2,648 Patentes de octubre de 1997 (pag. 75)

  1. 2369.-

    ACIDOS AMICOS N,N-DISUSTITUIDOS Y SUS SALES DE AMONIO ASI COMO LA UTILIZACION DE ESTOS COMO AGENTES EMULSIONANTES.

    (10/1997)

    LA INVENCION INCLUYE CHAMPUS FORMULADOS, SOLUCIONES SURFACTANTES, SOLUCIONES Y SUSPENSIONES EMULGENTES QUE COMPRENDEN CANTIDADES EFECTIVAS DE SALES DE FORMULA GENERAL (I) EN DONDE R1 Y R2 SON LO MISMO O DIFERENTE Y REPRESENTAN ALQUILO O ALQUENO QUE TIENE DE 8 A 40 ATOMOS DE CARBONO, R3 Y R4 SON LO MISMO O DIFERENTE QUE R1 Y R2, Y R5 Y R6 SON HIDROGENO; O R3, R4, R5, Y R6 SON INDEPENDIENTEMENTE HIDROGENO, ALQUILO O ALQUENO QUE TIENE DE 1 A 40 ATOMOS DE CARBONO CUANDO R1 Y R2 SON ALQUILO O ALQUENO QUE TIENEN 14-22 ATOMOS DE CARBONO; Y X REPRESENTA FENILO ORTO, PARA, O META SUSTITUIDO, O ALQUILENO O ALQUENILENO QUE TIENE...

  2. 2370.-

    FACTOR DE CRECIMIENTO EN RELACION CON TRANSPLANTES ARTIFICIALES.

    (10/1997)
    Solicitante/s: STRID, LARS. Inventor/es: STRID, LARS. Clasificación: A61L27/00, A61K38/06.

    ESTA INVENCION UTILIZA LA ACTIVIDAD BIOLOGICA DEL COMPLEJO DE COBRE DEL PEPTIDO DE GLICIL-L-HISTIDIL-L-LISINA. ESTE PEPTIDO ESTA ENLAZADO COVALENTEMENTE A TRANSPLANTES ARTIFICIALES DONDE TIENE UN EFECTO QUIMIOATRACTIVO Y TAMBIEN ACTUA CUANDO ES LIBERADO POR HIDROLISIS DE LOS TRANSPLANTES. EL PEPTIDO AUMENTA LA SINTESIS DE SINTESIS DE COLAGENO POR LO QUE PERMITE UNA SUSTITUCION MAS RAPIDA DE LOS TRANSPLANTES CON TEJIDO HUMANO.

  3. 2371.-

    ENSAYO INMUNOCROMATOGRAFICO Y METODO PARA UTILIZAR EL MISMO.

    (10/1997)
    Solicitante/s: PACIFIC BIOTECH INC. Inventor/es: HUANG, CHING, FAN, EUGENE, CHEN, FON-CHIU, MIA, WANG, DOU-MEI, WILSON, GREGG, L., MILNER, MICHAEL, W. Clasificación: C12Q1/00, G01N33/53, G01N33/551, G01N33/546.

    LA INVENCION EXPUESTA SE REFIERE AL CAMPO DE PRUEBAS DE UN SOLO PASO Y A LAS PRUEBAS DE AGLUTINACION DE LATEX ("LAT"), Y PROPORCIONA UN METODO PERFECCIONADO DE PREPARACION Y USO DE PRUEBAS DE INMUNIDAD DE UN PASO, ASI COMO DE METODOS PERFECCIONADOS DE PREPARACION DE PARTICULAS DE LATEX CUBIERTAS PARA UTILIZAR EN PRUEBAS DE DIAGNOSTICO Y, ESPECIALMENTE, EN PRUEBAS INMUNOCROMATOGRAFICAS.

  4. 2372.-

    MAQUINA PARA CORTAR EN BANDAS, ENCOLAR Y BOBINAR LOS CARTELES PARA PANELES PUBLICITARIOS DE PRISMA GIRATORIOS.

    (10/1997)
    Solicitante/s: AVENIR FRANCE. Inventor/es: CHABANIS, CLAUDE, DANGOISSE, JEAN-PAUL. Clasificación: G09F15/02, B65H37/04, G09F11/02.

    LA INVENCION SE REFIERE A UNA MAQUINA DE CORTAR EN TIRAS, EN PEGAR SOBRE PELICULA ADHESIVA DE DOBLE CARA Y EN RECONSTITUIR EN BOBINAS LOS CARTELES DESTINADOS A LOS PANELES PUBLICITARIOS DE PRISMAS ROTATIVAS. COMPRENDE UNA PLACA QUE RECIBE UN CARTEL ENTERO, PROVISTA DE TOPES DE IGUALADO Y DE GUIA , UNA CAJA DE ASPIRACION MOVIL ASOCIADO A DOS CREMALLERAS PARA HACER AVANZAR PASO A PASO, GOTAS PARA APLICAR EL CARTEL SOBRE LA CINTA ADHESIVA , UNA CUCHILLA CIRCULAR PARA CORTAR LAS TIRAS DE CARTEL, UN SISTEMA DE CORTE TRANSVERSAL DE LA CINTA ADHESIVA SOLA, UNA BOBINA MOTORIZADA SOBRE LA QUE SE ENROLLAN UNO DETRAS DE OTRO LAS TIRAS DE CARTELES CON ADHESIVO, SIENDO CONTROLADAS DICHAS FASES POR MEDIOS ELECTRONICOS.

  5. 2373.-

    PROCEDIMIENTO PARA LA REALIZACION DE UN LACADO DE VARIAS CAPAS Y LACAS BASE ACUOSAS ADECUADAS PARA ESTE PROCEDIMIENTO.

