Diferenciación de células no productoras de insulina en células productoras de insulina mediante GLP-1 o exendina-4 y utilizaciones de las mismas.

Procedimiento de diferenciación de células no productoras de insulina, que expresan IDX-1

, que portan receptores de GLP-1, en células productoras de insulina, que comprende poner en contacto las células no productoras de insulina in vitro con un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, polipéptidos que incluyen uno o más aminoácidos adicionales o sustituciones en posiciones distintas de las posiciones 7, 10, 12, 13 y 15 en la secuencia de aminoácidos de GLP-1 sin una pérdida apreciable de actividad funcional en comparación con GLP-1 en cuanto a la capacidad para diferenciar las células productoras de insulina de las células no productoras de insulina, que expresan IDX-1, que portan receptores de GLP-1, o fragmentos de GLP-1 que presentan la secuencia de aminoácidos de una de entre las SEC ID nos: 1 a 8, en el que las células no productoras de insulina son puestas en contacto con el factor de crecimiento durante por lo menos veinticuatro horas.

Tipo: Patente Europea. Resumen de patente/invención. Número de Solicitud: E08019260.

Solicitante: THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES .

Inventor/es: GREIG, NIGEL, EGAN,JOSEPHINE, PERFETTI,RICCARDO, HOLLOWAY,HAROLD, PASSANITI,ANTONIO.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > ACTIVIDAD TERAPEUTICA ESPECIFICA DE COMPUESTOS QUIMICOS... > Medicamentos para el tratamiento de trastornos del... > A61P5/50 (para aumentar o potenciar la actividad de la insulina)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen péptidos... > A61K38/22 (Hormonas (derivados de pro-opiomelanocortina, pro-encefalina o pro-dinorfina A61K 38/33, p. ej. corticotropina A61K 38/35))
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/575 (Hormonas)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/605 (Glucagones)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen péptidos... > A61K38/26 (Glucagón)
google+ twitter facebookPin it
Ilustración 1 de Diferenciación de células no productoras de insulina en células productoras de insulina mediante GLP-1 o exendina-4 y utilizaciones de las mismas.
Ilustración 2 de Diferenciación de células no productoras de insulina en células productoras de insulina mediante GLP-1 o exendina-4 y utilizaciones de las mismas.
Ilustración 3 de Diferenciación de células no productoras de insulina en células productoras de insulina mediante GLP-1 o exendina-4 y utilizaciones de las mismas.
Ilustración 4 de Diferenciación de células no productoras de insulina en células productoras de insulina mediante GLP-1 o exendina-4 y utilizaciones de las mismas.
Ver la galería de la patente con 30 ilustraciones.
Diferenciación de células no productoras de insulina en células productoras de insulina mediante GLP-1 o exendina-4 y utilizaciones de las mismas.

Texto extraído del PDF original:

DESCRIPCIÓN

Diferenciación de células no productoras de insulina en células productoras de insulina mediante GLP-1 o exendina- 4 y utilizaciones de las mismas El gobierno presenta determinados derechos respecto a la presente invención Antecedentes de la invención

Campo de la invención La presente invención describe una población de células productoras de insulina diferenciadas a partir de células no productoras de insulina poniendo en contacto las células no productoras de insulina con el péptido similar a glucagón 1 ("GLP-1"), péptidos relacionados. La presente invención se refiere asimismo a los procedimientos para obtener las células productoras de insulina y a las utilizaciones terapéuticas en el tratamiento de la diabetes mellitus como se define en las reivindicaciones. se refiere a un procedimiento de diferenciación de células no productoras de insulina, que expresan IDX-1, que portan receptores de GLP-1, en células productoras de insulina, y a un procedimiento de estimulación de células productoras de amilasa pancreáticas para que produzcan tanto insulina como amilasa mediante exendina-4 y polipéptidos relacionados y fragmentos de los mismos. La presente invención se refiere además a la utilización de exendina-4 y polipéptidos relacionados y fragmentos de los mismos para la preparación de un medicamento para tratar la diabetes en un sujeto.

Antecedentes de la técnica El páncreas de los mamíferos está compuesto por dos tipos distintos de tejido glandular, las células exocrinas que secretan enzimas digestivas al intestino y las células endocrinas que secretan hormonas a la corriente sanguínea. Tradicionalmente se creía que las células endocrinas se desarrollaban a partir de la cresta neural mientras que se creía que las células exocrinas se desarrollaban a partir del endodermo. Un trabajo más reciente sugiere que estos dos tipos de células pueden provenir de células precursoras endodérmicas comunes situadas a los largo del revestimiento epitelial de los conductos (Teitelman, 1996). Debe observarse que las células endocrinas son de diferenciación terminal y no se dividen para formar nuevas células endocrinas. Se cree que las células precursoras endodérmicas pancreáticas son las únicas células que producen nuevas células endocrinas pancreáticas.

El páncreas consiste en conductos, que transportan las enzimas exocrinas (amilasa y lipasa) al intestino; células acinares, que producen las enzimas exocrinas; e islotes de Langerhans, que contienen las células endocrinas que producen y secretan insulina, amilina y glucagón. Estas hormonas ayudan a mantener niveles de glucosa en sangre normales dentro de un intervalo notablemente estrecho.

Entre las células de islotes están las células beta que producen y secretan insulina. La producción y secreción de insulina por las células beta se controla mediante los niveles de glucosa en sangre. La liberación de insulina aumenta a medida que aumentan los niveles de glucosa en sangre. La insulina estimula la captación de glucosa por los tejidos diana y, por tanto, previene la hiperglucemia trasladando la glucosa a los tejidos para su almacenamiento.

La disfunción de células beta y la concomitante disminución en la producción de insulina pueden dar como resultado diabetes mellitus. En la diabetes tipo 1, el sistema inmunitario destruye completamente las células beta, dando como resultado una ausencia de células productoras de insulina (Physician’s Guide to Insulin Dependent [Type I] Diabetes Mellitus: Diagnosis and Treatment, Asociación Americana de la Diabetes, 1988). En la diabetes tipo 2, las células beta se vuelven progresivamente menos eficaces a medida que los tejidos diana se vuelven resistentes a los efectos de la insulina sobre la captación de glucosa. La diabetes tipo 2 es una enfermedad progresiva y la función de las células beta continúa deteriorándose a pesar del tratamiento en curso con cualquier agente disponible actualmente (Grupo de estudio prospectivo en el Reino Unido, 1995). Por tanto, las células beta están ausentes en las personas con diabetes tipo 1 y están funcionalmente alteradas en las personas con diabetes tipo 2.

Actualmente, se trata la disfunción de células beta de varias maneras diferentes. En el tratamiento de la diabetes tipo 1 o los estadios tardíos de la diabetes tipo 2, se utiliza la terapia de reemplazo de insulina. La terapia con insulina, aunque salva la vida, no restablece la normoglucemia, incluso cuando se utilizan infusiones continuas o inyecciones múltiples en regímenes complejos. Por ejemplo, los niveles posprandiales de glucosa continúan siendo excesivamente altos en individuos en terapia de reemplazo de insulina. Por tanto, la terapia con insulina debe administrarse mediante múltiples inyecciones diarias o infusión continua y los efectos deben monitorizarse cuidadosamente para evitar hiperglucemia, hipoglucemia, acidosis metabólica y cetosis. El reemplazo de las células beta puede conseguirse con trasplantes de páncreas. (Scharp et al., 1991; Warnock et

al., 1991). Dichos trasplantes, sin embargo, requieren encontrar un donante compatible, procedimientos quirúrgicos para implantar el tejido obtenido y la aceptación del injerto. Tras el trasplante en una persona con diabetes tipo 1, se requiere terapia inmunosupresora continua porque se reconocen y atacan a los antígenos de superficie celular de las células beta mediante los mismos procesos que destruyeron las células beta originariamente. Los fármacos inmunosupresores, tales como ciclosporina A, sin embargo, presentan numerosos efectos secundarios, incluyendo el aumento en el potencial para la infección. Por tanto, el trasplante puede dar como resultado numerosas complicaciones. Las personas con diabetes tipo 2 generalmente se tratan con fármacos que estimulan la producción y secreción de insulina desde las células beta. Una desventaja principal de estos fármacos, sin embargo, es que se estimula la producción y secreción de insulina independientemente del nivel de glucosa en sangre. Por tanto, la ingesta de alimentos debe equilibrarse con la estimulación de la producción y secreción de insulina para evitar hipoglucemia o hiperglucemia. En los últimos años, varios agentes nuevos han pasado a estar disponibles para tratar la diabetes tipo 2. Éstos incluyen metformina, acarbosa y troglitazona (véase Bressler y Johnson, 1997). Sin embargo, la disminución en hemoglobina A1c obtenida con estos agentes más nuevos es menor que la adecuada (Ghazzi et al., 1997), sugiriendo que no mejorarán el control a largo plazo de la diabetes mellitus. Más recientemente, el péptido similar al glucagón tipo 1 (GLP-1), una hormona secretada normalmente por las células neuroendocrinas del intestino en respuesta a los alimentos, se ha sugerido como un nuevo tratamiento para la diabetes tipo 2 (Gutniak et al., 1992; Nauck et al., J. Clin. Invest., 1993). Éste aumenta la liberación de insulina por las células beta incluso en sujetos con diabetes tipo 2 de larga duración (Nauck et al., Diabetologia, 1993). El tratamiento con GLP-1 presenta una ventaja con respecto a la terapia con insulina porque el GLP-1 estimula la secreción de insulina endógena, que se detiene cuando los niveles de glucosa en sangre disminuyen (Nauck et al., Diabetologia, 1993; Elahi et al., 1994). Cuando los niveles de glucosa en sangre son altos, el GLP-1 estimula la euglucemia mediante el aumento de la liberación y síntesis de insulina, la inhibición de la liberación de glucagón y la disminución del vaciado gástrico (Nauck et al., Diabetologia, 1993; Elahi et al., 1994; Wills et al., 1996; Nathan et al., 1992; De Ore et al., 1997). El GLP-1 también induce un aumento en los niveles de ARN mensajero de hexocinasa (Wang et al., Endocrinology 1995; Wang et al., 1996). Se sabe que el GLP-1 presenta un potente efecto de secreción de insulina sobre las células beta (Thorens y Waeber, 1993; Orskov, 1992) y aumenta la biosíntesis de insulina y la expresión génica de proinsulina cuando se añade a líneas celulares secretoras de insulina durante 24 horas (Drucker et al., 1987; Fehmann y Habener, 1992). En estudios utilizando células RIN 1046-38, el tratamiento de veinticuatro horas con GLP- aumentó la receptividad a la glucosa incluso después de que se hubiera eliminado el GLP-1 durante una hora y después de varias lavados de las células (Montrose-Rafizadeh et al., 1994). Por tanto, el GLP-1 es un agente liberador de insulina y un agente insulinotrópico (es decir un agente que aumenta la síntesis de insulina) conocido por presentar un efecto prolongado sobre las células beta. El GLP-1 es un producto de la modificación postraduccional del proglucagón. Se conocen en la técnica las secuencias de GLP-1 y sus fragmentos activos GLP-1 (7-37) y GLP-1(7-36) amida (Fehmann et al., 1995). Se ha demostrado que los receptores de GLP-1 están presentes en el intestino y en los islotes pancreáticos (Id.).

Los receptores pertenecen a una familia de receptores asociados a proteína G que incluye receptores de glucagón, de secretina y de péptidos intestinales vasoactivos. Tras la unión de GLP-1 a su receptor hay un aumento en AMPc en las células beta de los islotes de Langerhans (Widmann et al., 1996), indicando que el receptor se acopla al sistema de adenilciclasa mediante una proteína G estimulante. En tejidos periféricos, tales como el hígado, tejido adiposo y músculo esquelético, sin embargo, no se observa aumento en AMPc con GLP-1, sugiriendo que el GLP-1 actúa a través de un sistema diferente en los tejidos periféricos (Valverde y Villanueva-Penacarrillo, 1996). La exendina-4 es un péptido que se produce en las glándulas salivales del lagarto, monstruo de Gila (Goke et al., 1993). Se conoce en la técnica la secuencia de aminoácidos para exendina-4 (Fehmann et al., 1995). Aunque es el producto de un gen excepcionalmente no de mamífero y parece que se expresa solamente en la glándula salival (Chen y Drucker, 1997), la exendina-4 comparte una homología de secuencia de aminoácidos del 52% con GLP-1 y en mamíferos interacciona con el receptor de GLP-1 (Goke et al., 1993; Thorens et al., 1993;). In vitro, se ha demostrado que la exendina-4 estimula la secreción de insulina mediante células productoras de insulina y, administrada en cantidades equimolares, es más potente que el GLP-1 en provocar la liberación de insulina desde las células productoras de insulina.

Los estudios in vivo utilizando GLP-1 se han limitado a la utilización de inyecciones en bolo únicas o repetidas o infusiones a corto plazo de GLP-1 y la posterior evaluación de los efectos de secreción de insulina. En un estudio de este tipo, se sometieron a prueba infusiones de GLP-1 durante dos horas en pacientes con diabetes tipo 1 para evaluar la capacidad del GLP-1 para estimular la captación de glucosa en el músculo y la liberación de glucosa desde el hígado (Gutniak et al., 1992). Se han considerado las utilizaciones terapéuticas de GLP-1 para aumentar la liberación de insulina para la diabetes tipo 2, pero no para la diabetes tipo 1, dado que la diabetes tipo 1 se caracteriza por ausencia de células beta, la célula diana conocida para el GLP-1. Además, el GLP-1 presenta limitaciones conocidas como agente terapéutico en el tratamiento de la diabetes porque presenta una semivida biológica corta (De Ore et al., 1997), incluso cuando se administra mediante un bolo por vía subcutánea (Ritzel et al., 1995). No se ha utilizado anteriormente exendina-4 en estudios in vivo. Por tanto, los estudios hasta la fecha nunca han sugerido que o bien el GLP-1 o bien la exendina-4 es terapéuticamente eficaz sobre la función pancreática en personas con diabetes tipo 1 o que existen células diana para GLP-1 o exendina-4 en el páncreas distintas de las células beta. Sumario de la invención

Un objetivo de la presente invención es superar o reducir los problemas planteados anteriormente con la técnica anterior proporcionando un procedimiento que comprende poner en contacto unas células no productoras de insulina con un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas a GLP-1, y sus fragmentos. Además, se proporciona un procedimiento de diferenciación de células no productoras de insulina en células productoras de insulina, que comprende poner en contacto las células no productoras de insulina con un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas a GLP-1, y sus fragmentos. Se proporciona además un procedimiento para enriquecer una población de células para células productoras de insulina, que comprende poner en contacto la población de células con un factor de crecimiento que promueve la diferenciación de las células no productoras de insulina en células productoras de insulina. Es descrito asimismo un procedimiento para el tratamiento de la diabetes en un sujeto diagnosticado con la diabetes de tipo 1, que comprende administrar al sujeto un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1 de exendina-4, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas a GLP-1 o exendina-4, y sus fragmentos mediante infusión continua durante por lo menos veinticuatro horas. Se describe además un procedimiento para tratar la diabetes en un sujeto, que comprende obtener unas células no productoras de insulina a partir del sujeto que es tratado o de un donante; poner en contacto las células no productoras de insulina con un factor de crecimiento, promoviendo así la diferenciación de las células no productoras de insulina en células productoras de insulina; y administrar las células productoras de insulina que se promovieron para su diferenciación a partir de las células no productoras de insulina al sujeto diabético. La presente invención se refiere particularmente a un factor de crecimiento como se define en las reivindicaciones para la utilización en los procedimientos para tratar la diabetes.

En particular, se describe uno de los (1) a (52) siguientes.

(1) Una población de células productoras de insulina producida mediante un procedimiento que comprende poner en contacto unas células no productoras de insulina con un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas a GLP-1, y sus fragmentos.

(2) La población de (1), en la que las células no productoras de insulina son puestas en contacto con el factor de crecimiento in vitro.

(3) La población de (1), en la que las células no productoras de insulina son puestas en contacto con el factor de crecimiento in vivo.

(4) La población de (1), en la que las células no productoras de insulina comprenden unas células no de islotes.

(5) La población de (1), en la que las células no productoras de insulina comprenden células pancreáticas. (6) La población de (1), en la que las células no productoras de insulina comprenden células acinares pancreáticas.

(7) La población de (1), en la que las células no productoras de insulina comprenden células madre. (8) La población de (1), en la que las células no productoras de insulina comprenden células madre pancreáticas.

(9) La población de (1), en la que las células no productoras de insulina son células de mamífero. (10) La población de (9), en la que las células de mamífero son células humanas.

(11) La población de (1), en la que las células no productoras de insulina son puestas en contacto con el factor de crecimiento durante por lo menos veinticuatro horas.

(12) La población de (1), en la que las células no productoras de insulina son puestas en contacto con el factor de crecimiento durante por lo menos veinticuatro horas.

(13) Procedimiento de diferenciación de las células no productoras de insulina en células productoras de insulina, que comprende poner en contacto las células no productoras de insulina con un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas a GLP-1, y sus fragmentos.

(14) El procedimiento de (13), en el que las células no productoras de insulina son puestas en contacto con el factor de crecimiento durante por lo menos veinticuatro horas.

(15) El procedimiento de (13), en el que las células no productoras de insulina son puestas en contacto con el factor de crecimiento in vitro.

(16) El procedimiento de (13), en el que las células no productoras de insulina son puestas en contacto con el factor de crecimiento in vivo.

(17) Un procedimiento de enriquecimiento de una población de células para células productoras de insulina, que comprende poner en contacto la población de células con un factor de crecimiento que diferencia las células no productoras de insulina en células productoras de insulina.

(18) Un procedimiento para promover células productoras de amilasa pancreática para producir insulina y amilasa, que comprende poner en contacto las células productoras de amilasa pancreática con un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas a GLP-1, y sus fragmentos.

(19) Un procedimiento de tratamiento de la diabetes en un sujeto diagnosticado con la diabetes de tipo 1, que comprende administrar al sujeto un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas a GLP-1, y sus fragmentos mediante infusión continua durante por lo menos veinticuatro horas.

(20) El procedimiento de (19), en el que el factor de crecimiento diferencia las células no productoras de insulina en células productoras de insulina.

(21) Un procedimiento de tratamiento de la diabetes en un sujeto, que comprende (a) obtener unas células no productoras de insulina del sujeto que es tratado; (b) poner en contacto las células no productoras de insulina con un factor de crecimiento, diferenciando así las células no productoras de insulina en células productoras de insulina; y (c) administrar las células productoras de insulina de la etapa (b) al sujeto diabético.

(22) El procedimiento de (21), en el que las células no productoras de insulina son células pancreáticas.

(23) El procedimiento de (21), en el que las células no productoras de insulina son células madre. (24) Un procedimiento de tratamiento de la diabetes en un sujeto, que comprende (a) obtener unas células no productoras de insulina del sujeto que es tratado; (b) poner en contacto las células no productoras de insulina con un factor de crecimiento, diferenciando así las células no productoras de insulina en células productoras de insulina; (c) alterar los antígenos de superficie de las células productoras de insulina de la etapa (b), reduciendo así la probabilidad de que las células productoras de insulina causen una respuesta inmunitaria; y (d) administrar las células con los antígenos de superficie alterados de la etapa (c) al sujeto diabético.

(25) El procedimiento de (24), en el que las células no productoras de insulina son células pancreáticas. (26) El procedimiento de (24), en el que las células no productoras de insulina son células madre. (27) Un procedimiento de tratamiento de la diabetes en un sujeto, que comprende (a) obtener unas células no productoras de insulina de un donante; (b) poner en contacto las células no productoras de insulina con un factor de crecimiento, diferenciando así las células no productoras de insulina en células productoras de insulina; y (c) administrar las células productoras de insulina de la etapa (b) al sujeto diabético.

(28) El procedimiento de (27), en el que el donante es un cadáver.

(29) El procedimiento de (27), en el que las células no productoras de insulina son células pancreáticas. (30) El procedimiento de (27), en el que las células no productoras de insulina son células madre.

(31) Un procedimiento de tratamiento de la diabetes en un sujeto, que comprende (a) obtener unas células no productoras de insulina de un donante; (b) poner en contacto las células no productoras de insulina con un factor de crecimiento, diferenciando así las células no productoras de insulina en células productoras de insulina; (c) alterar los antígenos de superficie de las células productoras de insulina, reduciendo así la probabilidad de que las células productoras de insulina causen una respuesta inmunitaria; y (d) administrar las células con los antígenos de superficie alterados de la etapa (c) al sujeto diabético.

(32) El procedimiento de (31), en el que el donante es un cadáver. (33) El procedimiento de (31), en el que las células no productoras de insulina son células pancreáticas.

(34) El procedimiento de (31), en el que las células no productoras de insulina son células madre.

