de acuerdo con las instrucciones del fabricante.

Las dosis adecuadas para un efecto terapéutico están entre aproximadamente 106 y aproximadamente 109 células por dosis, preferiblemente en una serie de ciclos de dosificación. Un régimen de dosificación preferido consiste de cuatro ciclos de dosificación en una semana de dosis crecientes, comenzando en aproximadamente 107 células en el día 0, incrementando gradualmente hasta una dosis objetivo de aproximadamente 108 células en día 5. Modos adecuados de administración incluyen intravenosa, subcutánea, intracavitaria (por ejemplo mediante dispositivo de acceso a reservorio), intraperitoneal, e inyección directa en una masa tumoral.

Ejemplo 7. Tratamiento del glioma recurrente intracraneal en pacientes humanos.

El tratamiento de glioma o cualquier otro tipo de cáncer como se describe aquí utilizando células T que expresan IL13-CD28-41BBζ, de acuerdo con esta invención se realizó como sigue. Clones de células T, como se describe en el Ejemplo 6, se seleccionaron preferiblemente para: a. fenotipo de la superficie celular de TCRα/β +, CD4, CD8+, IL13 +; b. la presencia de una copia única de ADN de vector plásmido integrado cromosómicamente; c. expresión de la proteína IL13-CD28-41BBζ; d. lisis específica de objetivos IL13Rα2+ humano; e. dependencia de IL2 exógena para el crecimiento in vitro; f. micoplasma, hongos y esterilidad bacteriana y niveles de endotoxinas de menos de 5 EU/ml; y g. sensibilidad in vitro de clones a ganciclovir.

Se obtuvieron células mononucleares de sangre periférica a partir del paciente mediante leucoféresis, preferiblemente después de la recuperación de la cirugía de resección inicial y en un tiempo de al menos tres semanas desde la disminución de esteroides y/o su más reciente quimioterapia sistémica. El rendimiento de la célula mononuclear objetivo con leucoféresis fue en general 5x109 y el número objetivo de los clones de células T citolíticas resistentes a higromicina fue 25. En general, se han identificado al menos cinco clones que cumplen con todos los parámetros de control de calidad para la expansión in vitro. Los clones fueron criopreservados y los pacientes monitorizados por exámenes radiográficos y clínicos en serie. Cuando se documentó recurrencia de la progresión de la enfermedad, los pacientes fueron sometidos a una re-resección y/o la colocación de un dispositivo de acceso a reservorio para suministrar células T a la cavidad de resección tumoral.

Después de la recuperación de la cirugía y disminución de esteroides, si se aplica, el paciente comenzó la terapia de células T de la siguiente manera. El paciente recibió un objetivo de al menos cuatro ciclos en una semana de terapia. Durante el primer ciclo, el aumento de la dosis de células procedía de una dosis inicial el día 0 de aproximadamente 107 células, seguido por aproximadamente 5x107 células en el día 3 a una dosis objetivo de aproximadamente 108 células en el Día 5. El ciclo 2 comenzó tan pronto como en una semana desde comienzo del ciclo 1. En los días de la administración de células T, clones expandidos se procesaron de manera aséptica lavándolos dos veces en 50cc de PBS, luego se resuspendieron en solución salina normal libre de conservantes farmacéuticos en un volumen que dio como resultado la dosis de células para el suministro del paciente en 2 mL.

Preferiblemente, las células T se instilaron durante 5-10 minutos, seguido de un lavado de 2 mL de PFN administrada durante 5 minutos. La respuesta a la terapia se determinó MRI +/- gadolinio, con espectroscopia.

En general, las dosis de células fueron al menos un registro de menos de la dosis administrada en los estudios que emplean células LAK intracavitaria (dosis de células individuales de hasta 109 y el número de células acumuladas tan altas como 2.75x1010), Tilos expandidas ex vivo (hasta 109 células/dosis) y linfocitos ilo-reactivos (dosis inicial de células 108 con dosis de células acumuladas hasta 51.5x108). La dosis baja de dosificación repetitiva es favorecida para evitar respuestas inflamatorias potencialmente peligrosas que podrían ocurrir con instilaciones individuales de gran número de células. Cada infusión consistió preferiblemente de un clon de células T individual, y el mismo clon se administró preferiblemente a lo largo de curso del tratamiento del paciente.

Aquellos pacientes que demuestran la regresión del tumor con enfermedad residual en MRI pueden tener decursos adicionales de terapia comenzando no antes de la Semana 7, que consisten en la repetición de los Ciclos 3 y 4, seguido por una semana de descanso/reestadificación dato que estos tratamientos son bien tolerados hasta el momento en que la progresión de la enfermedad está documentada, o se logra una respuesta completa (RC) sobre la base de la evaluación radiográfica. Las toxicidades máximas generalmente aceptadas son menores de grado 3, sin embargo esto es a discreción del médico tratante.