    (10/1997)
    Solicitante/s: BASF COATINGS AKTIENGESELLSCHAFT. Inventor/es: SCHWARTE, STEPHAN, PIONTEK, SUSANNE, LASSMANN, WALTER, POTH, ULRICH, NIEMANN, JURGEN, EIKELMANN, KLAUS, DOBBELSTEIN, ARNOLD. Clasificación: B05D7/26.

    LA INVENCION SE REFIERE A UNA LACA BASE PARA LA ELABORACION DE LACADOS DEL TIPO BASECOAT-CLEARCOAT, QUE CONTIENEN UNA RESINA POLIACRILATO DILUIBLE EN AGUA QUE ES OBTENIBLE EN EL QUE UNA PRIMERA ETAPA, LOS MONOMEROS NO SATURADOS ETILENICAMENTE, LIBRES DE GRUPOS CARBOXILO, SE POLIMERIZAN EN UN DISOLVENTE ORGANICO Y, DESPUES DE LA TRANSFORMACION DE AL MENOS EL 80 % EN PESO DE ESTOS MONOMEROS, SE POLIMERIZAN LOS MONOMEROS CONTENIENDO GRUPOS CARBOXILO EN UNA SEGUNDA ETAPA Y SE NEUTRALIZA LA RESINA POLIACRILATO ASI OBTENIDA.

  6. 2374.-

    LAMINA DE CAPAS MULTIPLES, QUE CONSTA PARCIALMENTE DE ALMIDON.

    (10/1997)
    Solicitante/s: BIO-TEC BIOLOGISCHE NATURVERPACKUNGEN GMBH. Inventor/es: TOMKA, IVAN. Clasificación: C08J5/18, C08B30/12, C08L3/02, B32B9/00.

    UNA LAMINA DE UNA O MULTIPLES CAPAS CON UNA PERMEABILIDAD AL GAS ESENCIALMENTE REDUCIDA TIENE POR LO MENOS UNA CAPA COMPUESTA POR LO MENOS EN PARTE DE UN ALMIDON ESENCIALMENTE TERMOPLASTICO. PARA OBTENER UNA LAMINA DE UNA SOLA O MULTIPLES CAPAS QUE ES POR LO MENOS CASI COMPLETAMENTE INSENSIBLE A LA HUMEDAD, LA CAPA UNICA TIENE POR LO MENOS UN POLIMERO HIDROFOBICO ADICIONAL, TAL COMO POLIOLEFINA, QUE ES MEZCLADO CON EL ALMIDON DURANTE LA PRODUCCION DE LA CAPA UNICA, Y/O EL ALMIDON ES POR LO MENOS PARCIALMENTE RETICULADO EN LA SUPERFICIE DE LA CAPA UNICA Y/O LA CAPA UNICA SE CUBRE CON POR LO MENOS OTRA CAPA QUE ES CASI COMPLETAMENTE INSENSIBLE A LA HUMEDAD.

  7. 2375.-

    COMPOSICION PARASITICIDA Y METODOS PARA SU FABRICACION Y UTILIZACION.

    (10/1997)
    Solicitante/s: MALLINCKRODT VETERINARY, INC.. Inventor/es: GLADNEY, JULIE, G., SEYMOUR, DAVID, S. Clasificación: A01N53/00.

    SE DESCRIBE UNA COMPOSICION DE FASE LIQUIDA DE UN PIRETROIDE EN CONCENTRACIONES MAYORES DEL 50% EN PESO/PESO QUE SE PUEDE UTILIZAR COMO BASE PARA OTRAS FORMULACIONES QUE CONTIENEN PIRETROIDES EN FASES FISICAS DISTINTAS DE LA FASE LIQUIDA. TAMBIEN SE DESCRIBE UN METODO DE TRATAMIENTO MEDIANTE EL USO DE LA COMPOSICION EN MAMIFEROS DOMESTICOS.

  8. 2376.-

    PROCEDIMIENTO PARA LA PREPARACION DE UNA LAMINA COLOREADA COMPUESTA TERMOPLASTICA PARA ESTRUCTURAS LAMINADAS.

    (10/1997)
    Solicitante/s: E.I. DU PONT DE NEMOURS AND COMPANY. Inventor/es: PHILLIPS, THOMAS, RICHARD, VALLABHANENI, SIVA, VENKATA. Clasificación: B32B17/10, B44C1/17, B44C1/165.

    SE PRESENTA UN PROCESO DE TRANSFERENCIA SIN SOLVENTES PARA LA OBTENCION DE UNA HOJA A COLOCAR ENTRE CAPAS, UNIFORMEMENTE COLOREADA, QUE TENGA UNA SUPERFICIE RUGOSA O ESTAMPADA, EN DONDE UN REVESTIMIENTO COMPUESTO QUE CONSISTE EN UNA CAPA QUE CONTIENE PARTICULAS DE PIGMENTOS CRISTALINAS SOLIDAS MUY DIVIDIDAS DISPERSAS EN UN AGLUTINANTE DE RESINA Y AL MENOS UNA CAPA NO PIGMENTADA ES TRANSFERIDO DE UNA PELICULA PORTADORA A LA HOJA. LA TRANSFERENCIA DEL REVESTIMIENTO SE LLEVA A CABO AL TIEMPO QUE SE MANTIENEN LAS PARTICULAS DE PIGMENTOS EN LA FASE CRISTALINA SOLIDA Y SE MANTIENE LA SUPERFICIE RUGOSA DE LA HOJA.