La figura 2 muestra los niveles de glucosa en plasma durante una prueba de tolerancia a la glucosa en animales de 22 meses de edad. Los animales tratados con GLP-1 recibieron 1,5 pmol/kg/min. durante 48 h mediante infusión subcutánea. Los controles se infundieron con solución salina. Se administró glucosa (1 g/kg) por vía i.p. y se midió la glucosa en sangre en los tiempos indicados. Los resultados son la media (±SEM) de 6 animales tratados y 6 control. El análisis de la varianza con medidas repetidas de 0-30 min. mostró un valor de p<0,05. Los asteriscos indican: *p<0,05, **p<0,01, tal como se determinó mediante la prueba de la t de Student para datos independientes. La figura 3 muestra los niveles de insulina en plasma durante una prueba de tolerancia a la glucosa en animales de 22 meses de edad. Los animales tratados con GLP-1 recibieron 1,5 pmol/kg/min. durante 48 h mediante inyección subcutánea. Los controles se infundieron con solución salina. Se administró glucosa (1 g/kg) por vía i.p. y se midió la insulina sérica en los tiempos indicados. Los resultados son la media (±EEM) de 6 animales tratados y 6 control. El análisis de la varianza con medidas repetidas de 0-30 min. mostró un valor de p<0,05. El asterisco indica un p<0,01, tal como se determinó mediante la prueba de la t de Student para datos independientes.

La figura 4 muestra el aumento en número de veces en el contenido en insulina de los islotes después de 48 h de infusión de solución salina (control, 7 animales) o GLP-1 (1,5 pmol/kg/min., 7 animales) en ratas de 22 meses de edad. **p<0,01 mediante la prueba de la t de Student para datos independientes.

La figura 5 muestra los niveles de ARNm de insulina en páncreas de animales de 22 meses de edad, tratados con GLP-1, Ex+GLP-1, Ex y control. Cada muestra representa un páncreas individual, con cuatro animales en cada grupo de tratamiento. La figura 6 muestra los niveles de ARNm de GLUT2 en páncreas de animales de 22 meses de edad, tratados con GLP-1, Ex+GLP-1, Ex y control. Cada muestra representa un páncreas individual, con cuatro animales en cada grupo de tratamiento. La figura 7 muestra el ARNm de glucocinasa en páncreas de animales de 22 meses de edad, tratados con GLP-1, Ex+GLP-1, Ex y control. Cada muestra representa un páncreas individual, con cuatro animales en cada grupo de tratamiento. La figura 8 muestra las concentraciones de insulina en plasma en ratas anestesiadas en ayunas después de bolos intravenosos (i.v.) de GLP-1 (0,4 nmol/kg) y exendina-4 (0,4 nmol/kg) en 100 µl de NaCl. También se administró por vía i.v. NaCl (100 ∝l) a un grupo control. Se expresan los valores como la media ± EEM (n = 6 por grupo).

La figura 9 muestra las concentraciones de insulina en ratas anestesiadas en ayunas 2 min. después de bolos intravenosos de exendina-4 en las concentraciones mostradas. Se expresan los valores como la media ± EEM (n = 6 por concentración de exendina-4).

La figura 10 muestra los efectos del tratamiento con GLP-1 (1 nM) y exendina-4 (1 nM) durante 1 h sobre los niveles de AMPc intracelular en los islotes de Langerhans. Se facilitan las medias ± EEM de 4 experimentos, cada uno realizado por triplicado. La exendina-4 fue más eficaz que el GLP-1 (p<0,01). Obsérvese que tras lavar algunos de los islotes en tampón después de la hora en presencia de los péptidos y eliminar luego los islotes, aproximadamente 15 min. después habían regresado los niveles de AMPc al nivel inicial.

La figura 11 muestra una fotografía de las jaulas que albergaban a los ratones diabéticos tomada tras nueve semanas de tratamiento con exendina-4 (24 nmol/kg) o NaCl por vía intraperitoneal diariamente, 24 horas después del cambio de lecho anterior. Se albergaron dos ratones diabéticos por jaula. Se cambió el lecho cada 24 horas para los animales diabéticos después de las primeras pocas semanas de tratamiento. La jaula de la derecha contenía los animales tratados con exendina-4 mientras que la jaula de la izquierda contenía los animales tratados con NaCl. La figura 12 muestra los niveles de hemoglobina A1c en los ratones diabéticos y no diabéticos a los que se les administró o bien exendina-4 (24 nmol/kg) o bien solución salina normal por vía intraperitoneal diariamente durante 12-13 semanas. Se expresan los valores como la media ± EEM (n = 9-10 por grupo).

La figura 13 muestra las concentraciones de insulina y glucosa en ayunas en los ratones diabéticos y no diabéticos a los que se les administró o bien exendina-4 (24 nmol/kg) o bien solución salina normal por vía intraperitoneal diariamente durante 12-13 semanas. Se expresan los valores como la media ± EEM (n = 9-10 por grupo). La figura 14 muestra la curva de concentración de CCK - respuesta de liberación de amilasa desde las células AR42J. Las células se trataron con CCK a las concentraciones mostradas durante 50 min. Los valores de amilasa se expresan como un porcentaje de la amilasa liberada en el medio con respecto a la actividad total de amilasa de las células. Los resultados son la media ± EEM de 15 experimentos. La figura 15 muestra los efectos de glucagón (10 nM), GLP-1 (10 nM) e insulina (100 nM) ± CCK (1 nM) sobre la liberación de amilasa desde las células AR42J. Se incubaron las células AR42J inducidas por dexametasona durante 50 min. en presencia de las hormonas. Los valores de amilasa se expresan como un porcentaje de la amilasa liberada al medio con respecto a la actividad de amilasa total de las células. Los resultados son la media ± EEM de 20 experimentos, *p<0,05, **p<0,01, tratamiento frente a sin tratamiento. a=p< 0,01.

La figura 16 muestra el efecto de 50 min. de tratamiento con 8-bromo-AMPc (100 nM) sobre la liberación de amilasa desde las células AR42J. Los valores de amilasa se expresan como un porcentaje de la amilasa liberada al medio con respecto a la actividad de amilasa total de las células. Los resultados son la media ± EEM de 3 experimentos, *p<0,05, tratamiento frente a sin tratamiento.

La figura 17 muestra los efectos de rianodina (RY) y tapsigargina (TG) en presencia o ausencia de CCK sobre la liberación de amilasa desde las células AR42J. Los valores de amilasa se expresan como un porcentaje de la amilasa liberada al medio con respecto a la actividad de amilasa total de las células. Se añadieron RY y TG 30 min. antes de la adición de CCK, que luego se añadió durante 50 min. Los resultados son la media ± EEM de 3 experimentos, **p<0,01.

La figura 18 muestra el transcurso temporal de las acciones de vanadato (1 mM) (∆) y genesteína (300 µM) ( ) sobre la liberación de amilasa mediada por CCK (1 nM) desde las células AR42J. También se muestra la liberación de amilasa desde las células tratadas con CCK (1 nM) ( ) o las células control (sin tratamiento) ( ). Los valores de amilasa se expresan como un porcentaje de la amilasa liberada al medio con respecto a la actividad de amilasa total de las células. Los resultados son la media ± EEM de 4 experimentos, *p<0,05, **p<0,01, tratamiento con vanadato o genesteína más CCK frente a tratamiento con CCK sola. La figura 19 muestra los efectos de CCK sobre la [Ca2+]i libre intracelular en células AR42J individuales. La barra indica el tiempo de exposición a CCK 10 nM en tres células diferentes. La figura 19A muestra la respuesta de [Ca2+]i típica observada en por lo menos el 85% de las células. La figura 19B muestra que la respuesta de [Ca2+]i a CCK se suprime casi completamente después de 60 min. de exposición a rianodina (RY) 10 µM y tapsigargina (TG) 500 nM. La figura 19C muestra que se reduce el aumento transitorio de [Ca2+]i mediante la reducción del Ca2+ extracelular durante la exposición a CCK.

La figura 20 muestra los efectos de GLP-1 sobre los aumentos transitorios de [Ca2+]i y [Ca2+]i inducido por CCK en células AR42J individuales. Se estudió la misma célula en A-C. La figura 20A muestra que la exposición a GLP-1 1 nM indujo aumentos transitorios de [Ca2+]i prolongados, lentos, pequeños en aproximadamente el 50% de las células AR42J. La reducción en la amplitud de la posterior exposición a CCK 10 nM se muestra en la figura 20B. La figura 20C muestra que la amplitud del aumento transitorio de [Ca2+]i se reduce adicionalmente en respuesta a una segunda exposición a CCK aplicada en < 10 min. La figura 21 muestra los efectos de glucagón y 8-bromo-AMPc (8BAMPc) sobre la [Ca2+]i en células AR42J individuales. La figura 21A muestra que el glucagón (10 nM) indujo aumentos transitorios de [Ca2+]i prolongados, pequeños, lentos en aproximadamente el 70% de las células. La figura 21B muestra que en células tratadas con glucagón 10 nM durante 3-10 min., los posteriores aumentos transitorios de [Ca2+]i inducidos por CCK 10 nM mostraron una tasa de aumento lenta así como una fase de relajación prolongada. La figura 21C muestra que las exposiciones breves (1-5 min.) a 8BAMPc 100 nM atenuaban las relajación de los aumentos transitorios de [Ca2+]i inducidos por CCK.

La figura 22 muestra los efectos del tratamiento con GLP-1 (10 nM), glucagón (10 nM) y CCK (1 nM) ± IBMX (100 nM) durante 50 min. sobre los niveles de AMPc intracelulares en células AR42J. Los resultados son la media ± EEM de 3 experimentos, *p< 0,05. La figura 23 muestra la RT-PCR de los receptores de GLP-1 en células AR42J y páncreas de rata. Se amplificó el ADNc durante 30 ciclos utilizando cebadores en los extremos 5’ y 3’ del receptor de GLP-1 pancreático de rata. Se resolvieron los productos de PCR en un gel de agarosa al 1% y se visualizaron utilizando bromuro de etidio. De izquierda a derecha; carril 1, marcador de ADN; carril 2, blanco; carril 3, células AR42J; carril 4, páncreas de rata; carril 5, control de agua. En los carriles 3 y 4, se observa la banda de 928 pb esperada, que corresponde al receptor de GLP-1.

La figura 24 muestra el análisis de inmunotransferencia de tipo Western de la expresión del receptor de GLP-1 en células AR42J (carril 1, 2) y RIN 1046-38 (carril 3, 4). Se solubilizaron las células y se detectaron los receptores de GLP-1 tras la inmunoprecipitación e inmunotransferencia de tipo Western con anticuerpo frente al extremo aminoterminal del receptor de GLP-1. Las posiciones de los marcadores moleculares, en kDa, están a la derecha. Se ha demostrado que las bandas de 65 y 46 kDa corresponden a los receptores de GLP-1 maduros y de núcleo glicosilado, respectivamente (28). La figura 25 muestra la fosforilación de tirosina de proteínas en células AR42J en respuesta a diversos estímulos. Se indica una inmunotransferencia con anticuerpos anti-fosfotirosina representativa de las proteínas celulares totales a partir de células no tratadas (control) y células tratadas durante 5 min. (n = 3). Obsérvese el aumento en la fosforilación de residuos de tirosina con CCK y fluoruro de sodio (NaF) de las bandas de 46, 66, 120 y 190 kDa. El GLP-1 no presentó ningún efecto sobre aquellas proteínas. La insulina provocó un aumento de la fosforilación de la banda de 97 kDa, que corresponde a la subunidad  del receptor de insulina. La figura 26 muestra la inmunocitoquímica de células AR42J. Las células AR42J se fijaron con glutaraldehído y se incubaron con anticuerpo antiinsulina o antiglucagón de Linco a una dilución de 1:300. La figura 26A muestra células AR42J control, anticuerpos antiinsulina. La figura 26B muestra células tratadas con GLP-1 (10 nM) durante 48 horas, anticuerpo antiinsulina. La figura 26C muestra células AR42J tratadas con GLP-1 (10 nM) durante 72 horas, anticuerpo antiinsulina. La figura 26D muestra células de insulinoma RIN 1046-38, anticuerpo antiinsulina. La figura 26E muestra células control, anticuerpo antiglucagón. La figura 26F muestra células tratadas con GLP-1 (10 nM) durante 48 horas, anticuerpo antiglucagón. La figura 27 muestra el efecto del tiempo sobre la inducción de glucagón e insulina por la producción de GLP-1 (10 nM) en células AR42J. Para este experimento, las células se colocaron en los cubreobjetos tal como se describe en la presente memoria, todas en el mismo día. A continuación, se tiñeron con anticuerpo antiinsulina o antiglucagón en los días indicados. A continuación, esto se ha repetido numerosas veces (por lo menos 5 veces) en diferentes días y siempre han estado presentes insulina y glucagón. La figura 28 muestra la expresión de ARNm para insulina y glucagón utilizando RT-PCR. La figura 28A muestra el ARNm para insulina en 187 pb. La figura 28B muestra el ARNm para glucagón en 236 pb. El tratamiento con GLP-1 (1 nM) fue durante 3 días. La figura 29 muestra el efecto de GLP-1 y exendina-4 en presencia o ausencia de un inhibidor de la proteína cinasa C en células AR42J de un experimento representativo, que se repitió 3 veces. La figura 29A es el autorradiograma y la figura 29B representa las lecturas de densitometría (unidades relativas). Las células se sembraron en placa a una densidad de 105/pocillo en placas de 60 mm, se lisaron y entonces los lisados clarificados se inmunoprecipitaron con anticuerpo anti-ERK. Se analizaron los sedimentos inmunitarios para determinar la actividad ERK tal como se describe en la presente memoria. Carril 1, células AR42J control. Carril 2, células AR42J tratadas con GLP-1 (10 nM) durante 3 días. Carril 3, células tratadas con exendina-4 (0,1 nM) durante 3 días. Carril 4, células tratadas con GLP-1 (10 nM) más exendina-4 (0,1 nM) durante 3 días. Carril 5, células tratadas con GLP-1 (10 nM) más exendina- 4 más PKI (300 µM) durante 3 días. Carril 6, células tratadas con exendina-4 (0,1) más PKI (300 µM) durante 3 días. Carril 7, células tratadas con GLP-1 (10 nM) más PKI (300 µM) durante 3 días. Obsérvese que la exendina-4 (0,1 nM) es aproximadamente equivalente al GLP-1 (10 nM). La figura 30 muestra el efecto dosis-respuesta de GLP-1 sobre la liberación de amilasa desde células AR42J tratadas con dexametasona. Tras el tratamiento de 3 días con diferente concentración de GLP-1, se lavaron las células AR42J y se añadió CCK 1 nM. Se incubaron las células durante otros 50 min. y se recogieron las muestras para el ensayo de amilasa. N = 4, media ± EEM. Descripción detallada de la invención

Tal como se utiliza en las reivindicaciones, “un/una” puede significar uno/una o más. Es descrita en la presente memoria una población de células productoras de insulina preparada mediante un procedimiento que comprende poner en contacto unas células no productoras de insulina con un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas al mismo, y sus fragmentos. Las células no productoras de insulina, incluyendo células acinares primarias, líneas celulares acinares (por ejemplo, AR42J) y células madre, que anteriormente no se creía que presentaban receptores de GLP-1 y que anteriormente no se creía que podían producir insulina, pueden responder a GLP-1, factores de crecimiento que presentan secuencias de aminoácidos sustancialmente homólogas entre sí, y fragmentos de los mismos, diferenciándose en células productoras de insulina. El efecto es aumentar el número de células productoras de insulina, un efecto que es deseable en el tratamiento de la diabetes mellitus. Tal como se utiliza en la presente memoria, “células productoras de insulina” incluyen células que sintetizan (es decir, transcriben el gen de insulina, traducen el ARNm de proinsulina y modifican el ARNm de proinsulina en la proteína de insulina), expresan (es decir, manifiestan el rasgo fenotípico transportado por el gen de insulina) o secretan (liberan insulina al espacio extracelular) insulina de manera constitutiva o inducible. Los ejemplos de células productoras de insulina conocidas incluyen las células beta, que están ubicadas en los islotes pancreáticos in vivo. Con el fin de secretar insulina, una célula productora de insulina también debe expresar IDX-1.

Una población de células productoras de insulina puede contener células (por ejemplo, células beta) que producen insulina sin la utilización de los presentes procedimientos y otros tipos celulares. La novedad de los presentes procedimientos y composición no es invalidada por la presencia de células en la población que producen insulina de manera natural (por ejemplo, células beta). Se contempla asimismo que la población de células productoras de insulina pueda contener asimismo células no productoras de insulina.

Por “células no productoras de insulina” quiere decirse cualquier célula que no sintetiza, expresa o secreta de manera natural insulina de manera constitutiva o inducible. Por tanto, la expresión “células no productoras de insulina” tal como se utiliza en la presente memoria excluye las células beta. Los ejemplos de células no productoras de insulina que pueden utilizarse en los procedimientos de la presente invención incluyen células no beta pancreáticas, tales como células productoras de amilasa, células acinares, células de líneas celulares de adenocarcinoma ductal (por ejemplo, CD18, CD11), células Capan-I (véase Busik et al., 1997; Schaffert et al. 1997) y células madre. También pueden utilizarse células no pancreáticas, por ejemplo células madre no pancreáticas y células de otros órganos endocrinos o exocrinos, incluyendo, por ejemplo, células de la hipófisis. Las células no productoras de la insulina pueden ser células de mamífero o, incluso más específicamente, células humanas.

Ejemplos del presente procedimiento que utiliza células acinares pancreáticas, células productoras de amilasa pancreáticas, células no de islotes pancreáticas de mamífero y células madre se proporcionan en la presente memoria. Las células madre pueden incluir células madre pancreáticas y células madre no pancreáticas que se han promovido para producir IDX-1, Beta 2/NeuroD, y E47. Las células madre pancreáticas incluyen células precursoras epiteliales de conducto que originan células de islotes y acinares.

Las células no productoras de insulina deben presentar receptores de GLP-1 o receptores sustancialmente similares a los receptores de GLP-1 con el fin de diferenciarse en células productoras de insulina. Preferentemente, las células no productoras de insulina también pueden mostrar, tras entrar en contacto con el factor de crecimiento, un aumento en el calcio intracelular y la actividad ERK/MAPK y la activación de PKC.

Tal como se utiliza en la presente solicitud, “factor de crecimiento” significa una sustancia que puede diferenciar una célula no productora de insulina en una célula productora de insulina como se define en las reivindicaciones. Preferentemente el factor de crecimiento será uno de entre un grupo de factores de crecimiento insulinotrópicos, que incluye, por ejemplo. el GLP-1. Se describen asimismo en la presente memoria exendina-4, betacelulina, factor de dispersión de hepatocitos (HSF) y activina-A, o una combinación de los mismos, que excluye la betacelulina y la activina-A utilizadas conjuntamente y que excluye el HSF y la activina-A utilizados conjuntamente como ejemplos comparativos. Preferentemente, más del 10% de las células no productoras de insulina se diferenciarán en células productoras de insulina tras entrar en contacto con el factor de crecimiento; y, más preferentemente, por lo menos aproximadamente el 20%, 30%, 40%, 50% o más se diferenciarán en células productoras de insulina tras entrar en contacto con el factor de crecimiento. Por tanto, una población de células productoras de insulina preparadas in vitro según el presente procedimiento puede comprender tan sólo el 11% y hasta el 100% de células productoras de insulina. Mediante "secuencias de aminoácidos sustancialmente homólogas" a GLP-1 se hace referencia a los polipéptidos que incluyen uno o más aminoácidos adicionales, o sustituciones en las posiciones distintas de las posiciones 7, 10, 12, 13 y 15 en la secuencia de aminoácidos de GLP-1 sin una pérdida apreciable de actividad funcional en comparación con GLP-1 en cuanto a la capacidad para diferenciar las células productoras de insulina a partir de células no productoras de insulina.

Por tanto, se entiende que, si se desea, pueden hacerse modificaciones y cambios en la secuencia de aminoácidos de GLP-1, y todavía se obtiene una proteína que presenta características similares. Por tanto, se contempla que puedan hacerse diversos cambios en la secuencia de aminoácidos de la secuencia de aminoácidos de GLP-1 (o secuencia de ácido nucleico subyacente) sin pérdida apreciable de actividad o utilidad biológica y posiblemente con un aumento en tal actividad o utilidad.

El término "fragmentos", tal como se utiliza en la presente memoria refiriéndose al GLP-1, o a factores de crecimiento hace referencia a un polipéptido que presenta unas secuencias de aminoácidos de una de las SEC ID nº 1 a 8.

Se conocen otros fragmentos y secuencias modificadas de GLP-1 en la técnica (patente US n.º 5.614.492; patente US n.º 5.545.618; solicitud de patente europea, publicación nº EP 0 658 568 A1; documento WO 93/25579). Pueden extrapolarse fácilmente fragmentos similares y secuencias modificadas de exendina-4. Se espera que los residuos siguientes en GLP-1 (número de residuo en superíndice) y exendina-4 (número de residuo entre paréntesis y superíndice) deberían estar incluidos en un fragmento puesto que estos residuos están altamente conservados y son importantes para la unión al receptor: H7(1), G10(4), F12(6), T13(7), D15(9). Por tanto, los fragmentos adicionales o las secuencias modificadas pueden hacer fácilmente que se alteren los aminoácidos de GLP-1 y exendina-4, aparte de estos 5. La presente invención describe una población de células secretoras de insulina realizada mediante los procedimientos descritos en la presente memoria. Dado que se requiere la expresión de IDX-1 para la secreción de insulina a partir de una célula, las células no productoras de insulina que pueden utilizarse para hacer células secretoras de insulina deben incluir células que expresen IDX-1 de manera constitutiva o tras la simulación con un factor de crecimiento o transfectando la célula con un ácido nucleico que codifica para IDX-1 antes del, durante el o después del tratamiento de las células no productoras de insulina con el factor de crecimiento.

