Virus de la gripe porcina modificado por ingeniería genética y usos de los mismos.

Un virus de la gripe porcina atenuado modificado por ingeniería genética que tiene un fenotipo antagonista de interferón alterado

, en donde dicho virus comprende un gen de NS1 de virus de la gripe porcina A/Porcino/Texas/4199-2/98 con una mutación que produce una proteína NS1 con una deleción de todos los restos de aminoácido de NS1 excepto los restos de aminoácido 1-126, en donde el aminoácido amino-terminal es el número 1 y la mutación en el gen de NS1 confiere un fenotipo antagonista de interferón alterado.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2005/019382.

Solicitante: Icahn School of Medicine at Mount Sinai.

Inventor/es: PALESE, PETER, GARCIA-SASTRE,ADOLFO, WEBSTER,ROBERT, LAGER,KELLY M, RICHT,JUERGEN A, WEBBY,RICHARD J.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > A61K39/00 (Preparaciones medicinales que contienen antígenos o anticuerpos (materiales para ensayos inmunológicos G01N 33/53))
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen antígenos... > A61K39/12 (Antígenos virales)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen antígenos... > A61K39/145 (Orthomyxoviridae, p. ej. virus de la influenza)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/64 (Métodos generales para la preparación del vector, para su introducción en la célula o para la selección del huésped que contiene el vector)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > C12N5/00 (Células no diferenciadas humanas, animales o vegetales, p. ej. líneas celulares; Tejidos; Su cultivo o conservación; Medios de cultivo para este fin (reproducción de plantas por técnicas de cultivo de tejidos A01H 4/00))
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen antígenos... > A61K39/116 (Antígenos bacterianos polivalentes)
google+ twitter facebookPin it
Ilustración 1 de Virus de la gripe porcina modificado por ingeniería genética y usos de los mismos.
Ilustración 2 de Virus de la gripe porcina modificado por ingeniería genética y usos de los mismos.
Ilustración 3 de Virus de la gripe porcina modificado por ingeniería genética y usos de los mismos.
Ilustración 4 de Virus de la gripe porcina modificado por ingeniería genética y usos de los mismos.
Ver la galería de la patente con 11 ilustraciones.
Virus de la gripe porcina modificado por ingeniería genética y usos de los mismos.

Texto extraído del PDF original:

DESCRIPCIÓN

Virus de la gripe porcina modificado por ingeniería genética y usos de los mismos

1. Campo de la invención

La presente invención se refiere, en general, a virus de la gripe porcina atenuados modificados por ingeniería genética que tienen una capacidad alterada de antagonizar la respuesta del interferón (IFN) celular, y al uso de dichos virus atenuados en formulaciones de vacuna y farmacéuticas. En particular, la invención se refiere a virus de la gripe porcina atenuados modificados por ingeniería genética que tienen modificaciones en un gen de NS1 de virus de la gripe A/porcino/Texas/4199-2/98 que disminuyen o eliminan la capacidad del producto génico NS1 de antagonizar la respuesta del IFN celular. Estos virus se replican in vivo, pero muestran virulencia disminuida y atenuación aumentada, y por lo tanto son muy adecuados para su uso en vacunas de virus vivos, y en formulaciones farmacéuticas.

2. Antecedentes

2.1 Virus de la gripe

Las familias de virus que contienen ARN monocatenario con envuelta del genoma con sentido negativo se clasifican en grupos que tienen genomas no segmentados (Paramyxoviridae, Rhabdoviridae, Filoviridae y virus de la enfermedad de Borna) o aquellos que tienen genomas segmentados (Orthomyxoviridae, Bunyaviridae y Arenaviridae). La familia Orthomyxoviridae, descrita más adelante con detalle, y usada en los ejemplos de la presente memoria, incluye los virus de la gripe de tipo A, B y C, así como los virus Thogoto y Dhori y virus de la anemia infecciosa del salmón.

Los viriones de la gripe consisten en un núcleo ribonucleoproteico interno (una nucleocápside helicoidal) que contiene el genoma de ARN monocatenario, y una envuelta lipoproteica externa revestida en el interior por una proteína de la matriz (M1). El genoma segmentado del virus de la gripe A consiste en ocho moléculas (siete para la gripe C) de ARN monocatenarios, lineales, de polaridad negativa que codifican once polipéptidos, incluyendo: la proteína ARN polimerasa dependiente de ARN (PB2, PB1 y PA) y la núcleo proteína (NP) que forma la nucleocápside; las proteínas de membrana de la matriz (M1, M2); dos glucoproteínas de superficie que protegen la envuelta que contiene lípidos: hemaglutinina (HA) y neuraminidasa (NA); la proteína no estructural (NS1), la proteína de exportación nuclear (NEP); y el factor pro-apoptótico PB1-F2. La transcripción y replicación del genoma tiene lugar en el núcleo y el ensamblaje se produce mediante gemación en la membrana plasmática. Los virus pueden redistribuir los genes durante infecciones mixtas.

El virus de la gripe se adsorbe mediante HA a sialiloligosacáridos en glucoproteínas y glucolípidos de la membrana celular. Después de la endocitosis del virión se produce un cambio conformacional en la molécula HA dentro del endosoma celular que facilita la fusión de la membrana, desencadenando de este modo el desrecubrimiento. La nucleocápside migra hasta el núcleo donde se transcribe el ARNm viral. El ARNm viral se transcribe mediante un mecanismo único en el cual la endonucleasa viral escinde el extremo 5’ protegido de los ARNm heterólogos celulares que después sirven como cebadores para la transcripción de moldes de ARN viral por la transcriptasa viral. Los transcritos terminan en sitios de 15 a 22 bases desde los extremos de sus moldes, donde secuencias óligo (U) actúan como señales para la adición de tramos de poli (A). De las ocho moléculas de ARN viral así producidas, seis son mensajes monocistrónicos que se traducen directamente en las proteínas que representas HA, NA, NP y las proteínas de polimerasa viral, PB2, PB1 y PA. Los otros dos transcritos experimentan corte y ayuste, produciendo cada uno dos ARNm que se traducen en diferentes fases de lectura para producir M1, M2, NS1 y NEP. El segmento PB1 codifica una segunda proteína, la proteína PB1-F2 no estructural, usando un ATG alternativo. En otras palabras, los ocho segmentos de ARN viral codifican once proteínas: nueve estructurales y dos no estructurales. Se muestra un resumen de los genes del virus de la gripe y sus productos proteicos en la siguiente tabla I.

TABLA I: SEGMENTOS DE ARN DEL GENOMA DEL VIRUS DE LA GRIPE Y ASIGNACIONES CODIFICANTESa

Segmento Longitudb Polipéptidosc Longitudd Molélulas Comentarios (Nucleótidos) Codificados (Aminoácidos) por Virión 1 2341 PB2 759 30-60 Componente de ARN transcriptasa; componente de ARN trancriptasa de unión a capuchón de ARN de célula hospedadora; 2 2341 PB1 757 30-60 Inicio de la transcripción 3 2233 PB1-F2 87 Factor proapoptótico PA 716 30-60 componente ARN transcriptasa 4 1778 HA 566 500 Hemaglutinina; trímero; glucoproteína de envuelta; media la adhesión a células 1565 NP 498 1000 Nucleoproteína; asociada con ARN; componente estructural de ARN transcriptasa 6 1413 NA 454 100 Neuraminidasa; tetrámero; glucoproteína de envuelta 7 1027 M1 252 3000 Proteína de matriz; reviste el interior de la envuelta M2 96 ? Proteína estructural en membrana plasmática; ARNm con corte y ayuste 8 890 NS1 230 Proteína no estructural; función desconocida NEP 121 ? Proteína de exportación nuclear; ARNm con corte y ayuste a Adaptado de Lamb y P. W. Choppin (1983), Annual Review of Biochemistry, Volumen 52, 467-506.

b Para la cepa A/PR/8/34 c Determinado por enfoques bioquímicos y genéticos d Determinado por análisis de secuencia de nucleótidos y secuenciación de proteínas La patogenicidad de los virus de la gripe está modulada por múltiples factores del virus y el hospedador. Entre los factores del hospedador que combaten las infecciones víricas, el sistema de interferón tipo I (IFNα/β) representan un mecanismo de defensa innata antiviral poderoso que se estableció relativamente temprano en la evolución de organismos eucariotas (García-Sastre, 2002, Microbes Infect 4:647-55). El sistema IFNα/β antiviral implica tres etapas principales: (i) detección de infección vírica y secreción de IFNα/β, (ii) unión de IFNα/β a sus receptores e inducción transcripcional de genes estimulados por IFNα/β, y (iii) síntesis de encimas y proteínas antivirales. La mayoría de los virus, sin embargo, han adquirido información genética específica que codifica moléculas antagonistas IFNα/β, que bloquean de forma eficaz una o más etapas del sistema IFNα/β anti viral. Los virus de la gripe A expresan una proteína no estructural en células infectadas, la proteína NS1 (descrita en detalle, infra), que contrarresta la respuesta IFNα/β celular (García-Sastre et al., 1998, Virology 252:324.; 30).

El genoma del virus de la gripe A contiene ocho segmentos de ARN monocatenario de polaridad negativa, que codifica dos proteínas no estructurales y nueve estructurales. La proteína no estructural NS1 es abundante en células infectadas por virus de la gripe, pero no se ha detectado en viriones. NS1 es una fosfoproteína encontrada en el núcleo de forma prematura durante infecciones y también en el citoplasma en momentos posteriores del ciclo viral (King et al., 1975, Virology 64:378). Estudios con mutantes de gripe sensibles a temperatura (ts) que portan lesiones en el gen NS sugirieron que la proteína NS1 es un regulador transcripcional y post transcripcional de mecanismos por los cuales el virus es capaz de inhibir la expresión génica de la célula huésped y de estimular las síntesis de proteína viral. Como muchas otras proteínas que regulan procesos post transcripcionales, la proteína NS1 interacciona con secuencias y estructuras específicas de ARN. Se ha informado de que la proteína NS1 se une a diferentes especies de ARN incluyendo: ARNv, poli A, ARNsn U6, región 5’ no traducida de ARNm virales y ARNbc (Qiu et al, 1995, RNA 1: 304; Qiu et al, 1994, J. Virol. 68:2425; HatadaFukuda 1992, J Gen Virol. 73:3325-9). La expresión de la proteína NS1 a partir de ADNc en células transfectadas se ha asociado con varios efectos: inhibición del transporte núcleo citoplasmático de ARNm, inhibición de corte y ayuste de pre-ARNm, inhibición de la poliadenilación del ARNm del hospedador y estimulación de la traducción de ARNm viral (Fortes, et al, 1994, EMBO J. 13: 704; Enami et al, 1994, J. Virol; 68:1432; de la Luna et al., 1995, J. Virol. 69:2427; Lu et al, 1994, Genes Dev. 8:1817; Park et al, 1995, J. Biol Chem. 270,28433; Nemeroff et al, 1998, Mol. Cell. 1:1991; Chen et al, 1994, EMBO J. 18:2273-83). En particular, la proteína NS1 tiene tres dominios que se ha informado que tienen varias funciones reguladoras durante la infección por virus de la gripe. Los 73 amino ácidos amino terminales son responsables de la unión a ARN (Qian et al, 1995, RNA 1:948-956), particularmente ARN bicatenarios, que confieren al virus la capacidad de escapar de la respuesta de interferón α/β (Donelan et al, 2003, J. Virol. 77:13257-66). La parte central de la proteína interacciona con el factor de inicio de la traducción eucariota 4GI que facilita la traducción preferente de ARNm virales sobre los ARNm del hospedador (Arag6n et al, 2000, Mol. Cell Biol. 20:6259-6268). El dominio carboxy-terminal o efector ha demostrado inhibir el procesamiento de ARNm del hospedador, específicamente, la inhibición de la poliadenilación del ARNm del hospedador (Nemeroff et al, 1998, Mol. Cell 1 -.991-1000), la unión de colas poli (A) de exportación ARNm que inhibe la exportación nuclear y (Qiu y Krug, 1994, J. Virol. 68:2425-2432) y la inhibición de corte y ayuste de pre-ARNm (Lu et al, 1994, Genes Dev. 8:1817-1828).

Estudios de virus de la gripe recombinante humano que carece del gen de NS1 (delNS1) mostraron que este virus podría replicarse solamente en sistemas IFN incompetentes tales como ratones STAT1-/- o células Vero; por tanto la proteína NS1 es responsable de la actividad antagonista de IFN (Garcia-Sastre et al, 1998, Virology 252:324-330).

Además, se ha demostrado que los virus de la gripe humana con proteínas NS1 truncadas están atenuados en ratones (Egorov et al, 1998, J. Virol. 72:6437-6441) y proporcionan protección contra exposición a tipo silvestre (Talon et al, 2000, Proc. Natl. Acad. Sci. USA 97:4309-4314).

2.2 Virus de la gripe porcina

La gripe porcina (SI) es una enfermedad respiratoria aguda de los cerdos, causada por virus de la gripe tipo A. Su severidad depende de muchos factores, incluyendo la edad del hospedador, la cepa del virus, e infecciones secundarias (Easterday, 1980, Philos Trans R Soc Lond B Biol Sci 288:433-7). Los virus de la gripe A son virus ARN de hebra negativa segmentados y pueden aislarse de otras varias especies hospedadoras animales, incluyendo aves, seres humanos, caballos, ballenas, y visón. Aunque los virus de la gripe completos raramente cruzan la barrera de especies, los segmentos génicos pueden cruzar esta barrera a través de los procesos de redistribución genética o desplazamiento genético. Como los cerdos soportan la replicación de virus de la gripe A tanto humanos como aviares (Kida et al, 1994, J Gen Virol 75:2183-8), se ha postulado que desempeñan un papel importante en la transmisión inter especie actuando como "recipiente de mezcla" para redistribución entre virus específicos para diferentes especies hospedadoras (Scholtissek, 1994, Eur J Epidemiol 10:455-8). Esto puede conducir a la generación de nuevos virus de la gripe capaces de cruzar la barrera de especies hasta los seres humanos. Existen tres subtipos de virus SI (SIV) actualmente en circulación en cerdos en los Estados Unidos. H1N1, H3N2, y H1N2 (Olsen, 2002, Virus Res 85:199-210; Karasin et al, 2002, J Clin Microbiol 40:1073-9; Karasin et al, 2000, Virus Res 68:71-85; Olsen et al, 2000, Arch Virol 145:1399-419; Webby et al., 2000, J Virol 74:8243-51; Webby et al., 2001, Philos Trans R Soc Lond B Biol Sci 356:1817-28; Zhou, 2000, Vet Microbiol 74:47-58). Antes de 1998, se aislaron SIV H1N1 principalmente "clásicos" de cerdos en los Estados Unidos (Kida et al, 1994, J Gen Virol 75:2183-8; Scholtissek, 1994, Eur J Epidemiol 10:455-8; Olsen et al, 2000, Arch Virol. 145:1399-419). En 1998, se aislaron SIV del subtipo H3N2 en múltiples estados en los Estados Unidos. Estos virus se generaron por redistribución entre virus humanos, aviares y porcinos clásicos, están experimentando una rápida evolución y en general causan enfermedad más severa que SIV H1N1 clásico.

La patogenicidad de los virus de la gripe está modulada por múltiples factores víricos y hospedadores. Entre los factores hospedadores que combaten las infecciones víricas, el sistema de interferón tipo I (IFNα/β) representa un mecanismo de defensa innata antiviral poderoso que se estableció relativamente temprano en la evolución de organismos eucariotas (Garcia-Sastre, 2002, Microbes Infect 4:647-55). El sistema IFNα/β antiviral implica tres etapas principales: (i) detección de infección vírica y secreción de IFNα/β, (ii) unión de IFNα/β a sus receptores e inducción transcripcional de genes estimulados por IFNα/β, y (iii) síntesis de encimas y proteínas antivirales. La mayoría de los virus, sin embargo, han adquirido información genética específica que codifica moléculas antagonistas IFNα/β, que bloquean de forma eficaz una o más etapas del sistema y IFNα/β anti viral. Los virus de la gripe A expresan una proteína no estructural en células infectadas, la proteína NS1, que contrarresta la respuesta IFNα/β celular (García-Sastre et al., 1998, Virology 252:324.; 30).

La infección por gripe en cerdos se informó por primera vez en 1918 y los primeros virus de la gripe porcina se aislaron de cerdos en 1930 (Shope, R.E., 1931, J. Exp. Med. 54:373-385). Estos primeros aislados fueron los progenitores de lo que se reconoce como el linaje H1N1 de los virus de la gripe A porcinos. Desde 1930 hasta la década de 1990, la gripe en cerdos de América del Norte estuvo causada casi exclusivamente por infección con virus porcinos H1N1. Comenzó un drástico desplazamiento en el patrón de la gripe porcina alrededor de 1997, cuando se detectó un aumento inesperado y sustancial en la seropositividad H3 (8%), y comenzaron a aislarse virus H3N2 de cerdos tanto en los Estados Unidos como en Canadá (Olsen et al, 2000, Arch. Virol. 134:1399-1419). Además, la redistribución entre virus H3N2 y virus porcinos H1N1 provocó la detección de virus de redistribución H1N2 de segunda generación (Karasin et al, 2000, J. Clin. Microbiol 38:2453-2456; Karasin et al, 2002, J. Clin

Microbiol. 40:1073-1079). Además, se han aislado de cerdos virus H4N6 aviares de origen de pato en Canadá (Karasin et al, 2000, J. Virol 74:9322-9327). La generación de estos nuevos virus además de las variantes de arrastre antigénico descritas de virus de la gripe porcina H1N1, introduce implicaciones potenciales para la salud pública humana y veterinaria.

En 1998, una nueva cepa de virus de la gripe porcina para la cual los cerdos tenían poca inmunidad enfermó a todos los cerdos en una operación de 2.400 animales. Aunque ha habido solamente un subtipo de gripe que ha enfermado a los cerdos de América del Norte desde 1930, en los últimos pocos años se ha habido una rápida sucesión arrolladora de nuevos virus gripales a través de los 100 millones de cerdos de América del Norte. Después de años de estabilidad, el virus gripal porcino de América del Norte ha saltado a una rápida trayectoria evolutiva, creando variantes cada año. Esto no solo ha tenido un efecto indeseado sobre la industria granjera y un impacto económico negativo, sino que los expertos también están preocupados sobre que la evolución del virus gripal porcino aumente la probabilidad de que surja un nuevo virus que sea transmisible entre los seres humanos. Afortunadamente, las nuevas cepas porcinas que han aparecido en América del Norte hasta ahora no parecen infectar fácilmente a los seres humanos.