  9. 2377.-

    POLIMEROS COMO MEDIOS DE CONTRASTE PARA LA FORMACION DE IMAGENES POR RESONANCIA MAGNETICA.

    (10/1997)
    Solicitante/s: IMARX PHARMACEUTICAL CORP.. Inventor/es: UNGER, EVAN, C.. Clasificación: A61K49/00, A61B5/05, A61K33/40, G01N31/00, G01N24/00.

    SE DESCRIBEN MEDIOS CONTRASTANTES NUEVOS PARA SU USO EN LA FORMACION DE IMAGENES POR RESONANCIA MAGNETICA. TALES AGENTES CONTRASTANTES ESTAN FORMADOS POR POLIMEROS BIOCOMPATIBLES BIEN SOLOS BIEN EN MEZCLA CON UNO O MAS AGENTES CONTRASTANTES TALES COMO LOS AGENTES PARAMAGNETICOS, SUPERPARAMAGNETICOS O DE DENSIDAD PROTONICA. ADICIONALMENTE, SE PUEDEN MEZCLAR LOS POLIMEROS O POLIMERO Y EL AGENTE CONTRASTANTE CON UNO O MAS GASES BIOCOMPATIBLES PARA INCREMENTAR LA RELAJABILIDAD DE LA PREPARACION RESULTANTE.

  10. 2378.-

    ANALOGOS DE TROMBOMODULINA RESISTENTES A LA OXIDACION.

    (10/1997)
    Solicitante/s: SCHERING AKTIENGESELLSCHAFT. Inventor/es: MORSER, MICHAEL, JOHN, LIGHT, DAVID, RICHARD, GLASER, CHARLES, B. Clasificación: C12N15/12, A61K38/36, C07K14/745.

    SE PRODUCEN ANALOGOS NUEVOS DE TROMBOMODULINA RESISTENTES A LA OXIDACION, SOLUBLES PARA VARIOS USOS TERAPEUTICOS Y OTROS TIPOS DE USOS, TALES COMO EN LAS TERAPIAS DE ENFERMEDADES TROMBOTICAS Y VASCULARES. ESTOS ANALOGOS MUESTRAN LAS PROPIEDADES TERAPEUTICAS CARACTERISTICAS DE LA TROMBOMODULINA NATURAL, SIN EMBARGO SON SOLUBLES Y NO SE INACTIVAN TRAS HABER SIDO EXPUESTAS A OXIDANTES. ALGUNOS DE LOS ANALOGOS DESCRITOS SON PROTEINAS DE FUSION MULTIFUNCIONALES QUE TIENEN TANTO ACTIVIDAD ANTITROMBOTICA COMO ALGUNA BIOACTIVIDAD ADICIONAL.

  11. 2379.-

    TERAPIA ANTIVIRAL.

    (10/1997)
    Solicitante/s: THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY UNITED STATES DEPARTMENT OF COMMERCE. Inventor/es: HOOKS, JOHN, J., EVANS, CHARLES, H., DETRICK, BARBARA. Clasificación: C07K14/00, A61K38/00.

    UN METODO DE TRATAMIENTO DE UNA INFECCION VIRICA DE UN ANIMAL INCLUYE LA ADMINISTRACION DE UNA COMPOSICION QUE CONTIENE LEUCORREGULINA SOLA O EN COMBINACION CON UN AGENTE QUIMIOTERAPEUTICO ANTIVIRICO Y/O UN PORTADOR FARMACEUTICO.

  12. 2380.-

    APARATO PARA ORIENTAR LA LUZ BIDIRECCIONALMENTE.

    (10/1997)

    SE MUESTRA UN CONJUNTO DE DIRECCION OPTICA QUE INCLUYE ELEMENTOS DE DIRECCION PRIMERO Y SEGUNDO PARA REEXPEDIR LUZ EN ALCANCES OPTICOS DE IDA Y VUELTA SIN QUE EXISTA CRUCE. LA LUZ DE ENTRADA QUE VIAJA EN LA PRIMERA DIRECCION (7A) SE DIRIGE DESDE EL PRIMER LATERAL (61A) DEL PRIMER ELEMENTO AL PRIMER LATERAL (71A) DEL SEGUNDO ELEMENTO, SUFRIENDO DOS DEFLEXIONES DE DIRECCION ORTOGONAL A UN ALCANCE DE SALIDA REEXPEDIDO (8A). LA LUZ DE RETORNO A LO LARGO DEL MISMO ALCANCE O DE UNO ADYACENTE (8B) SE DIRIGE EN EL SEGUNDO LATERAL (61B) DE UN ELEMENTO AL SEGUNDO LATERAL (71B) DEL OTRO ELEMENTO. LA LUZ DE RETORNO...

  13. 2381.-

    MEJORAS INTRODUCIDAS EN ADAPTADORES PARA ENCHUFES ELECTRICOS.

    (10/1997)
    Solicitante/s: HOSSACK, SIMON. Inventor/es: HOSSACK, SIMON. Clasificación: H01R31/06, H01R31/00.