El tratamiento con ganciclovir conduce a la ablación de los clones de CAR+ HyTK+ CD8+ CTL. Por lo tanto, cualquier efecto secundario asociados con la terapia (dolor de cabeza, fiebre, escalofríos, náuseas, etc.) que puede ocurrir puede ser administrado usando tratamientos establecidos apropiados para la condición. Por ejemplo, el paciente puede recibir ganciclovir si se observa cualquier nueva toxicidad de grado 3 que progresa hasta el grado 4, o cualquier toxicidad relacionada con el tratamiento de grado 4 que, a juicio del médico tratante, pone al paciente en riesgo médico significativo. El ganciclovir administrado parenteralmente se dosifica a 10 mg/kg/día dividida cada 12 horas. Los pacientes deben ser hospitalizados por las primeras 72 horas de tratamiento con ganciclovir a para propósitos de monitorización. Si los síntomas no responden a ganciclovir dentro de las 48 horas, se pueden agregar agentes inmunosupresores adicionales, incluyendo pero no limitado a los corticosteroides y ciclosporina, a la discreción del médico tratante. Si las toxicidades son severas, también se puede utilizar decadron y/u otros fármacos inmunosupresores junto con ganciclovir a discreción del médico tratante.

Estudios de seguridad preliminares utilizando el protocolo delineado más arriba, donde se administraron clones de CTL que expresan IL13-CAR a pacientes humanos con glioma recurrente intracraneal, indicaron que de los eventos adversos que tuvieron posible correlación con la administración intracavitaria de las células T, el único evento Grado 3 han sido los dolores de cabeza que se produjeron con la administración de 108 células en cada uno de los dos pacientes tratados hasta la fecha. En ningún momento fueron eventos adversos de grado 4 o 5 que se encuentran asociados con la administración de las células T alteradas genéticamente. Así, el perfil global de seguridad de esta terapia de transferencia adoptiva aquí fue aceptable.

Ejemplos 8-12. Moléculas CAR de ejemplo. (Comparación) Las figuras 14 y 16-18 proveen las secuencias de los CAR de comparación.

La figura 14 provee la secuencia de un CAR de IL13-IgG4-cd28tm-CD28gg-Zeta (CO) (SEQ ID NO: 36). Esta secuencia codifica (1) la molécula de IL13 con la mutación E13Y (que es el ligando para el receptor de la superficie del tumor IL13Rα2 en la superficie del tumor (IL13)), (2) la porción Fc del dominio extracelular G4 isotipo de inmunoglobulina (IgG4), (3) la porción transmembrana de la molécula coestimuladora CD28 (cd28tm), (4) el dominio de señalización de CD28 con dos leucinas cambiadas a glicinas para el propósito de la expresión incrementada (CD28gg), y (5) el dominio de señalización de la cadena CD3ζ del receptor de células T (Zeta). Todos los segmentos fueron de codones optimizados (CO) para la expresión de mamífero incrementada. La porción subrayada de la secuencia es la secuencia de codificación para CD28gg.

La Figura 15, de acuerdo con la presente invención provee la secuencia de un CAR DE IL13-IgG4-cd4tm-CD28-4- 1BB-Zeta (también denominado aquí como IL13-CD28-41BBζ; SEQ ID NO: 37). Esta secuencia codifica (1) la molécula de IL13 con la mutación E13Y (que es el ligando para el receptor de la superficie del tumor IL13Rα2 en la superficie del tumor (IL13)), (2) la porción Fc del dominio extracelular G4 isotipo de inmunoglobulina (IgG4), (3) la porción transmembrana de CD4 (cd4tm); el dominio de señalización de la molécula coestimuladora CD28 (CD28) (4) el dominio de señalización de la molécula coestimuladora 4-1BB (4-1BB), y (5) el dominio de señalización de la cadena CD3ζ del receptor de células T (Zeta). La parte subrayada de la secuencia codifica CD28 y la porción en negrilla de la secuencia que codifica 4-1BB.