2.3 Virus atenuados

Las vacunas de virus inactivados se preparan "eliminando" el patógeno viral, por ejemplo, por tratamiento térmico o con formalina, de modo que no tenga capacidad de replicación. Las vacunas inactivadas tienen utilidad limitada porque no proporcionan inmunidad de larga duración y, por lo tanto, producen protección limitada. Un enfoque alternativo para producir vacunas contra virus implica el uso de vacunas de virus vivo atenuado. Los virus atenuados tienen capacidad de replicación pero no son patogénicos y, por lo tanto, proporcionan inmunidad de duración más larga y producen mayor protección. Sin embargo, los métodos convencionales para producir virus atenuados implican la posibilidad de aislamiento de mutantes de rango de hospedador, muchos de los cuales son sensibles a la temperatura; por ejemplo, el virus se pasa a través de hospedadores no naturales, y se seleccionan virus descendientes que son inmunogénicos, pero no patogénicos.

Un sustrato convencional para aislar y cultivar virus de la gripe con fines de vacuna son huevos embrionados de gallina. Los virus de la gripe se cultivan típicamente durante 2-4 días a 37 ºC en huevos de 10-12 días de vida. Aunque la mayoría de los aislados primarios humanos de virus de la gripe A y B se cultivan mejor en el saco amniótico de los embriones, después de 2 a 3 pases los virus llegan a adaptarse al cultivo en las células de la cavidad alantoidea, que es accesible desde el exterior del huevo (Murphy, B.R., y R.G. Webster, 1996.

Orthomyxoviruses pág. 1397-1445. In Fields Virology. Lippincott-Raven P.A.).

La tecnología de ADN recombinante y las técnicas de ingeniería genética, en teoría, producirían un enfoque superior para producir un virus atenuado ya que podrían diseñarse deliberadamente mutaciones específicas en el genoma viral. Sin embargo, las alteraciones genéticas necesarias para la atenuación de virus no son conocidas o predecibles. En general, los intentos de usar la tecnología de ADN recombinante para diseñar vacunas virales se han dirigido principalmente a la producción de vacunas de subunidad que contienen solamente las subunidades de proteína del patógeno implicadas en la respuesta inmunitaria, expresadas en vectores virales recombinantes tales como virus vaccinia o baculovirus. Más recientemente, las técnicas de ADN recombinante se han utilizado en un intento por producir mutantes de deleción de herpesvirus o poliomavirus que imitan virus atenuados encontrados en la naturaleza o mutantes de rango de hospedador conocido. Hasta 1990, los virus ARN de hebra negativa no eran susceptibles a manipulación específica de sitio en absoluto, y por tanto no podían modificarse por ingeniería genética.

Aunque estos virus son beneficiosos porque son inmunogénicos y no patogénicos, son difíciles de propagar en sustratos convencionales con el propósito de preparar vacunas. Además, los virus atenuados pueden poseer características de virulencia que son tan leves que no permiten al hospedador montar una respuesta inmunitaria suficiente para cumplir las posteriores exposiciones.

Los virus de la gripe humana no se replican de forma eficaz en aves, y viceversa debido a diferencias en receptores que se unen a los virus. En contraste, los cerdos son susceptibles de forma única a infección con virus humanos y aviares porque poseen tipos de receptor presentes tanto en seres humanos como en virus de la gripe aviar. Como resultado, se ha hipotetizado que los cerdos son los hospedadores de "recipiente de mezcla" para redistribución de virus humanos-aviares y existe apoyo para esta teoría a partir de varios estudios. Véase, por ejemplo Shu et al, 1994, Virology 202:825-33; Scholtissek, 1990, Med, Principles Pract. 2:65-71; Zhou et al, 1999 J Virol. 73:8851-6. Esta mezcla facilita la generación de nuevas cepas de virus de la gripe humana y el inicio de pandemias de gripe.

Las preparaciones de virus de la gripe inactivado o "eliminado" son las únicas vacunas de gripe actualmente con licencia en los Estados Unidos. Un enfoque alternativo para producir vacunas de virus a las vacunas de virus inactivado en que el patógeno viral está "eliminado", implica el uso de vacunas de virus vivo atenuado que tienen capacidad de replicación pero son no patogénicas. Las vacunas vivas que se administran por vía intranasal pueden tener ventajas sobre sus equivalentes inactivados. En primer lugar, las vacunas vivas se cree que inducen cito toxicidad mediada por células de reactividad cruzada mejorada así como respuesta de anticuerpos humoral, proporcionando mejor protección que las vacunas inactivadas (Gorse y Belshe, 1990, J. Clin. Microbiol. 28:2539- 2550; y Gorse et al, 1995, J. Infect. Dis. 172:1-10). En segundo lugar, las vacunas vivas también tienen la ventaja de administración intrasanal que evita el hinchamiento y el dolor muscular ocasionalmente asociado con la administración intramuscular de vacunas inactivadas con adyuvante. Se ha informado que estas vacunas vivas inducen no solamente respuestas humorales contra virus de la gripe homotípicos sino también la citotoxicidad mediada por células de reactividad cruzada. Las ventajas adicionales de vacunas vivas incluyen la facilidad de administración intranasal, la inducción de inmunidad en la mucosa, inmunidad de más larga duración, y su rentabilidad. Estas son todas consideraciones importantes respecto a las vacunas potenciales de gripe porcina.

Por tanto, se necesitan vacunas nuevas y más eficaces y formulaciones inmunogénicas para prevenir infecciones por virus de la gripe porcina generadas por dicha tecnología.

3. Sumario de la invención

La presente invención proporciona un virus de la gripe porcina atenuado modificado por ingeniería genética que tiene un fenotipo de antagonista de interferón alterado, donde dicho virus comprende un gen de NS1 de virus de la gripe porcina A/Porcino/Texas/4199-2/98 con una mutación que produce una proteína NS1 con una deleción de todos los restos de aminoácido de NS1 exceptos los restos de aminoácido 1-126, donde el aminoácido amino- terminal es el número 1 y la mutación en el gen de NS1 confiere un fenotipo de antagonista de interferón alterado.

La presente invención proporciona adicionalmente una formulación inmunogénica que comprende el virus de la gripe porcina atenuado modificado por ingeniería genética, y un excipiente fisiológicamente aceptable. Además, la presente invención proporciona una formulación farmacéutica que comprende el virus de la gripe porcina atenuado, modificado por ingeniería genética, de la presente invención y un vehículo farmacéuticamente aceptable.

Además, la presente invención proporciona el uso de una cantidad eficaz de la formulación inmunogénica de la presente invención en la preparación de un medicamento para su uso en la inmunización o inducción de una respuesta inmunitaria en un cerdo. Además, la presente invención proporciona el uso de una cantidad eficaz del virus de la gripe porcina atenuado modificado por ingeniería genética de la presente invención en la preparación de un medicamento, donde el medicamento es (a) para su uso en la prevención de una afección o un síntoma asociado con virus de la gripe porcina en un cerdo; o (b) para su uso en el tratamiento de una infección por virus de la gripe porcina en un cerdo.

La presente invención también proporciona un método para la producción de una formulación inmunogénica que comprende (a) propagar en un sustrato el virus de la gripe porcina atenuado modificado por ingeniería genética de la presente invención y (b) recoger el virus de la descendencia, donde el sustrato es una célula, línea celular o huevo embrionado.

Además, la presente invención proporciona una célula cultivada que contiene el virus de la gripe porcina atenuado, modificado por ingeniería genética, de la presente invención. La presente invención también proporciona un huevo embrionado que contiene el virus de la gripe porcina atenuado modificado por ingeniería genética de la presente invención.

En la presente memoria se describen virus de la gripe porcina atenuados que tienen una capacidad alterada de antagonizar la respuesta de interferón celular (IFN), métodos para producir dichos virus de la gripe porcina atenuados y el uso de dichos virus en formulaciones de vacuna y farmacéuticas. Dichos virus son capaces de generar una respuesta inmunitaria y crear inmunidad pero no causar enfermedad o causar fiebre y/o síntomas menos severos, es decir, los virus tienen virulencia disminuida. Por lo tanto, son candidatos ideales para vacunas de virus vivo. Además, los virus atenuados pueden inducir una robusta respuesta de IFN que tiene otras consecuencias biológicas in vivo, produciendo protección contra posteriores enfermedades infecciosas y/o induciendo respuestas antitumorales. Por lo tanto, los virus atenuados pueden usarse de forma farmacéutica, para la prevención o tratamiento de otras enfermedades infecciosas y/o enfermedades tratables por IFN.

La invención se basa, en parte, en el descubrimiento de los solicitantes de que los virus de la gripe porcina modificados por ingeniería para contener o que contienen una o más deleciones en el gen de NS1 tienen replicación alterada respecto a virus de la gripe porcina de tipo silvestre como se demuestra por menores lesiones pulmonares tras infección de cerdos, títulos virales reducidos en fluido de lavado bronco alveolar (BALF) y detección reducida de virus en frotis nasales. Sorprendentemente, y contrario a los resultados observados con virus de la gripe humana en modelos de ratón, la longitud de la proteína NS1 no se correlaciona con el nivel de atenuación del virus de la gripe porcina. Los solicitantes han descubierto que con gripe porcina, un virus mutante con la proteína NS1 más corta es el menos atenuado. En otras palabras, los virus de la gripe porcina que contienen deleciones más cortas en el gen de NS1 muestran una mayor atenuación in vivo que los virus de la gripe porcina que contienen deleciones más largas en su gen NS1, o virus de la gripe porcina de tipo silvestre. Los solicitantes han descubierto adicionalmente que los virus de la gripe porcina recombinantes están alterados en su capacidad de inhibir la producción de IFN in

vitro, y no se replican tan eficazmente como la cepa recombinante precursora en huevos embrionados de gallina de 10 días de vida, en células MDCK, en células PK-15 o en un modelo de cerdo in vivo. Aunque sin el deseo de limitarse a teoría o explicación alguna para el mecanismo de acción de los mutantes de deleción de NS1 de virus de la gripe porcina in vivo, las características atenuadas de dichos virus se deben presumiblemente a sus niveles de expresión de proteína NS1, su capacidad de inducir una robusta respuesta de IFN celular, y su capacidad alterada de antagonizar dicha respuesta. Sin embargo, las características beneficiosas de dichos virus pueden no ser únicamente atribuibles a su efecto sobre la respuesta de interferón celular. De hecho, las alteraciones en otras actividades asociadas con NS1, tales como, alteración de corte y ayuste de pre-ARNm, inhibición de la poliadenilación del ARNm celular, transporte núcleo citoplasmático de ARNm que contiene poli (A), y estimulación de síntesis de proteínas virales, pueden contribuir al fenotipo atenuado deseado conseguido por la introducción de mutaciones en el gen de NS1 del virus de la gripe porcina.

Un virus de la gripe porcina atenuado, descrito en la presente memoria, comprende una mutación en un gen de NS1 de la gripe porcina que disminuye la capacidad del producto génico NS1 de antagonizar la respuesta de interferón celular. Un virus de la gripe porcina atenuado descrito en la presente memoria puede comprender un genoma que comprende una mutación en un gen de NS1 del virus de la gripe porcina que disminuye la capacidad del producto génico NS1 de antagonizar una respuesta de interferón celular, y permite que el virus atenuado, a una multiplicidad de infección (MOI, por sus siglas en inglés) entre 0,0005 y 0,001, 0,001 y 0,01, 0,01 y 0,1, o 0,1 y 1, o una MOI de 0,0005, 0,0007, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1,0, 1,5, 2,0, 2,5, 3,0, 3,5, 4,0, 4,5, 5,0, 5,5, o 6,0, crezca hasta títulos entre aproximadamente 1 a aproximadamente 100 veces, aproximadamente 5 a aproximadamente 80 veces, aproximadamente 20 a aproximadamente 80 veces, o aproximadamente 40 a aproximadamente 80 veces, aproximadamente 1 a aproximadamente 10 veces, aproximadamente 1 a aproximadamente 5 veces, aproximadamente 1 a aproximadamente 4 veces, aproximadamente 1 a aproximadamente 3 veces, aproximadamente 1 a aproximadamente 2 veces, aproximadamente 3 a aproximadamente 15 veces, o aproximadamente 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces inferior que el virus de la gripe porcina de tipo silvestre en células (por ejemplo, células de un ser humano (por ejemplo, PerC6, una línea celular productora derivada de retinoblastos embrionarios humanos transformados con la región E1 de Adenovirus5), ratón, pollo (por ejemplo, fibroblastos embrionarios de pollo), rata, aves, o cerdo (por ejemplo, células PK(D1), células PK (15), células PK13, células NSK, células LLC-PK1, células LLC-PK1A, células ESK-4, células ST, células PT-K75, células PK-2a/CL 13 o SJPL)), determinados aproximadamente 2 a 10 días, 3 a 7 días , 3 a 5 días, o 2, 3, 4, 5, 6, 7, 8, 9, 10 días post infección cuando se propagan en las mismas condiciones. Los títulos de virus de la gripe porcina atenuados y de tipo silvestre pueden determinarse utilizando cualquier técnica bien conocida en la técnica o descrita en la presente memoria (por ejemplo, ensayos de hemaglutinación, ensayos de placa, dosis infecciosa en cultivo tisular 50 (DICT50), dosis infecciosa en huevo 50 (DIH50), etc.) y los virus pueden propagarse en condiciones descritas en la presente memoria bien conocidas en la técnica (por ejemplo, en células de cerdo, células MDCK (por ejemplo, en MEM, suero de ternera fetal (FCS) al 10% v/v, penicilina al 1%/estreptomicina a 37 ºC en una incubadora humidificada del 5% de CO2) o huevos embrionados de gallina (por

ejemplo, en una incubadora estacionaria a 37 ºC con humedad relativa del 55%). Como alternativa, los virus pueden propagarse en células (por ejemplo, en células de cerdo, células MDCK, etc.) que se cultivan en medios sin suero o de suero reducido (por ejemplo, TPCK tripsina).

En un aspecto específico, un virus de la gripe porcina atenuado descrito en la presente memoria comprende un genoma que comprende una mutación en un gen de NS1 de virus de la gripe porcina que disminuye la capacidad del producto génico NS1 de antagonizar una respuesta de interferón celular, y permite que el virus atenuado, a una multiplicidad de infección (MOI) entre 0,0005 y 0,001, 0,001 y 0,01, 0,01 y 0,1, o 0,1 y 1, o una MOI de 0,0005, 0,0007, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1,0, 1,5, 2,0, 2,5, 3,0, 3,5, 4,0, 4,5, 5,0, 5,5, o 6,0, crezca hasta títulos entre aproximadamente 1 a aproximadamente 100 veces, aproximadamente 5 a aproximadamente 80 veces, aproximadamente 20 a aproximadamente 80 veces, o aproximadamente 40 a aproximadamente 80 veces, aproximadamente 1 a aproximadamente 10 veces, aproximadamente 1 a aproximadamente 5 veces, aproximadamente 1 a aproximadamente 4 veces, aproximadamente 1 a aproximadamente 3 veces, aproximadamente 1 a aproximadamente 2 veces, aproximadamente 3 a aproximadamente 15 veces, o aproximadamente 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces inferior que el virus de la gripe porcina de tipo silvestre en células (por ejemplo, células de un ser humano (por ejemplo, PerC6, una línea celular productora derivada de retinoblastos embrionarios humanos transformados con la región E1 de Adenovirus5), ratón, pollo (por ejemplo, fibroblastos embrionarios de pollo), rata, aves, o cerdo (por

ejemplo, células PK(D1), células PK (15), células PK13, células NSK, células LLC-PK1, células LLC-PK1A, células ESK-4, células ST, células PT-K75, células PK-2a/CL 13 o SJPL)), determinados aproximadamente 2 a 10 días, 3 a 7 días , 3 a 5 días, o 2, 3, 4, 5, 6, 7, 8, 9, 10 días post infección cuando se propagan en las mismas condiciones. Los títulos de virus de la gripe porcina atenuados y de tipo silvestre pueden determinarse utilizando cualquier técnica bien conocida en la técnica o descrita en la presente memoria (por ejemplo, ensayos de hemaglutinación, ensayos de placa etc.) y los virus pueden propagarse en condiciones descritas en la presente memoria bien conocidas en la técnica (por ejemplo, en células de cerdo, células MDCK (por ejemplo, en MEM, suero de ternera fetal (FCS) al 10% v/v, penicilina al 1%/estreptomicina a 37 ºC en una incubadora humidificada del 5% de CO2) o huevos embrionados de gallina (por ejemplo, en una incubadora estacionaria a 37 ºC con humedad relativa del 55%).

Los virus de la gripe porcina usados de acuerdo con la presente descripción pueden seleccionarse entre cepas de origen natural, variantes o mutantes; virus mutagenizados (por ejemplo, virus generados por exposición a mutágenos, pases repetidos y/o pase en hospedadores no permisivos); redistribuciones; y/o virus modificados por ingeniería genética (por ejemplo, usando las técnicas de "genética inversa" y basadas en plásmidos sin auxiliar) que tienen el fenotipo deseado-es decir, una capacidad alterada de antagonizar la respuesta de IFN celular. Las cepas de origen natural, variantes o mutantes, redistribucionesy/o virus modificados por ingeniería genética con el fenotipo antagonista de interferón deseado pueden seleccionarse en base a crecimiento diferencial en células (por ejemplo, células de un ser humano (por ejemplo, PerC6, una línea celular productora derivada de retinoblastos embrionarios humanos transformados con la región E1 de Adenovirus5), ratón, pollo (por ejemplo, fibroblastos embrionarios de pollo), rata, aves, o cerdo (por ejemplo, células PK(D1), células PK (15), células PK13, células NSK, células LLC- PK1, células LLC-PK1A, células ESK-4, células ST, células PT-K75, células PK-2a/CL 13 o SJPL)) en otros ensayos descritos a continuación. Los virus de la gripe porcina de la invención pueden ser virus modificados por ingeniería genética. Los virus de la gripe porcina de la invención pueden ser cepas de origen no natural, variantes o mutantes y/o redistribuciones.