    LA INVENCION ESTA RELACIONADA CON UN ADAPTADOR CAPAZ DE RETENER UN ENCHUFE MOLDEADO EN SU INTERIOR. EL ADAPTADOR COMPRENDE PRIMERA Y SEGUNDA PARTE UNIDAS DESMONTABLEMENTE ENTRE SI Y ENTRE LAS QUE SE RETIENE EL ENCHUFE . SE DESCRIBEN VARIAS CARACTERISTICAS Y MEJORAS QUE: (A) PERMITEN LA INSERCION DEL ENCHUFE CUANDO LA PRIMERA Y LA SEGUNDA PARTE ESTAN FIJAS ENTRE SI, PERO SOLO SU EXTRACCION CUANDO ESTAN SEPARADAS; (B) SOLAMENTE SE COMPLETA EL CIRCUITO ELECTRICO CUANDO LAS PARTES ESTAN FIJAS DE ESTE MODO; (C) SOLAMENTE SE PERMITE LA SEPARACION DE LAS PARTES CUANDO EL ADAPTADOR NO ESTA ENCHUFADO EN UN ZOCALO; O (D) SOLAMENTE SE PERMITE LA EXTRACCION DEL ENCHUFE MOLDEADO CUANDO EL ADAPTADOR NO ESTA ENCHUFADO EN UN ZOCALO.

  14. 2382.-

    SISTEMA DE SINCRONIZACION DE CAMPO CON CONTROL DE INDICADOR DE ESCRITURA/LECTURA.

    (10/1997)

    UN SISTEMA DE SINCRONIZACION DE CAMPO PARA SEÑALES DE VIDEO ASINCRONAS COMPRENDE UN VISUALIZADOR DE VIDEO SINCRONIZADO CON UNA SEÑAL DE VIDEO PRIMERA QUE TIENE UN COMPONENTE DE VALOR DE LINEA PRIMERO Y UN COMPONENTE DE VALOR DE CAMPO PRIMERO. UNA SEÑAL DE VIDEO SEGUNDA QUE POSEE UN COMPONENTE DE VALOR DE LINEA SEGUNDO SE ALMACENA PRIMERAMENTE EN UNA MEMORIA DE CAMPO, QUE TIENE PUERTOS DE GRABACION Y LECTURA SINCRONOS. LA SEÑAL DE VIDEO SEGUNDA ES POSTERIORMENTE ACELERADA EN UN MEMORIA DE LINEA MULTIPLE QUE POSEE PUERTOS DE GRABACION Y ESCRITURA ASINCRONOS Y PUNTEROS DE GRABACION Y LECTURA REINICIALIZABLES...

  15. 2383.-

    SUSPENSIONES OFTALMICAS.

    (10/1997)
    Solicitante/s: INSITE VISION, INC. Inventor/es: ROBINSON, JOSEPH, R., DAVIS, JEFFERY, P., CHANDRASKARAN, SANTOSH, KUMAR, SU, YANSHENG DORMITORY BUILDING 40, ARCHIBALD, ROY, D. Clasificación: A61K9/00, A61K47/32.

    LOS POLIMEROS LIGERAMENTE ENLAZADOS, PREFERIBLEMENTE LOS QUE SE PREPARAN MEDIANTE POLIMERIZACION DE SUSPENSION O EMULSION DE AL MENOS UN 90% DE UN MONOMERO MONOETILENICAMENTE INSATURADO QUE CONTENGA CARBOXIL TAL COMO EL ACIDO ACRILICO CON ENTRE EL 0.1 Y 5% DE UN AGENTE ENLAZADOR POLIFUNCIONAL, Y PREFERIBLEMENTE DIFUNCIONAL, TAL COMO EL GLICOL DE DIVINIL, QUE TENGA UN TAMAÑO DE PARTICULA NO MAYOR A 50 (MU)M EN UN DIAMETRO ESFERICO EQUIVALENTE, CUANDO SE FORMULAN CON UN MEDICAMENTO OFTALMOLOGICO, EN SUSPENSION EN UN MEDIO ACUOSO EN EL QUE LA CANTIDAD DE POLIMERO OSCILA ENTRE UN 0.1 Y UN 6.5%, EN BASE AL PESO TOTAL DE LA SUSPENSION ACUOSA, EL PH SE ENCUENTRA ENTRE EL 3.0 Y 6.5, Y LA PRESION OSMOTICA ES DE ENTRE 10 OSM Y 400 OSM, SUMINISTRAN NUEVOS SISTEMAS DE LIBERACION DE MEDICAMENTOS OFTALMOLOGICOS QUE TENGAN VISCOSIDADES ADECUADAMENTE BAJAS QUE PERMITEN QUE SEAN FACILMENTE ADMINISTRADOS EN EL OJO EN FORMA DE GOTAS.

  16. 2384.-

    CARBAMATOS DE INDANO PIRROLIDINA.

    (10/1997)
    Solicitante/s: PFIZER INC.. Inventor/es: CHEN, YUHPYNG, L.. Clasificación: A61K31/40, C07D209/70.

    COMPUESTOS DE LA FORMULA (I) EN DONDE W ES (A) O (B) Y R7, R8, R9, R10, R11, R6, R5 Y R1 SON COMO SE DESCRIBE AQUI DENTRO.

  17. 2385.-

    DISPOSITIVO PARA LA PREVENCION DE LLAGAS.

    (10/1997)

    UN DISPOSITIVO PARA LA PREVENCION DE LLAGAS POR PRESION EN UN PACIENTE (P) QUE COMPRENDE UNA SUPERFICIE DE APOYO FLEXIBLE DEFINIDA POR UNA PLURALIDAD DE ELEMENTOS DE APOYO DISCONTINUOS QUE ESTAN SEPARADOS POR MEDIOS EN FORMA DE CANALES , PARA LA CIRCULACION DEL AIRE, ADYACENTES A LA SUPERFICIE DE APOYO . EL DISPOSITIVO COMPRENDE UN CUERPO PLASTICO DE ESPUMA INTEGRAL QUE TIENE UNA RETARDANCIA A LA COMBUSTION SEGUN EL PUNTO 5 DE FUENTE DE IGNICION, 2 5852; SIENDO LOS ELEMENTOS DISCONTINUOS , CUANDO EL DISPOSITIVO ES UN DISPOSITIVO SEMEJANTE A UN COLCHON ALARGADO, SOPORTES O LISTONES ALARGADOS...

