Procedimientos de ensayo para MDV-1.

Un procedimiento de cuantificación de una cepa de vacuna del serotipo 1 del virus de la enfermedad de Marek

(MDV-1) en una muestra de un ave, que comprende las etapas de:

(i) proporcionar una muestra biológica que ha sido obtenida del ave;

(ii) someter la muestra biológica de (i) a PCR cuantitativa (qPCR) en tiempo real, que comprende:

(a) la amplificación de una región del gen pp38 dentro de la muestra de ácido nucleico de (i), conteniendo dicha región una diferencia de polimorfismo de un solo nucleótido (SNP) uniforme entre las cepas de vacuna y virulenta del MDV-1; y siendo dicho SNP un polimorfismo G/A ubicado en la posición 320 de las secuencias de la Figura 1 ((a) y (b)); y

(b) la puesta en contacto del ácido nucleico amplificado de (a) con una sonda de ácido nucleico detectable específica del SNP de la cepa virulenta de MDV-1;

(iii) medir los cambios en la señal detectable producida por la sonda de (ii).

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/GB2010/001602.

Solicitante: Zoetis W LLC.

Nacionalidad solicitante: Estados Unidos de América.

Dirección: 100 Campus Drive Florham Park NJ 07932 ESTADOS UNIDOS DE AMERICA.

Inventor/es: BAIGENT,SUSAN, NAIR,VENUGOPAL, LE GALLUDEC,HERVE.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/70 (en los que intervienen virus o bacteriófagos)

PDF original: ES-2538189_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Procedimientos de ensayo para MDV-1

La presente invención se refiere a procedimientos de ensayo y, en particular, a procedimientos para el análisis de los niveles de cepas de vacuna y los niveles de cepas virulentas de virus, en concreto, del virus de la enfermedad de Marek de serotipo 1 (MDV-1) , en muestras de aves.

Antecedentes El virus de la enfermedad de Marek (MDV) es un herpesvirus que provoca la enfermedad linfoproliferativa en los pollos. Incluso tras la introducción de vacunas contra el MDV, la infección sigue causando considerables pérdidas en la industria avícola. El MDV se divide en tres serotipos, estableciendo todos ellos infecciones latentes. El serotipo 1 incluye virus oncogénicos, el serotipo 2, virus no oncogénicos, y el serotipo 3 incluye los herpesvirus del pavo (HVT) (Bülow y col., (1976) Zentralblatt für Veterinarmedizin, 23B, 391-402) .

Handberg y col., (2001) "Avian Pathology" 30: 243-249 describen el uso de PCR específica del serotipo 1 y serotipo 3 para la detección del MDV en los pollos. Las muestras de tejido se tomaron de sangre (glóbulos de la capa leucocítica) , bazo, hígado, piel, puntas de pluma y ovarios.

La cepa CVI988 (Rispens) , un serotipo 1 del MDV atenuado de manera natural (MDV-1) , se introdujo a mediados de la década de los noventa (Rispens y col., (1972) "Avian Diseases", 16, 108-125; De Boer y col., (1986) "Avian Diseases", 30, 276-283) y, hasta la fecha, es la vacuna más eficaz contra el MDV. Sin embargo, incluso a la luz de los programas de vacunación, los brotes de MDV siguen causando pérdidas significativas. Estos brotes pueden tener varias causas, entre las que se incluyen: la inhibición por los anticuerpos maternos de la replicación del virus de la vacuna (King y col., (1981) "Avian Diseases", 25, 74-81; de Boer y col., (1986) supra) ; la supresión de la respuesta inmunitaria a la vacuna por tensiones ambientales o coinfecciones con patógenos inmunosupresores; la infección con una cepa virulenta de MDV antes del establecimiento de la inmunidad vacunal completa; la infección de aves vacunadas y completamente inmunocompetentes con una cepa de MDV hipervirulenta (Witter y col., (2005) "Avian Pathology", 34, 75-90.) ; y, por último, la administración de dosis de vacuna insuficientes que no producen inmunidad protectora.

Como tal, es importante poder medir con precisión la vacuna contra el MDV y el virus de desafío (virulento) de forma individual, incluyendo la medición de una o ambas variables en el mismo pollo tanto por razones experimentales como comerciales. A nivel experimental, es muy útil poder examinar las interacciones entre la vacuna y el virus de desafío con vistas a comprender mejor el mecanismo de protección vacunal y las diferencias de eficacia entre las vacunas. A nivel comercial, es importante ayudar a identificar las causas de los fallos de la vacuna, tales como la administración de una dosis subóptima de vacuna (Landman y Verschuren, 2003) , la interferencia con la replicación del virus de la vacuna por los anticuerpos maternos (King et al, 1981; de Boer y col., (1986) y la infección con cepas de campo de MDV hipervirulentas (Witter y col., 2005) .