La presente invención proporciona asimismo un factor de crecimiento que puede diferenciar las células productoras de insulina a partir de las células no productoras de insulina. Dichos factores de crecimiento incluyen GLP-1, o factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas al mismo, y sus fragmentos. La diferenciación puede producirse in vivo o in vitro tras el contacto de la célula no productora de insulina con el factor de crecimiento. El contacto podría ser una vez mediante bolo, una vez mediante infusión continua, o en repetidas ocasiones mediante bolo o infusión continua. La presente invención describe asimismo un procedimiento de cribado de los factores de crecimiento que diferencian un célula productora de insulina a partir de una célula no productora de insulina. Más específicamente, el procedimiento de cribado implica las etapas de (1) poner en contacto el factor de crecimiento que debe ser cribado con una célula no productora de insulina, (2) evaluar la célula no productora de insulina respecto a las características de las células productoras de insulina, y (3) identificar los factores de crecimiento que diferencian las células productoras de insulina a partir de las células no productoras de insulina. Las características preferidas de las células productoras de insulina incluyen la capacidad para transcribir el gen de insulina, la capacidad para traducir el ARNm de insulina, la capacidad para liberar o secretar insulina, la capacidad para almacenar insulina, la capacidad para percibir los niveles de glucosa, y la capacidad para liberar insulina de una manera regulada. Puesto que se cree que la expresión de los factores de transcripción IDX-1, Beta 2/Neuro D y E47 es necesaria para la producción de insulina, estos factores también se expresarán normalmente en la células productoras de insulina de la invención.

Por “entrar en contacto” se entiende un caso de exposición de la superficie extracelular de una célula a una sustancia en niveles fisiológicamente eficaces. Una célula puede entrar en contacto con un factor de crecimiento, por ejemplo, añadiendo el factor de crecimiento al medio de cultivo (por infusión continua, por suministro en bolo o cambiando el medio a un medio que contiene el factor de crecimiento) o añadiendo el factor de crecimiento al fluido intracelular in vivo (por suministro local, suministro sistémico, inyección intravenosa, suministro en bolo o infusión continua). La duración del “contacto” con una célula o un grupo de células se determina por el tiempo en que la sustancia, en este caso un factor de crecimiento, está presente a niveles fisiológicamente eficaces en el medio o fluido extracelular que baña la célula. El GLP-1 presenta una semivida corta de varios minutos, mientras que la semivida de la exendina-4 es sustancialmente mayor, del orden de horas. Por tanto, un bolo de GLP-1 puede estar en contacto con la célula durante minutos, y un bolo de exendina-4 puede estar en contacto con la célula durante horas. La etapa de poner en contacto en los procedimientos de la presente invención puede tener lugar in vitro. Por ejemplo, en un protocolo de trasplante pueden emplearse procedimientos ex vivo de tal manera que las células no productoras de insulina se extraen de un donante (por ejemplo, el individuo que está siendo tratado) y se mantienen fuera del organismo según los protocolos convencionales bien conocidos en la técnica (véase Gromada et al., 1998). Mientras se mantienen fuera del organismo, las células podrían ponerse en contacto con el factor de crecimiento y posteriormente infundir las células (por ejemplo, en un vehículo aceptable) o trasplantarse utilizando procedimientos bien conocidos en la técnica al sujeto donante o un sujeto diferente del sujeto donante.

Alternativamente, la etapa de poner en contacto de la presente invención puede tener lugar in vivo. Los procedimientos para administrar GLP-1, o los factores de crecimiento relacionados, son proporcionados en la presente memoria. El GLP-1, o los factores de crecimiento relacionados, son administrados sistémicamente, incluyendo, por ejemplo, por una bomba, por una línea intravenosa o por inyección en bolo (Gutniak et al., 1992; solicitud de patente europea, publicación n.º 06193222 A2; patente US n.º 5.614.492; patente US n.º 5.545.618). La inyección en bolo puede incluir vías subcutánea, intramuscular o intraperitoneal. Las células no productoras de insulina empiezan a diferenciarse en células productoras de insulina después de aproximadamente veinticuatro horas de ponerse en contacto con GLP-1, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas al mismo, o sus fragmentos. El número máximo de células que se diferencian en células productoras de insulina normalmente lo han hecho después de siete días de contacto. De un modo interesante, las nuevas células productoras de insulina continúan mostrando la capacidad de producir insulina incluso después de interrumpir el contacto con GLP-1, sus fragmentos o los factores de crecimiento relacionados. Las nuevas células productoras de insulina muestran la capacidad de producir insulina durante por lo menos hasta 2 semanas después de interrumpir el contacto.

Por tanto, la etapa de poner en contacto será normalmente de por lo menos veinticuatro horas. Por “por lo menos veinticuatro horas” quiere decirse veinticuatro horas o más. Específicamente, las células no productoras de insulina pueden ponerse en contacto con el factor de crecimiento durante 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 horas hasta 3, 4, 5, 6, 7 o más días o cualquier tiempo transcurrido particular en horas o minutos dentro del intervalo anterior.

Preferentemente, las células no productoras de insulina se pondrán en contacto con el factor de crecimiento durante siete días. Las dosificaciones del GLP-1, sus fragmentos activos o factores de crecimiento relacionados que se deben utilizar en los procedimientos in vivo o in vitro y los procesos de la invención preferentemente oscilan desde aproximadamente 1 pmol/kg/minuto hasta aproximadamente 100 nmoles/kg/minuto para la administración continua y desde aproximadamente 1 nmol/kg hasta aproximadamente 40 nmoles/kg para la inyección en bolo. Preferentemente, la dosificación de GLP-1 en los procedimientos in vitro será de 10 pmoles/kg/min. a aproximadamente 100 nmoles/kg/min., y en los procedimientos in vivo desde aproximadamente 0,003 nmoles/kg/min. hasta aproximadamente 48 nmoles/kg/min. Más preferentemente, la dosificación de GLP-1 en procedimientos in vitro oscila de aproximadamente 100 picomoles/kg/minuto a aproximadamente 10 nanomoles/kg/minuto, y en los procedimientos in vivo desde aproximadamente 0,03 nanomoles/kg/minuto hasta aproximadamente 4,8 nanomoles/kg/minuto. La dosificación preferida de exendina-4 como comparativa en procedimientos in vitro es de 1 pmol/kg/min. a aproximadamente 10 nmoles/kg/min., y en in vivo desde aproximadamente 1 pmol/kg hasta aproximadamente 400 pmoles/kg para una inyección en bolo. Una dosificación más preferida de exendina-4 en procedimientos in vitro oscila desde aproximadamente 10 pmoles/kg/minuto hasta aproximadamente 1 nmol/kg/minuto, y en in vivo desde aproximadamente 10 pmoles/kg hasta aproximadamente 40 pmoles/kg para una inyección en bolo. Se proporciona un procedimiento de diferenciación de células no productoras de insulina que comprende poner en contacto las células no productoras de insulina con un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas al mismo, y sus fragmentos. Por “diferenciación de células no productoras de insulina en células productoras de insulina” quiere decirse un cambio en las características fenotípicas de las células no productoras de insulina de tal manera que las células afectadas presentan por lo menos la característica fenotípica de producir insulina. La célula afectada puede presentar todas las características fenotípicas de una célula beta o puede presentar menos que todas las características fenotípicas de una célula beta. La célula afectada puede producir insulina pero mantener por lo demás las características fenotípicas de la célula no productora de insulina. Por ejemplo, una célula no productora de insulina, tal como una célula productora de amilasa pancreática (es decir, célula acinar pancreática), que se pone en contacto con GLP-1 puede continuar expresando amilasa, típico de una célula productora de amilasa, pero, a diferencia de la típica célula productora de amilasa, también produce insulina. Por tanto, es posible una continuidad entre el cambio fenotípico completo y el cambio fenotípico individual. Los ejemplos muestran el sorprendente resultado de que la capacidad de producir insulina puede conferirse a células no secretoras de insulina maduras (por ejemplo, células acinares). Un aumento en la proliferación de células no productoras de insulina puede preceder la diferenciación de células no productoras de insulina en células productoras de insulina, y “diferenciación” no pretende excluir ninguna proliferación que acompañe el cambio de la célula a un fenotipo productor de insulina. Debido a la importancia de IDX-1, Beta 2/NeuroD y E27 en la secreción de insulina, la presente invención proporciona asimismo un procedimiento de diferenciación de células no productoras de insulina en células productoras de insulina que incluye la etapa adicional de transfectar células no productoras de insulina con un ácido nucleico o ácidos nucleicos que codifican para IDX-1, Beta 2/NeuroD y/o E27 antes de poner en contacto la célula no productora de insulina con GLP-1, o un factor de crecimiento similar. Alternativamente, una etapa adicional puede comprender transfectar una célula ya puesta en contacto con GLP-1, o un factor de crecimiento similar con un ácido nucleico o ácidos nucleicos que codifican para IDX-1, Beta 2/NeuroD y/o E27. Si la célula puesta en contacto está in

vivo, puede lograrse la transfección mediante perfusión retrógrada del ADN de plásmido para IDX-1 en el conducto de secreción del páncreas (véase Goldfine et al., 1997). Adicionalmente, en algunos casos, la expresión de IDX-1, Beta 2/NeuroD y E47 puede resultar de la aplicación de ciertas proteínas a células que no expresan IDX-1, incluyendo por ejemplo las células madre.

La presente invención describe asimismo un procedimiento de enriquecimiento de una población de células para las células productoras de insulina, que comprende poner en contacto la población de células con un factor de crecimiento que estimula la diferenciación de las células no productoras de insulina en células productoras de insulina. La población de células producida mediante este procedimiento se expande en el número de células productoras de insulina y puede utilizarse en los procedimientos de tratamiento descritos en la presente memoria.

La presente invención describe además un procedimiento de estimulación de células productoras de amilasa pancreáticas para que produzcan tanto insulina como amilasa, que comprende poner en contacto las células productoras de amilasa pancreáticas con un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1 o exendina-4, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas a los mismos, y sus fragmentos. Se proporciona un ejemplo de este procedimiento en los ejemplos.

La presente invención describe además un procedimiento de tratamiento de la diabetes en un sujeto al que se le ha diagnosticado diabetes tipo 1, que comprende administrar al sujeto el factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas al mismo, y sus fragmentos mediante infusión continua durante por lo menos veinticuatro horas. Los procedimientos de tratamiento son eficaces para tratar la diabetes en un sujeto con diabetes tipo 1, porque el factor de crecimiento estimula la diferenciación en el individuo de células no productoras de insulina en células productoras de insulina, tal como se describe en detalle en la presente memoria.

El sujeto de la invención puede incluir seres humanos, animales domésticos, ganado (por ejemplo, bóvidos, caballos, cerdos, etc.), mascotas (como gatos y perros) individuales. Por “diabetes” quiere decirse diabetes mellitus, una enfermedad metabólica caracterizada por una deficiencia o ausencia de secreción de insulina por el páncreas. Tal como se utiliza en toda la memoria, “diabetes” incluye diabetes mellitus tipo 1, tipo 2, tipo 3 y tipo 4 a menos que se especifique lo contrario en la presente memoria. La presente invención describe asimismo un procedimiento de tratamiento de la diabetes en un sujeto, que comprende obtener unas células no productoras de insulina del sujeto que es tratado o de un donante, poner en contacto las células no productoras de insulina con un factor de crecimiento in vitro, promoviendo así la diferenciación de las células no productoras de insulina en células productoras de insulina; y administrar las células productoras de insulina que fueron promovidas para diferenciar a partir de las células no productoras de insulina al sujeto diabético. En el procedimiento de tratamiento de la diabetes, en el que las células no productoras de insulina son de un donante, pudiendo ser el donante un cádaver. Como forma de realización adicional de la presente invención, puede permitirse la proliferación in vitro de las células no productoras de insulina antes de ponerse en contacto con el factor de crecimiento. Preferentemente, la estimulación de la diferenciación de células no productoras de insulina en células productoras de insulina dará como resultado una diferenciación mayor de aproximadamente el 20% de las células no productoras de insulina en células productoras de insulina. Incluso más preferentemente, más de aproximadamente el 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% o 90% de las células tratadas se diferenciarán en células productoras de insulina. La alteración de los antígenos de superficie de las células productoras de insulina obtenidas mediante la diferenciación de las células no productoras de insulina en células productoras de insulina, puede reducir la probabilidad de que las células productoras de insulina provoquen una respuesta inmunitaria. Las células con antígenos de superficie alterados pueden administrarse entonces al sujeto diabético. Los antígenos de superficie celular pueden ser alterados antes de, durante, o tras la diferenciación de las células no productoras de insulina en células productoras de insulina. La presente invención describe asimismo un procedimiento para la diferenciación de las células endoteliales en células de músculo liso, que comprende poner en contacto las células endoteliales con un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1 o exendina-4, factores de crecimiento que presentan unas secuencias de aminoácidos sustancialmente homólogas a los mismos, y sus fragmentos. La presente invención se ilustrará a continuación haciendo referencia a los siguientes ejemplos, en los que los ejemplos de exendina-4 no están comprendidos dentro del alcance de la invención. Ejemplos Ejemplo 1

Como se conoce que GLP-1 en células de insulinoma cultivadas influyen positivamente en la secreción de insulina, síntesis de insulina y ARN mensajero de insulina, se evaluaron los efectos del GLP-1 sobre el envejecimiento de ratas Wistar.

Materiales. GLP-1 y exendina [9-39] (Ex) un antagonista de receptores peptídicos de GLP-1, se adquirieron de Bachem (King of Prussia, PA). Los reactivos químicos eran de Sigma (St Louis, MO), a menos que se establezca lo contrario. Animales. Se utilizaron ratas Wistar de tres meses de edad (jóvenes) y 22 meses (de edad avanzada) procedentes de la colonia Wistar en el NIA (Baltimore, MD). Se mantuvieron con alimento para ratas y se alimentaron a voluntad. Todas las ratas de edad avanzada son descendientes de diez familias fundadoras mantenidas en el NIA. Protocolos. Para asegurar que los animales de edad avanzada eran capaces de responder al GLP-1, se llevó a cabo un experimento con una única dosis con un bolo intravenoso de GLP-1. Seis ratas Wistar de edad avanzada (22 meses) y 6 jóvenes (3 meses) estuvieron en ayunas durante la noche. Después de la anestesia con pentobarbital 50 mg/kg, se colocó un catéter en la arteria femoral para tomar muestras de sangre, y se administró un bolo de GLP-1 (0,2 nmol/kg) en la vena safena durante 30 s. Se extrajo sangre (tomada a los 2, 4, 7 y 10 min.) para la determinación de insulina. Se les implantó a las ratas una bomba microosmótica Alzet (Alza Corp. Palo Alto, CA) en la región interescapular durante 48 h. En el grupo tratado, se administró GLP-1 a una tasa de 1,5 y Ex a 15 pmol/kg-1.min-1. Se ha demostrado que con el fin de prevenir el efecto insulinotrópico de GLP-1, se requiere una concentración de Ex 10 veces mayor (Wang et al., J. Clin., Invest., 1995). Los animales control recibieron solución salina normal en sus bombas y recibieron su infusión durante el mismo periodo de tiempo.

Para las pruebas de tolerancia a la glucosa, después de estar en su sitio las bombas durante 36 h (n = 6 cada uno, para el control y el tratamiento con GLP-1), las ratas estuvieron en ayunas durante la noche, se anestesiaron con pentobarbital 50 mg/kg, y se retiraron las bombas, dando un tiempo de infusión total de GLP-1 de 48 h. Se colocó un catéter en la arteria femoral para la toma de muestras de sangre y se extrajo sangre para la medición del GLP-1. Se administró una prueba de tolerancia a la glucosa intraperitoneal (i.p.) (IPGTT, Ig/kg de PC) durante 120 min. tras la retirada de las bombas. Se obtuvieron muestras de sangre a los 15, 30, 45, 60 y 90 min. con el fin de estimar los niveles de glucosa e insulina. Se extrajo sangre (200 µl) en tubos heparinizados que contenían EDTA para la determinación de glucosa e insulina Para determinar el contenido en insulina intraislote, se utilizaron 14 ratas. Se trataron siete con GLP-1, y siete con solución salina, tal como se describió anteriormente. Después de 48 h, precedidas de un ayuno durante la noche, se sacrificaron los animales y se recogieron los islotes de Langerhans tal como se describió anteriormente (Perfetti et al., 1995; Egan et al., 1991). A continuación, se midió el contenido en insulina intraislote en 50 islotes escogidos al azar de cada páncreas individual. Se centrifugaron los islotes escogidos, y se eliminó cualquier medio residual, se suspendió el sedimento en ácido-etanol enfriado con hielo (500 µl) y se homogeneizó. Tras la centrifugación del homogeneizado (1.400 x g, 4ºC), se recogió el sobrenadante para la medición de la insulina intracelular. Se disolvió el sedimento en ácido fórmico y se determinó el contenido en proteínas. Ensayos. Se midió la glucosa en plasma mediante el procedimiento de la glucosa oxidasa.

(Egan et al., 1991). Se midieron la insulina y el GLP-1 mediante RIA tal como se publicó anteriormente (Wang et al. Endocrinology, 1995; Nathan et al., 1992). Se midió la cantidad de proteínas celulares utilizando el procedimiento de Bradford (Bio-Rad Richmond, CA) que utiliza γ- globulina bovina como patrón. Aislamiento del ARN y cuantificación de los ARNm pancreáticos endocrinos.

Se utilizaron los páncreas completos de las ratas que se habían sometido a una infusión de 48 h de GLP-1 o solución salina, para extraer el ARN total. Tras un ayuno durante la noche, se sacrificaron los animales, se extirparon los páncreas y se congelaron en nitrógeno líquido tan pronto como fue posible. Se extrajo el ARN mediante homogeneización en isocianato de guanidinio, seguido de ultracentrifugación en una capa de cloruro de cesio 5,7 M (Glisin et al., 1974; Chigwin et al., 1979). Luego, se preparó ARN-poli-A a partir del ARN total mediante cromatografía de afinidad utilizando columnas de oligo (dT) (Biolabs INC, Beverly, MA). Se cuantificó el ARN mediante análisis espectrofotométrico a 260 nm. Se utilizó el análisis de transferencia por ranuras utilizando ARN- poli-A, para la cuantificación de los niveles de ARNm de la glucocinasa, que es el principal sensor de glucosa de la célula beta (Matschinsky, 1990), las tres hexocinasas, GLUT 2, el principal transportador de glucosa de la célula beta (Mueckler, 1990) e insulina. Se diluyeron 4 microgramos de ARN-poli-A en 50t-µ1 de tampón TE (Tris-HCl 10 mM, EDTA 1 mM, pH 7,4), 20 µl de formaldehído al 37% y 20 µl de SSC 10x. Las muestras se incubaron a 60ºC durante 15 min., y luego se diluyeron con 1 ml de SSC 10x enfriado con hielo (SSC 1x = NaCl 0,15 M + citrato de sodio 0,015). Se enjuagó una vez cada pocillo del minisobre de la transferencia por ranuras, con SSC 10x enfriado con hielo y 300 µl de la muestra por pocillo, luego se cargó por triplicado sobre la membrana. Se aplicó vacío para drenar las muestras a través de la membrana, seguido de tres lavados de los pocillos con SSC 10x enfriado con hielo. Finalmente, las membranas se secaron durante 2 h a 80ºC en un horno de vacío para la reticulación del ARN. Las hibridaciones con sondas de ADNc (insulina II de rata del Dr. S.J. Giddings, Universidad de Washington, St Louis, MO; glucocinasa de rata del Dr. M.A. Magnuson, Universidad de Vanderbilt, Nashville, TN; GLUT2 de rata del Dr. M.J. Birnbaum, Escuela de Medicina de Harvard, Boston MA; y ADNc de hexocinasa I, II, III del Dr. J.E. Wilson, Universidad del Estado de Michigan, East Lancing, MI) se llevaron a cabo tal como se describió anteriormente (Wang et al., Endocrinology, 1995; Wang et al., Mol. Cell., Endocrinol., 1996). Todas las sondas de ADNc se marcaron con [32P]-dCTP (Amersham Life Science, Arlington Heights, IL) mediante el procedimiento de sensibilización al azar que utiliza Sequenase (United States Biochemical, Cleveland, OH). Se sintetizó un oligonucleótido homólogo a la cola de poli-A de los ARNm en un sintetizador de ADN de Applied Biosystem (5’GATGGATCCTGCAGAAGCTTTTTTTTTTTTTTTTTTTT3’) y se utilizó para cuantificar el ARNm celular total. Se llevó a cabo la hibridación con oligo dT20 con el fin de verificar que se utilizó aproximadamente una cantidad igual de ARN para cada muestra. Las sondas de oligonucleótidos se marcaron en los extremos con [32P]-γATP (Amersham) utilizando polinucleótido cinasa de T4 (New England Biolabs, Beverly, MA). Las hibridaciones con sondas de oligonucleótidos se llevaron a cabo tal como se describió anteriormente (Wang et al., Endocrinology, 1995; Wang et al., Mol. Cell. Endocrinol., 1996) y se cuantificaron utilizando un analizador de transferencia Betascope 603 (Betagen, Walthman, MA) Aislamiento del ARN y cuantificación de los ARNm en los islotes de Langerhans. Para confirmar los cambios vistos en páncreas completos, se aisló ARN de islotes de Langerhans procedentes de los animales tratados tal como se describió anteriormente con GLP-1. Los islotes se aislaron y se extrajo el ARN utilizando el microprocedimiento, descrito previamente (Perfetti et al., 1995). Aproximadamente 5 µg de ARN total de los islotes procedían de un páncreas. Se llevó a cabo un análisis de transferencia por ranuras para cuantificar los niveles de ARNm de las hexocinasas, GLUT2 e insulina.