  18. 2386.-

    PROCEDIMIENTO PARA LA PREPARACION DE 17-OXO-ESTEROIDES.

    (10/1997)
    Solicitante/s: SCHERING AKTIENGESELLSCHAFT. Inventor/es: WEBER, ALFRED, NICKISCH, KLAUS, KENNEKKE, MARIO, KLAGES, UWE, ROHDE, RALPH. Clasificación: C12P33/16.

    SE DESCRIBE UN METODO PARA LA PREPARACION DE 17-OXOESTEROIDES MEDIANTE LA OXIDACION FERMENTATIVA DE 17 (BETA)-HIDROXIESTEROIDES , CARACTERIZANDOSE EN QUE SE UTILIZA PARA LA FERMENTACION UN CULTIVO BACTERIANO DE LAS ESPECIES MYCOBACTERIUM SPEC. NRRL B-3805, MYCOBACTERIUM SPEC NRRL B-3683, MYCOBACTERIUM PHLER NRRL B-8154 O MYCOBACTERIUM FORTITUM NRRL B-8153.

  19. 2387.-

    METODO PARA EL DIAGNOSTICO DEL VIRUS DEL PAPILOMA HUMANO TIPO 16 UTILIZANDO LA REACCION EN CADENA DE LA POLIMERASA.

    (10/1997)
    Solicitante/s: THE ROYAL FREE HOSPITAL SCHOOL OF MEDICINE. Inventor/es: EMERY, VINCENT CLIVE, BAVIN, PEGGY JANE, WALKER, PATRICK. Clasificación: C12Q1/68, C07H21/04, C12P19/34, C12Q1/70.

    EL INVENTO OFRECE OLIGONUCLEOTIDOS (A): 5' GGGGTCGGTGGACCGGTCGATGTA 3' Y (B): 5' GGGCTCTGTCCGGTTCTGCTTGTC 3' Y SUS DERIVADOS. ESTOS OLIGOS PUEDEN UTILIZARSE COMO UN PAR DE INICIADORES PARA LA DETECCION DE ADN DE HPV16 (VIRUS DE PAPILOMA HUMANO TIPO 16) EN UNA MUESTRA, SIN QUE SURJAN POSITIVOS FALSOS DEBIDO A LA PRESENCIA DE OTRAS CEPAS HPV. SE MUESTRAN EQUIPOS QUE CONTIENEN LOS INICIADORES Y EL USO DE LOS INICIADORES PARA SELECCIONAR POBLACIONES.

  20. 2388.-

    PIPERAZINAS 1,4-DISUSTITUIDAS.

    (10/1997)

    UN COMPUESTO DE PIPERACINA DISUSTITUIDA CON LA FORMULA (I), EN DONDE R1 ES UN HALOGENO, METOXIDO, ALQUILO DE C1-6 TRIFLUOROMETILO Y R2 ES METILO O UN ALQUILO DE C1-8 SUSTITUIDO, ALQUENILO DE C3-8 O CICLOALQUILO DE C3-8, DONDE LOS SUSTITUYENTES PUEDEN SER HIDROXIDOS, GRUPOS OXIMINO O CETO EN UNA POSICION QUE LLEVA A UNA AMINA TERCIARIA ESTABLE: O R2 ES UN ALQUILO DE C1-8 RAMIFICADO O NO, O UN ALQUENILO DE C3-8 EL CUAL EN ALGUNA POSICION PUEDE ESTAR SUSTITUIDO COMO ARRIBA, PERO ESTA SUSTITUIDO TERMINALMENTE CON UNO DE LOS SIGUIENTES GRUPOS: CIANO, UN ALCOXI C1-4 SUSTITUIDO OPCIONALMENTE POR UN ALCOXI...

  21. 2389.-

    NEUMATICO DOTADO DE UNA BANDA DE RODADURA QUE TIENE NERVADURAS LATERALES CUYA SUPERFICIE ESTA RADIALMENTE RETRAIDA CON RESPECTO A LAS OTRAS NERVADURAS.

    (10/1997)
    Solicitante/s: COMPAGNIE GENERALE DES ETABLISSEMENTS MICHELIN-MICHELIN & CIE. Inventor/es: LUROIS, PATRICK. Clasificación: B60C9/20, B60C11/04, B60C11/01.

    CON EL FIN DE MEJORAR LA RESISTENCIA A LA SEPARACION ENTRE LOS EXTREMOS DE LAS CAPAS DE TRABAJO (31 A 34) DE UNA ARMADURA DE CUMBRE Y ENTRE LOS BORDES DE ESTA ARMADURA Y LA ARMADURA DE CARCASA RADIAL , DICHAS CAPAS TIENEN ANCHOS AXIALES DIFERENTES ENTRE SI Y AL MENOS DOS ANCHOS SON SUPERIORES A LA DISTANCIA AXIAL (L) QUE SEPARA LOS EJES MEDIANOS (XX') DE LAS DOS RANURAS LATERALES , LAS MAS CERCANAS DE LOS BORDES DE LA BANDA DE RODADURA Y QUE DELIMITAN REGIONES LATERALES DONDE LA BANDA DE RODADURA TIENE UN PERFIL MERIDIANO RADIALMENTE RETIRADO HACIA ATRAS RESPECTO DEL PERFIL MERIDIANO DE LA ENVOLTURA GEOMETRICA DE SU ZONA MEDIANA.