Se ha desarrollado un ensayo de PCR cuantitativa (qPCR) en tiempo real altamente sensible para la cuantificación absoluta del MDV-1 en los tejidos de pollo (Baigent y col., 2005a) , y se ha usado con mucho éxito para investigar la cinética de la replicación del virus de la vacuna CVI988 en los tejidos de polluelos experimentales y comerciales en ausencia de infección por el virus de desafío (Baigent y col., 2005b, 2006) . Sin embargo, este procedimiento no puede distinguir entre CVI988 y el virus de desafío. Otros grupos han desarrollado ensayos de PCR en tiempo real para cuantificar el MDV-2 (Renz y col., 2006) y MDV-3 (herpesvirus de los pavos) (Islam y col., 2006a) . Estos ensayos específicos del serotipo se pueden usar para cuantificar tanto el virus de la vacuna como el virus de desafío virulento en cada pollo, donde el virus de desafío (siempre MDV-1) es de un serotipo diferente al virus de la vacuna (MDV-2 o -3) (Islam y col., 2006b) .

Sin embargo, la vacuna contra el MDV más ampliamente usada y eficaz es una cepa del serotipo 1 atenuada de forma natural (CVI988, Rispens) (Rispens y col., 1972; de Boer y col., 1986) y, hasta la fecha, no ha sido posible la PCR en tiempo real para distinguir el virus de desafío del virus de serotipo 1 de la vacuna, ya que las diferencias de secuencia entre ellos son muy limitadas. Se puede usar una diferencia en el número de repeticiones de la región de repetición de 132 pb para distinguir CVI988 de cepas virulentas usando la PCR convencional (Becker y col., 1992; Silva, 1992) . Sin embargo, la naturaleza repetitiva de esta región impide su uso en la PCR cuantitativa. Las diferencias en el gen meq y el gen ICP4 no son uniformes entre CVI988 y las cepas virulentas. También se ha desarrollado un sistema de qPCR (Baigent, sin publicar) para distinguir entre MDV-1 clonado en BAC (cromosomas artificiales bacterianos) y MDV-1 de tipo silvestre mediante la dirección de la secuencia específica de BAC del MDV1 clonado en BAC y el gen US2 del MDV-1 de tipo silvestre, pudiéndose usar este para distinguir entre cepas de la vacuna clonadas en BAC y cepas virulentas de tipo silvestre, pero solo cuando dichas cepas de vacuna están clonadas en BAC. Cabe señalar que dicho procedimiento no se pudo usar a nivel comercial, dado que no hay vacunas de MDV-1 comerciales clonadas en BAC.

El gen pp38 muestra una diferencia uniforme de un solo nucleótido entre la cepa de la vacuna CVI988 y las cepas virulentas de MDV-1. Sin embargo, resulta difícil diseñar cebadores de qPCR que sean capaces de distinguir dicha pequeña diferencia.

Descripción de la invención La presente invención proporciona procedimientos para cuantificar las cepas de MDV-1 de vacuna y/o virulentas del serotipo 1 del virus de la enfermedad de Marek en aves, basándose en un polimorfismo de un solo nucleótido (SNP) en el gen pp38. Estos procedimientos también incluyen procedimientos de cuantificación de las cantidades relativas y/o absolutas de las cepas de vacuna y virulentas, y la determinación del número de copias de cada cepa.

En un primer aspecto, la invención proporciona un procedimiento de cuantificación de una cepa de vacuna del serotipo 1 del virus de la enfermedad de Marek (MDV-1) en una muestra de un ave, que comprende las etapas de:

(i) proporcionar una muestra biológica que se haya obtenido del ave;

(ii) someter la muestra biológica de (i) a PCR cuantitativa (qPCR) en tiempo real, que comprende:

(a) la amplificación de una región del gen pp38 dentro de la muestra de ácido nucleico de (i) , conteniendo dicha región una diferencia de polimorfismo de un solo nucleótido (SNP) uniforme entre las cepas de vacuna y virulenta del MDV-1; y siendo dicho SNP un polimorfismo G/A ubicado en la posición 320 de las secuencias de la Figura 1 ( (a) y (b) ) ; y

(b) la puesta en contacto del ácido nucleico amplificado de (a) con una sonda de ácido nucleico detectable específica del SNP de la cepa virulenta de MDV-1;

(iii) medir los cambios en la señal detectable producida por la sonda de (ii) .