Análisis estadístico Se expresaron los datos como la media ± EEM. La significación de los datos de insulina y glucosa obtenidos a partir de la IPGTT se sometió a prueba utilizando el análisis de la varianza con medidas repetidas de SAS (SAS Institute Inc.; Cary, NC). Si se documentaba una variación significativa (p< 0,05), se compararon los valores en puntos de tiempo individuales mediante la prueba de la t de Student para datos independientes. Todos los demás datos se analizaron utilizando la prueba de la t de Student para datos independientes: se consideró significativo p<0,05. Respuesta al bolo de GLP-1 i.v. de una única dosis. Los animales en ayunas jóvenes y de edad avanzada respondieron igualmente bien a un bolo de GLP-1 0,2 nmol/kg suministrado durante 30 seg. Sus respuestas de insulina eran superponibles (figura 1). A los 2 min. tras la finalización del bolo, la respuesta de insulina fue máxima tanto en los animales jóvenes (373,3 ± 43,7 pmol) como en los de edad avanzada (347,7 ± 25,7 pmol/l) y en ambos grupos los niveles de insulina habían vuelto al nivel inicial a los 10 min. Pruebas de tolerancia a la glucosa. Los animales de edad avanzada presentan una franca intolerancia a la glucosa en comparación con los animales jóvenes durante una IPGTT (figura 2). La glucosa en ayunas, tomada justo ante a la glucosa i.p., no era diferente entre los animales control y los tratados. La glucosa en sangre fue significativamente inferior durante la prueba de tolerancia a la glucosa en los animales tratados con GLP-1 en comparación con los animales control en los puntos de tiempo de 15 min. (9,04 ± 0,92 frente a 11,61 ± 0,23 mmol/l) y 30 (8,61 ± 0,39 frente a 10,36 ± 0,43 mmol/l) (figura 2). Además, los animales de edad avanzada ya no eran intolerantes a la glucosa en comparación con los animales jóvenes. Al revisar la respuesta de insulina al mismo tiempo, puede observarse que la respuesta de insulina a los 15 min. fue significativamente mejor en los animales tratados con GLP-1 en comparación con los controles (figura 3). En efecto, las ratas tratadas con solución salina presentaron su nivel pico de insulina a los 30 min., mientras que los animales tratados con GLP-1 presentaron el pico a los 15 min. Esta rápida respuesta de insulina explicó la disminución en la glucosa en sangre en los animales tratados (figura 2). Los niveles de insulina en ayunas durante la noche fueron mayores en los animales tratados con GLP-1 pero debido a una gran variación entre los animales, esto no fue estadísticamente diferente de los controles (192 ± 47 frente a 134 ± 45 pmol/l). La infusión durante 48 h de GLP-1 en ratas Wistar de 22 meses de edad potencia la respuesta de insulina a una IPGTT. Este fenómeno se observó incluso después de la finalización de la infusión de GLP-1, indicando que la GLP-1 puede inducir cambios a largo plazo que sobrepasan y ultramodulan la liberación de insulina. El cambio principal de la curva de respuesta de insulina fue en la liberación temprana de insulina después de la carga de glucosa, y se indujo mediante un desplazamiento en la secreción máxima de insulina desde 30 min. después de la inyección de glucosa, tal como se observó en los controles, hasta sólo 15 min. en las ratas tratadas con GLP-1. Contenido en insulina intraislote. Hubo variación en la cantidad de insulina entre los islotes para cada páncreas individual tal como podría esperarse de los animales de edad avanzada (figura 4). Sin embargo, hubo sistemáticamente más insulina en los islotes de los animales tratados (p<0,01). Los islotes de los controles y de las ratas tratadas con GLP-1 presentaron 5,31 ± 1,19 frente a 19,68 ± 3,62 ng de insulina por µg de proteínas pancreáticas totales, respectivamente.

Niveles en plasma de GLP-1. Se midió el GLP-1 en plasma en 3 animales 6 h tras el inicio de la infusión de GLP-1 para asegurar tanto que se alcanzaban los niveles de GLP-1 en el estado estacionario como para verificar que el péptido se estaba infundiendo realmente. El nivel de GLP-1 en plasma a las 6 h fue de 106,7 ± 17,6 mientras que a las 48 h fue de 125,0 ± 41,4 pmol/l. Antes del inicio de las pruebas de tolerancia a la glucosa, el GLP-1 en plasma estaba por debajo del nivel de detectabilidad del ensayo. Los niveles de GLP-1 en ayunas en las ratas Wistar control fue de 10-20 pmol/l. No hubo diferencia en los niveles de GLP-1 en ayunas entre los animales jóvenes y los de edad avanzada. Por tanto, la infusión de GLP-1 elevó los niveles de GLP-1 en plasma en aproximadamente 6 veces los niveles en ayunas. Puesto que se notifican que los niveles con alimentación en ratas Wistar (Wang et al., J. Clin. Invest., 1995), así como en seres humanos (Gutniak et al., 1992), se duplican aproximadamente después de alimentarse, los niveles en plasma que se obtuvieron con las bombas eran farmacológicos.

Efecto del GLP-1 sobre la expresión génica. Se midió la abundancia de ARNm de insulina así como los niveles de ARNm de otros factores implicados en las etapas tempranas de liberación de insulina mediada por glucosa, así como el metabolismo de la glucosa en las células beta. Se cuantificaron los resultados mediante densitometría, se normalizaron mediante la utilización de hibridación con oligo dT y se expresaron en términos relativos mediante la asignación al resultado de los controles de animales jóvenes un valor de 1. La figura 6 muestra que las transferencias para ARNm de insulina de páncreas completos de 6 animales jóvenes y 12 de edad avanzada, y los resultados combinados de todos los animales mostrados en la figura 5. La figura 7 muestra la transferencia de tres preparaciones de ARN de los islotes aislados de tres animales de edad avanzada. Los niveles de ARNm de insulina aumentaron en un 50% aproximadamente en los animales de edad avanzada frente a los jóvenes (figura 5A, P< 0,05, y figura 6). El GLP-1 aumentó el ARNm de insulina tanto en animales jóvenes como de edad avanzada en comparación con los controles (figura 5A, P<0,01 y figura 6). Pueden observarse resultados similares en las preparaciones de islotes aislados (figura 7). Este aumento se evitó totalmente cuando los animales se trataron simultáneamente con Ex, un inhibidor de la unión de GLP-1 a su propio receptor. De gran interés es el hecho de que los animales tratados con Ex sola o Ex con GLP-1, los niveles de ARNm de insulina fueron inferiores que en los controles (p<0,05). Los niveles de ARNm de insulina disminuyeron un promedio del 60% en presencia de Ex sola. Los niveles de ARNm de GLUT-2 en los animales de edad avanzada disminuyeron en un 70% en comparación con los controles jóvenes y esto se invirtió completamente mediante el tratamiento con GLP-1 (figura 5B, P<0,001).

Puede observarse el aumento de los niveles de ARNm de GLUT-2 por GLP-1 en los animales de edad avanzada tanto en las preparaciones de islotes (figura 7) y como de páncreas completo (figura 6). En los animales jóvenes, el GLP-1 no influye significativamente en los niveles de ARNm de GLUT-2 (figura 5). Los niveles disminuyeron en un 50% en presencia de Ex solo (figura 5B, P<0,05), pero no en los animales tratados con Ex y GLP-1 (figura 5B).

No hubo diferencias entre los animales jóvenes y los de edad avanzada en los niveles de ARNm de glucocinasa (figura 5C). El GLP-1 aumentó significativamente los niveles de glucocinasa en animales jóvenes (figura 5, P<0,05) pero mucho más en animales de edad avanzada (figura 5C, P<0,001, figura 7). Se observaron resultados similares en los animales de edad avanzada con las preparaciones de islotes aislados (figura 7). Ex evitó completamente los aumentos inducidos por GLP-1 en el ARNm de glucocinasa.

Para todas las preparaciones, los resultados de los páncreas se reflejaron en los islotes. Los niveles de ARNm de hexocinasa I, II y III fueron muy bajos en los páncreas completos y los islotes, y no parecieron verse alterados por el tratamiento con GLP-1. También se infundió GLP-1 durante 5 días en ratas de edad avanzada (n=6) y se encontraron los mismos resultados que con la infusión durante 48 h.

Tras la infusión continua con GLP-1, los páncreas fueron sorprendentemente más grandes que los páncreas del grupo control. Los páncreas de los animales tratados pesaron un 26% más que los páncreas de los animales control. Sorprendentemente, además, la secreción de insulina permaneció mejorada incluso después de la eliminación de la fuente exógena de GLP-1. La semivida biológica de la acción insulinotrópica del GLP-1 en la sangre es de 6-8 min. (Elahi et al., 1994) y puesto que la infusión de GLP-1 se había finalizado por lo menos 2 horas antes de realizar las pruebas de tolerancia a la glucosa, la presencia continuada de los niveles de GLP-1 elevados, por lo menos a corto plazo, no fue necesaria para la mejora de la tolerancia en los animales Wistar de edad avanzada.

El GLP-1 aumenta la biosíntesis de insulina y los niveles de ARNm de insulina in vivo, tal como se demostró anteriormente en células de insulinoma (Wang et al., Endocrinology, 1995). Además, el GLP-1 parecería ser necesario para el mantenimiento normal de los niveles de ARNm de insulina en el páncreas. Ex no sólo inhibió el efecto del GLP-1 sobre el ARNm de insulina, sino que también produjo una disminución en el ARNm de insulina en los animales a los que se les administró Ex sola. Ex es un inhibidor competitivo de la unión del GLP-1 a su receptor, requiriéndose una concentración de Ex 10 veces superior para inhibir el efecto insulinotrópico del GLP-1 (Wang et al., J. Clin. Invest., 1995), por lo que es de suponer que estaba inhibiendo la unión del GLP-1 endógeno en los animales que recibieron Ex sola. Esto significa que el GLP-1 presenta efectos sobre el mantenimiento de los niveles de ARNm de insulina en el intervalo fisiológico.

Se ha propuesto que en la diabetes tipo 2, la célula beta que almacena insulina disminuye por debajo de un nivel crítico, y que esto produce una reducción posterior en las respuestas de insulina inducidas por glucosa (Hosokawa et al., 1996). Tal como muestran los datos, el GLP-1 puede aumentar el contenido en insulina intraislote y cuando se administra de manera continua, no sólo mediante bolo, puede inducir también cambios beneficiosos para la función de las células beta, más allá de sus efectos simplemente sobre la secreción de insulina.

Ejemplo 2 La exendina-4 es un péptido producido en las glándulas salivales del lagarto, monstruo de Gila. En el presente ejemplo, se informa de que en ratas Wistar, criadas en el Instituto Nacional sobre el Envejecimiento (NIA), fue un agente insulinotrópico bastante más potente de diferentes maneras que el GLP-1. Además se informa de que la exendina-4 conduce a una mejora sostenida del control de la diabetes en un modelo de roedor de la diabetes tipo 2. Materiales. Se adquirieron exendina-4 y GLP-1 de Bachem (King of Prussia, PA). Los reactivos químicos procedían de Sigma (St Louis, MO), a menos que se establezca lo contrario.

Animales. Se utilizaron ratas Wistar de cuatro meses de edad procedentes de la colonia Wistar en el NIA (Baltimore, MD), para los experimentos con una única dosis de los efectos de exendina-4 y GLP-1 (véase el ejemplo 1). Se les mantuvo con alimento de laboratorio estándar y se les alimentó a voluntad. Para los experimentos a largo plazo, se adquirieron ratones diabéticos de cuatro meses de edad (C57BLKS/J-Leprdb/Leprdb) que carecían del receptor de leptina, y su camada no diabética a las 4 semanas de edad procedente de Jackson Laboratories (Bar Harbor, Maine). Se alojaron dos por jaula y también se les alimentó a voluntad. Se enjaularon los mismos ratones juntos en la duración del estudio. Se enjaularon ratas Wistar sobre tela metálica mientras que los lechos de los ratones fueron de un producto a base de papel, “Carefresh” (Absorption Co., Bellingham, WA). Protocolos. Las ratas Wistar estuvieron en ayunas durante la noche. Después de la anestesia con pentobarbital 50 mg/kg, se colocó un catéter en la arteria femoral para la toma de muestras de sangre. Se administró un bolo de o bien exendina-4 o bien GLP-1 en la vena safena (i.v.) durante 30 s a 12 animales, mientras que se administró un bolo de solución salina normal (NaCl) a los otros seis. Se rotó el orden de las inyecciones. Se extrajo sangre (tomada a los -5, 0, 2, 5, 15, 30, 60, 120, y 180 min.) en tubos heparinizados que contenían EDTA y aprotinina para la determinación de insulina (véase el ejemplo 1). Se aclimataron los animales a las instalaciones durante por lo menos 2 días. Once animales diabéticos y 10 no diabéticos recibieron 24 nmol/kg de exendina-4 (i.p.), diariamente (7-9 am), mientras que 10 animales diabéticos y 10 no diabéticos recibieron NaCl i.p. Posteriormente, se determinaron los niveles de glucosa en sangre completa, tomados del seno retroorbital, en los ratones utilizando un glucómetro Elite (Bayer). Se continuó este régimen durante 12-13 semanas. En el día ocho, dos de los ratones no diabéticos (compañeros de jaula) y en el día catorce uno de los ratones diabéticos, murieron justo después de recibir exendina-4. Se pesaron los animales semanalmente. Después de una semana del régimen, se tomaron de nuevo muestras de sangre de un seno retroorbital para la determinación de los niveles de insulina y glucosa. Al final del régimen, se obtuvieron muestras de sangre en ayunas para la medida de los niveles de glucosa e insulina, y se sometió a ensayo sangre completa que contenía EDTA para determinar la hemoglobina AIc (Hb AIc) en el mismo día para los cuatro grupos. En otro grupo de ocho ratones diabéticos de 14 semanas de edad, se les administró 24 nmol/kg de exendina-4 i.p. y NaCl i.p. diariamente durante cinco días a cuatro de cada grupo.

Determinaciones del AMPc. Se recogieron los islotes de Langerhans de ratas Wistar (Perfetti et al., 1995) y entonces se incubaron lotes de 25 islotes durante 1 h a 37ºC en un tampón que contenía (mM) NaCl 140, KCl 5, NaPO4 1, MgSO4 1, glucosa 5, CaCl2 2, HEPES 20, tampón (pH 7,4) y albúmina de suero bovino al 0,1%. Tras esto, se incubaron en el mismo tampón durante 1 hora en presencia de GLP-1 (1 nM) o exendina-4 (1 nM). Después se lavaron algunos lotes de islotes tres veces con solución salina tamponada con fosfato (PBS) enfriada con hielo y se lisaron con 1 ml de ácido perclórico 0,6 mM enfriado con hielo. Otros lotes se lavaron tres veces con el tampón a 37ºC y se dejaron otros 15 min. antes de lavarse tres veces con PBS enfriado con hielo seguido de lisis con el ácido perclórico. Luego, los lisados (950 µl se transfirieron a tubos de microcentrífuga y se midió el AMPc tal como se describió anteriormente (véase el ejemplo 1) mediante la utilización del kit de ensayo de [3H]-AMPc (Amersham). Se sometió a ensayo la proteína celular mediante la utilización del procedimiento de Bradford (Bio-Rad, Richmond, CA) que utiliza γ-globulina bovina como patrón. Ensayos. La glucosa en plasma se midió mediante el procedimiento de la glucosa oxidasa (Wang et al., 1997). La insulina se midió mediante RIA tal como se describió anteriormente (véase el ejemplo 1). Se evaluó la Hb AIe utilizando una máquina DiaSTAT de BIO-RAD (Herculas CA), que utiliza cromatografía de intercambio catiónico de baja presión junto con una elución en gradiente para separar las variantes y los subtipos de hemoglobina de la sangre hemolizada. Se controlaron las fracciones de hemoglobina separadas por medio de la absorción de la luz a 415 nm.

Procedimientos estadísticos. Se proporcionan todos los resultados como la media ± EEM. Las pruebas de la t se basaron en los resultados de una prueba F que examina la igualdad de la varianza de las dos medias. Si las varianzas eran significativamente diferentes de manera estadística entonces la prueba de la t se basó en varianzas desiguales. Para la determinación de la CE50, se restaron los niveles de insulina en plasma basales y la actividad restante a cada concentración se expresó como un porcentaje de la actividad máxima (que se consigue mediante un exceso de péptido). A continuación, esto se transformó en un formato logit donde logit = ln (% actividad / 100 - % actividad]) y se representó gráficamente como una función del log de la concentración del compuesto. Efectos de exendina-4 en ratas Wistar. La exendina-4 fue un agente insulinotrópico más potente que GLP-1 en diferentes niveles cuando se administró por vía intravenosa. La respuesta de insulina máxima en las ratas Wistar se observa con GLP-1 0,4 nmol/kg (De Ore et al., 1997). A esta misma concentración de exendina-4, la respuesta de insulina máxima se duplica aproximadamente (figura 8). Los niveles de insulina vuelven al nivel inicial en 10 min. con GLP-1, pero con exendina-4 realmente van por debajo del nivel inicial y han vuelto al nivel inicial en 60 min. La concentración CE50 para la liberación de insulina es menor y la cantidad máxima de insulina secretada mediante exendina-4 es mayor que con GLP-1. La CE50 fue de 0,019 (figura 9) frente a 0,19 nmol/kg para exendina-4 frente a GLP-1 (véase el ejemplo 1), respectivamente. Los animales a los que se les administró exendina-4, presentaron un aumento obvio en la diuresis en la duración del estudio (no se cuantificó el volumen de orina) puesto que continuaron orinando frecuentemente durante el estudio a pesar de la extracción de sangre, lo que disminuiría el volumen de sangre circulante, mientras que los animales tratados con GLP-1 orinaron poco o nada durante el estudio.

Efectos de la exendina-4 y GLP-1 en los niveles de AMPc en islotes aislados. La exendina 4 aumentó más los niveles de AMPc en islotes aislados que GLP-1 en concentraciones equimolares. El GLP-1 aumentó el AMPc de manera dependiente de la concentración con una respuesta de AMPc máxima a 1 nM. A esa concentración de exendina-4, los niveles de AMPc fueron aproximadamente 3 veces mayores (figura 10) que con GLP-1. Esto probablemente explica por qué la exendina-4 produce una liberación de insulina máxima mayor que GLP-1. En un esfuerzo por observar si la exendina-4 o GLP-1 pueden permanecer en el receptor de GLP-1 y de este modo mantener un aumento en AMPc tras la eliminación de los péptidos de la disolución tampón, se eliminó el péptido de algunos islotes mediante tres lavados con tampón nuevo y a continuación se midió el AMPc después de 15 min. Con ambos péptidos, los niveles de AMPc volvieron al nivel inicial por lo menos en 15 minutos.

Efecto del tratamiento con dosis múltiples de exendina-4 en ratones. La actividad biológica de exendina-4, que se midió mediante su capacidad para disminuir el azúcar en sangre, fue mucho más prolongada de lo que se esperaba cuando se administró por vía subcutánea o i.p. a los animales diabéticos. En los experimentos preliminares, se encontró que los ratones diabéticos tratados con exendina-4 presentaron niveles de azúcar en sangre menores 24 horas después de las inyecciones i.p. y subcutáneas (s.c.) mientras que con inyecciones de GLP-1, los niveles de azúcar en sangre volvieron al nivel inicial. Esto conduce a diseñar un experimento a largo plazo con exendina-4. Al inicio del régimen con exendina-4 i.p. diaria en los ratones, la glucosa en sangre en ayunas fue de 145 ± 51 mg/dl en los ratones no diabéticos, y de 232 ± 38 mg/dl en los ratones diabéticos. Después de una semana de tratamiento, el nivel de glucosa en ayunas en los ratones no diabéticos tratados con exendina-4 fue de 70 ± 25 mg/dl y fue significativamente menor que en los animales no diabéticos tratados con NaCl, 135 ± 5 mg/dl (p < 0,05). Los animales diabéticos presentaron una respuesta altamente significativa a exendina-4. Los niveles de glucosa disminuyeron hasta 90 ± 11 mg/dl en los animales tratados con exendina desde 238 ± 51 mg/dl (p< 0,002) en los animales tratados con NaCl (tabla 1). Se midieron los niveles de insulina en ayunas en los animales diabéticos que recibieron NaCl o exendina-4. Fueron mayores en los animales que recibieron exendina-4 (p< 0,002). Basándose en estos datos, se continuó tratando los animales diariamente con exendina-4. Como el lecho era un producto a base de papel que se vuelve más oscuro progresivamente con el aumento de la micción, estaba claro que las jaulas de los animales diabéticos tratados con exendina-4, aunque no totalmente secas como estaban las jaulas de los animales no diabéticos, obviamente siempre estuvieron más secas 24 horas después del cambio, que las jaulas de los animales diabéticos tratados con NaCl (figura 11, fotografía tomada después de 9 semanas de tratamiento). Se supuso que la disminución de la micción en los ratones diabéticos tratados con exendina-4 se debió a una menor diuresis osmótica debido a una menor glucosa en sangre. Los animales diabéticos presentaban claramente más peso que los animales no diabéticos. Después de 9 semanas, el peso de los animales no diabéticos alcanzó una meseta a aproximadamente 28 gramos (g) mientras que los animales diabéticos continuaron aumentando de peso. A las 13-14 semanas de tratamiento, los animales tratados con NaCl comenzaron a perder peso (38,7 g) mientras que los animales tratados con exendina-4 mantuvieron su peso (46,7 g). Se sometió a ensayo la sangre completa de los animales tratados con solución salina y exendina-4 para las determinaciones de Hb AIc y se midió en plasma para determinar las concentraciones de glucosa e insulina tras ayuno durante la noche (figura 12). Puede observarse que todos estos parámetros se alteraron significativamente mediante el tratamiento diario con exendina-4. La Hb AIc fue del 8,8% en los animales diabéticos tratados con NaCl frente al 4,7% en los animales tratados con exendina-4 (p< 0,0001). Además, la Hb AIc era menor en los animales no diabéticos, el 3,5 frente al 3,1% (p = 0,0002), tratados con exendina-4 frente a tratados con NaCl, respectivamente. Los niveles de glucosa fueron significativamente menores (278,7 ± 30,0 frente a 517 ± 59 mg/dl), p<0,005) y los niveles de insulina significativamente mayores (4.600 ± 1.114 frente a 707,2 ± 169,7 pmol/l, p< 0,02) en los animales diabéticos tratados con exendina-4 (figura 13). Las tendencias en la glucosa y la insulina fueron las mismas en los animales no diabéticos con tratamiento con exendina-4 aunque no tan drásticas (figura 13).