  22. 2390.-

    PROCEDIMIENTO PARA LA PREPARACION ENZIMATICA DEL FACTOR DE CRECIMIENTO DE LOS FIBROBLASTOS.

    (10/1997)
    Solicitante/s: PHARMACIA & UPJOHN S.P.A.. Inventor/es: PAUL, FRANCOIS, BETBEDER, DIDIER, SARMIENTOS, PAOLO, MONSAN, PIERRE. Clasificación: C07K1/00, C12P21/06.

    UN BFGF SE PREPARA A BASE DE: (I) FORMAR UN ADUCTO ENTRE HEPARINA O SULFATO DE HEPARANO Y UN BFGF QUE TIENE EL ENLACE 9-10 LEU-PRO; (II) TRATAR EL ADUCTO CON PEPSINA A O CATEPFINA D, DISOCIANDO ASI EL ENLACE ANTEDICHO; Y (III) LIBERAR DEL ADUCTO EL BFGF ASI OBTENIDO. ESTE PROCESO PUEDE SER APLICADO PARA PREPARAR LA FORMA AMINOACIDA 146 DEL BFGF A PARTIR DE FORMAS MAS LARGAS DEL BFGF. TAMBIEN SE PUEDE UTILIZAR PARA PRODUCIR UNA SOLA FORMA DEL BFGF A PARTIR DE UNA MEZCLA DE BFGFS CUYAS SECUENCIAS AMINOACIDAS SOLO DIFIEREN PORQUE TIENEN N-TERMINOS DIFERENTES.

  23. 2391.-

    ENFRIAMIENTO SUBITO DE REACTOR PARA LA HIDRATACION CATALITICA DE OLEFINAS DURANTE LA PRODUCCION DE ETERES.

    (10/1997)
    Solicitante/s: MOBIL OIL CORPORATION. Inventor/es: YURCHAK, SERGEI, BEECH, JAMES, HARDING, JR., STOOS, JAMES, ARTHUR, WONG, STEPHEN SUI FAI, JURONG REFINERY. Clasificación: B01J8/04, C07C29/04, C07C41/05.

    UN PROCESO PARA LA PRODUCCION DE ETER POR HIDRATACION CATALITICA Y ETERIFICACION DE ALMACENAMIENTOS OLEFINICOS QUE CONTIENEN AL MENOS UN ALQUENO INFERIOR, CONTACTANDO EL ALMACENAMIENTO OLEFINICO Y AGUA EN UNA DIVERSIDAD DE ZONAS DE REACCION CATALITICA QUE CONTIENEN UN CATALIZADOR DE ETERIFICACION E HIDRATACION DE OLEFINAS ACIDAS DE OXIDO DE METAL SOLIDO Y POROSO BAJO CONDICIONES DE HIDRATACION Y ETERIFICACION. SE CONSIGUE UNA OPERACION MEJORADA RECUPERANDO UNA CORRIENTE DE CHORRO DESDE AL MENOS UNA ZONA DE LECHO DE HIDRATACION PREFIJADA; DIVIDIENDO LA PRIMERA CORRIENTE DE CHORRO EN UNA CORRIENTE RECUPERADA DE PRODUCTO Y UNA VARIEDAD DE CORRIENTES RECICLADAS; Y PASANDO AL MENOS UNA PARTE DE LAS CORRIENTES RECICLADAS ENFRIADAS QUE CONTIENEN OLEFINAS, ALCOHOL Y ETER ENTRE LA CORRIENTE DE CHORRO COMPONENTE EN PROPORCIONES PARA REDUCIR AL MENOS UNA ZONA DE LECHO DE REACCION PREFIJADA A LO LARGO CON CHORRO CALIENTE DE LA ZONA DE REACCION PRECEDENTE.

  24. 2392.-

    PROCEDIMIENTO PARA OBTENER MATERIAL DE SILICIO NITRURABLE.

    (10/1997)
    Solicitante/s: EATON CORPORATION. Inventor/es: EDLER, JAMES, P., LISOWSKY, BOHDAN. Clasificación: C04B35/591.

    UN PROCESO PARA PREPARAR UN MATERIAL QUE CONTIENE SILICIO NITRURABLE; PROCESO QUE INCLUYE (A) LA PULVERIZACION DE UNA MASA ACUOSA ESPESA DE MATERIAL PULVERIZADO DE SILICIO, AGUA, AL MENOS UN ACIDO DE DENSIFICACION, QUE INCLUYE AL2O3, Y OTRO ACIDO DE DENSIFICACION, LA PULVERIZACION SE REALIZA PARA PROVOCAR UNA REACCION QUIMICA SUBSTANCIAL ENTRE EL SILICIO Y EL AGUA; Y (B) LA REDUCCION DEL CONTENIDO DE AGUA DE LA MASA ACUOSA ESPESA QUE HA REACCIONADO PARA FORMAR UNA MASA DESHIDRATADA. EN OTRA REALIZACION, AL MENOS SE PUEDE INCORPORAR UN AGENTE DE NITRURACION PARA AYUDAR A CUALQUIER NITRURACION QUE SE PUEDA REALIZAR.

  25. 2393.-

    COMPOSICIONES FARMACEUTICAS QUE CONTIENEN 5-DIFLUOROMETOXI-2-(3 ,4-DIMETOXI-2-PIRIDIL)-METILSULFINIL)BENCIMIDAZOL Y UN AGENTE ANTI-HELICOBACTER PARA EL TRATAMIENTO DE TRASTORNOS GASTROINTESTINALES.