La Figura 16 provee la secuencia de un CAR de IL13-IgG4-cd28tm-CD28-OX40-Zeta (SEQ ID NO: 38). Esta secuencia codifica (1) la molécula de IL13 con la mutación E13Y (que es el ligando para el receptor de la superficie del tumor IL13Rα2 en la superficie del tumor (IL13)), (2) la porción Fc del dominio extracelular G4 isotipo de inmunoglobulina (IgG4), (3) la porción transmembrana de la molécula coestimuladora CD28 (cd28tm), (4) el dominio de señalización de CD28 (CD28), (5) el dominio de señalización de la molécula coestimuladora OX-40 (OX40), y (6) el dominio de señalización de la cadena CD3 del receptor de células T (Zeta). La secuencia de codificación de cd28tm está subrayada (aminoácidos 364-390); la secuencia que codifica CD28 está en cursiva (aminoácidos 391- 431); la secuencia que codifica OX40 está en negrilla (aminoácidos 432-467); y la secuencia que codifica Zeta está a la vez subrayada y en cursiva (aminoácidos 468-580).

La Figura 17 provee la secuencia de un CAR de IL13-IgG4-cd28tm-CD28gg-4-1BB-Zeta (SEQ ID NO: 39). Esta secuencia codifica (1) la molécula de IL13 con la mutación E13Y (que es el ligando para el receptor de la superficie del tumor IL13Rα2 en la superficie del tumor (IL13)), (2) la porción Fc del dominio extracelular G4 isotipo de inmunoglobulina (IgG4), (3) la porción transmembrana de la molécula coestimuladora CD28 (cd28tm), (4) el dominio de señalización de CD28 con dos leucinas cambiadas a glicinas para el propósito de la expresión incrementada (CD28gg), (5) el dominio de señalización de la molécula coestimuladora 4-1BB (4-1BB), y (6) el dominio de señalización de la cadena CD3ζ del receptor de células T (Zeta). La porción subrayada de la secuencia codifica CD28gg y la porción en negrita de la secuencia codifica 4-1BB.

La Figura 18 provee la secuencia de un CAR de IL13-IgG4-cd28tm-CD28gg^199-4-1BB-Zeta (SEQ ID NO: 40). Esta secuencia codifica (1) la molécula de IL13 con la mutación E13Y (que es el ligando para el receptor de la superficie del tumor IL13Rα2 en la superficie del tumor (IL13)), (2) la porción Fc del dominio extracelular G4 isotipo de inmunoglobulina (IgG4), (3) la porción transmembrana de la molécula coestimuladora CD28 (cd28tm), (4) el dominio de señalización de CD28 con dos leucinas cambiadas a glicinas para el propósito de la expresión incrementada, y su dominio quinasa eliminado para el propósito de remover su actividad de señalización (esto es, como un control negativo para la SEC ID NO: 39) (CD28gg^199), (5) el dominio de señalización de la molécula coestimuladora 4-1BB (4-1BB), y (6) el dominio de señalización de la cadena CD3ζ del receptor de células T (Zeta). La parte subrayada de la secuencia codifica CD28gg^199 y la parte en negrita de la secuencia codifica 4-1 BB.

Listado de secuencias

<110> Jensen, Michael <120> Método y composiciones para el funcionamiento potenciado del efector antitumoral de células T <130> 1954-504 <150> 61/091,915 <151> 2008-08-26 <160> 53 <170> PatentIn version 3.5 <210> 1 <211> 132 <212> PRT <213> Homo sapiens <400> 1

<210> 2 <211> 416 <212> ADN <213> Homo sapiens <400> 2 <210> 3 <211> 416 <212> ADN

<213> Homo sapiens <400> 3 <210> 4 <211> 497 <212> PRT <213> Homo sapiens <400> 4 <400> 5

<210> 6 <211> 1522 <212> ADN <213> Homo sapiens

<400> 6 <210> 7 <211> 84 <212> ADN <213> Homo sapiens

<400> 7 <210> 8 <211> 336 <212> ADN <213> Homo sapiens <400> 8 <210> 9 <211> 686 <212> ADN <213> Homo sapiens <400> 9 <210> 10

<211> 67 <212> ADN <213> Homo sapiens <400> 10 <210> 11 <211> 339 <212> ADN <213> Homo sapiens <400> 11 <210> 12 <211> 1092 <212> ADN <213> Secuencia Artificial <220> <223> Vector plásmido <400> 12

<210> 13 <211> 6770 <212> ADN <213> Secuencia Artificial <220> <223> Vector plásmido <400> 13 <400> 14

<211> 102 <212> ADN <213> Homo sapiens <400> 17 <210> 18 <211> 101 <212> ADN <213> Homo sapiens <400> 18 <210> 19 <211> 100 <212> ADN <213> Homo sapiens <400> 19 <210> 20 <211> 100 <212> ADN <213> Homo sapiens <400> 20 <210> 21 <211> 96 <212> ADN <213> Homo sapiens <400> 21