En los ocho ratones diabéticos que tenían 14 semanas de edad cuando sus tratamientos comenzaron, los niveles de azúcar en sangre fueron de 640 ± 37 mg/dl en los animales tratados con NaCl y de 355 ± 21 mg/dl en los animales tratados con exendina-4 después de cinco días. Sus niveles de insulina fueron de 6.904 ± 705 frente a 1.702 ± 54 pmol/l, tratados con exendina-4 frente a tratados con NaCl, respectivamente.

Tras la administración de exendina-4 i.p. y s.c., los niveles de azúcar en sangre en los ratones diabéticos presentaron una respuesta biológica mucho más prolongada porque los niveles de azúcar en sangre permanecieron más bajos (hasta 24 horas tras una dosis i.p.) por más tiempo de lo que se esperaba de la respuesta de insulina a la exendina-4 i.v., con el efecto hipoglucemiante de las inyecciones i.p. fueron menos variables que con s.c. Esto se debió posiblemente a la mayor variación en la técnica s.c. y talvez incluso pérdida del péptido durante las inyecciones en algunos casos.

En los estudios que implican la inyección i.p. de exendina-4 i.p. diariamente durante una semana, los niveles de azúcar en sangre en ayunas como resultado de sólo una inyección al día fueron realmente menores que los niveles de azúcar en sangre de los animales no diabéticos. También era obvio al examinar las jaulas cada mañana, que los animales diabéticos estaban recibiendo exendina-4 puesto que sus jaulas estuvieron siempre más secas. También se observó este efecto en los animales no diabéticos que recibieron exendina-4. En los experimentos en los que se administró exendina-4 diariamente durante cinco días a animales diabéticos cuyos niveles de azúcar en sangre medios eran de 640 mg/dl, también hubo un efecto notable en la disminución del azúcar en sangre, y los niveles de insulina se aumentaron notablemente. Esto es poco probable que se deba a la expansión de la masa de células beta y sugeriría que las células beta de las ratas diabéticas siguen respondiendo todavía a exendina-4 incluso en presencia de tal marcada hiperglucemia. Incluso después de 12 semanas de exendina-4, los niveles de azúcar en sangre fueron menores que en los animales tratados con NaCl. Normalmente, las respuestas primarias de anticuerpos tras las inyecciones intraperitoneales llevan hasta 14-21 días y la exendina-4 es un hapteno débil a cualquier proporción. Así que para las primeras semanas de tratamiento, no se esperaría que la exendina-4 se neutralice por el anticuerpo. Junto con esto, los efectos biológicos de la exendina-4 son a muy bajas concentraciones y por tanto, posiblemente el péptido presenta una mayor afinidad por el receptor de GLP-1 que por su anticuerpo específico y así podría no neutralizarse totalmente por el anticuerpo. Otras posibilidades en cuanto a por qué la exendina-4 podría no neutralizarse son que existe un péptido similar a exendina-4 producido en los roedores que aún no se ha identificado o que una molécula de tipo exendina-4 se forma en el útero de los roedores lo cual convierte a los animales maduros en tolerantes a exendina-4. Se administró a ratones diabéticos, exendina-4 a una menor concentración (1 nmol/kg) i.p. durante una semana.

Este sólo fue tan eficaz en la disminución del azúcar en sangre que la mayor cantidad notificada en este ejemplo. No se observaron efectos adversos de las inyecciones diarias sobre el comportamiento de los ratones. Puesto que se ha observado que para los primeros 3-4 días de inyección de exendina-4, el peso de los animales disminuye, pero en el séptimo día vuelve al mismo que en los animales tratados con NaCl. En el estudio a largo plazo, se pesó semanalmente y así se soslayó la disminución inicial. A excepción de que el lecho estaba obviamente más seco cada mañana en los animales diabéticos tratados, no pudieron detectarse efectos nocivos evidentes de exendina-4 en los animales. Por tanto, se sugiere que la exendina-4 podría ser superior a GLP-1 como un tratamiento para la diabetes tipo 2 en seres humanos.

Ejemplo 3 Utilizando el protocolo del ejemplo 1, se administró GLP-1 mediante la infusión continua durante de uno a cinco días a ratas jóvenes y de edad avanzada, mientras que las ratas control recibieron infusiones comparables de solución salina. Por el contrario, se administró exendina-4 por vía intraperitoneal una vez al día durante cinco días según el protocolo del ejemplo 2. Aproximadamente el 20% de las células en los páncreas tratados con GLP-1 fueron positivos para PCNA a los cinco días. En el mismo punto de tiempo, hubo células en proliferación en el islote. Además, había células en proliferación revistiendo los conductos y, más sorprendentemente, en el tejido acinar, un área que generalmente se considera que está desprovista de células madre. También sorprendentemente, se encontraron varias células positivas para insulina fuera de los islotes entre el tejido acinar, donde no se esperan células positivas para insulina. Estos resultados demuestran que la infusión continua de GLP-1 o la inyección intraperitoneal repetida con exendina-4 durante por lo menos dos días da como resultado un aumento en el número total de células positivas para insulina y en la diferenciación de las células acinares en células positivas para IDX-1 e insulina. Además, estos resultados sugieren que GLP-1 y exendina-4 aumentan la proliferación de las células y, específicamente, un aumento en la proliferación de células productoras de insulina dentro del tejido acinar. La infusión continua de GLP-1 estimula la diferenciación de las células no productoras de insulina en células productoras de insulina, tras poner en contacto las células no productoras de insulina con GLP-1 durante más de veinticuatro horas. Se observó el efecto tan pronto como el día 1, y el efecto máximo tan pronto como a los siete días. Tal diferenciación fue sorprendente puesto que la técnica anterior sólo mostraba resultados insulinotrópicos en células beta. Además, la presente invención fue sorprendente porque las células acinares, que nunca han mostrado poder producir insulina, se estimulan para secretar insulina tras ponerlas en contacto con GLP-1. El aumento del número de células productoras de insulina se mantiene sin cambios durante por lo menos dos semanas después que el tratamiento se interrumpe. Puesto que la diferenciación en una célula productora de insulina es un acontecimiento terminal, es improbable la desdiferenciación de vuelta a una célula no productora de insulina incluso en puntos de tiempo posteriores. Por tanto, el efecto es permanente.

Se demuestra en la presente invención que la exendina-4 presenta los mismos efectos que GLP-1 sobre la diferenciación de células productoras de insulina a partir de células no productoras de insulina. Sorprendentemente, se demuestra que exendina-4 presenta una semivida mucho más larga que GLP-1. Por tanto, el aumento en el número de células productoras de insulina, puede conseguirse con la inyección en bolo diaria, en lugar de la infusión continua, de exendina-4 durante dos días. Después de dos inyecciones, se observan células productoras de insulina fuera del islote. El efecto máximo se consigue en siete días. Al igual que con GLP-1, el efecto persiste durante por lo menos dos semanas, y probablemente de forma permanente, incluso después que se interrumpe el contacto con la exendina-4. GLP-1, exendina-4, factores de crecimiento que presentan secuencias de aminoácidos sustancialmente homólogas a GLP-1 o exendina-4, y fragmentos de los mismos, afectan a la diferenciación de células no productoras de insulina

in vivo e in vitro. Además, una variedad de células no productoras de insulina, incluyendo las células madres y las células acinares pueden estimularse para que se diferencien en células productoras de insulina. Estos avances con respecto a la técnica anterior proporcionan procedimientos de tratamiento de la diabetes mellitus, mediante lo cual se aumentan en número las células productoras de insulina mediante la administración del factor de crecimiento a un paciente o poniendo en contacto las células no productoras de insulina in vitro.

Ejemplo 4 El propósito de este estudio fue determinar si GLP-1 y las hormonas de los islotes, glucagón e insulina, tienen efectos sobre el tejido acinar. Se utilizaron las células AR42J (Christophe, 1994), que se derivan de un tumor exocrino pancreático de rata, como modelo de tejido acinar. A continuación, se examinaron algunos aspectos del sistema de transducción de señales a través del cual ya se conoce que GLP-1 funciona en las células beta (Goke et al., 1993; Holz et al., 1995; Yada et al., 1993). Materiales. Se obtuvieron GLP-1, glucagón, exendina-4 y exendina 9-39 de Bachem (Torrance CA). Colecistocinina (CCK), insulina, genesteína y vanadato procedían de Sigma Chemical Co (St Louis, MO). La línea celular pancreática de rata, AR42J, procedía de la Colección Americana de Cultivos Tipo (Rockville, MD). Se adquirieron anticuerpos anti-tirosina de Upstate Biotechnology, Inc (Lake Placis, NY) Cultivo celular. Se mantuvieron células AR42J en medio de Eagle modificado por Dulbecco (Gibco, Grand Island, NY) (DMEM) complementado con un 10% de suero de ternero fetal, penicilina 100 UI/ml, estreptomicina 100 µg/ml y glutamina 2 mM. Se utilizaron las células del pase 23-26 durante todo este estudio. De forma rutinaria, se colocaron las células en placas a aproximadamente 105 células/ml en placas agrupadas de 12 pocillos, y se incubaron en un incubador humidificado a 37ºC con el 95% de aire y el 5% de CO2. Puesto que las células AR42J respondieron escasamente a CCK, las células se incubaron de forma rutinaria con dexametasona 10 nM durante 48 h antes de su utilización, ya que se sabía que esto induce la capacidad de respuesta a CCK de manera dependiente de la concentración (Logsdon et al., 1987). Ensayo de amilasa. Para la secreción de amilasa, las células se lavaron para eliminar el medio con 2 ml de solución salina tamponada con fosfato (PBS). Luego, la incubación se llevó a cabo en DMEM que contenía HEPES 15 mM, albúmina de suero bovino (BSA) al 0,2% e inhibidor de tripsina de soja al 0,01%. Se añadieron las hormonas y los reactivos de interés durante 50 min. a 37ºC. A continuación, se retiró inmediatamente el medio de incubación para la determinación de amilasa y se lavaron las células de nuevo con 2 ml de PBS enfriado con hielo. Se añadió el tampón de lisado que contenía (en mM) Tris-HCl 130, CaCl2 10, NaCl 75 y Tritón X-100 al 0,2% (pH 8,0) a las células y entonces se recogieron los lisados para determinar la actividad amilasa total (Ceska et al., 1969). La amilasa liberada se expresó como el porcentaje de la actividad amilasa total de las células. Medición del AMPc. Se hicieron crecer células en placas de 12 pocillos y se trataron con hormonas y reactivos ± IBMX tal como se describió anteriormente. Luego, se lavaron 3 veces con PBS enfriado con hielo y se lisaron con 1 ml de ácido perclórico 0,6 mM enfriado con hielo. Los lisados (950 µl) se transfirieron a tubos de microcentrífuga y se ajustó el pH a 7,0 utilizando K2CO3 5 M. Después de la centrifugación durante 5 min. a 104 rpm, se secó a vacío el sobrenadante, y luego se recuperó en 200 µl de tampón Tris/EDTA. Después de añadir Na2CO3 0,15 mM (50 µl) y ZnSO4 0,15 mM (50 µl), seguido de incubación durante 15 min. en hielo, se eliminó el precipitado de sal mediante centrifugación durante 15 min. a 3,5 x 103 rpm y se sometieron a ensayo 50 µl de sobrenadante utilizando un kit de ensayo de [3H]-AMPc (Amersham Corp., Arlington Heights, IL), (Steiner et al., 1972). Se midió la proteína celular utilizando el procedimiento de Bradford (Bio-Rad, Richmond, CA) con gamma-globulina bovina como patrón (Bradford, 1976). Medición del calcio intracelular, [Ca2-]1. Se cargaron las células AR42J con la sonda de fluorescencia de Ca2+, éster de indo-1-acetoximetilo (indo-1/AM). La disolución de carga consistía en 50 µg de indo-1/AM (Molecular Probes Inc.), 30 µl de dimetilsulfóxido (DMSO) y 5 µl de Pluronic F-127 al 25% (p/p en DMSO) (BASF Wyandott Corp.) Se añadió esta mezcla a 2,0 ml de células en solución salina equilibrada de Hank (concentración final de indo-1 de 25 µM) y se mezcló cuidadosamente en una placa de agitación durante 1 h. A continuación, las células se centrifugaron a 400xg durante 60 s, se resuspendieron en una disolución de baño convencional, que consistía en (en mM): NaCl 137; KCl 5; MgSO4 1,3; CaCl2 5; HEPES 20; se ajustó el pH con NaOH a 7,4, y se almacenó durante por lo menos 1 h antes de utilizarse. Tanto la carga con indo-1 como los experimentos se llevaron a cabo a temperatura ambiente (22-24ºC). La suspensión celular se colocó en una cámara sobre la fase de un microscopio de fluorescencia invertido (Spurgeon et al., 1990). Se restringió el campo de emisión a una sola célula. Se excitó indo-1 a 350 ± 5 nm cada 5 ms, y la emisión de fluorescencia se dividió en bandas de longitud de onda de 410 ± 5 y 490 ± 5 nm. La razón de fluorescencia 410:490 (razón F410/F490), corregida para la autofluorescencia, se utilizó como un índice de la [Ca2+]1, utilizando la metodología bien conocida en la técnica (Spurgeon et al., 1990). La autofluorescencia de la célula se evaluó en un gran número de células no cargadas con indo-1 del mismo lote. En un experimento típico, la disolución de baño convencional se intercambió rápidamente (< 200 ms) por una de las disoluciones de prueba inyectadas desde una micropipeta colocada en estrecha proximidad a la célula (Janczewski et al., 1993; Konnerth et al., 1986). De forma rutinaria, las células se expusieron a la disolución de prueba durante 240-300 s. Después de eso, se eliminó por lavado la disolución de prueba, mientras que se monitorizaba la [Ca2+]1 durante 120-180 s adicionales. Las disoluciones de prueba se prepararon justo antes del experimento mediante la adición de las hormonas en la disolución de baño convencional. Unión de GLP-1. Se colocaron en placas las células AR42J y se cultivaron tal como se describió anteriormente. Al inicio del experimento de unión, se incubaron las células con DMEM libre de suero durante 2 h a 37ºC. A continuación, se lavaron las células dos veces con 0,5 ml de tampón de unión que contenía (en mM) NaCl 120, MgSO4 1,2, acetato de sodio 13, KCl 5, Tris 10, pH 7,6. Luego, se incubaron las células durante la noche a 4ºC con 0,5 ml de tampón de unión complementado con un 2% de BSA, aprotinina 500 U/ml, glucosa 10 mM, un intervalo de concentraciones de GLP-1 (0,03 nM-100 nM) y 30.000 cpm de 125I-GLP-1 (2.000 Ci/mmol, Peninsula, Belmont, CA). Sólo se utilizó 125I-GLP-1 preparado recientemente en el plazo de dos semanas desde la fecha de referencia. Al final de la incubación, se desechó el sobrenadante y se lavaron las células tres veces con PBS enfriado con hielo. Las células se lisaron con 0,5 ml de NaOH 0,5 N/SDS al 1% durante 30 min. a temperatura ambiente. La radiactividad se midió en los lisados en un contador gamma de la serie Apec de ICN. La unión específica se determinó restando la unión no específica presente a 500 nM de GLP-1 de la unión total. Anteriormente, se ha utilizado este procedimiento para caracterizar la unión de GLP-1 en células CHO que sobreexpresan el receptor de GLP-1 y en adipocitos 3T3-L1 (Montrose-Rafizadeh et al., J. Biol. Chem., 1997; Montrose-Rafizadeh et al., J. Cell Physiol., 1997). RT-PCR del receptor de GLP-1. Se sintetizó ADN complementario a partir de ARN celular total utilizando la transcriptasa inversa del virus de leucemia murina de Maloney (Bethesda Research Laboratories, Gaithersburg, MD) y el cebador aleatorio de hexanucleótidos (Pharmacia LKB Biotechnology Inc., Piscataway, NJ). Se realizó la amplificación mediante PCR (30 ciclos) (Saiki et al., 1997) a partir de ADNc de primera cadena utilizando Taq ADN polimerasa recombinante (Amplitaq, Perkin-Elmer, Cetus). Los cebadores de oligonucleótidos estaban en el extremo 5’ y 3’ de la secuencia del receptor de GLP-1 pancreático (Thorens, 1992), 5’ACAGGTCTCTTCTGCAACC3’ y 5’AAGATGACTTCATGCGTGCC3’, respectivamente. A continuación, los productos de PCR se resolvieron en un gel de agarosa al 1% y se visualizaron utilizando bromuro de etidio. Se subclonaron los productos de PCR en el vector pBluescript y se secuenciaron utilizando la técnica de la terminación de cadenas y el kit Sequenase 2.0 (United States Biochemicals, Cleveland, OH). Además, se determinó la especificidad del producto de PCR mediante la enzima de restricción Bstx 1. Inmunoprecipitación e inmunotransferencia de tipo Western del receptor de GLP-1

Se hicieron crecer células AR42J y una línea celular de insulinoma, células RIN 1046-38, en placas de 60 mm tal como se describió anteriormente. Cuando las células alcanzaron una confluencia del 80%, se lavaron dos veces con un tampón de Krebs-Ringer que contenía NaCl 115 mM, KCl 5 mM, CaCl2 2,5 mM, MgCl2 1 mM, NaHCO3 24 mM y HEPES 25 mM y se congelaron en nitrógeno líquido. Las células congeladas se rasparon y lisaron en tampón RIPA que contenía Tris-HCl 20 mM: pH 8,0, NaCl 137 mM, Triton X-100 al 1%, desoxicolato al 0,5%, SDS al 0,1%, PMFS 0,2 mM, leupeptina 10 µg/ml, aprotinina 20 µg/ml, ortovanadato de Na 1 mM, benzamidina 1 mM. Se eliminó el material insoluble mediante centrifugación a 15.000 xg durante 15 min. a 4ºC, y se recogió el sobrenadante para inmunoprecipitación e inmunotransferencia de tipo Western. Se añadió a cada tubo anticuerpo anti-GLP-1-R contra el extremo N-terminal (donación del Dr. Joel Habener, Hospital General de Massachusetts, MA) a 1:250, junto con 40 µl de proteína A y proteína G. La inmunoprecipitación se llevó a acabo a 4ºC durante la noche y se lavaron los inmunocomplejos dos veces con tampón RIPA, se lavaron de nuevo otras dos veces con tampón de lavado (Hepes 25 mM, Triton X-100 al 0,1% y ortovanadato de Na 1 mM), a continuación se solubilizaron los sedimentos de inmunocomplejos en 50 µl de tampón de muestra para SDS-PAGE a 70ºC durante 10 min. Las proteínas inmunoprecipitadas se eluyeron con una minicolumna de resina y se sometieron a gel de SDS-poliacrilamida al 4-20%. Después de que se electrotransfirió el gel a la membrana de PVDF, se bloqueó la inmunotransferencia con un 5% de leche descremada en tampón TBST (Tris-HCl 20 mM [pH 7,5], NaCl 137 mM y Tween 20 al 0,1%) durante 1 hora a temperatura ambiente, y luego se incubaron con el anticuerpo contra el receptor de GLP-1 a 1:1500 durante 1 h a temperatura ambiente. Se lavaron tres veces las membranas de PDVF con TBST y se incubaron con antisueros de anticuerpos secundarios anti-conejo conjugados con peroxidada de rábano picante durante 1 h a temperatura ambiente. Tras una serie de lavados con TBST, se revelaron las inmunotransferencias utilizando el sistema de detección de quimioluminiscencia ECI. Se cuantificaron las autorradiografías utilizando el software Image-QuantTM (versión 3.3) en un densitómetro láser de Molecular Dynamics. En este experimento, se utilizó la línea de células productoras de insulina, células RIN1046-38, como un control positivo para la presencia del receptor de GLP-1. Se utilizaron alícuotas (20 µl) de lisados celulares clarificados para determinar la concentración de proteínas que se estimó mediante el procedimiento de Bradford (Bradford, 1976).