    (10/1997)
    Solicitante/s: BYK GULDEN LOMBERG CHEMISCHE FABRIK GMBH. Inventor/es: PARSONS, MICHAEL, E. Clasificación: A61K31/44.

    SE PRESENTAN COMPOSICIONES FARMACEUTICAS QUE CONTIENEN UN AGENTE ANTIMICROBIANO INHIBIDOR DE LAS HELICOBACTERIAS Y UN DERIVADO DE LA BENCIMIDAZOLA QUE TIENEN ACTIVIDAD INHIBITORIA DE LA SECRECCION DEL ACIDO GASTRICO.

  26. 2394.-

    PREPARACION DE MATERIAL CONTENIENDO SILICIO NITRURABLE Y MATERIAL RESULTANTE.

    (10/1997)
    Solicitante/s: EATON CORPORATION. Inventor/es: EDLER, JAMES, P., LISOWSKY, BOHDAN. Clasificación: C04B35/591.

    UN PROCESO PARA PREPARAR UN MATERIAL QUE CONTIENE SILICIO NITRURABLE; PROCESO QUE INCLUYE LA PULVERIZACION DE UNA SUSPENSION ACUOSA ESPESA DE MATERIAL PULVERIZADO DE SILICIO Y AGUA, LA PULVERIZACION SE REALIZA PARA PROVOCAR UNA REACCION QUIMICA SUBSTANCIAL ENTRE EL SILICIO Y EL AGUA. LA REDUCCION DEL CONTENIDO DE AGUA DE LA SUSPENSION ACUOSA ESPESA QUE HA REACCIONADO FORMA UNA MASA PROCESABLE. EN OTRA REALIZACION, SE PUEDEN INCORPORAR LOS ADITIVOS DESEADOS TALES COMO, AL MENOS, UN AGENTE DE NITRURACION PARA AYUDAR A CUALQUIER NITRURACION O A CUALQUIER OTRO PROCESO QUE SE PUEDA REALIZAR POSTERIORMENTE.

  27. 2395.-

    VACUNA MUERTA INACTIVADA DEL MYCOPLASMA HYOPNEUMONIAE Y METODO DE EMPLEO DE LA MISMA.

    (10/1997)
    Solicitante/s: AMERICAN CYANAMID COMPANY. Inventor/es: DAYALU, KRISHNASWAMY, IYENGAR, PETERSEN, GARY R. Clasificación: A61K39/02, C12N1/20, A61K39/39.

    LA INVENCION SUMINISTRA UNA BACTERIA QUE COMPRENDE UN MATERIAL AISLADO DE "MYCOPLASMA HYOPNEUMONIAE" VIRULENTO, INACTIVADO CON ETILENEIMIDO BINARIO, EN UNA CANTIDAD EFECTIVA PARA INMUNIZAR A UN CERDO CONTRA LA INFECCION POR "MYCOPLASMA HYOPNEUMONIAE" Y UN PORTADOR FISIOLOGICAMENTE ACPTABLE ADECUADO. LA INVENCION TAMBIEN SUMINISTRA UN METODO PARA PRODUCIR ESTA BACTERIA. LA INVENCION ADEMAS SUMINISTRA UN METODO PARA INACTIVAR UNA RAMA VIRULENTA DE "MYCOPLASMA HYOPNEUMONIAE" PONIENDO EN CONTACTO EL "MYCROPLASMA HYOPNEUMONIAE" CON ETILENEIMIDO BINARIO. FINALMENTE LA INVENCION TAMBIEN SUMINISTRA UN METODO PARA INMUNIZAR A LOS CERDOS CONTRA LA INFECCION POR "MYCOPLASMA HYOPNEUMONIAE" QUE COMPRENDE LA ADMINISTRACION A LOS CERDOS DE UNA DOSIS DEL MATERIAL SUFICIENTE PARA SU INMUNIZACION.

  28. 2396.-

    PARTICULAS VIRICAS ENSAMBLADAS Y SU USO EN UNA VACUNA CONTRA UNA ENFERMEDAD ROTAVIRICA.

    (10/1997)
    Solicitante/s: THE UNIVERSITY OF SASKATCHEWAN. Inventor/es: REDMOND, MARK, J., IJAZ, MOHAMMED, KHALID, PARKER, MICHAEL, D. Clasificación: C12N7/04, A61K39/15, C12N15/46.

    SE PRESENTAN PARTICULAS VIRALES UNIDAS DERIVADAS DE PROTEINAS DE ROTAVIRUS. LAS PARTICULAS UNIDAS INCLUYEN LA PROTEINA CAPSIDA INTERIOR, VP6, JUNTO CON UNA O LAS DOS PROTEINAS CAPSIDAS EXTERIORES, VP4 Y VP7. ESTAS UNIONES SE PUEDEN UTILIZAR PARA COMPOSICIONES DE VACUNAS PARA EL TRATAMIENTO Y PREVENCION DE ENFERMEDADES ROTAVIRALES.

  29. 2397.-

    UN PROCEDIMIENTO DE IMPRESION.

    (10/1997)
    Solicitante/s: POLAROID CORPORATION. Inventor/es: ALLEN, JANET, A., FERLA, GUILLERMO, S. Clasificación: B41J2/455, H04N1/23, G06K15/14.