<210> 22 <211> 39 <212> ADN <213> Homo sapiens <400> 22 caacctgaca gctggcatgt actgtgcagc cctggaatc 39 <210> 23 <211> 39 <212> ADN <213> Homo sapiens <400> 23 gttggactgt cgaccgtaca tgacacgtcg ggaccttag 39 <210> 24 <211> 43 <212> ADN <213> Homo sapiens <400> 24 atctctagag ccgccaccat gcttctcctg gtgacaagcc ttc

43 <210> 25 <211> 34 <212> ADN <213> Homo sapiens <400> 25 gagggaggca cagggcctgg gatcaggagg aatg 34 <210> 26 <211> 34 <212> ADN <213> Homo sapiens <400> 26 cattcctcct gatcccaggc cctgtgcctc cctc 34 <210> 27 <211> 35 <212> ADN <213> Homo sapiens <400> 27 gggaccatat ttggactcgt tgaaccgtcc ctcgc <210> 28 <211> 35 <212> ADN <213> Homo sapiens <400> 28 gcgagggacg gttcaacgag tccaaatatg gtccc <210> 29 <211> 26

<212> ADN <213> Homo sapiens <400> 29 atgcggccgc tcagcgaggg ggcagg 26 <210> 30 <211> 39 <212> ADN <213> Homo sapiens <400> 30 atcgaattcg ccgccaccat gggaaacagc tgttacaac 39 <210> 31 <211> 36 <212> ADN <213> Homo sapiens <400> 31 gataagctta tcgattcacc acatcctcct tcagtt 36 <210> 32 <211> 43 <212> ADN <213> Homo sapiens <400> 32 cattgggcta ggcatcttct tcaggagtaa gaggagcagg ctc 43 <210> 33 <211> 47 <212> ADN <213> Homo sapiens <400> 33 gtttctttct gccccgtttg ccacctccgg agcgataggc tgcgaag 47 <210> 34 <211> 47 <212> ADN <213> Homo sapiens <400> 34 cttcgcagcc tatcgctccg gaggtggcaa acggggcaga aagaaac 47 <210> 35 <211> 38 <212> ADN <213> Homo sapiens <400> 35 gttgcggccg ctcacagttc acatcctcct tcttcttc 38 <210> 36 <211> 1644 <212> ADN <213> Homo sapiens

<400> 36 <210> 37 <211> 1761

<212> ADN <213> Homo sapiens <400> 37

<210> 38

<210> 39

<211> 1779 <212> ADN <213> Homo sapiens <400> 39

<210> 40 <211> 1779 <212> ADN <213> Homo sapiens <400> 40

<210> 41 <211> 544 <212> ADN <213> Homo sapiens <400> 41 <210> 42 <211> 1494 <212> ADN <213> Homo sapiens <400> 42

<210> 43 <211> 268 <212> ADN <213> Homo sapiens <400> 43

<210> 44 <211> 748 <212> ADN <213> Homo sapiens <400> 44 <210> 45 <211> 187 <212> ADN <213> Homo sapiens <400> 45 <210> 46 <211> 811 <212> ADN <213> Homo sapiens <400> 46

<210> 47 <211> 2076 <212> ADN <213> Homo sapiens <400> 47

<210> 48 <211> 299 <212> ADN <213> Homo sapiens <400> 48 <210> 49 <211> 75 <212> ADN <213> Secuencia Artificial <220>

<223> oliconucleótido con homología al gen de la enfermedad de glosopeda <400> 49 <210> 50 <211> 21 <212> ADN <213> Homo sapiens <400> 50 caagaatccc aaactcacca g 21 <210> 51 <211> 23 <212> ADN <213> Homo sapiens <400> 51 cgttgatatt gctgattaag tcc 23 <210> 52 <211> 24 <212> ADN <213> Homo sapiens <400> 52 atcccagtaa tggttgtcct gcct 24 <210> 53 <211> 24 <212> ADN <213> Homo sapiens <400> 53 tcttgcttag gttggctgcc tagt 24 Reivindicaciones 1. Un receptor antígeno quimérico (CAR) que está codificada por el ADN de la SEQ ID NO: 37.

2. Un linfocito T asilado que expresa el CAR de la reivindicación 1.

3. Un linfocito T que expresa el CAR de la reivindicación 1 para uso en inmunoterapia del cáncer.

4. El linfocito T de la reivindicación 2 para uso en inmunoterapia del cáncer.

5. El linfocito T de la reivindicación 3 o de la reivindicación 4 en donde dicho cáncer es seleccionado del grupo que consiste de glioblastoma, meduloblastoma, cáncer de seno, cáncer de cabeza y cuello, cáncer de riñón, cáncer de ovario, sarcoma de Kaposi, leucemia mielogenosa aguda, y enfermedades malignas de linaje B.