Estudios de fosforilación de tirosina. Se incubaron previamente las células AR42J en el tampón equilibrado de Krebs-Ringer (KRBB) que contenía NaCl 115 mM, KCl 5 mM, CaCl2 2,5 mM, MgCl2 1 mM, NaHCO3 24 mM y HEPES 25 mM durante 2 h a 37ºC. Luego, se eliminó el medio y se añadió KRBB nuevo, seguido de la colocación de la célula sobre una placa calefactora a 37ºC durante 5 min. Después de la adición de varios reactivos (véase la figura 24) durante 5 min., se terminó la reacción mediante la inmersión de las placas en nitrógeno líquido. Las células congeladas se rasparon y lisaron en tampón RIPA. Se eliminó el material insoluble mediante centrifugación a 15.000xg durante 15 min., y se recogió el sobrenadante para la inmunoprecipitación e inmunotransferencia. Las proteínas que contenían fosfotirosina procedentes de los lisados clarificados se inmunoprecipitaron con anticuerpos monoclonales anti-fosfotirosina y se separaron mediante electroforesis en geles de poliacrilamida-SDS al 4-12% en condiciones reductoras seguido por electrotransferencia a la membrana de PVDF e inmunotransferencia con anticuerpos policlonales anti-fosfotirosina. Se revelaron las inmunotransferencias utilizando el sistema de detección de quimioluminiscencia ECL (Amersham). Se sometió a ensayo el contenido total de proteínas en los lisados celulares clarificados utilizando el procedimiento de Bradford (Bradford, 1976).

Análisis estadístico. Cuando era aplicable, los resultados se expresaron como la media ± EEM y se sometieron a la prueba de t de Student para datos independientes. Las comparaciones dentro de los grupos se analizaron utilizando el análisis de la varianza de una vía (ANOVA). Se consideró significativo p<0,05. Liberación de amilasa. CCK fue un estímulo potente de la liberación de amilasa.

Se observó la estimulación máxima a 10 nM (figura 14). Aunque el glucagón (10 ó 100 nM) por sí mismo no presentaba ningún efecto sobre la liberación de amilasa, cuando se combinó con CCK, inhibió, pero no suprimió completamente, la liberación de amilasa inducida por CCK (figura 15; n = 20, p<0,01). El GLP-1 y la insulina, o bien solos o bien combinados con CCK, no influyeron en la liberación de amilasa (figura 15). Además, se examinó exendina-4 (concentraciones que oscilaron de 10 pM a 10 nM) para determinar sus efectos potenciales sobre la liberación de amilasa y, al igual que GLP-1, no pareció que influyera en la liberación de amilasa. Puesto que podría esperarse que GLP-1 y glucagón eleven los niveles de AMPc en las células AR42J, se examinó el efecto del 8-bromo-AMPc (8-Br-AMPc), un análogo del AMPc, sobre la liberación de amilasa para buscar efectos específicos del AMPc. Aunque parecía que el 8-Br-AMPc no tenía ningún efecto sobre la liberación de amilasa cuando se administraba solo, redujo la liberación de amilasa inducida por CCK (figura 16). Además, se utilizó tapsigargina y rianodina, inhibidores específicos de receptores de rianodina/canales de liberación de Ca2+ de RE y de las bombas de Ca2+ de RE, respectivamente, solo y en combinación con CCK, para investigar el papel de una elevación del calcio intracelular en la liberación de amilasa. La combinación de tapsigargina y rianodina disminuyó, pero no inhibió completamente, la liberación de amilasa inducida por CCK (figura 17; n = 3, p<0,01). El NaF, que imita los efectos de la CCK sobre la liberación de amilasa en el tejido acinar (Vajanaphanich et al., 1995), hizo lo mismo en las células AR42J. La genesteína (300 µM), el inhibidor de tirosina cinasa, disminuyó la liberación de amilasa mediada por CCK, especialmente en los puntos de tiempo iniciales del tratamiento con CCK, mientras que el vanadato, el inhibidor de tirosina fosfatasa, aumentó significativamente la liberación de amilasa basal y la mediada por CCK (figura 18). Se ha demostrado que cuando las células beta del páncreas se tratan con GLP-1 durante 24 h, existe un aumento en la liberación de insulina mediada por glucosa y GLP-1 (Wang et al., Endocrinology, 1995). Por tanto, se buscó algún efecto a largo plazo que GLP-1 podría tener sobre la liberación de amilasa. La preincubación de las células AR42J durante 8, 24, 48 ó 72 h con GLP-1 (10 nM) e insulina (100 nM) no aumentó la liberación de amilasa basal o inducida por CCK (1 nM).

Respuestas de [Ca2+]1 a CCK en células AR42J. En las presentes condiciones experimentales, la mayoría (85%; n = 35) de las células AR42J respondieron a CCK 1 nM con un aumento transitorio en la [Ca2+]1. La figura 6A muestra un ejemplo representativo de los aumentos transitorios de [Ca2+]1 inducidos por CCK, que comenzaron después de 5-25 s tras la exposición a CCK y alcanzaron un pico en el plazo de los siguientes 5-15 segundos. La [Ca2+]1 pico, evaluada a partir de la razón pico de inmunofluorescencia de indo-1 (IFR), superó la IFR en reposo en 2,5-3,5 veces.

La relajación de los aumentos transitorios de [Ca2+]1 comenzó inmediatamente después del pico y normalmente consistió en una fase inicial rápida, seguida de una meseta y una fase final más lenta. Después del aumento transitorio de [Ca2+]1, la [Ca2+]1 de nivel inicial disminuyó por debajo de la [Ca2+]1 de reposo, que se midió antes de la exposición a CCK (figura 19A). Durante el reposo posterior, la [Ca2+]1 de nivel inicial mostró un aumento gradual, pero normalmente no se recuperó completamente hasta los niveles del control en un plazo de 10 minutos. Los aumentos transitorios de [Ca2+]1 provocados por una exposición repetida a CCK antes de una recuperación completa de la [Ca2+]1 en reposo se redujeron en un 30-40% frente a la anterior [Ca2+]1. Los aumentos transitorios de [Ca2+]1 inducidos por CCK se suprimieron casi completamente en las células pretratadas con rianodina 10 µM y tapsigargina 500 µM (figura 19B; n=7). Estos resultados respaldan el concepto de que en las células acinares, el RE es la mayor fuente de cambios en la [Ca2+]1 inducidos por CCK (Muallem et al., 1988; Ochs et al., 1983). De acuerdo con esta idea, las exposiciones a CCK añadido a una disolución de superfusión libre de Ca2+ (figura 19C) no afectó apreciablemente a la tasa de aumento o la magnitud de los aumentos transitorios de [Ca2+]1 (n = 5). Sin embargo, tal como se muestra en la figura 19C, una reducción en el Ca2+ extracelular redujo la duración de los aumentos transitorios de [Ca2+]1, sugiriendo, tal como se demostró anteriormente (Muallem et al., 1988); Ochs et al., 1983), que el Ca2+ extracelular puede desempeñar un papel en el mantenimiento del componente retrasado de los aumentos transitorios de [Ca2+]1 iniciados mediante la liberación de Ca2+ del RE inducido por CCK.

Respuestas de [Ca2-]1 al GLP-1 en células AR42J. La exposición a GLP-1 provocó respuestas de [Ca2+]1 en aproximadamente el 50% (n = 27) de las células AR42J. Los aumentos transitorios inducidos por GLP-1 (figura 20A) presentaron considerable variabilidad, pero normalmente se desarrollaron a una velocidad más lenta y alcanzaron amplitudes más pequeñas (aumento de 1,5-2,5 veces con respecto a la IFR en reposo) que las respuestas de [Ca2+]1 a CCK. Además, los aumentos transitorios de [Ca2+]1 inducidos por GLP-1 se relajaron a una velocidad más lenta que aquellos inducidos por CCK (figuras 20A frente a 19A y 20B, C). La figura 20B muestra los efectos sobre [Ca2+]1 de la CCK aplicada < 10 min. tras una exposición a GLP-1 en la misma célula. En experimentos de este tipo, los aumentos transitorios inducidos por CCK mantuvieron su configuración característica (como en la figura 19A) pero alcanzaron menores amplitudes. Este último efecto puede atribuirse, por lo menos en parte, a una reducción del contenido en [Ca2+]1, indicado por una reducción en la IFR de nivel inicial, y/o la reducción parcial del contenido en Ca2+ del RE (véase la figura 19). Con la exposición a CCK una segunda vez, las amplitudes fueron incluso menores (figura 20C). El pretratamiento con rianodina (100 µM) y tapsigargina (500 µM) suprimió virtualmente las respuestas de [Ca2+]1 al GLP-1. En su conjunto, estos resultados indican que CCK y GLP-1 tienen acceso a las mismas fuentes intracelulares de Ca2+, presumiblemente el RE, pero tal vez liberan el Ca2+ mediante mecanismos diferentes. La exendina-4, el homólogo del GLP-1 procedente del monstruo de Gila, tuvo efectos idénticos a GLP-1 sobre [Ca2+]1, pero fue aproximadamente un orden de magnitud más potente. El antagonista de GLP-1, exendina 9-39 (Goke et al., 1993), inhibió los aumentos transitorios de calcio inducidos por GLP-1 cuando se utilizó a una concentración 10 veces mayor que GLP-1.

Efectos del glucagón y 8-bromo-AMPc sobre [Ca2-]1 en células AR42J. Las exposiciones a glucagón (10 nM) indujeron respuestas de [Ca2+]1 en el 70% (n = 12) de las células AR42J. Los aumentos transitorios de [Ca2+]1 comenzaron poco después de la exposición al glucagón, se desarrollaron a una velocidad relativamente lenta, presentaron un pico al 200-250% del nivel de IFR en reposo y mostraron una relajación lenta y prolongada (figura 21A). Los aumentos transitorios de [Ca2+]1 inducidos por CCK poco después del tratamiento con glucagón (o con ambos tratamientos añadidos simultáneamente) mostraron una velocidad de aumento atenuada y una velocidad de relajación muy lenta (figura 21B). De forma similar, las exposiciones cortas (60-300 s) a 8-bromo-AMPc 0,1 µM, una forma de AMPc permeable para la membrana, normalmente no afectaron notablemente a la velocidad de aumento de los aumentos transitorios de [Ca2+]1 inducidos por CCK, pero ralentizó notablemente su velocidad de relajación (figura 21C). Anteriormente, se ha demostrado una reducción en la movilización intracelular de [Ca2+]1 con el éster de acetoximetilo de dibutiril-AMPc en presencia de CCK en las células acinares (Kimura et al., 1996).

Unión del GLP-1. La unión específica de 125I-GLP-1, que se determinó mediante el desplazamiento de la unión total por la presencia de GLP-1 frío 500 µM, fue del 0,64 ± 0,16% (n = 9, la cantidad de la unión específica fue significativamente mayor que cero, p<0,01) de radiactividad total añadida y de 27 ± 3,2% (n=9) de unión total. Debido a la baja unión específica, no se realizó un análisis de Scatchard completo.

Niveles de AMPc. Los niveles de AMPc intracelular no se alteraron en las células AR42J mediante el tratamiento de 1 h con GLP-1 (0,1 a 100 nM) o IBMX (100 nM) en presencia o ausencia de CCK (1 nM) o con CCK (0,1 a 100 nM) solo. Aunque IBMX produjo un ligero aumento en los niveles de AMPc, en 3 experimentos, no fue estadísticamente diferente de las células no tratadas con IBMX. El glucagón (10 nM) produjo un aumento de 2 veces en los niveles de AMPc en presencia y ausencia de CCK (figura 22). La exendina-4 (0,1 a 10 nM) no alteró los niveles de AMPc. RT-PCR del receptor de GLP-1. Se detectó la presencia de ARNm de receptores de GLP-1 en las células AR42J utilizando RT-PCR. La figura 23 muestra que utilizando cebadores idénticos a la secuencia conocida de receptores de GLP-1 pancreático (Thorens, 1992), puede detectarse el producto de PCR de tamaño previsto (928 pb; véase Egan et al., 1994) en las células AR24J y en el páncreas de rata, pero no en la PCR del control de agua. La ausencia de cualquier contaminación de ADN genómico se establece ya que los cebadores abarcan secuencias intrónicas que darían bandas de PCR de 1,8 Kbases. No se observaron bandas adicionales correspondientes a la PCR de ADN genómico contaminante en las reacciones de PCR. Las reacciones de PCR se clonaron, se secuenciaron parcialmente y se identificó que eran el receptor de GLP-1 de células beta. Análisis de inmunotransferencia de la expresión de GLP-1. Mediante la utilización de un anticuerpo contra la región N-terminal del receptor de GLP-1, se obtuvieron bandas específicas a 65 y 45 kDa en las células control positivas, las células RIN 1046-38, y en las células AR42J. Se ha mostrado que corresponden a los receptores de GLP-1 maduros y glucosilados en el núcleo, respectivamente (figura 24). Estudios de fosforilación de tirosina. En ausencia de cualquier estimulación, algunas proteínas presentaron un nivel basal de fosforilación que aumentó en presencia de CCK y NaF, pero no de GLP-1 (figura 25). Cuatro proteínas (46, 66, 120 y 190 kDa) se vieron influidas de la manera más obvia en presencia de CCK con por lo menos un aumento de 2 veces en los niveles de fosforilación de esas proteínas. La genisteína disminuyó las fosforilaciones de tirosina inducidas por CCK y disminuyó la liberación de amilasa mediada por CCK, tal como se mostró ya en la figura 18.

Las células AR42J responden de manera fisiológica a CCK según se demuestra mediante la inducción de la liberación de amilasa de manera dependiente de la concentración y un aumento del calcio intracelular. CCK también indujo la fosforilación de tirosina de proteínas tal como se ha mostrado anteriormente (Lutz et al., 1993). La CCK indujo aumentos sustanciales en los sustratos fosforilados de tirosina de 190, 120, 66 y 46 kDa basándose en masas moleculares aparentes cuando se separaron en geles de SDS-poliacrilamida. Ya se han descrito dos de esas fosforilaciones, de 120 y 66 kDa (Id). La inhibición de la fosforilación de tirosina por genisteína inhibió la liberación de amilasa y también disminuyó los acontecimientos de fosforilación de tirosina. Esto sugiere que en las células AR42J, como en las células acinares, que la fosforilación de tirosina está implicada en la secreción de amilasa regulada. La insulina indujo la fosforilación más probablemente de la subunidad beta de su propio receptor en 97 kDa. Anteriormente se ha demostrado que NaF, un activador de las proteínas G bien conocido (Rivard et al., 1995), imita los efectos de la CCK en las células acinares porque aumenta la liberación de amilasa y aumenta la actividad tirosina cinasa en las células acinares (Id.). El NaF imita los efectos de CCK sobre los acontecimientos de fosforilación de tirosina en las células AR42J y por tanto, da credibilidad a la hipótesis que existe una proteína G sensible a fluoruro que funciona como transductor entre el receptor de CCK y la fosforilación de tirosina (Id.). GLP-1 aumentó claramente el calcio intracelular pero no parecía aumentar la liberación de amilasa solo o con CCK en las células AR42J. Se demostró que no hay aumento en AMPc en presencia de GLP-1 a pesar que fue evidente con glucagón. Malhotra et al. (1992), utilizando células acinares de rata, declararon que exendina-4, veneno del monstruo de Gila que es homólogo al GLP-1, potenciaba la liberación de amilasa inducida por CCK y aumentaba el AMPc celular, pero no trataron los efectos del GLP-1. Sin embargo, no se observó el aumento de AMPc hasta que se utilizó exendina-4 10-8 M, concentración a la cual la exendina-4 puede interaccionar a través de otros receptores (Id.). De igual manera, el efecto en la potenciación de la liberación de la amilasa inducida por CCK (desde el 12% de amilasa total liberada por CCK solo frente al 16% con exendina-4 y CCK juntos) se observó con exendina-4 10-8 M y alcanzó significación estadística sólo en el punto de tiempo de 15 min. (p<0,02) del transcurso de tiempo de exposición a CCK durante 1 hora. Los procedimientos pueden no ser lo suficientemente sensibles para escoger un efecto tan pequeño y específico en el tiempo de GLP-1 o exendina-4, si esto se produjese, y, una vez más, el efecto sobre la secreción mostrado por Malhotra et al. puede deberse a la interacción con otros receptores. En las células beta del páncreas, la exendina-4 aumenta la secreción de insulina y AMPc con concentraciones tan bajas como 10-10 M (Goke et al., 1993). Por otro lado, debido a la baja afinidad del receptor, pueden no haberse detectado cambios agudos, pequeños en los niveles de AMPc con GLP-1 . La respuesta de las células AR42J es similar a la observada en las células periféricas (hígado, tejido adiposo y músculo esquelético), que tampoco muestran un aumento en los niveles de AMPc (Valverde y Villanueva-Penacarrillo, 1996). Parece que GLP-1 podría acoplarse o bien a un subtipo de proteína G diferente que en las células beta o bien a otros subtipos de proteínas G. Se ha demostrado que el receptor de CCK se acopla a los subtipos Gi así como a los subtipos Gq en la células acinares (Schnefel et al., 1990). En las células AR42J, GLP-1 puede acoplarse a por lo menos un subtipo Gi y posiblemente a otras subunidades alfa de las proteínas G. En los adipocitos 3T3-L1, en los que GLP-1 aumenta la síntesis de lípidos y la captación de glucosa, se ha demostrado que el receptor de GLP-1 se acopla lo más probablemente a un subtipo Gi (Montrose-Rafizadeh et al., J. Biol. Chem., 1997) y que en las células CHO, que sobreexpresan el receptor de GLP-1, se acopla a otras subunidades alfa (Montrose-Rafizadeh et al., Diabetes, 1997). De forma similar a CCK, la elevación en el calcio intracelular inducida por GLP-1 era desde el retículo endoplasmático. Sin embargo, el patrón de los gradientes de calcio no fue el mismo que con CCK, insinuando que la señalización para la liberación de calcio por CCK era posiblemente diferente que la de glucagón y GLP-1. El GLP-1 no aumentó los acontecimientos de fosforilación de tirosina. Esto demuestra una vez más, la importancia de la fosforilación de tirosina para la liberación de amilasa regulada. Además, demuestra que las rutas independientes de una elevación del calcio intracelular son importantes para la secreción de amilasa. Además, esto se pone en relieve mediante los resultados obtenidos en presencia de tapsigargina y rianodina. Aunque, impidieron cualquier aumento en el calcio intracelular, redujeron, pero no impidieron completamente, la liberación de amilasa inducida por CCK. De este modo, un aumento del calcio intracelular es necesario para la expresión completa de la liberación de amilasa inducida por CCK, pero claramente por sí misma no es suficiente para inducir la liberación de amilasa en las células AR42J.

Cualquier tipo de célula puede contener diversas subunidades beta de la proteínas de unión a GTP (von Weizsacker et al., 1992). Esto podría significar que dependiendo del subtipo activado, por ejemplo, Gq por CCK o GLP-1, Gs por glucagón o GLP-1, o Gi tanto por CCK como por GLP-1, puede liberarse una unidad Gβy diferente. Entonces, podría requerirse una Gβy específica para los acontecimientos de fosforilación de tirosina observados en las células AR42J tal como se describió ya para la activación de proteínas cinasas activadas por mitógeno (Hawes et al., 1995). Además, esto aumenta la posibilidad de que si se liberan dos subunidades Gβy diferentes mediante la acción de una hormona, podrían presentar efectos aditivos o antagonistas sobre diversos acontecimientos posteriores. Los receptores de GLP-1 están presentes en las células AR42J. Su activación por GLP-1 y exendina-4 conduce al aumento del calcio intracelular, probablemente procedente del RE. Sin embargo, su activación no conduce a un aumento en la liberación de amilasa y no se potencia la liberación de amilasa inducida por CCK.

Ejemplo 5 Tal como se trata en el ejemplo 4, los receptores de GLP-1 están presentes en las células AR42J, y el tratamiento con GLP-1 con una única dosis de las células AR42J eleva el calcio intracelular en las células. Además, estudios anteriores mostraron que, aunque la dexametasona estimulaba que las células AR42J llegaran a ser células de tipo acinar (Christophe, 1994), la betacelulina y la activina A convertían aproximadamente el 10% de las células AR42J en células productoras de insulina (Mashima et al., J. Clin. Invest. 1996). De manera similar, tras la exposición al factor de crecimiento de hepatocitos (HGF, también conocido como el factor de dispersión de hepatocitos, (HSF)), aproximadamente el 3% de las células AR42J eran positivas para insulina; en las que la exposición a HGF y activina A dio como resultado aproximadamente el 10% de células positivas para insulina (Mashima et al., Endocrinology, 1996). No se menciona en ninguno de los estudios anteriores relativos o bien a GLP-1 o bien a exendina-4. Además, o bien GLP-1 o bien exendina-4 pueden convertir células AR42J en células productoras de insulina en números bastante mayores que el tratamiento combinado con activina A y betacelulina o el tratamiento combinado con HGF y activina A. El mecanismo del efecto de GLP-1 o exendina-4 puede implicar, como etapa final, la activación de la ruta de ERK/MAPK, ya que la inhibición de la activación de ERK impidió la producción de insulina y glucagón. Materiales. Se obtuvieron las células AR42J de la ATCC (Rockville, MD). GLP-1, exendina-4 y exendina 9-39 (antagonista del receptor de GLP-1) procedían de Bachem (Torrance, CA). Los anticuerpos anti-insulina y anti- glucagón procedían de Linco (Charles, MO). El anticuerpo anti-ERK 1/2 de rata (ERK1-CT) y la proteína básica de mielina (MBP) se adquirieron a Upstate Biotechnology Incorporated (Lake Placid, NY). Los reactivos del radioinmunoensayo de insulina procedían de Peninsula Laboratories (Belmont, CA). Los reactivos de medición de proteínas se obtuvieron de Bio-Rad (Hercules, CA). Los kits de ABC-peroxidasa se obtuvieron de Vector Laboratories (Burlingame, CA). El sistema de RT-PCT de un tubo TianTM se adquirió a Boehringer Mannheim (Indianapolis, IN). Se obtuvo desoxirribonucleasa I de Gibco BRL (Gaithersburg, MD). Los cubreobjetos de vidrio procedían de VWR Scientific (Baltimore MD).