En un aspecto específico, un virus de la gripe porcina atenuado descrito en la presente memoria comprende un genoma que comprende una mutación en un gen SN1 del virus de la gripe porcina que disminuye la capacidad del producto génico NS1 de antagonizar una respuesta de interferón celular, y permite que el virus atenuado, a una multiplicidad de infección (MOI) entre 0,0005 y 0,001, 0,001 y 0,01, 0,01 y 0,1, o 0,1 y 1, o una MOI de 0,0005, 0,0007, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1,0, 1,5, 2,0, 2,5, 3,0, 3,5, 4,0, 4,5, 5,0, 5,5, o 6,0, crezca hasta títulos entre aproximadamente 1 a aproximadamente 100 veces, aproximadamente 5 a aproximadamente 80 veces, aproximadamente 20 a aproximadamente 80 veces, o aproximadamente 40 a aproximadamente 80 veces, aproximadamente 1 a aproximadamente 10 veces, aproximadamente 1 a aproximadamente 5 veces, aproximadamente 1 a aproximadamente 4 veces, aproximadamente 1 a aproximadamente 3 veces, aproximadamente 1 a aproximadamente 2 veces, aproximadamente 3 a aproximadamente 15 veces, o aproximadamente 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces inferior que el virus de la gripe porcina de tipo silvestre en células (por ejemplo, células de un ser humano (por ejemplo, PerC6, una línea celular productora derivada de retinoblastos embrionarios humanos transformados con la región E1 de Adenovirus5), ratón, pollo (por ejemplo, fibroblastos embrionarios de pollo), rata, aves, o cerdo (por ejemplo, células PK(D1), células PK (15), células PK13, células NSK, células LLC-PK1, células LLC-PK1A, células ESK-4, células ST, células PT-K75, células PK-2a/CL 13 o SJPL)) determinados por un ensayo de hemaglutinación de BALF de cerdos o sobrenadantes de células de cerdo aproximadamente de 2 a 10 días, 3 a 7 días , 3 a 5 días, o 2, 3, 5, 6, 7, 8, 9, 10 días post infección o cuando los virus se siembran en placas en células renales caninas Madin- Darby (MDCK). El crecimiento de un virus de la gripe porcina atenuado de la invención puede compararse con un patrón o referencia particular, por ejemplo, virus de la gripe porcina de tipo silvestre A/Porcino/Texas/4199-2/98. El virus atenuado puede modificarse por ingeniería genética para que contenga o exprese secuencias de ácido nucleico de virus de la gripe no porcina tales como, por ejemplo, un epítopo de un patógeno foráneo o un antígeno tumoral. Preferiblemente, las secuencias de virus de la gripe no porcina no incluyen una secuencia de ácido nucleico que altera el fenotipo atenuado del virus. Por consiguiente las secuencias de ácido nucleico que codifican proteínas, polipéptidos o péptidos con actividad antagonizante de interferón preferiblemente no se modifican por ingeniería en un virus de la gripe porcina.

En la presente memoria se describen virus de la gripe porcina atenuados que comprenden un genoma que comprende al menos dos, al menos tres, al menos cuatro o más mutaciones en dos, tres, cuatro o más genes del virus de la gripe porcina, donde al menos una de las mutaciones está en el gen de NS1 y contribuye a o es responsable (directa o indirectamente) de la atenuación del virus y/o la capacidad disminuida del virus de antagonizar una respuesta de interferón celular. En un aspecto, un virus de la gripe porcina atenuado descrito en la presente memoria comprende un genoma que comprende al menos dos, al menos tres, al menos cuatro o más mutaciones en dos, tres, cuatro o más genes del virus de la gripe porcina, donde al menos una de las mutaciones está en el gen de NS1 y es responsable de la capacidad disminuida del producto génico NS1 de antagonizar una respuesta de interferón celular, y permite que el virus atenuado, a una MOI entre 0,0005 y 0,001, 0,001 y 0,01, 0,01 y 0,1, o 0,1 y 1, o una MOI de 0,0005, 0,0007, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1,0, 1,5, 2,0, 2,5, 3,0, 3,5, 4,0, 4,5, 5,0, 5,5 o 6,0, crezca hasta títulos entre aproximadamente 1 a aproximadamente 100 veces, aproximadamente 5 a aproximadamente 80 veces, aproximadamente 20 a aproximadamente 80 veces, o aproximadamente 40 a aproximadamente 80 veces, aproximadamente 1 a aproximadamente 10 veces, aproximadamente 1 a aproximadamente 5 veces, aproximadamente 1 a aproximadamente 4 veces, aproximadamente 1 a aproximadamente 3 veces, aproximadamente 1 a aproximadamente 2 veces, aproximadamente 3 a aproximadamente 15 veces o aproximadamente 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces inferiores que el virus de la gripe porcina de tipo silvestre en células (por ejemplo, células de un ser humano (por ejemplo, PerC6, una línea celular productora derivada de retinoblastos embrionarios humanos transformados con la región E1 de Adenovirus 5), ratón, pollo (por ejemplo, fibroblastos embrionarios de pollo), rata, aves, o cerdo (por ejemplo, células PK(D1), células PK(15), células PK13, células NSK, células LLC- PK1, células LLC-PK1A, células ESK-4, células ST, células PT-K75, células PK-2a/CL 13 o SJPL)), determinados por, por ejemplo, ensayos de hemaglutinación, aproximadamente 2 a 10 días, 3 a 7 días, 3 a 5 días, o 2, 3, 5, 6, 7, 8, 9,10 días post-infección cuando los virus se propagan en las mismas condiciones.

En un aspecto específico, un virus de la gripe porcina atenuado descrito en la presente memoria comprende un genoma que comprende al menos dos, al menos tres, al menos cuatro o más mutaciones en dos, tres, cuatro o más genes del virus de la gripe porcina, donde al menos una de las mutaciones está en el gen de NS1 y es responsable de la capacidad disminuida del producto génico NS1 de antagonizar una respuesta de interferón celular, y permite que el virus atenuado, a una MOI entre 0,0005 y 0,001, 0,001 y 0,01, 0,01 y 0,1, o 0,1 y 1, o una MOI de 0,0005, 0,0007, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1,0, 1,5, 2,0, 2,5, 3,0, 3,5, 4,0, 4,5, 5,0, 5,5 o 6,0, crezca hasta títulos entre aproximadamente 1 a aproximadamente 100 veces, aproximadamente 5 a aproximadamente 80 veces, aproximadamente 20 a aproximadamente 80 veces, o aproximadamente 40 a aproximadamente 80 veces, aproximadamente 1 a aproximadamente 10 veces, aproximadamente 1 a aproximadamente 5 veces, aproximadamente 1 a aproximadamente 4 veces, aproximadamente 1 a aproximadamente 3 veces, aproximadamente 1 a aproximadamente 2 veces, aproximadamente 3 a aproximadamente 15 veces o aproximadamente 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces inferiores que el virus de la gripe porcina de tipo silvestre en células de cerdo, determinados por, por ejemplo, ensayos de hemaglutinación, aproximadamente 2 a 10 días, 3 a 7 días, 3 a 5 días, o 2, 3, 5, 6, 7, 8, 9, 10 días post- infección cuando los virus se propagan en las mismas condiciones (por ejemplo, en células MDCK). En otro aspecto, un virus de la gripe porcina atenuado descrito en la presente memoria comprende un genoma que comprende al menos dos, tres, cuatro o más mutaciones en dos, tres, cuatro o más genes del virus de la gripe porcina, donde al menos una de las mutaciones está en el gen de NS1 y es responsable de la atenuación del virus, y permite que el virus atenuado, a una MOI entre 0,0005 y 0,001, 0,001 y 0,01, 0,01 y 0,1, o 0,1 y 1, o una MOI de 0,0005, 0,0007, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1,0, 1,5, 2,0, 2,5, 3,0, 3,5, 4,0, 4,5, 5,0, 5,5 o 6,0, crezca hasta títulos entre aproximadamente 1 a aproximadamente 100 veces, aproximadamente 5 a aproximadamente 80 veces, aproximadamente 20 a aproximadamente 80 veces, o aproximadamente 40 a aproximadamente 80 veces, aproximadamente 1 a aproximadamente 10 veces, aproximadamente 1 a aproximadamente 5 veces, aproximadamente 1 a aproximadamente 4 veces, aproximadamente 1 a aproximadamente 3 veces, aproximadamente 1 a aproximadamente 2 veces, aproximadamente 3 a aproximadamente 15 veces o aproximadamente 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces inferiores que el virus de la gripe porcina de tipo silvestre en células de cerdo, determinados por, por ejemplo, ensayos de hemaglutinación, aproximadamente 2 a 10 días, 3 a 7 días, 3 a 5 días, o 2, 3, 5, 6, 7, 8, 9, 10 días post- infección cuando los virus se propagan en las mismas condiciones (por ejemplo, en células MDCK). DE acuerdo con estos aspectos, el virus atenuado tiene un fenotipo antagonista de interferón alterado y puede modificarse por ingeniería genética para que contenga o exprese secuencias de ácido nucleico de virus de la gripe no porcina tales como, por ejemplo, un epítopo de un patógeno foráneo (por ejemplo, epítopos del virus del síndrome reproductor y respiratorio porcino, citomegalovirus porcino, coronavirus respiratorio porcino, virus de la encefalomiocarditis porcina, diarrea epidémica porcina y determinantes antigénicos de patógenos porcinos no virales tales como bacterias incluyendo, aunque sin limitación, Brucella suis, y parásitos incluyendo, aunque sin limitación, ascárides (Ascaris suum), tricocéfalos (Trichuris suis), o un antígeno tumoral tal como antígeno carcinoembrionario (CEA), antígeno de cáncer de mama tal como EGFR (receptor del factor de crecimiento epidérmico), antígeno HER2 (p185HER2), epítopo HER2, antígeno canceroso-50 (CA-50), antígeno canceroso 15-3 (CA15-3) asociado con cáncer de mama, antígeno asociado a carcinoma (CAA), antígeno de melanoma, y antígenos asociados a melanoma 100, 25, y 150). Preferiblemente, las secuencias de virus de la gripe no porcina (secuencias heterólogas) no incluyen una secuencia de ácido nucleico que altera el fenotipo atenuado del virus. Por consiguiente, las secuencias de ácido nucleico que codifican proteínas, polipéptidos o péptidos con actividad antagonizante de interferón preferiblemente no se modifican por ingeniería en el virus de la gripe porcina.

Las mutaciones en el gen de NS1 del virus de la gripe porcina comprenden (como alternativa, consisten en) cualquier mutación que produzca el fenotipo deseado (es decir, una capacidad alterada de antagonizar una respuesta de interferón celular). Ejemplos del tipo de mutaciones que pueden incluirse en o introducirse en un gen de NS1 del virus de la gripe porcina incluyen, aunque sin limitación, deleciones, sustituciones, inserciones y combinaciones de las mismas. Una o más mutaciones pueden localizarse en cualquier parte en todo el gen de NS1 gene, es decir, en las regiones reguladoras, no codificantes y/o codificantes (por ejemplo, el extremo amino-terminal y/o el carboxi-terminal o cualquier parte entre ellos). En un aspecto específico, un virus de la gripe porcina atenuado, descrito en la presente memoria, comprende un genoma que comprende un gen de NS1 del virus de la gripe porcina con una mutación (por ejemplo, una deleción o sustitución) en el extremo amino-terminal. En un aspecto preferido, un virus de la gripe porcina atenuado, descrito en la presente memoria, comprende un genoma que comprende un gen de NS1 de la gripe porcina con una mutación (por ejemplo, una deleción o sustitución, preferiblemente una deleción) en el extremo carboxi-terminal. En otro aspecto, un virus de la gripe porcina atenuado, descrito en la presente memoria, comprende un genoma que comprende una mutación en un gen de NS1 del virus de la gripe porcina que produce una deleción que consiste en 5, preferiblemente 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 100, 105, 110, 115, 119, 120, 121, 125, 130, 135, 140, 145, 146, 147, 148, 150, 155, 160, 165, 170 o 175 restos de aminoácido del extremo carboxi-terminal de NS1, o una deleción entre 5- 170, 25-170, 50-170, 100-170, 90-160, 100-160 o 105-160, 90-150, 5-75, 5-50 o 5-25 restos de aminoácido del extremo carboxi-terminal. En otro aspecto, un virus de la gripe porcina atenuado, descrito en la presente memoria, comprende un genoma que comprende una mutación en un gen de NS1 del virus de la gripe porcina que produce una deleción de todos los restos de aminoácido del producto génico NS1 excepto los restos de aminoácido 1-126, los restos de aminoácido 1-120, los restos de aminoácido 1-115, los restos de aminoácido 1-110, los restos de aminoácido 1-100, los restos de aminoácido 1-99, los restos de aminoácido 1-95, los restos de aminoácido 1-85, los restos de aminoácido 1-80, los restos de aminoácido 1-75, los restos de aminoácido 1-73, los restos de aminoácido 1-70, los restos de aminoácido 1-65 o los restos de aminoácido 1-60, donde el aminoácido amino-terminal es el número 1. El virus de la gripe porcina atenuado puede estar modificado por ingeniería genética. Un virus de la gripe porcina atenuado de la descripción es TX/98/del 126, TX/98/del 99 o TX/98/del 73.

El virus de la gripe porcina atenuado de la presente invención puede ser un virus quimérico que expresa una secuencia heteróloga. Preferiblemente, la secuencia heteróloga no es una secuencia de ácido nucleico que altera el fenotipo atenuado del virus. Por consiguiente, preferiblemente, las secuencias de ácido nucleico que codifican proteínas, polipéptidos o péptidos con actividad antagonizante de interferón no se modifican por ingeniería en el virus de la gripe porcina. El virus quimérico puede expresar un antígeno tumoral. El virus quimérico puede expresar un epítopo de un patógeno foráneo.

Un virus de la gripe porcina atenuado que tenga el fenotipo deseado puede usarse en sí mismo como el principio activo en formulaciones de vacuna, farmacéuticas o inmunogénicas. Como alternativa, el virus de la gripe porcina atenuado puede usarse como el vector o "estructura" de vacunas producidas de forma recombinante o formulaciones inmunogénicas. Para este fin, puede usarse la técnica de "genética inversa" o el enfoque de plásmido sin auxiliar para diseñar mutaciones o introducir epítopos exógenos en el virus de la gripe porcina atenuado, que serviría como la cepa "precursora". De este modo, pueden diseñarse vacunas para inmunización contra variantes de cepa, o como alternativa, contra agentes infecciosos o antígenos de enfermedad completamente diferentes (por ejemplo, antígenos tumorales). Por ejemplo, pueden diseñarse virus de la gripe porcina atenuados para que expresen epítopos neutralizantes de otras cepas preseleccionadas. Como alternativa, pueden construirse epítopos de otros virus en el virus de la gripe porcina atenuado. Como alternativa, pueden diseñarse epítopos de patógenos infecciosos no virales (por ejemplo, parásitos, bacterias, hongos) en el virus de la gripe porcina.

Pueden usarse técnicas de redistribución para transferir el fenotipo atenuado desde una cepa precursora de virus de la gripe porcina (un mutante natural, un virus mutagenizado, o un virus modificado por ingeniería genética) hasta una cepa de virus diferente (un virus de tipo silvestre, un mutante natural, un virus mutagenizado, o un virus modificado por ingeniería genética). Puede usarse la "técnica de genética inversa" o el enfoque de plásmido sin auxiliar, para diseñar mutaciones o introducir epítopos exógenos en el virus de la gripe porcina atenuado, que serviría como la "cepa precursora".

En la presente memoria, se describen métodos para vacunar a sujetos, que comprenden administrar una formulación de vacuna que comprende un virus de la gripe porcina atenuado que comprende una mutación en un gen de NS1 de la gripe porcina que disminuye la capacidad del producto génico NS1 de antagonizar la respuesta de interferón celular, y un excipiente fisiológicamente eficaz. En un aspecto, en la presente memoria se describe un método que comprende administrar una cantidad eficaz de una formulación de vacuna. En ciertos aspectos, la dosis de la formulación de vacuna administrada es entre aproximadamente 102 a aproximadamente 108, aproximadamente 103 a aproximadamente 107, o aproximadamente 104 a aproximadamente 5x106 ufp. En otros aspectos, la dosis de la formulación de vacuna administrada es de 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 105, 106, 5 x 106, 107, 5 x 107 o 108 ufp. En aspectos específicos, el sujeto es un burro, cebra, camello, perro, ave (por ejemplo, un pato). En un aspecto preferido, el sujeto es un cerdo.

La presente invención proporciona formulaciones inmunogénicas que comprenden un virus de la gripe porcina atenuado de la invención. En la presente memoria se describen métodos para inducir una respuesta inmunitaria para el tratamiento, control o prevención de una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una infección diferente a una infección por virus de la gripe porcina, o una afección o síntoma asociado con la misma, o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección, que comprende administrar a un sujeto una formulación inmunogénica de la invención. En un aspecto, la presente invención se refiere a una formulación inmunogénica para su uso en un método para inmunizar o inducir una respuesta inmunitaria, por ejemplo, para el tratamiento, control o prevención de una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, que comprende administrar a un sujeto una cantidad eficaz de una formulación inmunogénica de la invención. La dosis de formulación inmunogénica de la invención a administrar a un sujeto es entre aproximadamente 102 a aproximadamente 108, aproximadamente 103 a aproximadamente 107, o aproximadamente 104 a aproximadamente 5 x 106 ufp o aproximadamente 104 a aproximadamente 107 ufp. La formulación inmunológica a administrar a un sujeto puede tener un virus de la gripe porcina atenuado de la presente invención en una concentración de aproximadamente 104 a aproximadamente 107 ufp/ml. La dosis de formulación inmunogénica de la invención a administrar a un sujeto puede ser 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 105, 106, 5 x 106, 107, 5 x 107 o 108 ufp. El sujeto es un burro, cebra, camello, perro, ave (por ejemplo, un pato), y especialmente un cerdo.