En un segundo aspecto, la invención proporciona un procedimiento de cuantificación de una cepa virulenta del serotipo 1 del virus de la enfermedad de Marek (MDV-1) en una muestra de un ave, que comprende las etapas de:

(i) proporcionar una muestra biológica que se haya obtenido del ave;

(ii) someter la muestra biológica de (i) a PCR cuantitativa (qPCR) en tiempo real, que comprende:

(a) la amplificación de una región del gen pp38 dentro de la muestra de ácido nucleico de (i) , conteniendo dicha... [Seguir leyendo]

 


Reivindicaciones:

1. Un procedimiento de cuantificación de una cepa de vacuna del serotipo 1 del virus de la enfermedad de Marek (MDV-1) en una muestra de un ave, que comprende las etapas de:

(i) proporcionar una muestra biológica que ha sido obtenida del ave;

(ii) someter la muestra biológica de (i) a PCR cuantitativa (qPCR) en tiempo real, que comprende:

(a) la amplificación de una región del gen pp38 dentro de la muestra de ácido nucleico de (i) , conteniendo dicha región una diferencia de polimorfismo de un solo nucleótido (SNP) uniforme entre las cepas de vacuna y virulenta del MDV-1; y siendo dicho SNP un polimorfismo G/A ubicado en la posición 320 de las secuencias de la Figura 1 ( (a) y (b) ) ; y

(b) la puesta en contacto del ácido nucleico amplificado de (a) con una sonda de ácido nucleico detectable específica del SNP de la cepa virulenta de MDV-1;

(iii) medir los cambios en la señal detectable producida por la sonda de (ii) .

2. Un procedimiento de cuantificación de una cepa virulenta del serotipo 1 del virus de la enfermedad de Marek (MDV-1) en una muestra de un ave, que comprende las etapas de:

(i) proporcionar una muestra biológica que ha sido obtenida del ave;

(ii) someter la muestra biológica de (i) a PCR cuantitativa (qPCR) en tiempo real, que comprende:

(a) la amplificación de una región del gen pp38 dentro de la muestra de ácido nucleico de (i) , conteniendo dicha región una diferencia de polimorfismo de un solo nucleótido (SNP) uniforme entre las cepas de vacuna y virulenta del MDV-1; y siendo dicho SNP un polimorfismo G/A ubicado en la posición 320 de las secuencias de la Figura 1 ( (a) y (b) ) ; y

(b) la puesta en contacto del ácido nucleico amplificado de (a) con una sonda de ácido nucleico detectable específica del SNP de la cepa virulenta de MDV-1;

(iii) medir los cambios en la señal detectable producida por la sonda de (ii) .

3. Un procedimiento de cuantificación de una cepa de vacuna y una cepa virulenta del serotipo 1 del virus de la enfermedad de Marek (MDV-1) en una muestra de un ave, que comprende las etapas de:

(i) proporcionar muestras biológicas que han sido obtenidas del ave;

(ii) someter las muestras biológicas de (i) a PCR cuantitativa (qPCR) en tiempo real, que comprende:

(a) la amplificación de una región del gen pp38 dentro de la muestra de ácido nucleico de (i) , conteniendo dicha región una diferencia de polimorfismo de un solo nucleótido (SNP) uniforme entre las cepas de vacuna y virulenta del MDV-1; y siendo dicho SNP un polimorfismo G/A ubicado en la posición 320 de las secuencias de la Figura 1 ( (a) y (b) ) ; y

(b) la puesta en contacto del ácido nucleico amplificado de (a) con una sonda de ácido nucleico detectable específica del SNP de la cepa de vacuna y una segunda sonda de ácido nucleico específica del SNP de la cepa virulenta de MDV-1;

(iii) medir los cambios en la señal detectable producida por cada sonda de (ii) ; y, opcionalmente, incluir la siguiente etapa posterior a la etapa (iii) ;

(iv) comparar los cambios en la señal detectable medida en (iii) para cada sonda específica.

4. El procedimiento de cualquier reivindicación anterior, en la que el procedimiento incluye opcionalmente la etapa de aislar el ácido nucleico de la muestra biológica de la etapa (i) y someter el ácido nucleico aislado a la qPCR de la etapa (ii) .

5. El procedimiento de cualquier reivindicación anterior, en el que las qPCR de la etapa (ii) comprenden además una qPCR convencional conocida simultánea que utiliza una sonda marcada con una señal detectable distinta para permitir la cuantificación absoluta de las cepas de la vacuna y/o virulentas.

6. El procedimiento de cualquier reivindicación anterior, en el que las sondas son complementarias a una secuencia de pp38 que tiene incorporada la región de hasta 30 pares de bases en torno al SNP.

7. El procedimiento de cualquier reivindicación anterior, en el que las sondas pueden contener dentro de una secuencia más larga o comprender únicamente las siguientes secuencias o un fragmento de las mismas:

sonda específica de la cepa de vacuna: 5' CCCACCGTGACAGCC 3'; sonda específica de la cepa virulenta: 5' CCCACTGTGACAGCC 3'; o una segunda sonda específica de la cepa virulenta: 5' CTCCCACTGTGACAGCC 3.