El inhibidor de la proteína cinasa C (PKC) 1-o-hexadecil-2-o-metil-rac-glicerol (PKI), y el inhibidor de MAP cinasa cinasa (MAPKK), PD98059, procedía de Calbiochem (San Diego, CA).

Cultivo celular. Se mantuvieron las células AR42J en medio de Eagle modificado por Dulbecco (DMEM) complementado con un 3% de suero de ternero fetal (FBS), penicilina 100 UI/ml, estreptomicina 100 µg/ml y glutamina 2 mM. Se utilizaron las células del pase 23-35 a lo largo de todo este estudio. Las células se colocaron de manera rutinaria en placas a una densidad de aproximadamente 105 células/ml en placas aglomeradas de 12 pocillos o sobre cubreobjetos y se incubaron en un incubador humidificado a 37ºC con el 95% de aire y el 5% de CO2. Análisis inmunocitoquímico. Se cultivaron las células sobre cubreobjetos de vidrio, se lavaron con solución salina tamponada con fosfato (PBS) para eliminar el suero, y se fijaron con glutaraldehído al 0,5% en PBS. Las células se permeabilizaron con Triton X-100 al 0,2% durante 5 min. y el resto del procedimiento se llevó a cabo a temperatura ambiente en una cámara humidificada. Se utilizó succión para eliminar los reactivos entre cada etapa pero se evitó el secado de las muestras. Se utilizó reactivo suficiente para cubrir cada muestra (normalmente era adecuado aproximadamente 1 ó 2 gotas). Los cubreobjetos se incubaron en H2O2 al 0,3% en PBS durante 30 min. para extinguir la actividad peroxidasa endógena y se lavaron con PBS 3 veces, seguido por la incubación con suero caprino al 2% en PBS durante 30 min. para bloquear la unión no específica de IgG. Se eliminó el suero en exceso mediante secado con papel. Se utilizaron antisueros policlonales primarios específicos (anti-insulina 1:300; anti- glucagón 1:300). Se diluyó el anticuerpo con PBS que contenía suero caprino al 1%. Esto se aplicó al cubreobjetos y se incubó a temperatura ambiente durante 1 hora. Los cubreobjetos se lavaron 3 veces con PBS, cada vez durante 5 min., después se incubaron con anticuerpo secundario biotinilado durante 1 h y se lavaron 3 veces con PBS. Se aplicó el complejo de avidina-biotina-peroxidasa en PBS durante 30 min. El marcaje de la inmunoperoxidasa se realizó con un kit de ABC Vectostain (Vector Labs, Burlingame, CA). Después del lavado extenso con PBS 4-5 veces (cada uno de 5 min.), los cubreobjetos se incubaron en tetraclorhidrato de diaminobencidina (DAB) en PBS, con peroxido de hidrógeno al 0,01% durante 3 minutos. Se detuvo la reacción mediante el lavado de los cubreobjetos y se examinó bajo un microscopio óptico. Para confirmar la tinción específica, se utilizaron las muestras incubadas con anticuerpo primario preabsorbido como control negativo, y se utilizó la línea de células productoras de insulina, células RIN 1046-38, como control positivo para los experimentos. El procedimiento con avidina-biotina-peroxidasa (ABC) se realizó según los procedimientos conocidos en la técnica (Hsu et al., 1981). Medición de insulina inmunorreactiva. Las células AR42J se cultivaron como anteriormente en placas aglomeradas de 12 pocillos. Cuando las células alcanzaron una confluencia del 60%, se trataron con GLP-1 durante 3 días. Al comienzo de los experimentos, se tomó una alícuota del medio con el fin de someter a ensayo la acumulación de insulina en el medio. Luego se lavaron las células dos veces con tampón equilibrado de Krebs-Ringer (KRBB) y se incubaron en el mismo tampón que contenía glucosa 10 mM durante 1 hora más. Se recogió el medio y mantuvo a -20º C hasta que los niveles de insulina se sometieran a ensayo mediante RIA (véase el ejemplo 1: Wang et al., Endocrinology, 1995). Se lavaron las células con PBS y se desprendieron con tripsina al 0,25% y EDTA al 0,02%. Se recogió el sedimento celular y se lisó con ácido fórmico para la determinación de proteínas mediante el procedimiento de Bradford (Bradford, 1976), utilizando globulina bovina como patrón.

Reacción en cadena de la polimerasa y transcripción inversa (RT-PCR). Se aisló el ARN total de las células AR42J tratadas mediante los procedimientos de Chomczynski y Sacchi (1987). Se pretrataron las muestras de ARN total con ADNasa en Tris-HCl 20 mM (pH 8,4), MgCl2 2 mM y KCl 50 mM para eliminar cualquier traza de ADN genómico contaminante. La RT-PCR se realizó en un volumen de 50 µl de tampón que contenía KCl 50 mM, Tris-HCl 10 mM, MgCl2 3,5 mM, dNTP 200 µM cada uno, 0,4 µM de cada uno de los cebadores sentido y antisentido para insulina I y II de rata (cebador sentido de insulina = 5’TGCCCAGGCTTTTGTCAAACAGCACCTT3’; cebador antisentido de insulina = 5’CTCCAGTGCCAAGGTCTGAA 3’). La amplificación se llevó a cabo durante 25 ciclos a una temperatura de desnaturalización de 94ºC durante 1 min., una temperatura de hibridación de 60ºC durante 45 s y una temperatura de extensión de 72ºC durante 1 min. El ARNm de células RIN 1046-38 se utilizaron como control positivo. En el caso de la RT-PCR del glucagón, la temperatura de desnaturalización y extensión fue similar a la de la insulina excepto por la temperatura de hibridación que era de 65ºC durante 1 min. (cebador sentido de glucagón = 5’ GTGGCTGGATTGTTTGTAATGCTGCTG3’; cebador antisentido = 5’ CGGTTCCTCTTGGTGTTCATCAAC3’). Los productos de RT-PCR se visualizaron mediante tinción con bromuro de etidio en geles de agarosa al 2%.

Actividad MAP cinasa. Tras el tratamiento, se lisaron las células confluentes al 80% que se encontraban en placas de 60 mm a 4ºC en tampón de lisis (en mM): TRIS-HCl 50, pH 8, NaCl 150, EDTA 5, NP-40 al 1%, desoxicolato de sodio al 0,25%, NaF 1, pirofosfato de sodio 10, PSMF 0,1, ortovanadato de sodio 1, aprotinina 20 µg/ml y leupeptina 10 µg/ml. Se clarificó el lisado celular mediante centrifugación a 16.000xg a 4ºC durante 20 min. Se inmunoprecipitó el lisado celular clarificado durante la noche a 4ºC, rotando con 4,5 µg de anticuerpo ERK1-CT y 40 µg de resina de agarosa con proteína G + proteína A como relleno (Oncogene Research Product, Cambridge, MA). Se sometió a ensayo el sedimento inmunitario para determinar la actividad MAPK utilizando MBP como sustrato. Se fosforiló MBP (18,6 µg) a 20ºC durante 10 min. en un volumen final de 60 µl que contenía Hepes 20 mM, pH 7,4, MgCl2 10 mM, DDT 1 mM, ATP no marcado 20 µM y 40 µCi (3.000 Ci/mmol) de [32P]-ATP. Se terminó la reacción mediante la adición de 25 µl de tampón de muestra Laemmli 3X y calentando a 70ºC durante 10 min. Se evaluó la actividad MAPK mediante SDS-PAGE y autorradiografía. Los autorradiogramas se cuantificaron por densitometría. Ensayo de amilasa. Para la determinación de amilasa, se lavaron las células para liberarlas del medio con 2 ml de PBS. A continuación, se llevó a cabo la incubación en DMEM que contenía HEPES 15 mM; BSA al 0,2% y inhibidor de tripsina de soja al 0,01%. Se añadió CCK (1 nM) durante 50 min. a 37ºC. Entonces se retiró inmediatamente el medio de incubación para la determinación de amilasa y se lavaron las células de nuevo con 2 ml de PBS enfriado con hielo. Se añadió el tampón de lisado que contenía (en mM) Tris-HCl 130, CaCl2 10, NaCl 75 y Triton X-100 al 0,2% (pH 8,0) a las células y entonces se recogieron los lisados para determinar la amilasa total (Ceska et al., 1969).Se expresó la amilasa liberada como el porcentaje de la amilasa total en las células.

Estadística. Todos los valores de datos se muestran como la media ± EEM, y se analizaron las diferencias entre los grupos tratados mediante un análisis de ANOVA de un factor. Se analizaron las diferencias entre las células tratadas y no tratadas utilizando la prueba de la t de Student. Se consideró p<0,05 como una diferencia significativa.

Efectos del GLP-1 sobre la expresión de insulina y glucagón. Tras el tratamiento con GLP-1 o exendina-4, las células AR42J se convierten en células que contienen insulina. Utilizando el anticuerpo anti-insulina, estaba presente una inmunotinción intensa en las células AR42J. Por el contrario, no se observó inmunotinción en las células AR42J no tratadas con GLP-1. La preabsorción de los anticuerpos con un exceso de insulina y glucagón evitó la tinción (figura 26).

Con GLP-1 1 nM, se convirtió ~ 10% en células positivas para insulina después de 3 días. Cuando se utilizaron GLP-1 10 nM o exendina-4 0,1 nM durante 3 días, ~ 25% de las células AR42J se convirtieron en células positivas para insulina. En algunas zonas de los portaobjetos, láminas completas de células contiguas llegaron a ser positivas para insulina. Apareció una célula positiva para glucagón ocasional tan pronto como a las 24 horas. A las 48 h, el 20% de todas las células AR42J tratadas eran positivas para glucagón, siendo ~ 6% de las células positivas para insulina. A las 72 h, la mitad de todas las células tratadas contenía glucagón. A partir de entonces el número de células que contenía glucagón disminuyó pero aún ~ 25% de las células continuaron siendo positivas para insulina durante por lo menos 7 días (figura 27). La presencia o ausencia de dexametasona en el medio de cultivo no influyó en modo alguno en el número de células que se convirtieron en células “endocrinas” en presencia de GLP-1.

Cuando se añadieron PD98059 (50 µM), un inhibidor selectivo de MEK que fosforila y activa ERK, o PKI (300 µM) simultáneamente con GLP-1, no se produjo la conversión de las células. Liberación de insulina. Después de un periodo de 3 días de tratamiento de las células AR42J con GLP-1 1 nM, se detectó fácilmente insulina en el medio de cultivo mediante radioinmunoensayo. En 3 cultivos separados, estaba presente 5,1 ± 0,4 pg de insulina/µg de proteína (media ± DE) en el medio de cultivo celular a partir del período de tiempo de 60-72 h. Para investigar si la glucosa podría inducir la secreción de insulina a partir de las células no tratadas y tratadas con GLP-1 durante 3 días, se eliminó el medio y las células se lavaron con KRBB libre de glucosa 3 veces. Esto estuvo seguido por la adición de KRBB que contenía glucosa 10 mM durante 1 h y las células se mantuvieron a 37ºC. Se recogió el tampón de incubación y se midió la insulina. La insulina fue cero para las células control, mientras que hubo 0,65 ± 0,15 pg de insulina/µg de proteína presente en el tampón de las células que se habían observado previamente durante 3 días de GLP-1. La secreción de insulina apenas se detectó en presencia de PKI 200 µM o en presencia de PD98059 (50 µM). Análisis mediante RT-PCR. El análisis mediante RT-PCR demostró un ARNm de insulina I y II de rata de 187 pb en células AR42J tratadas con GLP-1 durante 3 días. Las células RIN se utilizaron como control positivo. En este experimento, se trató previamente el ARN con ADNasa, solo se amplificó un fragmento de ARNm de insulina I y II con la longitud prevista, por tanto la banda que apareció a 187 pb fue el producto del ARNm de insulina específico (figura 28A). Por el contrario, no se detectaron productos RT-PCR en el control negativo ni en las células no tratadas con GLP-1. El análisis mediante transferencia de tipo Northern de células AR42J estimuladas con GLP-1 fue ligeramente positivo y por tanto la banda se barrió escasamente. El ARNm de glucagón a 236 pb se detectó en las células AR42J tratadas con GLP-1 a las 48 h (figura 28B). Actividad MAP cinasa. La activación de ERK se detectó fácilmente en las células AR42J. Su actividad aumentó notablemente con GLP-1 y exendina-4, el péptido del veneno del monstruo de Gila, que es homólogo en un 52% con GLP-1 y ha mostrado ser un secretagogo de insulina (Goke., et al 1993). La exendina-4 fue aproximadamente 100 veces más potente que GLP-1 (figuras 29A y 29B). El PKI (300 µM) solo disminuyó la actividad MAPK hasta ser inferior a la de las células control. Cambio de amilasa. La incubación de AR42J con dexametasona durante 72 h aumentó el contenido en amilasa 6,6 veces (12,57 U/I) en las células en comparación con las células no tratadas con dexametasona (1,88 U/I). Cuando se añadió GLP-1 junto con dexametasona, el contenido en amilasa total disminuyó en comparación con el tratamiento con dexametasona sola (7,76 U/I). También disminuyó la respuesta aguda a CCK (1 nM) en las células que se pretrataron con GLP-1 durante 72 h (figura 30). GLP-1 induce a las células AR42J a diferenciarse en células endocrinas pancreáticas, o, como mínimo, en células con características endocrinas. Junto con esta observación, el mismo patrón se produce en el páncreas embrionario en desarrollo (Guz et al., 1995). El glucagón es la primera hormona detectada (Rall et al., 1973). Se postula que las células que contienen glucagón son células precursoras de otros diversos tipos de células endocrinas de los islotes, y que, a su vez, surgieron del epitelio ductal (Guz et al., 1995). Pero los mecanismos que regulan la formación y diferenciación de las células productoras de hormonas pancreáticas todavía están en gran medida indeterminados.

El GLP-1 activa la producción de glucagón muy temprano en las células AR42J y esto va seguido luego de cerca por la producción de insulina. Eventualmente la mayoría de las células AR42J “endocrinas” son células productoras de insulina según disminuye la producción de glucagón. La exendina-4 fue incluso más potente que GLP-1 como factor para la producción de insulina en las células AR42J. Se observaron algunas células que contenían insulina en presencia de concentraciones de tan sólo 10-11 molar de exendina-4. GLP-1 (y/o un péptido similar a GLP-1, tal vez que se asemeja a exendina-4) puede ser un factor de diferenciación en el embrión para los islotes. Se esperaría que un péptido de este tipo estuviera presente en altas concentraciones a nivel local a medida que se están formando el páncreas a partir del intestino primitivo. Se ha planteado la hipótesis de que el glucagón es la señal para la diferenciación de las células beta mediante el aumento de AMPc que conduciría a una disminución de la proliferación celular y a cambios en la síntesis macromolecular, culminando en el fenotipo de las células beta (Rall et al., 1973) Esto todavía podría ser aplicable en las células AR42J. Como el glucagón es la hormona observada por primera vez en este sistema, podría ser la señal para la producción de insulina. El GLP-1 producido en el intestino primitivo podría ser la señal para la expresión de glucagón (y posteriormente la expresión de insulina), que conduciría a la formación adicional de células endocrinas y estructuras similares a los islotes. La ruta final común para la diferenciación en células “endocrinas” en las células AR42J, así como otros tipos de células, es probable que sea a través de la ruta de ERK/MAPK. El GLP-1 o la exendina-4 producen poco o ninguna tinción de insulina en las células AR42J y ninguna de insulina en el medio cuando se inhibe la actividad ERK. Se observa poca cantidad o ninguna de insulina en presencia de GLP-1 y un inhibidor de PKC. Como se conoce que el receptor de GLP-1 se une a la proteína G, está presente en las células AR42J, y eleva el calcio intracelular en las células AR42J (véase el ejemplo 4), su activación mediante la unión de ligandos probablemente conduce a la activación de PKC así como a otros acontecimientos posteriores aún indeterminados (Nishizuka, 1984; Zamponi et al., 1997). PKC, a su vez, ha mostrado ser uno de los factores que activan la ruta de MAPK (Offermanns et al., 1993; Siddhanti et al., 1995). Por lo tanto, bloqueando la activación de PKC mediante GLP-1 probablemente conduzca a la disminución de la actividad MAPK y evite el desarrollo del fenotipo de células “endocrinas”. Además, no todas las células se convierten en células “endocrinas” con GLP-1, incluso con incubaciones durante hasta 7 días. Las células AR42J tratadas presentan tanto propiedades exocrinas como neuroendocrinas, tal como se ha descrito para células AR42J no tratadas (véase Christophe, 1994). Morfológicamente, diversas poblaciones de células tratadas no parecen las mismas. Por tanto, pueden estar presentes subpoblaciones de células en las células AR42J no tratadas. Específicamente, algunas de estas poblaciones pueden presentar el receptor de GLP-1, y otras pueden no presentarlo. Las preparaciones celulares obtenidas a partir de la población total de células AR42J presentan receptores de GLP-1 mediante inmunotransferencia de tipo Western, análisis de PCR y secuenciación parcial. Con la secuenciación, el receptor es idéntico al que se encuentra en las células beta y que ya se ha caracterizado completamente (véase el ejemplo 4). Además, por lo menos el 50% de las células AR42J aumentan el calcio intracelular en respuesta a GLP-1. Por lo tanto, GLP-1 probablemente activa una serie de acontecimientos que requieren un aumento del calcio intracelular y aún otros factores desconocidos hasta el momento que están definitivamente presentes en las células AR42J y los comprometen a que lleguen a ser células “endocrinas”.

Ejemplo 6 Pueden seleccionarse sujetos a los que se les diagnosticó diabetes tipo 1 para el tratamiento con GLP-1 o exendina-4. El procedimiento de tratamiento de Gutniak et al., 1992 puede modificarse de modo que el GLP-1 se administra durante por lo menos veinticuatro horas mediante una cánula en la vena antecubital. La cánula puede conectarse a un sistema de infusión de insulina que bombea entre 0,03 y 4,80 nmoles/kg/min. de GLP-1. Pueden monitorizarse regularmente los niveles de glucosa en sangre, utilizando procedimientos bien conocidos en la técnica, durante la administración de GLP-1 y tras el periodo de veinticuatro horas de administración de GLP-1. Tras veinticuatro horas de infusión de GLP-1, el sujeto muestra niveles de glucosa en sangre que se aproximan a los niveles normales y presenta una necesidad reducida de terapia con insulina.

Alternativamente, pueden tratarse sujetos con diabetes de tipo I con exendina-4 mediante una única inyección subcutánea o mediante inyecciones subcutáneas repetidas diarias de 0,01 nmol/kg a 0,4 nmol/kg. Los niveles de glucosa en sangre pueden monitorizarse regularmente tras la administración de exendina-4. La necesidad de terapia de reemplazo de insulina debe disminuir y los niveles de glucosa en sangre deben aproximarse a los niveles normales. Poniendo en contacto las células con GLP-1 o exendina-4 como se ha descrito anteriormente, debe apreciarse que ambos GLP-1 o exendina-4, secuencias sustancialmente homólogas, o sus fragmentos, podrían utilizarse de manera conjunta.

Referencias

1. Arver et al. 1991. Different aetiologies of type 2 (non-insulin-dependent) diabetes mellitus in obese and nonobese subjects. Diabetologia. 34: 483-487.

2. Bradford. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Annal. Biochem. 72: 248-254.

3. Bressler, R. and Johnson, G.G. 1997. Pharmacological regulation of blood glucose levels in non-insulin dependent diabetes. Arch. Int. Med. 157:836-848.

4. Busik et al. 1997. Glucose-Specific Regulation of Aldose Reductase in Capan-1 Human Pancreatic Dcust Cells In Vitro. J. Clin. Invest. 100: 1685-1692.

5. Ceska et al. 1969. A new and rapid method for the clinical determination of alpha-amylase activities in human serum and urine. Clin. Chim. Acta 26: 437-444.

6. Chen y Drucker. 1997. Tissue-specific expression of unique mRNAs that encode pro-glucagon-derived peptides or exendin-4 in the lizard. J. Biol. Chem. 272: 4108-4115.

7. Chigwin et al. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ridonuclease.

Biochemistry. 18: 5294-5299.

8. Chomczynski y Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate- phenolchloroform extraction. Analyt. Biochem. 162: 156-159.