Los virus de la gripe porcina atenuados, que inducen contundentes respuestas de IFN en sujetos, también pueden usarse en formulaciones farmacéuticas para la profilaxis o el tratamiento de infecciones y enfermedades tratables por IFN tales como cáncer. A este respecto, el tropismo del virus de la gripe porcina atenuado puede alterarse para abordar el virus en un órgano, tejido o células diana deseadas in vivo o ex vivo. Usando este enfoque, la respuesta de IFN puede inducirse de forma local, en el sitio diana, evitando de este modo o minimizando los efectos secundarios de la terapia con IFN sistémico. Para este fin, el virus de la gripe porcina atenuado puede modificarse por ingeniería para que exprese un ligando específico para un receptor del órgano, tejido o células diana.

En la presente memoria se describen métodos para prevenir, controlar o tratar una infección, o enfermedad tratable por IFN en un sujeto (por ejemplo, un cerdo), diferente de una infección por virus de la gripe porcina, o enfermedad tratable por IFN causada por virus de la gripe porcina, que comprende administrar una formulación farmacéutica descrita en la presente memoria. En un aspecto, se describe en la presente memoria un método para prevenir, controlar o tratar una infección o enfermedad tratable por IFN en un sujeto, diferente de una infección por virus de la gripe porcina o enfermedad tratable por IFN causada por virus de la gripe porcina, que comprende administrar a un sujeto una cantidad eficaz de una formulación farmacéutica descrita en la presente memoria. En ciertas realizaciones, la dosis de la formulación farmacéutica a administrar al sujeto es entre aproximadamente 102 a aproximadamente 1012, aproximadamente 102 a aproximadamente 1010, aproximadamente 102 a aproximadamente 108, aproximadamente 103 a aproximadamente 109, aproximadamente 103 a aproximadamente 107, aproximadamente 104 a aproximadamente 108, aproximadamente 104 a aproximadamente 5 x 106, aproximadamente 104 a aproximadamente 107, o aproximadamente 104 a aproximadamente 1012 ufp. La formulación farmacéutica a administrar al sujeto puede tener un virus de la gripe atenuado de la presente invención a una concentración de aproximadamente 104 a aproximadamente 1012 ufp/ml. La dosis de la formulación farmacéutica a administrar puede ser de 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 105, 106, 5 x 106, 107, 5 x 107, 108, 5 x 108, 1 x 109, 5 x 109, 1 x 1010, 5 x 1010, 1 x 1011, 5 x 1011 o 1012 ufp. El sujeto puede ser un burro, cebra, camello, perro, ave (por ejemplo, un pato), y especialmente un cerdo.

En la presente memoria se describen métodos para prevenir, controlar o tratar el cáncer en un sujeto que comprende administrar una formulación farmacéutica descrita en la presente memoria. En un aspecto, se describe en la presente memoria un método para prevenir, controlar o tratar el cáncer en un sujeto que comprende administrar a un sujeto una cantidad eficaz de una formulación farmacéutica descrita en la presente memoria. La formulación farmacéutica puede comprender un virus de la gripe porcina que comprende un antígeno tumoral. La dosis de la formulación farmacéutica a administrar al sujeto puede ser entre aproximadamente 102 a aproximadamente 1012, aproximadamente 102 a aproximadamente 1010, aproximadamente 102 a aproximadamente 108, aproximadamente 103 a aproximadamente 109, aproximadamente 103 a aproximadamente 107, aproximadamente 104 a aproximadamente 108, aproximadamente 104 a aproximadamente 5 x 106 ufp o aproximadamente 104 a aproximadamente 1012 ufp. La dosis de la formulación farmacéutica a administrar es de 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 105, 106, 5 x 106, 107, 5 x 107, 108, 5 x 108, 1 x 109, 5 x 109, 1 x 1010, 5 x 1010, 1 x 1011, 5 x 1011 o 1012 ufp. El sujeto puede ser un burro, cebra, camello, perro, ave (por ejemplo, un pato), y especialmente un cerdo.

Los solicitantes han demostrado que los virus de la gripe porcina atenuados con actividad antagonista de interferón alterada se replican in vivo generando títulos que son inferiores que los detectados con virus de la gripe porcina de tipo silvestre, pero que son suficientes para inducir respuestas inmunológicas y de citoquinas. Por tanto, las mutaciones que disminuyen pero no suprimen la actividad antagonista de IFN del virus de la gripe porcina son preferidas para formulaciones de vacuna, inmunológicas, y farmacéuticas. Dichos virus pueden seleccionarse por su crecimiento en sustratos tanto convencionales como no convencionales, y por su virulencia intermedia.

La presente invención proporciona células que contienen (como alternativa, que comprenden) virus de la gripe porcina atenuados de la presente invención. Una célula puede contener/comprender un virus de la gripe porcina que está modificado por ingeniería genética. El virus de la gripe porcina atenuado contenido en la célula puede modificarse para que codifique un epítopo derivado de otro patógeno (por ejemplo, otro virus) o un antígeno tumoral. El genoma del virus de la gripe porcina atenuado puede comprender al menos un segmento derivado de un virus diferente. Cualquier célula puede infectarse con, contener o comprender un virus de la gripe porcina atenuado de la invención incluyendo, aunque sin limitación, células MDCK, células PK, células Vero, células endoteliales de vena umbilical humana primaria (HUVEC), línea celular de epitelio humano H292, células HeLa, y células renales embrionarias porcinas RES. La célula puede ser una célula de cerdo o una línea celular de cerdo. La célula (por ejemplo, una célula de cerdo o línea celular de cerdo) puede ser deficiente en interferón.

Los virus de la gripe porcina de la invención pueden estar contenidos en huevos embrionados de gallina 10 días de vida, 6 a 9 días de vida, 6 a 8 días de vida, o 6 a 7 días de vida. Los virus pueden estar contenidos en la cavidad alantoidea de dichos huevos. Los virus pueden estar contenidos en la cavidad amniótica de dichos huevos.

La invención abarca el uso de sustratos tales como células, líneas celulares y huevos embrionados, para propagar los virus de la gripe porcina atenuados de la invención. En una realización, la invención proporciona métodos para la producción de vacunas. La producción de formulaciones inmunogénicas y la producción de agentes farmacéuticos que comprenden propagar en un sustrato un virus de la gripe porcina atenuado de la presente invención y recoger el virus descendiente, donde el sustrato es una célula, línea celular o huevo embrionado. En ciertas realizaciones, el sustrato es un sistema IFN-deficiente. Sistemas IFN-deficientes ejemplares incluyen, aunque sin limitación, huevos embrionados jóvenes (por ejemplo, huevos embrionados de 6 a 10 días de vida, 6 a 9 días de vida, 6 a 8 días de vida o 6 a 7 días de vida), y líneas celulares IFN-deficientes (tales como células VERO o líneas celulares modificadas por ingeniería genética tales como knockouts STAT1). También pueden usarse huevos embrionados o líneas celulares pretratadas con compuestos que inhiben el sistema IFN (incluyendo fármacos, anticuerpos, antisentido, ribozimas, etc.) como sistema IFN-deficiente. Además, pueden usarse huevos deficientes en el sistema IFN, por ejemplo, huevos producidos por aves STAT1 negativas, especialmente aves de corral, incluyendo aunque sin limitación, pollos, patos o pavos transgénicos, como sistema IFN-deficiente.

3.1 Terminología

Como se emplea en esta memoria, el término "alrededor de" o "aproximadamente" cuando se usa junto con un número se refiere a cualquier número dentro del 1, 5 o 10% del número referenciado.

Como se emplea en esta memoria, la expresión "amino-terminal" de NS1 se refiere a los aminoácidos desde el resto de aminoácido amino-terminal (resto de aminoácido 1) hasta el resto de aminoácido 115, los restos de aminoácido 1 a 100, los restos de aminoácido 1 a 75, los restos de aminoácido 1 a 50, los restos de aminoácido 1 a 25, o los restos de aminoácido 1 a 10 de la proteína NS1 del virus de la gripe porcina.

Como se emplea en esta memoria, la expresión "carboxi-terminal" de NS1 se refiere a los restos de aminoácido 116 al resto de aminoácido carboxi-terminal, los restos de aminoácido 101 al resto de aminoácido carboxi-terminal, los restos de aminoácido 76 al resto re aminoácido carboxi-terminal, los restos de aminoácido 51 al resto de aminoácido carboxi-terminal, o los restos de aminoácido 26 al resto de aminoácido carboxi-terminal de la proteína NS1 del virus de la gripe porcina, cuando el extremo amino-terminal de NS1 es los restos de aminoácido 1 al resto de aminoácido 115, los restos de aminoácido 1 a 100, los restos de aminoácido 1 a 15, los restos de aminoácido 1 a 50, o los restos de aminoácido 1 a 25, respectivamente, de la proteína NS1 del virus de la gripe porcina. Las deleciones del extremo carboxi-terminal pueden incluir deleciones que consisten en 5, preferiblemente 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 73, 75, 80, 85, 90, 95, 99, 100, 105, 110, 115, 120, 125, 126, 130, 135, 140, 145, 150, 155, 160, 165, 170 o 175 restos de aminoácido desde el extremo carboxi-terminal de NS1.

Como se emplea en esta memoria, la expresión "modulador del receptor de citoquinas" se refiere a un agente que modula fosforilación de un receptor de citoquinas, la activación de una ruta de transducción de señales asociada con un receptor de citoquinas, y/o la expresión de una proteína particular tal como una citoquina. Dicho agente puede modular directa o indirectamente la fosforilación de un receptor de citoquinas, la activación de una ruta de transducción de señales asociada con un receptor de citoquinas, y/o la expresión de una proteína particular tal como una citoquina. Por tanto, los ejemplos de moduladores de receptores de citoquinas incluyen, aunque sin limitación, citoquinas, fragmentos de citoquinas, proteínas de fusión, y anticuerpos que se unen de forma inmunoespecífica a un receptor de citoquinas o un fragmento del mismo. Además, ejemplos de moduladores de receptor de citoquinas incluyen, aunque sin limitación, péptidos, polipéptidos (por ejemplo, receptores de citoquina soluble), proteínas de fusión y anticuerpos que se unen de forma inmunoespecífica a una citoquina o a un fragmento de la misma.

Como se emplea en esta memoria, la expresión "cantidad eficaz" se refiere a la cantidad de una terapia (por ejemplo un agente profiláctico o terapéutico) que es suficiente para reducir y/o mejorar la gravedad y/o duración de una afección (por ejemplo, una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, otra afección (por ejemplo, otra infección vírica), una enfermedad tratable por IFN o una afección en la que pueden usarse virus atenuados de la gripe porcina como vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección), prevenir el avance de una afección (por ejemplo, una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, otra infección (por ejemplo, otra infección vírica), una enfermedad tratable por IFN o una afección en que pueden usarse virus atenuados de la gripe porcina como vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección), causar regresión de una afección (por ejemplo, una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, otra afección (por ejemplo, otra infección vírica), o una enfermedad tratable por IFN), prevenir la reaparición, desarrollo, o aparición de uno o más síntomas asociados con una afección (por ejemplo, una infección por virus de la gripe porcina o una afección o síntoma asociada con la misma, otra afección (por ejemplo, otra infección vírica), o una enfermedad tratable por IFN), reducir el título de virus de la gripe porcina o potenciar o mejorar el efecto o efectos profilácticos o terapéuticos de otra terapia (por ejemplo, agente profiláctico o terapéutico).

Como se emplea en esta memoria, el término "epítopos" se refiere a sitios o fragmentos de un polipéptido o proteína que tienen actividad antigénica o inmunogénica en un animal, preferiblemente en un mamífero, y lo más preferiblemente en un cerdo. Un epítopo que tiene actividad inmunogénica es un sitio o fragmento de un polipéptido o proteína que provoca una respuesta de anticuerpos en un animal. Un epítopo que tiene actividad antigénica es un sitio o fragmento de un polipéptido o proteína al cual se une un anticuerpo inmunoespecíficamente como se determina por cualquier método bien conocido para un experto en la materia, por ejemplo por inmunoensayos.

Como se emplea en esta memoria, el término "fragmento" en el contexto de un agente proteico se refiere a un péptido o polipéptido que comprende una secuencia de aminoácidos de al menos 2 restos de aminoácido contiguos, de al menos 5 restos de aminoácido contiguos, de al menos 10 restos de aminoácido contiguos, de al menos 15 restos de aminoácido contiguos, de al menos 20 restos de aminoácido contiguos, de al menos 25 restos de aminoácido contiguos, de al menos 40 restos de aminoácido contiguos, de al menos 50 restos de aminoácido contiguos, de al menos 60 restos de aminoácido contiguos, de al menos 70 restos de aminoácido contiguos, de al menos 80 restos de aminoácido contiguos, de al menos 90 restos de aminoácido contiguos, de al menos 100 restos de aminoácido contiguos, de al menos 125 restos de aminoácido contiguos, de al menos 150 restos de aminoácido contiguos, de al menos 175 restos de aminoácido contiguos, de al menos 200 restos de aminoácido contiguos, o de al menos 250 restos de aminoácido contiguos de la secuencia de aminoácidos de un péptido, polipéptido o proteína. En una realización, un fragmento de una proteína de longitud completa retiene la actividad de la proteína de longitud completa, por ejemplo, actividad antagonista de IFN. En otra realización, el fragmento de la proteína de longitud completa no retiene la actividad de la proteína de longitud completa, por ejemplo, actividad antagonista de IFN.

Como se emplea en esta memoria, el término "fragmento" en el contexto de un ácido nucleico se refiere a un ácido nucleico que comprende una secuencia de ácido nucleico de al menos 2 nucleótidos contiguos, de al menos 5 nucleótidos contiguos, de al menos 10 nucleótidos contiguos, de al menos 15 nucleótidos contiguos, de al menos 20 nucleótidos contiguos, de al menos 25 nucleótidos contiguos, de al menos 30 nucleótidos contiguos, de al menos 35 nucleótidos contiguos, de al menos 40 nucleótidos contiguos, de al menos 50 nucleótidos contiguos, de al menos 60 nucleótidos contiguos, de al menos 70 nucleótidos contiguos, de al menos 80 nucleótidos contiguos, de al menos 90 nucleótidos contiguos, de al menos 100 nucleótidos contiguos, de al menos 125 nucleótidos contiguos, de al menos 150 nucleótidos contiguos, de al menos 175 nucleótidos contiguos, de al menos 200 nucleótidos contiguos, de al menos 250 nucleótidos contiguos, de al menos 300 nucleótidos contiguos, de al menos 350 nucleótidos contiguos, o de al menos 380 nucleótidos contiguos de la secuencia de ácido nucleico que codifica un péptido, polipéptido o proteína. En una realización preferida, un fragmento de un ácido nucleico codifica un péptido o polipéptido que retiene actividad de la proteína de longitud completa, por ejemplo, actividad antagonista de IFN. En otra realización, el fragmento de la proteína de longitud completa no retiene la actividad de la proteína de longitud completa, por ejemplo, actividad antagonista de IFN.

Como se emplea en esta memoria, la expresión secuencia heteróloga" se refiere a cualquier secuencia de ácido nucleico o secuencia proteica, polipeptídica o peptídica que no se encuentra normalmente o está asociada de forma natural en la naturaleza con un ácido nucleico o secuencia proteica, polipeptídica o peptídica de interés. Por ejemplo, una "secuencia heteróloga" puede referirse a una secuencia derivada de una especie diferente.

Como se emplea en esta memoria, la expresión "en combinación" se refiere al uso de más de una terapia (por ejemplo, más de un agente profiláctico y/o agente terapéutico). El uso de la expresión "en combinación" no restringe el orden en que se administran las terapias (por ejemplo, agentes profilácticos y/o terapéuticos) a un sujeto con una afección (por ejemplo, una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, otra infección (por ejemplo, otra infección vírica) o una enfermedad tratable por IFN). Una primera terapia (por ejemplo, un primer agente profiláctico o terapéutico) puede administrarse antes de (por ejemplo, 5 minutos, 15 minutos, 30 minutos, 45 minutos, 1 hora, 2 horas, 4 horas, 6 horas, 12 horas, 24 horas, 48 horas, 72 horas, 96 horas, 1 semana, 2 semanas, 3 semanas, 4 semanas, 5 semanas, 6 semanas, 8 semanas, o 12 semanas antes), de forma concomitante con, o posterior a (por ejemplo, 5 minutos, 15 minutos, 30 minutos, 45 minutos, 1 hora, 2 horas, 4 horas, 6 horas, 12 horas, 24 horas, 48 horas, 72 horas, 96 horas, 1 semana, 2 semanas, 3 semanas, 4 semanas, 5 semanas, 6 semanas, 8 semanas, o 12 semanas después) la administración de una segunda terapia (por ejemplo, un segundo agente profiláctico o terapéutico) a un sujeto con una afección (por ejemplo, una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, otra infección (por ejemplo, otra afección vírica) o una enfermedad tratable por IFN).

Como se emplea en esta memoria, la expresión "actividad antagonista de interferón" se refiere a una proteína o polipéptido, o fragmento, derivado, o análogo del mismo que reduce o inhibe la respuesta inmunitaria de interferón celular. En particular, una proteína o polipéptido, o fragmento, derivado o análogo del mismo (por ejemplo, NS1 del virus de la gripe porcina) que tiene actividad antagonista de interferón reduce o inhibe la expresión y/o actividad de interferón. En una realización específica, la expresión "actividad antagonista de interferón" se refiere a una proteína o polipéptido del virus de la gripe porcina, o fragmento, derivado, o análogo del mismo que reduce o inhibe la respuesta inmunitaria de interferón celular. Una proteína o polipéptido del virus de la gripe porcina con actividad antagonista de interferón puede afectar de forma preferente a la expresión y/o actividad de uno o dos tipos de interferón (IFN). En una realización, está afectada la expresión y/o actividad de IFN-. En otra realización, está afectada la expresión y/o actividad de IFN-. En una realización, está afectada la expresión y/o actividad de IFN-. En ciertas realizaciones, la expresión y/o actividad de IFN- y/o IFN- se reduce en un 5-10%, 10-20%, 20-30%, 30- 40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90% o más por la proteína, polipéptido, etc. con una actividad antagonista de interferón en comparación con un control (por ejemplo, PBS o una proteína sin actividad antagonista de interferón) en sistemas IFN competentes, por ejemplo, una célula de tipo silvestre o animal en las mismas condiciones. En ciertas realizaciones, la expresión y/o actividad de IFN- y/o IFN- se reduce en aproximadamente 1 a aproximadamente 100 veces, en aproximadamente 5 a aproximadamente 80 veces, en aproximadamente 20 a aproximadamente 80 veces, en aproximadamente 1 a aproximadamente 10 veces, o en aproximadamente 1 a aproximadamente 5 veces, o en aproximadamente 40 a aproximadamente 80 veces, o 1, 2, 3, 4, 5, 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces por la proteína, polipéptido, etc. con una actividad antagonista de interferón en comparación con un control (por ejemplo, PBS o una proteína sin actividad antagonista de interferón) en sistemas IFN competentes en las mismas condiciones.