8. El procedimiento de cualquier reivindicación anterior, en el que la qPCR de la etapa (ii) comprende además el uso

de una sonda de ácido nucleico "total" de la etapa (ii) capaz de detectar las cepas tanto de vacuna como virulentas; en el que la sonda total específica de ambas cepas puede contener opcionalmente dentro de una secuencia más larga o comprender únicamente la siguiente secuencia o un fragmento de la misma.

5' GCTACCGCCTGAGCC 3'.

9. El procedimiento de cualquier reivindicación anterior, en el que las sondas usadas son sondas fluorogénicas homomarcadas que comprenden dos colorantes indicadores idénticos que son capaces de inactivarse entre sí y volverse a activar una vez que la sonda se ha escindido.

10. El procedimiento de cualquier reivindicación anterior, en el que los cebadores usados en la amplificación de la muestra de ácido nucleico pueden contener dentro de una secuencia más larga o comprender únicamente las siguientes secuencias o un fragmento de las mismas:

Cebador directo: 5' GAGCTAACCGGAGAGGGAGA 3' Cebador inverso: 5' CGCATACCGACTTTCGTCAA 3'.

11. El procedimiento de cualquier reivindicación anterior, en el que la cepa de MDV virulenta es seleccionada entre RB1 B MDV, 584A MDV, 595 MDV, 684A MDV, Md5 MDV, HPRS-B14 MDV, JM102 MDV, 660A MDV, 675A MDV, 549 MDV, 571 MDV o C12-130 MDV.

12. El procedimiento de cualquier reivindicación anterior, en el que la muestra de ácido nucleico proporcionada se obtiene de los siguientes tejidos: sangre, bazo, hígado, piel, ovarios, bursa, timo, riñón y puntas de pluma.

13. El procedimiento de cualquier reivindicación anterior, en el que la señal detectable comprende un agente fluorescente tal como un colorante fluorescente o un cromóforo, y es opcionalmente un colorante seleccionado entre MAR, JUP, NEP, SAT, URA.

14. Uso del procedimiento de cualquier reivindicación anterior en el diagnóstico de la infección con MDV-1 virulento en aves.

15. Uso del procedimiento de cualquier reivindicación anterior como herramienta de investigación en el desarrollo y/o ensayo de vacunas contra MDV-1.

16. Un kit de piezas que comprende:

(i) cebadores que amplificarán una región del gen pp38 que porta un polimorfismo de un solo nucleótido (SNP) uniforme entre la cepa de vacuna y la cepa virulenta de MDV-1, siendo dicho SNP un polimorfismo G/A ubicado en la posición 320 de las secuencias de la Figura 1 ( (a) y (b) ; y

(ii) una sonda de ácido nucleico marcada para el polimorfismo de pp38 específico de bien (1) la cepa de vacuna de MDV-1 o (2) las cepas virulentas de MDV-1.

17. Un kit de piezas que comprende:

(i) cebadores que amplificarán una región del gen pp38 que porta un polimorfismo de un solo nucleótido (SNP) uniforme entre la cepa de vacuna y la cepa virulenta de MDV-1, siendo dicho SNP un polimorfismo G/A ubicado en la posición 320 de las secuencias de la Figura 1 ( (a) y (b) ;

(ii) una sonda de ácido nucleico marcada para el polimorfismo de pp38 específico de la cepa de vacuna; y

(iii) una sonda de ácido nucleico marcada para el polimorfismo de pp38 específico de cepas virulentas de MDV-1.

18. El kit de las reivindicaciones 16-17, en el que el kit comprende además reactivos de qPCR convencionales.

19. El kit de las reivindicaciones 16-18, que comprende además reactivos necesarios para una qPCR convencional conocida que utiliza una sonda marcada con una señal detectable distinta.

20. El kit de las reivindicaciones 16-19, en el que la cepa de vacuna es la vacuna CVI988.

21. El kit de las reivindicaciones 16-20, en el que la/s sonda/s de ácido nucleico puede (n) contener dentro de una secuencia más larga o comprender únicamente las siguientes secuencias o un fragmento de las mismas:

sonda específica de la cepa de vacuna: 5' CCCACCGTGACAGCC 3'; y/o sonda específica de la cepa virulenta: 5' CCCACTGTGACAGCC 3'.

22. El kit de las reivindicaciones 16-21, en el que el kit comprende además una sonda total que se une tanto a las cepas de vacuna como a las cepas virulentas.

23. El kit de la reivindicación 22, en el que la sonda total puede contener dentro de una secuencia más larga o comprender únicamente la siguiente secuencia o un fragmento de la misma:

5' GCTACCGCCTGAGCC 3'.

Figura 9 (b)