9. Christophe. 1994. Pancreatic tumoral cell line AR42J: an amphicrine model. Am. J. Physiol. 266: G963-971. 10. De Ore et al. 1997. The effects of GLP-1 on insulin release in young and old rats in the fasting state and during an intravenous glucose tolerance test. J. Geront. 52: B245-249.

11. Drucker et al. 1987. Glucagon -like Peptide 1 stimulates insulin gene expression and increases cyclic AMP in a rat islet cell line Proc. Natl. Acad. Sci. USA. 84: 3434-3438.

12. Egan et al. 1994. Glucagon-like peptide-1 (7-36) amide (GLP-1) enhances insulin-stimulated glucose metabolism in 3T3-L1 adipocytes: one of several potential extrapancreatic sites of GLP-1 action. Endocrinology 135: 2070-2075.

13. Egan et al. 1991. Glucose stimulated insulin release by individual beta cells: potentiation by glyburide. J.

Exp.Med. Biol. 196: 203-210.

14. Elahi, et al. 1994. The insulinotropic actions of glucose-dependent insulinotropic polypeptide (GIP) and glucagonlike peptide-1 (737) in normal and diabetic subjects. Regulatory Peptides. 51: 63-74.

15. Elahi, et al. 1985. The effect of age and glucose concentration on insulin secretion by the isolated perfused pancreas. Endocrinology 116: 11-16.

16. Fehmann y Habener. 1992. Insulinotropic hormone glucagon-like peptide-1 (7-37) stimulation of proinsulin gene expression and proinsulin biosynthesis in insulinoma βTC-1 cells. Endocrinology 130: 159-166.

17. Fehmann et al. 1995. Cell and Molecular Biology of the Incretin Hormones Glucagon-Like Peptide-I and Glucose-Dependent Insulin Releasing Polypeptide. Endocrine Rev. 16:390-410.

18. Ghazzi et al. 1997. Cardiac and glycemic benefits of troglitazone treatment in NIDDM. Diabetes. 46: 433-439.

Care. 15: 270-276.

19. Glisin et al. 1974. Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry. 13: 2633-2637. 20. Goke et al. 1993. Exendin-4 is a potent agonist and truncated exendin-(9-39)-amide an antagonist at the GLP- 1-(7-36)-amide receptor of insulin-secreting β-cells. J.Biol. Chem. 268; 19650-19655.

21. Goldfine et al. 1997. The Endocrine Secretion of Human Insulin and Growth Hormone by Exocrine Glands of the Gastrointestinal Tract. Nature Biotechnology 15:1378-1382.

22. Gromada et al. 1998. Glucagon-Like Peptide 1(7-36) Amide Stimulates Exocytosis in Human Pancreatic β- Cells by Both Proximal and Distal Regulatory Steps in Stimulus-Secretion Coupling. Diabetes 47:57-65.

23. Gutniak et al. 1992. Antidiabetogenic effect of glucagon-like peptide-1 (7-36) amide in normal subjects and patients with diabetes mellitus. N. Engl. J. Med. 326: 1316-1322.

24. Guz et al. 1995. Expression of murine STF-1, a putative insulin gene transcription factor, in β cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121: 11-18.

25. Hawes et al. 1995. Distinct pathways of Gi-and Gq-mediated mitogen-activated protein kinase activation. J.

Biol. Chem. 270: 17148-17153.

26. Holz et al. 1995. Activation of a cAMP-regulated Ca2+ -signaling pathway in pancreatic beta-cells by the insulinotropic hormone glucagon-like-peptide-1. J. Biol. Chem. 270: 17749-17757.

27. Hosokawa et al. 1996. Mechanism of impaired glucose-potentiated insulin secretion in diabetic 90% pancreatectomy rats. Study using glucagonlike peptide-1 (7-37). J. Clin. Invest. 97: 180-186.

28. Hsu et al. 1981. Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: A comparison between (ABC) and unlabeled antibody (PAP) procedures. J. Histochem. Cytochem. 29: 577-580.

29. Janczewski y Lakatta. 1993. Buffering of calcium influx by sarcoplasmic reticulum during the action potential in guinea-pig ventricular myocytes. J. Physiol. 471: 343-363.

30. Kimura et al. 1996. High concentrations of cholecystokinin octapeptide suppress protein kinase C activity in guinea pig pancreatic acini. Peptides 17:917-925.

31. Konnerth et al. 1986. Nonsynaptic epileptogenesis in the mammalian hippocampus in vitro. I. Development of seizurelike activity in low extracellular calcium. J. Neurophysiol. 56: 409-423.

32. Logsdon et al. 1987. Mechanism of glucocorticoid-induced increase in pancreatic amylase gene transcription.

J. Biol. Chem. 262: 15765-15769.

33. Lutz et al. 1993. A role for cholecystokinin-stimulated protein tyrosine phosphorylation in regulated secretion by the pancreatic acinar cell. J. Biol. Chem. 268: 11119-11124.

34. Malhotra et al. 1992. Exendin-4, a new peptide from heloderma suspectum venom, potentiates cholecystokinininduced amylase release from rat pancreatic acini. Regul. Pept. 41: 149-156.

35. Mashima et al. 1996. Betacellulin and activin A coordinately convert amylase-secreting AR42J cells into insulinsecreting cells. J. Clin. Invest. 97:1647-1654.

36. Mashima et al. 1996, Formation of Insulin-Producing Cells from Pancreatic Acinar AR42J Cells by Hepatocyte Growth Factor. Endocrinology 137: 3969-3976.

37. Matschinsky. 1990. Glucokinase as glucose sensor and metabolic signal generator in pancreatic β-cells.

Diabetes. 39: 647-652.

38. Montrose-Rafizadeh et al. 1997. High potency antagonists of the pancreatic glucagon-like peptide-1 receptor.

J. Biol. Chem. 272: 21201-21206.

39. Montrose-Rafizadeh et al. 1994. Incretin hormones regulate glucose-dependent insulin secretion in RIN 1046- 38 cells: mechanism of action. Endocrinology. 135: 589-594.

40. Montrose-Rafizadeh et al. 1997. Evidence of direct coupling of pancreatic GLP-1 receptor to different G- protein alpha subunits. Diabetes 46: 0724a (Abstr.) 41. Montrose-Rafizadeh et al. 1997. Novel signal transduction and peptide specificity of glucagon-like peptide receptor in 3T3-L1 adipocytes. J. Cell. Physiol. 172: 275-280.

42. Muallem et al. 1988. Agonist-sensitive calcium pool in the pancreatic acinar cell. I. Permeability properties.

Am. J. Physiol. 255: G221-228.

43. Mueckler. 1990. Family of glucose-transporter genes. Implications for glucose homeostasis and diabetes.

Diabetes. 39: 6-11.

44. Nathan et al. 1992. Insulinotropic action of glucagonlike peptide-1-(7-37) in diabetic and nondiabetic subjects.

Diabetes Care. 15: 270-276.

45. Nauck et al. 1993. preserved incretin activity of Glucagon-like peptide 1 (7-36) amide but not of synthetic human gastric inhibitory polypeptide in patients with Type-2 diabetes mellitus. J. Clin. Invest.91: 301-307.

46. Nauck et al. 1993. normalization of fasting hyperglycemia by exogenous glucagon-like peptide 1 (7-36) amide in Type 2 (non-insulin-dependent) diabetic patients. Diabetologia. 36: 741-744.

47. Nishizuka. 1984. The role of protein kinase C in cell surface signal transduction and tumor promotion. Nature 308: 693-698.

48. Ochs et al. 1983. Intracellular free calcium concentrations in isolated pancreatic acini: effects of secretagogues. Biochem. Biophys. Res. Commun. 117: 122-128.

49. Offermanns et al. 1993. Stimulation of tyrosine phosphorylation and mitogen-activated-protein (MAP) kinase activity in human SH-SY5Y neuroblastoma cells by carbachol. Biochem. J. 294: 545-550.

50. Orskov. 1992. Glucagon-like peptide-1, a new hormone of the entero-insular axis. Diabetologia. 35: 701-711.

51. Perfetti et al. 1995. Age-dependent reduction in insulin secretion and insulin mRNA in isolated islets from rats.

Am. J. Physiol. 269: E983-990.

52. Physician’s Guide to Insulin Dependent [Type I] Diabetes Mellitus: Diagnosis and Treatment. American Diabetes Association, 1988.

53. Rall et al. 1973. Early differentiation of glucagon-producing cells in embryonic pancreas; a possible developmental role for glucagon. Proc. Nat. Acad. S ci. USA 70: 3478-3482.

54. Ritzel et al. 1995. Pharmacokinetic, insulinotropic, and glucagonostatic properties of GLP-1 [7-36 amide] after subcutaneous injection in healthy volunteers. Dose-response-relationships. Diabetologia. 38: 720-725.

55. Rivard et al. 1995. Novel model of integration of signaling pathways in rat pancreatic acinar cells. Am. J.

Physiol. 269: G352-G362.

56. Saiki et al. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.

Science 239: 487-491.

57. Schaffert et al. 1997. Modification of Blood Group A Expression in Human Pancreatic Tumor Cell Lines by Inhibitors of N-Glycan Processing. Internat’l J. Pancreatology 21: 21-29.

58. Schnefel et al. 1990. Cholecystokinin activates G¡1-, Gi2-, Gi3-and several Gs-proteins in rat pancreatic acinar cells. Biochem. J. 269: 483-488.

59. Siddhanti et al. 1995. Forskolin inhibits protein kinase C-induced mitogen-activated protein kinase activity in MC3T3-E1 osteoblasts. Endocrinology. 136: 4834-4841.

60. Spurgeon et al. 1990. Simultaneous measurement of Ca2+, contraction, and potential in cardiac myocytes.

Am. J. Physiol. 258: H574-H586.

61. Steiner et al. 1972. Radioimmunoassay for cyclic nucleotides II adenosine 3’, 5’-monophosphate and guanosine 3’, 5’-monophosphate in mammalian tissues and body fluids. J. Biol. Chem. 247: 1114-1120.

62. Teitelman. Induction of beta-cell neogenesis by islet injury. Diabetes Metabolism Rev. 12: 91-102, 1996. 63. Thorens. 1992. Expression cloning of the pancreatic beta cell receptor for the gluco-incretin hormone glucagonlike peptide 1. Proc. Natl. Acad. Sci. USA 89: 8641-8645.

64. Thorens et al. 1993. Cloning and functional expression of the GLP-1 receptor: Demonstration that exendin-4 is an agonist and exendin-3(9-39) is an antagonist of the receptor. Diabetes. 42: 1678-1672.

65. Thorens y Waeber.1993. Glucagon-like peptide-1 and the control of insulin secretion in the normal state and in NIDDM. Diabetes. 42: 1219-1225.

66. UK Prospective Study Group. 1995. UK Prospective Diabetes Study 16: Overview of 6 years’ therapy of Type 2 diabetes: A progressive disease. Diabetes . 44: 1249-1258.

67. Vajanaphanich et al. 1995. Cross-talk between calcium and cAMP-dependent intracellular signaling pathways.

J. Clin. Invest. 96: 386-393.

68. Valverde y Villanueva-Penacarrillo. 1996. In vitro insulinomimetic effects of GLP-1 in liver, muscle and fat.

Acta Physiologica Scandinavica 157: 359-360.

69. von Weizsacker et al. 1992. Diversity among the beta subunits of heterotrimeric GTP-binding proteins; Characterization of a novel beta-subunit cDNA. Biochem. Biophys. Res. Commun. 183: 350-356.

70. Wang et al. 1997. Glucagon-like peptides-1 can reverse the age related decline in glucose tolerance in rats. J.

Clin. Invest. 99: 2883-2889.

71. Wang et al. 1995. Glucagon-like peptide-1 affects gene transcription and messenger ribonucleic acid stability of components of the insulin secretory system in RIN 1046-38 cells. Endocrinology. 136: 4910-4917.

72. Wang et al. 1996. GIP regulates glucose transporters, hexokinases, and glucose-induced insulin secretion in RIN 1046-38 cells. Moll. Cell. Endo.116: 81-87.

73. Wang et al. 1995. Glucagon-like peptide-1 is a physiological incretin in rat. J. Clin. Invest. 95: 417-421.

74. Wang et al. 1988. Effects of aging on insulin synthesis and secretion. Differential effects on proinsulin messenger mRNA levels, proinsulin biosynthesis, and secretion of newly made and preformed insulin in the rat. J. Clin. Invest. 81: 176-184.

75. Wang y Rowe. 1988. Age-related impairment in the short term regulation of insulin biosynthesis by glucose in rat pancreatic islets. Endocrinology 123: 1008-1013.

76. Widmann et al. 1996. Desensitization and phosphorylation of the glucagon-like peptide-1 (GLP-1) receptor by GLP-1 and 4-phorbol 12-Myristate 13-acetate. Mol. Endocrinol. 10: 62-75.

77. Wills et al. 1996. Gastric emptying, glucose responses, and insulin secretion after a liquid test meal: effects of exogenous glucagon-like peptide-1-(7-36) amide in Type 2 (non-insulin-dependent) diabetic patients, J. Clin. Endocrinol. Metab. 81: 327-332.

78. Yada et al. Glucagon-like peptide-1-(7-36) amide and a rise in cyclic adenosine 3’, 5’-monophosphate increase cytosolic free Ca2+ in rat pancreatic β-cells by enhancing Ca2+ channel activity. Endocrinology 133: 1685-1692.

79. Zamponi et al. 1997. Crosstalk between G proteins and protein kinase C mediated by the calcium channel alpha 1 subunit. Nature. 385: 442-446.

80. Scharp et al. 1991. Transplant. 51: 76. 81. Warnock et al. 1991. Diabetologia 34: 55.

Listado de secuencias <110> Riccardo Perfetti Antonino Passaniti Nigel Greig Harold Holloway <120> Células productorasa de insulina diferenciadas a partir de células no productoras de insulina mediante GLP-1 o exendina-4 y utilizaciones de las mismas <130> 14014.0346P <150> 60/095, 917 <151> 1998-08-10 <160> 25 <170> FastSEQ para Windows Versión 3.0 <210> 1 <211> 30 <212> PRT <213> Humano <400> 1 <210> 2 <211> 31 <212> PRT <213> Humano <400> 2 <210> 3 <211> 29 <212> PRT <213> Humano <400> 3 <210> 4 <211> 28 <212> PRT <213> Humano <400> 4 <210> 5 <211> 27 <212> PRT <213> Humano <400> 5 <210> 6 <211> 26 <212> PRT <213> Humano <400> 6 <210> 7 <211> 25 <212> PRT <213> Humano <400> 7 <210> 8 <211> 24 <212> PRT <213> Humano <400> 8 <210> 9 <211> 39 <212> PRT <213> Monstruo de Gila <400> 9 <210> 10 <211> 38 <212> PRT <213> Monstruo de Gila <400> 10 <210> 11 <211> 37 <212> PRT <213> Monstruo de Gila <400> 11 <210> 12 <211> 36 <212> PRT <213> Monstruo de Gila <400> 12 <210> 13 <211> 35 <212> PRT <213> Monstruo de Gila <400> 13 <210> 14 <211> 34 <212> PRT <213> Monstruo de Gila <400> 14 <210> 15 <211> 33 <212> PRT <213> Monstruo de Gila <400> 15 <210> 16 <211> 32 <212> PRT <213> Monstruo de Gila <400> 16 <210> 17 <211> 31 <212> PRT <213> Monstruo de Gila <400> 17 <210> 18 <211> 30 <212> PRT <213> Monstruo de Gila <400> 18 <210> 19 <211> 38 <212> ADN <213> Secuencia artificial <220> <223> Cebador oligonucleótido <400> 19 gatggatcct gcagaagctt tttttttttt tttttttt 38 <210> 20 <211> 19 <212> ADN <213> Secuencia artificial <220> <223> Cebador oligonucleótido <400> 20 acaggtctct tctgcaacc 19 <210> 21 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Cebador oligonucleótido <400> 21 aagatgactt catgcgtgcc <210> 22 <211> 28 <212> ADN <213> Secuencia artificial <220> <223> Cebador oligonucleótido <400> 22 tgcccaggct tttgtcaaac agcacctt 28 <210> 23 <211> 20 <212> ADN <213> Secuencia artificial <220> <223> Cebador oligonucleótido <400> 23 ctccagtgcc aaggtctgaa <210> 24 <211> 27 <212> ADN <213> Secuencia artificial <220> <223> Cebador oligonucleótido <400> 24 gtggctggat tgtttgtaat gctgctg 27 <210> 25 <211> 24 <212> ADN <213> Secuencia artificial <220> <223> Cebador oligonucleótido <400> 25 cggttcctct tggtgttcat caac 24

REIVINDICACIONES

1. Procedimiento de diferenciación de células no productoras de insulina, que expresan IDX-1, que portan receptores de GLP-1, en células productoras de insulina, que comprende poner en contacto las células no productoras de insulina in vitro con un factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, polipéptidos que incluyen uno o más aminoácidos adicionales o sustituciones en posiciones distintas de las posiciones 7, 10, 12, 13 y 15 en la secuencia de aminoácidos de GLP-1 sin una pérdida apreciable de actividad funcional en comparación con GLP-1 en cuanto a la capacidad para diferenciar las células productoras de insulina de las células no productoras de insulina, que expresan IDX-1, que portan receptores de GLP-1, o fragmentos de GLP-1 que presentan la secuencia de aminoácidos de una de entre las SEC ID nos: 1 a 8, en el que las células no productoras de insulina son puestas en contacto con el factor de crecimiento durante por lo menos veinticuatro horas. 2. Factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, polipéptidos que incluyen uno o más aminoácidos adicionales o sustituciones en posiciones distintas de las posiciones 7, 10, 12, 13 y 15 en la secuencia de aminoácidos de GLP-1 sin una pérdida apreciable de actividad funcional en comparación con GLP-1 en cuanto a la capacidad para diferenciar células productoras de insulina a partir de células no productoras de insulina, que expresan IDX-1, portadoras de receptor de GLP-1, o fragmentos de GLP-1 que presentan la secuencia de aminoácidos de una de las SEC ID nº: 1 a 8, para su utilización en un procedimiento para tratar la diabetes en un sujeto, que comprende administrar el factor de crecimiento al sujeto para poner en contacto las células no productoras de insulina con el factor de crecimiento, en el que las células no productoras de insulina son puestas en contacto con el factor de crecimiento durante por lo menos veinticuatro horas. 3. Factor de crecimiento para su utilización según la reivindicación 2, en el que el sujeto es un sujeto diagnosticado con la diabetes de tipo I, y en el que el factor de crecimiento es administrado al sujeto por infusión continua durante por lo menos veinticuatro horas. 4. Factor de crecimiento para su utilización según la reivindicación 3, en el que el factor de crecimiento diferencia las células no productoras de insulina, que expresan IDX-1, portadoras de receptor de GLP-1, en células productoras de insulina. 5. Factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, polipéptidos que incluyen uno o más aminoácidos adicionales o sustituciones en posiciones distintas de las posiciones 7, 10, 12, 13 y 15 en la secuencia de aminoácidos de GLP-1 sin una pérdida apreciable de actividad funcional en comparación con GLP-1 en cuanto a la capacidad para diferenciar las células productoras de insulina a partir de las células no productoras de insulina, que expresan IDX-1, portadoras de receptor de GLP-1, o fragmentos de GLP-1 que presentan la secuencia de aminoácidos de una de las SEC ID nº: 1 a 8 para su utilización en un procedimiento para tratar la diabetes en un sujeto, que comprende (a) obtener las células no productoras de insulina, que expresan IDX-1, portadoras de receptor de GLP-1, a partir del sujeto que es tratado; (b) poner en contacto las células no productoras de insulina con el factor de crecimiento, diferenciando así las células no productoras de insulina en células productoras de insulina; y (c) administrar las células productoras de insulina de la etapa (b) al sujeto diabético. 6. Factor de crecimiento seleccionado de entre el grupo que consiste en GLP-1, polipéptidos que incluyen uno o más aminoácidos adicionales o sustituciones en posiciones distintas de las posiciones 7, 10, 12, 13 y 15 en la secuencia de aminoácidos de GLP-1 sin una pérdida apreciable de actividad funcional en comparación con GLP-1 en cuanto a la capacidad para diferenciar las células productoras de insulina a partir de las células no productoras de insulina, que expresan IDX-1, portadoras de receptor de GLP-1, o fragmentos de GLP-1 que presentan la secuencia de aminoácidos de una de las SEC ID nº: 1 a 8 para su utilización en un procedimiento para tratar la diabetes en un sujeto, que comprende (a) obtener las células no productoras de insulina, que expresan IDX-1, portadoras de receptor de GLP-1, a partir de un donante; (b) poner en contacto las células no productoras de insulina con el factor de crecimiento, diferenciando así las células no productoras de insulina en células productoras de insulina; y (c) administrar las células productoras de insulina de la etapa (b) al sujeto diabético.

7. Factor de crecimiento para su utilización según la reivindicación 6, en el que el donante es un cadáver.

8. Procedimiento o factor de crecimiento para su utilización según cualquiera de las reivindicaciones anteriores, en el que las células no productoras de insulina son células pancreáticas. 9. Procedimiento o factor de crecimiento para su utilización según cualquiera de las reivindicaciones, en el que las células no productoras de insulina son células madre pancreáticas.

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015  

E08019260 ES 2 553 108 T3 13-11-2015   ES 2 553 108 T3