Como se emplea en esta memoria, las expresiones "sistemas IFN deficientes" o "sustratos IFN deficientes" se refieren a sistemas, por ejemplo, células, líneas células y animales, tales como cerdos, ratones, pollos, pavos, conejos, ratas, etc., que no producen IFN o producen niveles bajos de IFN (es decir, una reducción en la expresión de IFN de un 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90% o más en comparación con sistemas IFN competentes en las mismas condiciones), no responden o responden de forma menos eficaz a IFN, y/o son deficientes en la actividad de uno o más genes antivirales inducidos por OFN.

Como se emplea en esta memoria, la expresión "fenotipo inductor de IFN" se refiere a un fenotipo por el cual un virus muestra una respuesta aumentada de interferón celular en comparación con un virus de tipo silvestre, que típicamente inhibe o reduce las respuestas celulares mediadas por interferón.

Como se emplea en esta memoria, las expresiones "trastornos tratables por IFN", "enfermedades tratables por IFN" y expresiones análogas se refieren a afecciones que se pueden prevenir, tratar, controlar o mejorar mediante la administración de IFN, ya sea IFN-, ,  o cualquier combinación de los mismos. Los trastornos tratables por IFN no tienen que estar limitados a cerdos, si el virus de la gripe porcina infecta a otras especies. Ejemplos de trastornos tratables por IFN en cerdos incluyen, aunque sin limitación, enfermedad de la fiebre aftosa, neumonía Haemophilus porcina (PHP, y otros trastornos causados por infección con, por ejemplo, infección por A. pleuropneumoniae, P. haemolytica, P. multocida, H. somnus y A. suis).

Como se emplea en esta memoria, la expresión fenotipo "intermedio" con respecto a actividad antagonista de IFN se refiere a un fenotipo que puede estimular una contundente respuesta inmunitaria, estando atenuada al mismo tiempo porque los virus con un fenotipo intermedio no pueden superar la respuesta de IFN del hospedador. En particular, un fenotipo intermedio puede estimular una respuesta inmunitaria e inhibir/reducir IFN solamente al grado en que permite menos rondas de replicación del virus o menos cantidades de partículas virales que se producen en comparación con el virus de tipo silvestre, como se determina por técnicas bien conocidas en la técnica (por ejemplo, como se mide por títulos en placas inferiores o ensayos de hemaglutinación).

Como se emplea en esta memoria, el término "asilado", en el contexto de virus, se refiere a un virus que se obtiene de un único virus precursor. Un virus puede aislarse usando métodos rutinarios conocidos para los expertos en la materia incluyendo, aunque sin limitación, los basados en purificación de placa y dilución limitante.

Como se emplea en esta memoria, los términos "tratar", "tratamiento", y "controlar" ser refieren a los efectos beneficiosos que un sujeto obtiene de una terapia (por ejemplo, un agente profiláctico o terapéutico), que no provoca cura de la enfermedad. En ciertas realizaciones, a un sujeto se administra una o más terapias (por ejemplo, uno o más agentes profilácticos o terapéuticos) para "tratar" una enfermedad para prevenir la progresión o empeoramiento de la enfermedad.

Como se emplea en esta memoria, la expresión "multiplicidad de infección" o "MOI" es la cantidad promedio de virus por célula infectada. La MOI se determina dividiendo la cantidad de virus añadida (ml añadido por UFP) por el número de células añadidas (ml añadido x células/ml).

Como se emplea en esta memoria, la expresión "virus de la gripe no porcina" en el contexto de virus de la gripe no porcina que contienen o que comprenden secuencias de virus de la gripe no porcina se refiere a cualquier cepa o aislado de virus de la gripe que comprende una secuencia (por ejemplo, un ácido nucleico o secuencia de aminoácidos) heteróloga al virus de la gripe porcina, es decir, la secuencia no se encuentra de forma natural en asociación con el virus de la gripe porcina.

Como se emplea en esta memoria, la expresión "gen NS1" se refiere al gen que codifica la proteína no estructural (NS1) en gripe. NS1 es una de las ocho moléculas codificadas por el genoma segmentado de gripe A y otros virus.

Un "gen de NS1 de virus de la gripe porcina" es un gen de NS1 aislado de un virus de la gripe porcina. Los genes NS1 porcinos representativos pueden encontrarse en bases de datos públicas de secuencias tales como GenBank e incluyen, aunque sin limitación, el número de acceso a GenBank AJ293939 (A/porcino/Italia/13962/95(H3N2)) y número de acceso a Genbank AJ344041 (A/porcino/Cotes d'Armor/1121/00(H1N1)). Un "producto génico NS1" se refiere a un producto génico (por ejemplo, un ARN o proteína) codificado por un gen NS1. En el caso de una proteína, el producto génico NS1 es de longitud completa y tiene actividad NS1 de tipo silvestre (por ejemplo, de Gripe A/porcino/Texas/4199-2/98). Un "producto génico NS1 de virus de la gripe porcina" se refiere a un producto génico (por ejemplo, un ARN o proteína) codificado por un gen de NS1 de virus de la gripe porcina. En el caso de una proteína, el producto génico NS1 de virus de la gripe porcina es de longitud completa y tiene actividad NS1 de virus de la gripe porcina de tipo silvestre, por ejemplo, Gripe A/porcino/Texas/4199-2/98.

Como se emplea en esta memoria, los términos "prevenir", "que previene" y "prevención" se refieren a la inhibición del desarrollo o aparición de una afección (por ejemplo, una infección por virus de la gripe porcina o una afección asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección asociada con la misma, una enfermedad tratable por IFN o una afección en que puede usarse los virus de la gripe porcina atenuados como vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección), o la prevención de la reaparición, aparición, o desarrollo de uno o más síntomas de una afección (por ejemplo, una infección por virus de la gripe porcina o una afección asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección asociada con la misma, o una enfermedad tratable por IFN), en un sujeto resultante de la administración de una terapia (por ejemplo, un agente profiláctico o terapéutico), o la administración de una combinación de terapias (por ejemplo, una combinación de agentes profilácticos o terapéuticos).

Como se emplea en esta memoria, las expresiones "agente profiláctico" y "agentes profilácticos" se refieren a cualquier agente o agentes que pueden usarse en la prevención de una afección o un síntoma de la misma (por ejemplo, una infección por virus de la gripe porcina o una afección asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociada con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección). Preferiblemente, un agente profiláctico es un agente que se sabe que es útil para o se ha usado o se está usando actualmente para prevenir o impedir la aparición, desarrollo, progresión y/o gravedad de una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección.

Como se emplea en esta memoria, la expresión "cantidad profilácticamente eficaz" se refiere a la cantidad de una terapia (por ejemplo, agente profiláctico) que es suficiente para provocar la prevención del desarrollo, reaparición, o aparición de una afección o un síntoma de la misma (por ejemplo, una infección por virus de la gripe porcina o una afección asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociada con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección) o para potenciar o mejorar el efecto o efectos profilácticos de otra terapia (por ejemplo, un agente profiláctico).

Como se emplea en esta memoria, el término "purificado" en el contexto de virus se refiere a un virus que está sustancialmente libre de material celular y medio de cultivo de la fuente celular o tisular de la cual se deriva el virus.

La expresión "sustancialmente libre de material celular" incluye preparaciones de virus en que el virus está separado de componentes celulares de las células de las cuales se aísla o produce de forma recombinante. Por tanto, un virus que está sustancialmente libre de material celular incluye preparaciones de proteína que tienen menos de aproximadamente el 30%, 20%, 10%, o 5% (en peso seco) de proteínas celulares (también mencionadas en esta memoria como "proteínas contaminantes"). El virus también está sustancialmente libre de medio de cultivo, es decir, el medio de cultivo representa menos de aproximadamente el 20%, 10%, o 5% del volumen de la preparación de virus. Un virus puede purificarse usando métodos rutinarios conocidos para los expertos en la materia incluyendo, aunque sin limitación, cromatografía y centrifugación.

Como se emplea en esta memoria, los términos "sujeto" o "paciente" se usan de forma intercambiable. Como se emplea en esta memoria, los términos "sujeto" y "sujetos" se refieren a un animal (por ejemplo, aves, reptiles, y mamíferos), preferiblemente un mamífero incluyendo un no primate (por ejemplo, un camello, burro, cebra, vaca, cerdo, caballo, gato, perro, rata, y ratón) y un primate (por ejemplo, un mono, chimpancé, y un ser humano). El sujeto o paciente puede tener una infección por virus de la gripe porcina. El mamífero puede tener de 0 a 6 meses de edad, de 6 a 12 meses de edad, de 1 a 5 años de edad, de 5 a 10 años de edad, de 10 a 15 años de edad, de 15 a 20 años de edad, de 20 a 25 años de edad, de 25 a 30 años de edad, de 30 a 35 años de edad, de 35 a 40 años de edad, de 40 a 45 años de edad, de 45 a 50 años de edad, de 50 a 55 años de edad, de 55 a 60 años de edad, de 60 a 65 años de edad, de 65 a 70 años de edad, de 70 a 75 años de edad, de 75 a 80 años de edad, de 80 a 85 años de edad, de 85 a 90 años de edad, de 90 a 95 años de edad o de 95 a 100. El sujeto o paciente puede ser un cerdo. El cerdo puede ser de 0 a 6 meses de edad, de 6 a 12 meses de edad, de 1 a 5 años de edad, de 5 a 10 años de edad o de 10 a 15 años de edad. La longevidad natural de un cerdo es de 10-15 años.

Como se emplea en esta memoria, "virus de la gripe porcina" se refiere a un virus de la gripe tipo A o tipo C de la familia Orthomyxovirus que causa gripe porcina. Aunque los Orthomyxovirus tienen tres grupos: tipo A, tipo B y tipo C, solamente los virus de la gripe tipo A y tipo C infectan a los cerdos. Los subtipos de virus de la gripe porcina incluyen H1N1, H1N2, H3N2, y H3N1. H9N2 yH5N1 también pueden encontrarse en cerdos. Un virus de la gripe porcina puede ser un virus de la gripe que se ha aislado de cerdos. Un virus de la gripe porcina puede contener un gen de NS1 porcino. Los genes NS1 porcinos representativos pueden encontrarse en bases de datos públicas de secuencias tales como GenBank, e incluyen, aunque sin limitación, el número de acceso a GenBank No. AJ293939 (A/porcino/Italia/13962/95(H3N2)) y número de acceso a GenBank AJ344041 (A/porcino/Cotes d'Armor/1121/00(H1N1)). Ejemplos de variantes de virus de la gripe porcina incluyen, aunque sin limitación, A/Porcino/Colorado/1/77, A/Porcino/Colorado/23619/99, A/Porcino/Cote d'Armor/3633/84, A/Porcino/Cote d'Armor/ 3633/84, A/Porcino/Inglaterra/195852/92, A/Porcino/Finisterre/2899/82, A/Porcino/Hong Kong/10/98, A/Porcino/Hong Kong/9/98, A/Porcino/Hong Kong/81/78, A/Porcino/Illinois/100084/01, A/Porcino/Illinois/100085A/01, A/Porcino/Illinois/21587/99, A/Porcino/Indiana/1726/88, A/Porcino/Indiana/9K035/99, A/Porcino/Indiana/P12439/00, A/Porcino/Iowa/30, A/Porcino/Iowa/15/30, A/Porcino/Iowa/533/99, A/Porcino/Iowa/569/99, A/Porcino/Iowa/3421/90, A/Porcino/Iowa/8548-1/98, A/Porcino/Iowa/930/01, A/Porcino/Iowa/17672/88, A/Porcino/Italia/1513-1/98, A/Porcino/Italia/1523/98, A/Porcino/Corea/CY02/02, A/Porcino/Minnesota/55551/00, A/Porcino/Minnesota/593/99, A/Porcino/Minnesota/9088-2/98, A/Porcino/Nebraska/1/92, A/Porcino/Nebraska/209/98, A/Porcino/Países Bajos/12/85, A/Porcino/Carolina del Norte/16497/99, A/Porcino/Carolina del Norte/35922/98, A/Porcino/Carolina del Norte/93523/01, A/Porcino/Carolina del Norte/98225/01, A/Porcino/Oedenrode/7C/96, A/Porcino/Ohio/891/01, A/Porcino/Oklahoma/18717/99, A/Porcino/Oklahoma/18089/99, A/Porcino/Ontario/01911-1/99, A/Porcino/Ontario/ 01911-2/99, A/porcino/Ontario/41848/97, A/Porcino/Ontario/97, A/Porcino/Quebec/192/81, A/Porcino/Quebec/ 192/91, A/Porcino/Quebec/5393/91, A/Porcino/Taiwán/7310/70, A/Porcino/Tennessee/24/77, A/Porcino/Texas/ 41992/98, A/Porcino/Wisconsin/125/97, A/Porcino/Wisconsin/136/97, A/Porcino/Wisconsin/163/97, A/Porcino/Wisconsin/164/97, A/Porcino/Wisconsin/166/97, A/Porcino/Wisconsin/168/97, A/Porcino/Wisconsin/235/97, A/Porcino/Wisconsin/238/97, A/Porcino/Wisconsin/457/98, A/Porcino/Wisconsin/ 458/98, A/Porcino/Wisconsin/464/98 y A/Porcino/Wisconsin/14094/99.

Como se emplea en esta memoria, el término "sinérgico" se refiere a una combinación de terapias (por ejemplo, agentes profilácticos o terapéuticos) que es más eficaz que los efectos aditivos de dos terapias individuales cualesquiera o más (por ejemplo, uno o más agentes profilácticos o terapéuticos). Un efecto sinérgico de una combinación de terapias (por ejemplo, una combinación de agentes profilácticos o terapéuticos) permite el uso de dosificaciones inferiores de una o más terapias (por ejemplo, uno o más agentes profilácticos o terapéuticos) y/o administración menos frecuentes de dichas terapias a un sujeto con una afección (por ejemplo, una infección por virus de la gripe porcina o una afección o síntomas asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociada con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección). La capacidad de utilizar dosificaciones inferiores de terapias (por ejemplo, agentes profilácticos o terapéuticos) y/o de administrar dichas terapias de forma menos frecuente reduce la toxicidad asociada con la administración de dichas terapias a un sujeto sin reducir la eficacia de dichas terapias en la prevención o tratamiento de una afección (por ejemplo, una infección por virus de la gripe porcina o una afección o síntoma asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociada con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección). Además, un efecto sinérgico puede producir eficacia mejorada de terapias (por ejemplo, agentes profilácticos o terapéuticos) en la prevención o tratamiento de una afección (por ejemplo, una infección por virus de la gripe porcina o una afección o síntoma asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociada con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección). Finalmente, un efecto sinérgico de una combinación de terapias (por ejemplo, agentes profilácticos o terapéuticos) puede evitar o reducir efectos secundarios adversos o indeseados asociados con el uso de cualquier terapia individual.

Como se emplea en esta memoria, la expresión "modulador de receptor de células T" se refiere a un agente que modula la fosforilación de un receptor de células T, la activación de una ruta de transducción de señales asociada con un receptor de células T y/o la expresión de una proteína particular tal como una citoquina. Dicho agente puede modular de forma directa o indirecta la fosforilación de un receptor de células T, la activación de una ruta de transducción de señales asociada con un receptor de células T, y/o la expresión de una proteína particular tal como una citoquina. Ejemplos de moduladores de receptores de células T incluyen, aunque sin limitación, péptidos, polipéptidos, proteínas, proteínas de fusión y anticuerpos que se unen de forma inmunoespecífica a un receptor de células T o un fragmento del mismo. Además, ejemplos de moduladores de receptores de células T incluyen, aunque sin limitación, proteínas, péptidos, polipéptidos (por ejemplo, receptores de células T solubles), proteínas de fusión y anticuerpos que se unen de forma inmunoespecífica a un ligando para un receptor de células T o un fragmento del mismo.

Como se emplea en esta memoria, la expresión "cantidad terapéuticamente eficaz" se refiere a la cantidad de una terapia, que es suficiente para reducir la gravedad de una afección (por ejemplo, una infección por virus de la gripe porcina o una afección o asociada con la misma (por ejemplo, abortos, depresión, inapetencia, anorexia, disnea, mialgia, o ganglios linfáticos submandibulares agrandados inducidos por gripe), una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección), reducir la duración de una afección (por ejemplo, infección por virus de la gripe porcina o una afección asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección), reducir el título de virus de la gripe porcina u otro virus, reducir la cantidad de otros patógenos, mejorar uno o más síntomas de una afección (por ejemplo, una infección por virus de la gripe porcina o una afección asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección), prevenir el avance de una infección (por ejemplo, infección por virus de la gripe porcina o una afección asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección), causar regresión de una afección (por ejemplo, infección por virus de la gripe porcina o una afección asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección), o potenciar o mejorar el efecto o efectos terapéuticos de otra terapia.

Como se emplea en esta memoria, los términos "terapias" y "terapia" pueden referirse a cualquier protocolo o protocolos, método o métodos, composiciones, formulaciones, y/o agente o agentes que pueden usarse en la prevención, tratamiento, control, o mejora de una afección (por ejemplo, infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección). En ciertas realizaciones, los términos "terapias" y "terapia" se refieren a terapia biológica, terapia de apoyo, y/u otras terapias útiles en tratamiento, control, prevención, o mejora de una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una afección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección, conocidas para los expertos en la materia.