    APARATO Y METODO DE IMPRESION PARTICULARMENTE APROPIADO PARA PROPORCIONAR UNA COPIA IMPRESA DE UNA IMAGEN PRODUCIDA POR UN EQUIPO DE FORMACION DE IMAGENES MEDICAS O SEMEJANTE. EL METODO PRODUCE UNA COPIA IMPRESA DE MODULACION DE ZONA QUE TIENE MUCHOS NIVELES DE GRISES POR ELEMENTO DE MODULACION DE ZONA (PUNTOS) Y UNA SENSIBILIDAD DE FUERTE DENSIDAD. LAS ZONAS DE PUNTOS SE MODULAN EN MODELOS FORMADOS POR PUNTOS QUE, A SU VEZ, ESTAN FORMADOS POR SUBPUNTOS A LOS QUE SE HACE REFERENCIA COMO PLACAS QUE SE AÑADEN, PREFERIBLEMENTE, A PUNTOS DE TAMAÑO MINIMO POR ANCHO DE IMPULSO QUE MODULA DOS HACES DE RADIACION DE IMPRESION DE DISTINTAS DIMENSIONES.

  30. 2398.-

    PROCEDIMIENTO PARA PREPARAR N-ALQUILPOLIHIDROXIAMINAS Y AMIDAS DE ACIDOS GRASOS DE LAS MISMAS EN DISOLVENTES HIDROXI.

    (10/1997)
    Solicitante/s: THE PROCTER & GAMBLE COMPANY. Inventor/es: SCHEIBEL, JEFFREY JOHN, CONNOR, DANIEL, STEDMAN, SHUMATE, ROBERT, EDWARD, ST. LAURENT, JAMES CHARLES THEOPHILE ROGER BURCKET. Clasificación: C11D1/52, C07H1/00, C07H15/12.

    AMINAS COMO METILAMINA REACCIONAN CON MATERIALES COMO AZUCARES REDUCTORES EN DISOLVENTES DE HIDROXI COMO METANOL PARA PREPARAR AMINAS POLIHIDROXI N-ALQUILO. ASI, LA GLUCOSA REACCIONA CON METILAMINA Y EL ADUCTO RESULTANTE SE HIDROGENA PARA DAR NMETILGLUCAMINA. LAS POLIHIDROXIAMINAS N-ALQUILO PUEDEN REACCIONAR POSTERIORMENTE CON ESTERES GRASOS PARA DAR AMIDAS DE ACIDOS GRASOS POLIHIDROXI UTILES COMO SUPERFICIACTIVOS DETERGENTES. ASI LOS SUPERFICIACTIVOS DETERGENTES SE PUEDEN PREPARAR A PARTIR DE PRECURSORES NO PETROQUIMICOS COMO AZUCARES Y FUENTES DE AZUCARES COMO LA DEXTROSA, Y ESTERES DE ACIDOS GRASOS DERIVABLES DE GRASAS Y ACEITES VARIADOS.

  31. 2399.-

    INHIBIDOR DE LA ADHESION DE PLAQUETAS.

    (10/1997)
    Solicitante/s: MERCK PATENT GMBH. Inventor/es: SAWYER, ROY T. Clasificación: A61K38/17, C07K14/435, A61K38/46, C07K2/00, C07K1/18, A61L33/00.

    EL INHIBIDOR ES UNA PROTEINA DERIVADA DEL TEJIDO DE UNA SANGUIJUELA O DE LAS SECRECIONES DE SANGUIJUELAS (POR EJEMPLO, DEL HIRUDO MEDICINALIS), QUE ES CAPAZ DE ENLAZARSE A UN COLAGENO NATIVO DE TAL MODO QUE SUSTANCIALMENTE NO TIENEN LUGAR PRODUCTOS DE ROTURA POR DIVISION DE MOLECULAS DE COLAGENO EN SDS-PAGE. LA PROTEINA INHIBE SUSTANCIALMENTE LA AGREGACION O ADHESION DE PLAQUETAS INDUCIDA POR EL COLAGENO, TIENE UN PESO MOLECULAR DE 60 A 70 KILODALTONS EN FORMA REDUCIDA Y TIENE UNA ACTIVIDAD OPTIMA A UN PH DE 8,0.

  32. 2400.-

    DERIVADOS DE 2-FENIL Y 2-TIENIL-(2)-PIPERIDINA QUE TIENEN PROPIEDADESNEUROPROTECTORAS.

    (10/1997)
    Solicitante/s: ASTRA AKTIEBOLAG. Inventor/es: GRIFFITH, RONALD, CONRAD, MURRAY, ROBERT, JOHN, SCHMIESING, RICHARD, JOHN. Clasificación: A61K31/445, C07D211/14, C07D409/04, C07D211/12.

    COMPUESTOS DE LA FORMULA (I) EN DONDE R1 Y R2, QUE PUEDEN SER IGUALES O DIFERENTE, REPRESENTAN HIDROGENO O C1-6 ALQUIL, R3 Y R4 DE FORMA INDEPENDIENTE REPRESENTAN UNO O MULTIPLES RADICALES SELECCIONADOS DE HIDROGENO, HALOGENO, NH2, NO2, HALOGENO, HIDROXIL, C1-6 ALCOXI O C1-6 ALQUIL, X REPRESENTA S O UN GRUPO CH = CH -, Y LOS DERIVADOS ADMISIBLES FARMACEUTICAMENTE A PARTIR DE ESTOS COMPUESTOS QUE SON UTILIZADOS COMO PRODUCTOS FARMACEUTICOS, EN PARTICULAR LOS QUE POSEEN N ARTATO (NMDA) DISPONIENDO DE PROPIEDADES DE BLOQUEO Y SIENDO UTILIZADOS EN EL TRATAMIENTO Y/O PREVENCION DE DESORDENES NEUROLOGICOS.

<< · 38 · 56 · 65 · 70 · 72 · 73 · < · 75 · > · 77 · 79 · >>