Como se emplea en esta memoria, las expresiones "agente terapéutico" y "agentes terapéuticos" se refieren a cualquier agente o agentes que pueden usarse en la prevención, tratamiento, control, o mejora de una afección o un síntoma de la misma (por ejemplo, infección por gripe porcina o una afección o síntoma asociado con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección). Preferiblemente, un agente terapéutico es un agente que se sabe que es útil para, o se ha usado o se está usando actualmente para la prevención, tratamiento, control, o mejora de una infección por virus de la gripe porcina o una afección o síntomas asociados con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección.

Como se emplea en esta memoria, los términos "tratar", "tratamiento", y "que trata" se refieren a la erradicación o control de la replicación del virus de la gripe porcina o la replicación de un patógeno (por ejemplo, un virus) diferente al virus de la gripe porcina, la reducción en el título del virus de la gripe porcina o virus diferente al virus de la gripe porcina, la reducción en las cantidades de un patógeno, la reducción o mejora de la progresión, gravedad, y/o duración de una afección (por ejemplo, una infección por virus de la gripe porcina o una afección asociada con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección), o la mejora de uno o más síntomas como resultado de la administración de una o más terapias (incluyendo, aunque sin limitación, la administración de uno o más agentes profilácticos o terapéuticos).

La expresión "antígeno tumoral" como se emplea en esta memoria se refiere a una molécula en una célula tumoral que puede reconocerse específicamente por células T inmunitarias o anticuerpos. Un antígeno tumoral incluye antígenos presentes solamente en células tumorales (antígenos específicos de tumor) así como aquellos presentes en células normales pero expresados, de forma preferente o aberrante, en células tumorales (antígenos asociados a tumor). Los ejemplos de antígenos tumorales incluyen, aunque sin limitación, antígenos de sarcoidosis, cáncer de próstata, fibrosarcoma, antígenos de auto-diferenciación tales como oncofetal, o diferenciación, antígenos que se expresan por células malignas, incluyendo aunque sin limitación, antígenos oncofetales tales como antígenos carcinoembrionarios (CEA) del colon, alfa-fetoproteína, la contraparte antigénica o equivalente funcional humano del antígeno murino de 175 kDa de carcinomas de vejiga de células transicionales, el antígeno p97 o GD3 asociado a melanoma, y antígenos de diferenciación de carcinomas pulmonares humanos tales como L6 y L20.

Como se emplea en esta memoria, la expresión "virus de la gripe porcina de tipo silvestre" se refiere a los tipos de un virus porcino que son prevalentes, de circulación natural y producen brotes típicos de enfermedad. Ejemplos de virus de la gripe porcina de tipo silvestre incluyen, aunque sin limitación, A/Porcino/Colorado/1/77, A/Porcino/Colorado/23619/99, A/Porcino/Cote d'Armor/3633/84, A/Porcino/Cote d'Armor/ 3633/84, A/Porcino/Inglaterra/195852/92, A/Porcino/Finisterre/2899/82, A/Porcino/Hong Kong/10/98, A/Porcino/Hong Kong/9/98, A/Porcino/Hong Kong/81/78, A/Porcino/Illinois/100084/01, A/Porcino/Illinois/100085A/01, A/Porcino/Illinois/21587/99, A/Porcino/Indiana/1726/88, A/Porcino/Indiana/9K035/99, A/Porcino/Indiana/P12439/00, A/Porcino/Iowa/30, A/Porcino/Iowa/15/30, A/Porcino/Iowa/533/99, A/Porcino/Iowa/569/99, A/Porcino/Iowa/3421/90, A/Porcino/Iowa/8548-1/98, A/Porcino/Iowa/930/01, A/Porcino/Iowa/17672/88, A/Porcino/Italia/1513-1/98, A/Porcino/Italia/1523/98, A/Porcino/Corea/CY02/02, A/Porcino/Minnesota/55551/00, A/Porcino/Minnesota/593/99, A/Porcino/Minnesota/9088-2/98, A/Porcino/Nebraska/1/92, A/Porcino/Nebraska/209/98, A/Porcino/Países Bajos/12/85, A/Porcino/Carolina del Norte/16497/99, A/Porcino/Carolina del Norte/35922/98, A/Porcino/Carolina del Norte/93523/01, A/Porcino/Carolina del Norte/98225/01, A/Porcino/Oedenrode/7C/96, A/Porcino/Ohio/891/01, A/Porcino/Oklahoma/18717/99, A/Porcino/Oklahoma/18089/99, A/Porcino/Ontario/01911-1/99, A/Porcino/Ontario/ 01911-2/99, A/porcino/Ontario/41848/97, A/Porcino/Ontario/97, A/Porcino/Quebec/192/81, A/Porcino/Quebec/ 192/91, A/Porcino/Quebec/5393/91, A/Porcino/Taiwán/7310/70, A/Porcino/Tennessee/24/77, A/Porcino/Texas/ 41992/98, A/Porcino/Wisconsin/125/97, A/Porcino/Wisconsin/136/97, A/Porcino/Wisconsin/163/97, A/Porcino/Wisconsin/164/97, A/Porcino/Wisconsin/166/97, A/Porcino/Wisconsin/168/97, A/Porcino/Wisconsin/235/97, A/Porcino/Wisconsin/238/97, A/Porcino/Wisconsin/457/98, A/Porcino/Wisconsin/ 458/98, A/Porcino/Wisconsin/464/98 y A/Porcino/Wisconsin/14094/99.

4. Descripción de las figuras

Figuras 1A-1B. Generación de virus de la gripe Sw/Tx/98 derivados de plásmido con proteínas mutadas NS1. La Figura 1A representa un diagrama esquemático de los segmentos génicos de NS de gripe de tipo silvestre y mutada. El segmento génico NS se modificó para crear genes NS1 mutados que codifican 73, 99 y 126 aa, respectivamente. Las mutaciones de NS1 no afectaron a la secuencia de la proteína NEP. Las secuencias subrayadas se introdujeron para generar codones de parada (en negrita). La Figura 1B representa el análisis de RT- PCR de los virus mutantes de deleción rWT y NS1. Los segmentos de ARN viral de gripe se amplificaron usando cebadores específicos para las regiones no codificantes de los 8 segmentos virales de gripe. Las flechas indican el tamaño decreciente del segmento NS. Los puntos indican un producto correspondiente al extremo 3' del segmento génico HA debido a la unión interna del cebador directo.

Figuras 2A-2D. Caracterización de virus Sw/TX/98 de tipo silvestre y NS1 mutantes derivados de plásmido en cultivo tisular. La Figura 2A muestra curvas de crecimiento multi-ciclo de mutantes de tipo silvestre y de deleción NS1 en células PK-15. La Figura 2B muestra curvas de crecimiento de un único ciclo de mutantes de tipo silvestre y de deleción NS1 en células PK-15. La Figura 2C muestra el tamaño de placas en células MDCK a los 3 días post infección. La Figura 2D muestra un curso de tiempo de la expresión de proteínas virales. Las células PK-15 se infectaron con virus mutantes rWT y NS1 (MOI=2) y marcados con [35S]Met-Cys a los tiempos indicados p.i. Los extractos celulares se sometieron a SDS-PAGE y se analizaron por autorradiografía.

Figuras 3A-3C. Inducción de IFN tipo I en células PK-15 infectadas con virus Sw/TX/98 de tipo silvestre y

mutantes NS1 derivados de plásmido. La Figura 3A muestra una representación esquemática de los niveles de IFN en bioensayo de IFN secretados por células infectadas por virus en un ensayo fluorescente. La Figura 3B muestra un curso de tiempo de la síntesis de IFN tipo I. Se trataron células PK-15 recientes durante 24 horas con sobrenadantes inactivados por UV (recogidos a diferentes tiempos p.i.) de células PK-15 que se infectaron con los virus indicados, seguido por infección por VSV-GFP. Dieciséis horas post infección, las células que expresan GFP se visualizaron por microscopia de fluorescencia. La Figura 3C muestra un análisis RT-PCR de ARNm de TNF-, IFN- y específicos de actina- en células PK-15 infectadas con virus.

Figuras 4A-4C. Infección de cerdos de 4 semanas de edad con virus Sw/TX/98 de tipo silvestre y mutantes NS1 derivados de plásmido. La Figura 4A muestra un diagrama de barras que representa los valores histopatológicos de pulmones de cerdos infectados con virus de deleción TX/98 derivados de plásmido. Porcentaje medio (±ETM) de la superficie pulmonar con lesiones macroscópicas en el día 5 p.i. La Figura 4B muestra lesiones microscópicas en los bronquiolos medios en el día 5 p.i. La Figura 4C muestra los títulos de virus en el fluido de lavado broncoalveolar en el día 5 p.i.

Figuras 5A-5D. Examen histopatológico de pulmones de cerdos infectados con virus Sw/TX/98 de tipo silvestre y mutantes NS1 derivados de plásmido, aumento 200x. La Figura 5A muestra los bronquiolos de tamaño medio del pulmón de un cerdo de control no infectado. El revestimiento epitelial está intacto, y los alveolos adyacentes son normales. La Figura 5B muestra bronquiolitis necrotizante aguda severa y neumonía intersticial característica de la lesión extendida inducida por infección con virus rWT TX/98. La Figura 5C muestra un bronquiolo normal y un bronquiolo afectado en recuperación temprana de infección con virus mutante de deleción 1-99, representativo de la lesión menos extensiva inducida por infección con este virus. La Figura 5D muestra bronquiolos normales y alveolos adyacentes del pulmón de un cerdo inoculado con virus 1-126. No se indujeron lesiones por este virus.

Figuras 6A-D. Examen histopatológico de pulmones de cerdos infectados con virus Sw/TX/98 de tipo silvestre y mutantes NS1 derivados de plásmido, aumento 200x. La Figura 6A muestra el revestimiento epitelial de un bronquiolo más grande del pulmón de un cerdo de control no infectado. Las células epiteliales son altas columnares con núcleos basales pseudo-estratificados y cilios superficiales prominentes. La Figura 6B muestra el revestimiento epitelial de un bronquiolo más grande del pulmón de un cerdo infectado con virus TX/98 rWT. El revestimiento epitelial está en total desorganización debido a necrosis y proliferación regenerativa de las células epiteliales. La Figura 6C muestra un bronquiolo más grande y ramificación más pequeña de las vías aéreas del pulmón de un cerdo infectado con virus mutante de deleción 1-99, representativo de la lesión menos extensiva inducida por este virus. La Figura 6D muestra un revestimiento epitelial normal del pulmón de un cerdo inoculado con virus 1-126. No se produjo lesión bronquiolar.

Figura 7. Histopatología de cerdos vacunados con TX/98/del 126. La Figura 7 muestra un diagrama de barras que representa los valores histopatológicos de pulmones de cerdos vacunados con TX/98/del 126. Simulado = cerdos inoculados de forma simulada, no vacunados; H3N2 = cerdos no vacunados inoculados con 2x105 UFP por cerdo con A/Porcino/Texas/4199-2/98; H1N1= cerdos no vacunados inoculados con 2x105 UFP por cerdo con A/Porcino/MN/37866/99; MLV + Simulado = cerdos inoculados de forma simulada, vacunados con TX/98/del 126; MLV + H3N2 = cerdos vacunados con TX/98/del 126 inoculados con 2x105 UFP por cerdo con A/Porcino/Texas/4199-2/98; MLV+ H1N1= cerdos vacunados con TX/98/del 126 inoculados con 2x105 UFP por cerdo con A/Porcino/MN/37866/99.

Figura 8: Inmunohistoquímica para antígeno SIV en cerdos vacunados con TX/98/del 126. La Figura 8 muestra un diagrama de barras que representa los valores inmunohistológicos para cerdos vacunados con TX/98/del126. Simulado = cerdos inoculados de forma simulada, no vacunados; H3N2 = cerdos no vacunados inoculados con 2x 105 UFP por cerdo con A/Porcino/Texas/4199-2/98; H1N1 = cerdos no vacunados inoculados con 2x105 UFP por cerdo con A/Porcino/MN/37866/99; MLV + Simulado = cerdos inoculados de forma simulada, vacunados con TX/98/del 126; MLV + H3N2 = cerdos vacunados con TX/98/del 126 inoculados con 2x105 UFP por cerdo con A/Porcino/Texas/4199-2/98; MLV + H1N1= cerdos vacunados con TX/98/del 126 inoculados con 2x105 UFP por cerdo con A/Porcino/MN/37866/99.

Figura 9: Títulos de virus en lavado pulmonar de cerdos inmunizados con TX/98/del 126 expuestos con SIV

H3N2 y H1N1. La Figura 9 muestra un diagrama de barras que representa los títulos virales en lavado pulmonar de cerdos vacunados con TX/98/del126. Simulado = cerdos inoculados de forma simulada, no vacunados; H3N2 = cerdos no vacunados inoculados con 2x105 UFP por cerdo A/Porcino/Texas/4199-2/98; H1N1 = cerdos no vacunados inoculados con 2x105 UFP por cerdo con A/Porcino/MN/37866/99; MLV + Simulado = cerdos inoculados de forma simulada, vacunados con TX/98/del 126; MLV + H3N2 = cerdos vacunados con TX/98/del 126 inoculados con 2x105 UFP por cerdo con A/Porcino/Texas/4199-2/98; MLV + H1N1= cerdos vacunados con TX/98/del 126 inoculados con 2x105 UFP por cerdo con A/Porcino/MN/37866/99. El límite de detección de virus fue 101,5 DICT50/ml.

5. Descripción detallada de la invención

La presente invención proporciona un virus de la gripe porcina atenuado modificado por ingeniería genética que tiene un fenotipo antagonista de interferón alterado, donde dicho virus comprende un gen de NS1 del virus de la gripe porcina A/Porcino/Texas/4199-2/98 con una mutación que produce una proteína NS1 con una deleción de todos los restos de aminoácido de NS1 excepto los restos de aminoácido 1-126, donde el aminoácido amino- terminal es el número 1 y la mutación en el gen de NS1 confiere un fenotipo antagonista de interferón alterado.

La presente invención proporciona adicionalmente una formulación inmunogénica que comprende el virus de la gripe porcina atenuado, modificado por ingeniería genética, y un excipiente fisiológicamente aceptable. Además, la presente invención proporciona una formulación farmacéutica que comprende el virus de la gripe porcina atenuado, modificado por ingeniería genética, de la presente invención y un vehículo farmacéuticamente aceptable.

Además, la presente invención proporciona el uso de una cantidad eficaz de la formulación inmunogénica de la presente invención en la preparación de un medicamento para su uso en la inmunización o inducción de una respuesta inmunitaria en un cerdo. Además, la presente invención proporciona el uso de una cantidad eficaz del virus de la gripe porcina atenuado modificado por ingeniería genética de la presente invención en la preparación de un medicamento, donde el medicamento es (a) para su uso en la prevención de una afección o un síntoma asociado con virus de la gripe porcina en un cerdo; o (b) para su uso en el tratamiento de una infección por virus de la gripe porcina en un cerdo.

La presente invención también proporciona un método para la producción de una formulación inmunogénica que comprende (a) propagar en un sustrato el virus de la gripe porcina atenuado modificado por ingeniería genética de la presente invención y (b) recoger el virus de la descendencia, donde el sustrato es una célula, línea celular o huevo embrionado.

Además, la presente invención proporciona una célula cultivada que contiene el virus de la gripe porcina atenuado, modificado por ingeniería genética, de la presente invención. La presente invención también proporciona un huevo embrionado que contiene el virus de la gripe porcina atenuado modificado por ingeniería genética de la presente invención.

En la presente memoria se describen virus de la gripe porcina atenuados que tienen una capacidad alterada de antagonizar la respuesta de interferón (IFN) celular, métodos para producir dichos virus de la gripe porcina atenuados, y el uso de dichos virus en formulaciones de vacuna y farmacéuticas. Dichos virus son capaces de generar una respuesta inmunitaria y crear inmunidad pero sin causar enfermedad, o de causar menos síntomas y/o síntomas menos severos, es decir, los virus tienen virulencia disminuida. Por lo tanto, son candidatos ideales para vacunas de virus vivo. Además, los virus de la gripe porcina atenuados pueden inducir una contundente respuesta de IFN que tiene otras consecuencias biológicas in vivo, produciendo protección contra posteriores enfermedades infecciosas y/o induciendo respuestas antitumorales. Por lo tanto, los virus de la gripe porcina atenuados pueden usarse de forma farmacéutica para la prevención o tratamiento de otras enfermedades infecciosas y/o enfermedades tratables por IFN.

La invención se basa, en parte, en el descubrimiento de los solicitantes de que los virus de la gripe porcina modificados por ingeniería para que contengan o que contienen una o más deleciones en el gen de NS1 tienen replicación alterada respecto a virus de la gripe porcina de tipo silvestre como se demuestra por menos lesiones pulmonares tras infección de los cerdos, títulos virales reducidos en fluido de lavado broncoalveolar (BALF) y detección reducida de virus en frotis nasales. Sorprendentemente, y contrario a los resultados observados con virus de la gripe humana en modelos de ratón, la longitud de la proteína NS1 no se correlaciona con el nivel de atenuación del virus de la gripe porcina. Los solicitantes han descubierto que con gripe porcina, un virus mutante con la proteína NS1 más corta es el menos atenuado. En otras palabras, virus de la gripe porcina que contienen deleciones más cortas en el gen de NS1 muestran mayor atenuación in vivo que virus de la gripe porcina que contienen deleciones más largas en su gen NS1, o virus de la gripe porcina de tipo silvestre. Los solicitantes han descubierto adicionalmente que los virus de la gripe porcina recombinantes están alterados en su capacidad de inhibir la producción de IFN in vitro, y no se replican de forma tan eficaz como la cepa recombinante precursora en huevos embrionados de gallina de 10 días de vida, en células MDCK, en células PK-15 o en un modelo de cerdo in vivo. Aunque sin el deseo de limitarse a teoría o explicación alguna para el mecanismo de acción de los mutantes de deleción de NS1 del virus de la gripe porcina in vivo, las características atenuadas de dichos virus se deben presumiblemente a sus niveles de expresión de proteína NS1, su capacidad de inducir una contundente respuesta de IFN celular, y su capacidad alterada de antagonizar dicha respuesta. Sin embargo, las características beneficiosas de dichos virus pueden no ser únicamente atribuibles a su efecto sobre la respuesta de interferón celular. De hecho, alteraciones en otras actividades asociadas con NS1, tales como, la alteración del corte y ayuste del pre-ARNm, la inhibición de la poliadenilación del ARNm celular, el transporte nucleocitoplasmático del ARNm que contiene poli(A), y la estimulación de la síntesis de proteínas virales, pueden contribuir al fenotipo atenuado deseado conseguido mediante la introducción de mutaciones en el gen de NS1 del virus de la gripe porcina.

Un virus de la gripe porcina atenuado, descrito en la presente memoria, comprende una mutación en un gen de NS1 de la gripe porcina que disminuye la capacidad del producto génico NS1 de antagonizar la respuesta de interferón celular. En un aspecto, un virus de la gripe porcina atenuado descrito en la presente memoria comprende un genoma que comprende una mutación en un gen de NS1 de virus gripe porcina que disminuye la capacidad del producto génico NS1 de antagonizar una respuesta de interferón celular, y permite que el virus atenuado, a una multiplicidad de infección (MOI) entre 0,0005 y 0.001, 0,001 y 0,01, 0,01 y 0,1, o 0,1 y 1, o una MOI de 0,0005, 0,0007, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1, 0, 1,5, 2,0, 2,5, 3,0, 3,5, 4,0, 4,5, 5,0, 5,5, o 6,0, crezca hasta títulos entre aproximadamente 1 a aproximadamente 100 veces, aproximadamente 5 a aproximadamente 80 veces, aproximadamente 20 a aproximadamente 80 veces, o aproximadamente 40 a aproximadamente 80 veces, aproximadamente 1 a aproximadamente 10 veces, aproximadamente 1 a aproximadamente 5 veces, aproximadamente 1 a aproximadamente 4 veces, aproximadamente 1 a aproximadamente 3 veces, aproximadamente 1 a aproximadamente 2 veces, o aproximadamente 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces inferiores que el virus de la gripe porcina de tipo silvestre en células (por ejemplo, células de un ser humano (por ejemplo, PerC6, una línea celular productora derivada de retinoblastos embrionarios humanos transformados con la región E1 de adenovirus 5), ratón, pollo (por ejemplo, fibroblastos embrionarios de pollo), rata, aves, o cerdo (por ejemplo, células PK(D1), células PK(15), células PK13, células NSK, células LLC-PK1, células LLC-PK1A, células ESK-4, células ST, células PT-K75, células PK-2a/CL 13 o SJPL)), determinados aproximadamente 2 a 10 días, 3 a 7 días, 3 a 5 días, o 2, 3, 4, 5, 6, 7, 8, 9, 10 días post- infección cuando se propagan en las mismas condiciones. Los títulos de virus de la gripe porcina atenuados y de tipo silvestre pueden determinarse utilizando cualquier técnica bien conocida en la técnica o descrita en la presente memoria (por ejemplo, ensayos de hemaglutinación, ensayos de placa, dosis infecciosas en huevo (DIH50), dosis infecciosas en cultivo tisular (DICT50), etc.) y los virus pueden propagarse en condiciones descritas en la presente memoria o bien conocidas en la técnica (por ejemplo, en células de cerdo, células MDCK (por ejemplo, en MEM, suero fetal de ternera (FCS) al 10% v/v, penicilina al 1%/estreptomicina a 37 ºC en una incubadora humidificada al 5% de CO2) o huevos embrionados de gallina (por ejemplo, en una incubadora estacionaria a 37 ºC con humedad relativa del 55%). Como alternativa, los virus pueden propagarse en células (por ejemplo, en células de cerdo, células MDCK, etc.) que se cultivan en medio sin suero o de suero reducido (por ejemplo, TPCK tripsina). El crecimiento de un virus de la gripe porcina atenuado de la invención puede compararse con un patrón o referencia particular, por ejemplo, virus de la gripe porcina de tipo silvestre A/porcino/Texas/4199-2/98.

En un aspecto específico, un virus de la gripe porcina atenuado descrito en la presente memoria comprende un genoma que comprende una mutación en un gen de NS1 del virus de la gripe porcina que disminuye la capacidad del producto génico NS1 de antagonizar una respuesta de interferón celular, y permite que el virus atenuado, a una multiplicidad de infección (MOI) entre 0,0005 y 0.001, 0,001 y 0,01, 0,01 y 0,1, o 0,1 y 1, o una MOI de 0,0005, 0,0007, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1, 0, 1,5, 2,0, 2,5, 3,0, 3,5, 4,0, 4,5, 5,0, 5,5, o 6,0, crezca hasta títulos entre aproximadamente 1 a aproximadamente 100 veces, aproximadamente 5 a aproximadamente 80 veces, aproximadamente 20 a aproximadamente 80 veces, o aproximadamente 40 a aproximadamente 80 veces, aproximadamente 1 a aproximadamente 10 veces, aproximadamente 1 a aproximadamente 5 veces, aproximadamente 1 a aproximadamente 4 veces, aproximadamente 1 a aproximadamente 3 veces, aproximadamente 1 a aproximadamente 2 veces, o aproximadamente 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces inferiores que el virus de la gripe porcina de tipo silvestre en células de cerdo, determinados aproximadamente 2 a 10 días, 3 a 7 días, 3 a 5 días, o 2, 3, 4, 5, 6, 7, 8, 9, 10 días post-infección cuando se propagan en las mismas condiciones. Los títulos de virus de la gripe porcina atenuados y de tipo silvestre pueden determinarse utilizando cualquier técnica bien conocida en la técnica o descrita en la presente memoria (por ejemplo, ensayos de hemaglutinación, ensayos de placa, dosis infecciosas en huevo (DIH50), dosis infecciosas en cultivo tisular (DICT50), etc.) y los virus pueden propagarse en condiciones descritas en la presente memoria o bien conocidas en la técnica (por ejemplo, en células de cerdo, células MDCK (por ejemplo, en MEM, suero fetal de ternera (FCS) al 10% v/v, penicilina al 1%/estreptomicina a 37 ºC en una incubadora humidificada al 5% de CO2) o huevos embrionados de gallina (por ejemplo, en una incubadora estacionaria a 37 ºC con humedad relativa del 55%). Como alternativa, los virus pueden propagarse en células (por ejemplo, en células de cerdo, células MDCK, etc.) que se cultivan en medio sin suero o de suero reducido (por ejemplo, TPCK tripsina).

Un virus de la gripe porcina atenuado que tiene el fenotipo deseado puede en sí mismo usarse como principio activo en formulaciones de vacuna, farmacéuticas o inmunogénicas. Como alternativa, el virus de la gripe porcina atenuado puede usarse como el vector o "estructura" de vacunas producidas de forma recombinante o formulaciones inmunogénicas. Para este fin, puede usarse la técnica de "genética inversa" para diseñar mutaciones o introducir epítopos exógenos en el virus de la gripe porcina atenuado, que serviría como la cepa "precursora". De este modo, pueden diseñarse vacunas para inmunización contra variantes de cepa, o como alternativa, contra agentes infecciosos o antígenos de enfermedad completamente diferentes (por ejemplo, antígenos tumorales). Por ejemplo, el virus atenuado puede diseñarse para que exprese epítopos neutralizantes de otras cepas preseleccionadas. Como alternativa, epítopos de otros virus pueden construirse en el virus de la gripe porcina atenuado. Como alternativa, pueden diseñarse epítopos de patógenos infeccioso no virales (por ejemplo, parásitos, bacterias, hongos) en el virus de la gripe porcina atenuado.

En la presente memoria se describen métodos para vacunar a un sujeto que comprende administrar las formulaciones de vacuna descritas en la presente memoria. En un aspecto, se describe en la presente memoria un método que comprende administrar a un sujeto una cantidad eficaz de una formulación de vacuna descrita en la presente memoria. En ciertos aspectos, la dosis de la formulación de vacuna administrada al sujeto es entre aproximadamente 102 a aproximadamente 108, de aproximadamente 103 a aproximadamente 107, o de aproximadamente 104 a aproximadamente 5 x 106 ufp. En otros aspectos, la dosis de la formulación de vacuna administrada es 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 105, 106,5 x 106, 10 ,5 x 10 o 10 ufp. En otros aspectos, la dosis de una formulación inmunogénica de la invención administrada a un sujeto es 102 a aproximadamente 108, de aproximadamente 103 a aproximadamente 107, o de aproximadamente 104 a aproximadamente 5 x 106 ufp. En otros aspectos más, la dosis de una formulación inmunogénica de la invención administrada a un sujeto es 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 105, 106, 5 x 106, 107, 5 x 107 o 108 ufp.

En aspectos específicos, el sujeto es un burro, cebra, camello, perro, ave (por ejemplo, un pato). En un aspecto preferido, el sujeto es un cerdo.

La presente invención proporciona formulaciones inmunogénicas que comprenden un virus de la gripe porcina atenuado de la invención. También en la presente memoria se describen métodos para inducir una respuesta inmunitaria para el tratamiento, control o prevención de una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, o una afección en que pueden usarse los virus de la gripe porcina atenuados como un vector para inducir una respuesta inmunitaria contra un antígeno particular asociado con la afección, que comprende administrar a un sujeto una formulación inmunogénica de la invención. La presente invención se refiere a una formulación inmunogénica para su uso en un método para inmunizar o inducir una respuesta inmunitaria, por ejemplo, para el tratamiento, control o prevención de una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, que comprende administrar a un sujeto una cantidad eficaz de una formulación inmunogénica de la invención. La dosis de la formulación inmunogénica a administrar al sujeto puede ser entre aproximadamente 102 a aproximadamente 108, de aproximadamente 103 a aproximadamente 107, de aproximadamente 104 a aproximadamente 5 x 106 ufp o de aproximadamente 104 a aproximadamente 107 ufp. La dosis de la formulación inmunogénica de la invención a administrar a un sujeto puede ser de 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 105, 106, 5 x 106, 107, 5 x 107 o 108 ufp. El sujeto puede ser un burro, cebra, camello, pero, ave (por ejemplo, un pato), y especialmente un cerdo.

Los virus de la gripe porcina atenuados, que inducen contundentes respuestas de IFN en sujetos, también pueden usarse en formulaciones farmacéuticas para la profilaxis o tratamiento de otras infecciones, o enfermedades tratables por IFN tales como cáncer. A este respecto, el tropismo del virus de la gripe porcina atenuado puede alterarse para abordar el virus en un órgano, tejido o células diana deseadas in vivo o ex vivo. Usando este enfoque, la respuesta de IFN puede inducirse de forma local, en el sitio diana, evitando de este modo o minimizando los efectos secundarios de tratamientos sistémicos de IFN. Para este fin, el virus de la gripe porcina atenuado puede modificarse para expresar un ligando específico para un receptor del órgano, tejido o células diana.

En la presente memoria se describen métodos para prevenir, controlar o tratar una infección o enfermedad tratable por IFN en un sujeto, diferente a una infección viral de la gripe porcina o enfermedad tratable por IFN causada por virus de la gripe porcina, que comprende administrar una formulación farmacéutica de la invención. En un aspecto, se describe en la presente memoria un método para prevenir, controlar o tratar una infección o enfermedad tratable por IFN en un sujeto, diferente a una infección viral de la gripe porcina o enfermedad tratable por IFN causada por virus de la gripe porcina, que comprende administrar una cantidad eficaz de una formulación farmacéutica de la invención. La dosis de la formulación farmacéutica a administrar al sujeto puede ser entre aproximadamente 102 a aproximadamente 108, de aproximadamente 103 a aproximadamente 107, de aproximadamente 104 a aproximadamente 5 x 106 ufp o de aproximadamente 104 a aproximadamente 1012 ufp. La dosis de la formulación farmacéutica a administrar al sujeto puede ser de 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 10s, 106, 5 x 106, 107, 5 x 107, 105, 5 x 108, 1 x 109, 5 x 109, 1 x 1010, 5 x 1010, 1 x 1011, 5 x 1011 o 1012 ufp. El sujeto puede ser un burro, cebra, camello, pero, ave (por ejemplo, un pato), y especialmente un cerdo.

En la presente memoria se describen métodos para prevenir, controlar o tratar el cáncer en un sujeto que comprende administrar una composición farmacéutica de la invención. En un aspecto, se describe en la presente memoria un método para prevenir, controlar o tratar el cáncer en un sujeto que comprende administrar una cantidad eficaz de una composición farmacéutica de la invención. La dosis de la formulación farmacéutica a administrar al sujeto puede ser entre aproximadamente 102 a aproximadamente 108, de aproximadamente 103 a aproximadamente 107, de aproximadamente 104 a aproximadamente 5 x 106 ufp o de aproximadamente 104 a aproximadamente 1012 ufp. La dosis de la formulación farmacéutica a administrar al sujeto puede ser de 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 10s, 106, 5 x 106, 107, 5 x 107, 105, 5 x 108, 1 x 109, 5 x 109, 1 x 1010, 5 x 1010, 1 x 1011, 5 x 1011 o 1012 ufp.

Los solicitantes demostraron que virus de la gripe porcina atenuados con actividad antagonista de interferón alterada demostraron replicarse en títulos de generación in vivo que son inferiores que los detectados con virus de la gripe porcina de tipo silvestre, pero que son suficientes para inducir respuestas inmunológicas y de citoquinas. Por tanto, las mutaciones que disminuyen pero no eliminan la actividad antagonista de IFN del virus de la gripe porcina son preferidas para formulaciones de vacuna. Dichos virus pueden seleccionarse por su crecimiento en sustratos tanto convencionales como no convencionales, y por virulencia intermedia.

La presente invención proporciona células que contienen (como alternativa, que comprenden) virus de la gripe porcina de la presente invención. Una célula puede contener/comprender un virus de la gripe porcina que está modificado pro ingeniería genética. El virus de la gripe porcina atenuado contenido en la célula puede estar modificado por ingeniería para codificar un epítopo derivado de otro virus o un antígeno tumoral. El genoma del virus de la gripe porcina atenuado puede comprender al menos un segmento derivado de un virus diferente. Las células que pueden infectarse con, contener o comprender un virus de la gripe porcina atenuado de la invención incluyen, aunque sin limitación, células MDCK, células PK, células Vero, células endoteliales de vena umbilical humana primaria (HUVEC), línea celular de epitelio humano H292, células HeLa, y células renales embrionarias porcinas RES. La célula puede ser una célula de cerdo o una línea celular de cerdo. La célula (por ejemplo, una célula de cerdo o línea celular de cerdo) puede ser deficiente en interferón.

La invención abarca el uso de sustratos tales como células, líneas celulares y huevos embrionados, para propagar los virus de la gripe porcina atenuados de la invención. En una realización, la invención proporciona métodos para la producción de vacunas, la producción de formulaciones inmunogénicas y la producción de agentes farmacéuticos que comprenden propagar en un sustrato un virus de la gripe porcina atenuado de la presente invención y recoger el virus de la descendencia, donde el sustrato es una célula, línea celular o huevo embrionado. El sustrato puede ser un sistema IFN-deficiente. Sistemas IFN-deficientes ejemplares incluyen, aunque sin limitación, huevos embrionados jóvenes (por ejemplo, huevos embrionados de 6 a 10 días de vida, de 6 a 9 días de vida, de 6 a 8 días de vida o de 6 a 7 días de vida), líneas celulares IFN-deficientes (tales como células VERO o líneas celulares modificadas por ingeniería genética tales como knockouts STAT1). Los huevos embrionados o líneas celulares pre-tratadas con compuestos que inhiben el sistema IFN (incluyendo fármacos, anticuerpos, antisentido, ribozimas, etc.) también pueden usarse como sistema IFN-deficiente. Además, los huevos deficientes en el sistema IFN, por ejemplo, huevos producidos por aves STAT1 negativas, especialmente aves de corral, incluyendo aunque sin limitación pollos, patos o pavos transgénicos, pueden usarse como sistemas IFN-deficiente.

5.1 Generación de mutantes con actividad antagonista de IFN alterada

Cualquier virus o cepa de la gripe porcina mutante que tenga una actividad antagonista de IFN disminuida puede seleccionarse y usarse de acuerdo con la presente descripción. En un aspecto, pueden seleccionarse mutantes o variantes de origen natural, o mutantes espontáneos de la gripe porcina que tengan una capacidad alterada de antagonizar la respuesta de IFN celular. En otro aspecto, los virus de la gripe porcina mutantes pueden generarse exponiendo el virus a mutágenos, tales como irradiación ultravioleta o mutágenos químicos, o por múltiples pases y/o pase en hospedadores no permisivos. Puede usarse selección en un sistema de cultivo diferencial para aquellos mutantes que tienen función antagonista de IFN alterada. Como el virus de la gripe porcina A tiene un genoma segmentado, el fenotipo atenuado puede transferirse a otra cepa que tenga un antígeno deseado por redistribución, (es decir, por coinfección del virus atenuado y la cepa deseada, y selección de las redistribuciones que presentan ambos fenotipos). Los virus de la gripe porcina de la invención no son virus de origen natural. Los virus de la gripe porcina de la invención pueden ser virus modificados por ingeniería genética. Un virus de la gripe porcina con mutaciones de origen natural en el gen de NS1 puede no estar abarcado por la invención. En ciertos aspectos, los virus de la gripe porcina conocidos con mutaciones en el gen de NS1 gene no están abarcados por la invención. En aspectos específicos, los virus de la gripe porcina descritos en la presente memoria contienen todo o una parte del gen de NS1 derivado de virus de la gripe humana.

Puede diseñarse mutaciones en el virus de la gripe porcina usando enfoques de "genética inversa". De este modo, pueden diseñarse mutaciones naturales u otras mutaciones que confieren el fenotipo atenuado en cepas de vacuna. Por ejemplo, pueden diseñarse deleciones, inserciones o sustituciones de la región codificante del gen del virus de la gripe porcina para la actividad antagonista de IFN (es decir, el NS1 del virus de la gripe porcina). También se contemplan deleciones, sustituciones o inserciones en la región no codificante del gen del virus de la gripe porcina responsable de la actividad antagonista de IFN. Para este fin, pueden diseñarse mutaciones en las señales responsables de la transcripción, replicación, poliadenilación y/o empaquetado del gen responsable de la actividad antagonista de IFN. Dichas mutaciones, por ejemplo en el promotor, podrían regular negativamente la expresión del gen del virus de la gripe porcina responsable de la actividad antagonista de IFN. Pueden hacerse mutaciones en el promotor, por ejemplo, por combinación del promotor (por ejemplo, del promotor del virus de la gripe B), o en las regiones no codificantes del gen NS1. Las mutaciones en los genes del virus de la gripe porcina que pueden regular la expresión del gen del virus de la gripe porcina responsable de la actividad antagonista de IFN (es decir, el gen de NS1 del virus de la gripe porcina) también están dentro del alcance de los virus que pueden usarse de acuerdo con la invención.

También en la presente memoria se describen virus de la gripe porcina que comprenden genomas que comprenden mutaciones en el segmento génico NS1 que pueden no provocar una actividad antagonista de IFN alterada o un fenotipo inductor de IFN sino que provocan funciones virales alteradas y un fenotipo atenuado, por ejemplo, inhibición alterada de la exportación nuclear de ARNm que contiene poli(A), inhibición alterada del corte y Yuste de pre-ARNm, inhibición alterada de la activación de PKR por secuestro de ARNbc, efecto alterado sobre la traducción de ARN viral e inhibición alterada de la poliadenilación del ARNm del hospedador (por ejemplo, véase Krug en Textbook of Gripe, Nicholson et al. Ed. 1998, 82-92, y referencias citadas en ese documento).

La técnica de genética inversa implica la preparación de ARN virales recombinantes sintéticos que contienen las regiones no codificantes del ARN del virus de la gripe porcina que son esenciales para el reconocimiento por polimerasas virales y para señales de empaquetado necesarias para generar un virión maduro. Los ARN recombinantes se sintetizan a partir de un molde de ADN recombinante y se reconstituyen in vitro con complejo de polimerasa viral purificado para formar ribonucleoproteínas (RNP) recombinantes que pueden usarse para transfectar células. Se consigue una transfección más eficaz si las proteínas de polimerasa viral están presentes durante la transcripción de los ARN sintéticos in vitro o in vivo. Los RNP recombinantes sintéticos pueden rescatarse en partículas virales infecciosas. Las técnicas anteriores se describen en la patente de Estados Unidos Nº 5.166.057 expedida el 24 de noviembre de 1992; en la patente de Estados Unidos Nº 5.854.037 expedida el 29 de diciembre de 1998; en la publicación de patente europea EP 0702085A1, publicada el 20 de febrero de 1996; en la solicitud de patente de Estados Unidos Nº de serie 09/152.845; en las publicaciones de patente internacional PCT W097/12032 publicada el 3 de abril de 1997; W096/34625 publicada el 7 de noviembre de 1996; en la publicación de patente europea EP-A780475; el documento WO 99/02657 publicado el 21 de enero de 1999; el documento WO 98/53078 publicado el 26 de noviembre de 1998; el documento WO 98/02530 publicado el 22 de enero de 1998; el documento WO 99/15672 publicado el 1 de abril de 1999; el documento WO 98/13501 publicado el 2 de abril de 1998; el documento WO 97/06270 publicado el 20 de febrero de 1997; y el documento EPO 780 475A1 publicado el 25 de junio de 1997.

También puede utilizarse la tecnología de plásmidos sin auxiliar para diseñar un virus de la gripe porcina atenuado. Para una descripción de la tecnología de plásmidos sin auxiliar véase, por ejemplo, la publicación internacional Nº WO 01/04333; la patente de Estados Unidos Nº 6.649.372; Fodor et al., 1999, J. Virol. 73:9679-9682; Hoffmann et

al., 2000, Proc. Natl. Acad. Sci. USA 97:6108-6113; y Neumann et al., 1999, Proc. Natl. Acad. Sci. USA 96:9345- 9350.

Los virus atenuados generados por el enfoque de genética inversa o tecnología de plásmidos sin auxiliar pueden usarse en las formulaciones de vacuna, inmunogénicas y farmacéuticas descritas en la presente memoria. Las técnicas de genética inversa o la tecnología de plásmidos sin auxiliar también pueden usarse para diseñar mutaciones adicionales en otros genes virales importantes para la producción de formulaciones de vacuna, inmunogénicas y farmacéuticas - es decir, los epítopos de cepas de vacuna útiles variantes pueden modificarse en un virus de la gripe porcina atenuado. Como alternativa, pueden diseñarse epítopos completamente exógenos, incluyendo antígenos derivados de otros patógenos virales o no virales en la una cepa atenuada. Por ejemplo, puede modificarse antígenos de virus no relacionados, antígenos de parásitos, antígenos bacterianos o fúngicos o antígenos tumorales en una cepa atenuada (por ejemplo, epítopos de virus del síndrome reproductor y respiratorio porcino, citomegalovirus porcino, coronavirus respiratorio porcino, virus de encefalomiocarditis porcina, diarrea epidémica porcina y determinantes antigénicos de patógenos porcinos no virales tales como bacterias, incluyendo, aunque sin limitación, Brucella suis, y parásitos incluyendo, aunque sin limitación, ascárides (Ascaris suum), tricocéfalos (Trichuris suis), o un antígeno tumoral tal como el antígeno carcinoembrionario (CEA), antígeno de cáncer de mama tal como EGFR (receptor del factor de crecimiento epidérmico), antígeno HER2 (p185HER2), epítopo HER2 neu, antígeno canceroso-50 (CA-50), antígeno canceroso 15-3 (CA15-3) asociado con cáncer de mama, antígeno asociado a carcinoma (CAA), antígeno de melanoma, y antígenos asociados a melanoma 100, 25, y 150). Como alternativa, pueden diseñarse epítopos que alteren el tropismo del virus in vivo en los virus atenuados quiméricos descritos en la presente memoria.

En un aspecto específico, puede usarse una combinación de técnicas de genética inversa o tecnología sin auxiliar y técnicas de redistribución para diseñar virus atenuados que tengan los epítopos deseados en virus de la gripe porcina. Por ejemplo, puede co-infectarse un virus de la gripe porcina atenuado (generado por, por ejemplo, técnicas de genética inversa, tecnología de plásmidos sin auxiliar o una combinación de las mismas) y una cepa que porta el epítopo de vacuna deseado (generada por, por ejemplo, selección natural, mutagénesis, por técnicas de genética inversa, tecnología de plásmidos sin auxiliar o una combinación de las mismas) en hospedadores que permiten la redistribución de los genomas segmentados. Entonces pueden seleccionarse las redistribuciones que presentan tanto el fenotipo atenuado como el epítopo deseado. Pueden usarse técnicas de redistribución para transferir el fenotipo atenuado desde una cepa precursora de virus de la gripe porcina (un mutante natural, un virus mutagenizado, o un virus modificado por ingeniería genética) a una cepa de virus diferente (un virus de tipo silvestre, un mutante natural, un virus mutagenizado, o un virus modificado por ingeniería genética).

En un aspecto específico, se describe en la presente memoria un virus de la gripe porcina atenuado que comprende un genoma que comprende una mutación en el gen de NS1 del virus de la gripe porcina que disminuye la capacidad del producto génico NS1 de antagonizar una respuesta de interferón celular. DE acuerdo con este aspecto, el virus de la gripe porcina atenuado está preferiblemente modificado por ingeniería genética.

Los virus de la gripe porcina atenuados de la invención pueden tener una o más o una combinación de cualquiera de las siguientes características: la capacidad de inducir actividad de interferón a un nivel menor que (por ejemplo, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% o 98% menor que) el del virus de la gripe porcina de tipo silvestre, por ejemplo, A/Porcino/Texas/4199-2/98, medido por ensayos convencionales de interferón; un título viral 1 a 50, 2 a 25, 2 a 10 o 3 a 7 veces menor que el virus de la gripe porcina de tipo silvestre, por ejemplo, A/Porcino/Texas/4199-2/98, cuando se cultivan en la mismas condiciones (por ejemplo, inoculados a una MOI de 0,0001, 0,0005, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1, 5 o 10 y cultivados en células PK, células PK(D1), células PK(15), células PK13, células NSK, células LLC-PK1, células LLC-PK1A, células ESK-4, células ST, células PT-K75, células PK-2a/CL 13 o células SJPL y ensayados en células MDCK); un título viral 1 a 10 veces, 1 a 5 veces, 5-10 veces, 10 a 500, 20 a 250, 20 a 100 o 40 a 80 veces menos que el virus de la gripe porcina de tipo silvestre, por ejemplo, A/Porcino/Texas/4199-2/98, cuando se aíslan de BALF de cerdos infectados ensayados en un ensayo de placa realizado en células MDCK; o una capacidad reducida de causar lesiones pulmonares en cerdos infectados.

En un aspecto específico, un virus de la gripe porcina atenuado descrito en la presente memoria tiene un genoma que comprende una mutación en un gen de NS1 del virus de la gripe porcina que disminuye la capacidad del producto génico NS1 de antagonizar una respuesta de interferón celular, y permite que el virus atenuado, a una multiplicidad de infección (MOI) entre 0,0005 y 0,001, 0,001 y 0,01, 0,01 y 0,1, 0,1 y 1, o 0,1 y 1, o una MOI de 0,0005, 0,0007, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1,0, 1,5, 2,0, 2,5, 3,0, 3,5, 4,0, 4,5, 5,0, 5,5 o 6,0, crezca hasta títulos entre aproximadamente 1 a aproximadamente 100 veces, aproximadamente 5 a 10 aproximadamente 80 veces, aproximadamente 20 a aproximadamente 80 veces, o aproximadamente 40 a aproximadamente 80 veces, aproximadamente 1 a aproximadamente 10 veces, aproximadamente 1 a aproximadamente 5 veces, aproximadamente 1 a aproximadamente 4 veces, aproximadamente 1 a aproximadamente 3 veces, aproximadamente 1 a aproximadamente 2 veces, o aproximadamente 1, 2, 3, 4, 5, 6, 7, 8, o aproximadamente 1, 2, 3, 4, 5, 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces inferiores que el virus de la gripe porcina de tipo silvestre en células (por ejemplo, células de un ser humano (por ejemplo, PerC6, una línea celular productora derivada de retinoblastos embrionarios humanos transformados con la región E1 de Adenovirus 5), ratón, pollo (por ejemplo, fibroblastos embrionarios de pollo), rata, aves, o cerdo (por ejemplo, células PK(D1), células PK(15), células PK13, células NSK, células LLC-PK1, células LLC-PK1A, células ESK-4, células ST, células PT-K75, células PK-2a/CL 13 o SJPL)) determinados por un ensayo de hemaglutinación de BALF obtenido de cerdos o sobrenadantes de células de cerdo aproximadamente 2 a 10 días, 3 a 7 días, 3 a 5 días o 2, 3, 5, 6, 7, 8, 9, 10 días post-infección o cuando los virus se siembran en placa en células MDCK. El crecimiento de un virus de la gripe porcina atenuado puede compararse con un patrón o referencia particular, por ejemplo, virus de la gripe porcina de tipo silvestre A/Porcino/Texas/4199-2/98. El virus atenuado puede modificarse por ingeniería genética para que contenga o exprese secuencias de ácido nucleico de virus de la gripe no porcina tales como, por ejemplo, un epítopo de un patógeno foráneo o un antígeno tumoral. Preferiblemente, las secuencias de virus de la gripe no porcina no incluyen una secuencia de ácido nucleico que alterar el fenotipo atenuado del virus. Por consiguiente, las secuencias de ácido nucleico que codifican proteínas, polipéptidos o péptidos con actividad antagonizante de interferón preferiblemente no se modifican por ingeniería en virus de la gripe porcina.

En la presente memoria se describen virus de la gripe porcina atenuados que comprende un genoma que comprende al menos dos, al menos tres, al menos cuatro o más mutaciones en dos, tres, cuatro o más genes del virus de la gripe porcina, donde al menos una de las mutaciones está en el gen de NS1 y contribuye a o es responsable (directa o indirectamente) de la atenuación del virus y/o la capacidad disminuida del virus de antagonizar una respuesta de interferón celular. En un aspecto específico, un virus de la gripe porcina atenuado comprende un genoma que comprende al menos dos, al menos tres, al menos cuatro o más mutaciones en dos, tres, cuatro o más genes del virus de la gripe porcina, donde al menos una de las mutaciones está en el gen de NS1 y es responsable de la capacidad disminuida del producto génico NS1 de antagonizar una respuesta de interferón celular, y permite que el virus atenuado, a una MOI entre 0,0005 y 0,001, 0,001 y 0,01, 0,01 y 0,1, o 0,1 y 1, o una MOI de 0,0005, 0,0007, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1,0, 1,5, 2,0, 2,5, 3,0, 3,5, 4,0, 4,5, 5,0, 5,5 o 6,0, crezca hasta títulos entre aproximadamente 1 a aproximadamente 100 veces, aproximadamente 5 a aproximadamente 80 veces, aproximadamente 20 a aproximadamente 80 veces, o aproximadamente 40 a aproximadamente 80 veces, aproximadamente 1 a aproximadamente 10 veces, aproximadamente 1 a aproximadamente 5 veces, aproximadamente 1 a aproximadamente 4 veces, aproximadamente 1 a aproximadamente 3 veces, aproximadamente 1 a aproximadamente 2 veces, o aproximadamente 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces inferiores que el virus de la gripe porcina de tipo silvestre, por ejemplo, A/Porcino/Texas/4199-2/98, en células de cerdo, determinados por, por ejemplo, ensayos de hemaglutinación, aproximadamente 2 a 10 días, 3 a 7 días, o 2, 3, 5, 6, 7, 8, 9, 10 días post-infección cuando los virus se propagan en las mismas condiciones. En otro aspecto, un virus de la gripe porcina atenuado descrito en la presente memoria comprende un genoma que comprende al menos dos, tres, cuatro o más mutaciones en dos, tres, cuatro o más genes del virus de la gripe porcina, donde al menos una de las mutaciones está en el gen de NS1 y es responsable de la atenuación del virus, y permite que el virus atenuado, a una MOI entre 0,0005 y 0,001, 0,001 y 0,01, 0,01 y 0,1, o 0,1 y 1, o a una MOI de 0,0005, 0,0007, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1,0, 1,5, 2,0, 2,5, 3,0, 3,5, 4,0, 4,5, 5,0, 5,5 o 6,0, crezca hasta títulos entre aproximadamente 1 a aproximadamente 100 veces, aproximadamente 5 a aproximadamente 80 veces, aproximadamente 20 a aproximadamente 80 veces, o aproximadamente 40 a aproximadamente 80 veces, aproximadamente 1 a aproximadamente 10 veces, aproximadamente 1 a aproximadamente 5 veces, aproximadamente 1 a aproximadamente 4 veces, aproximadamente 1 a aproximadamente 3 veces, aproximadamente 1 a aproximadamente 2 veces, o aproximadamente 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 o 100 veces inferiores que el virus de la gripe porcina de tipo silvestre, por ejemplo, A/Porcino/Texas/4199-2/98, en células de cerdo, determinados por, por ejemplo, ensayos de hemaglutinación, aproximadamente 2 a 10 días, 3 a 7 días, 3 a 5 días, o 2, 3, 5, 6, 7, 8, 9, 10 días post-infección cuando los virus se propagan en las mismas condiciones (por ejemplo, en células MDCK). DE acuerdo con estos aspectos, el virus atenuado tiene un fenotipo antagonista de interferón alterado y los virus pueden modificarse por ingeniería genética para que contengan o expresen secuencias de ácido nucleico de virus de la gripe no porcina tales como, por ejemplo, un epítopo de un patógeno foráneo (por ejemplo, epítopos del virus del síndrome reproductor y respiratorio porcino, citomegalovirus porcino, coronavirus respiratorio porcino, virus de la encefalomiocarditis porcina, diarrea epidémica porcina y determinantes antigénicos de patógenos no virales tales como bacterias y parásitos, por nombrar sólo unos pocos) o un antígeno tumoral. Preferiblemente, las secuencias de virus de la gripe no porcina (secuencias heterólogas) no incluyen una secuencia de ácido nucleico que altera el fenotipo atenuado del virus. Por consiguiente, las secuencias de ácido nucleico que codifican proteínas, polipéptidos o péptidos con actividad antagonizante de interferón preferiblemente no se modifican por ingeniería en el virus de la gripe porcina.

Puede introducirse cualquier mutación que produzca el fenotipo deseado (preferiblemente, una capacidad alterada de antagonizar una respuesta de interferón celular) en el gen de NS1 del virus de la gripe porcina. Ejemplos de los tipos de mutaciones que pueden incluirse en o introducirse en el gen de NS1 del virus de la gripe porcina incluyen, aunque sin limitación, deleciones, sustituciones, inserciones y combinaciones de las mismas. Una o más mutaciones puede localizarse en cualquier lugar en todo el gen de NS1 (por ejemplo, el extremo amino-terminal, el extremo carboxi-terminal o cualquier parte entre ellos) y/o el elemento regulador del gen NS1. En un aspecto específico, un virus de la gripe porcina atenuado, descrito en la presente memoria, comprende un genoma que comprende un gen de NS1 del virus de la gripe porcina con una mutación (por ejemplo, una deleción o sustitución) en el extremo amino- terminal. En un aspecto preferido, un virus de la gripe porcina atenuado, descrito en la presente memoria, comprende un genoma que comprende un virus de la gripe porcina con una mutación (por ejemplo, una deleción o sustitución, preferiblemente una deleción) en el extremo carboxi-terminal. En otro aspecto, un virus de la gripe porcina atenuado descrito en la presente memoria comprende un genoma que comprende una mutación en un gen de NS1 del virus de la gripe porcina que provoca una deleción que consiste en 5, preferiblemente 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 73, 75, 80, 85, 90, 95, 99, 100, 105, 110, 115, 120, 125, 126, 130, 135, 140, 145, 150, 155, 160, 165, 170 o 175 restos de aminoácido del extremo carboxi terminal de NS1, o una deleción entre 5-170, 25- 170, 50-170, 100-170, 100-160 o 105-160 restos de aminoácido del extremo carboxi-terminal. En otro aspecto, un virus de la gripe porcina atenuado descrito en la presente memoria comprende un genoma que comprende una mutación en un gen de NS1 del virus de la gripe porcina que provoca una deleción de todos los restos de aminoácido excepto los restos de aminoácido 1-126, los restos de aminoácido 1-120, los restos de aminoácido 1- 115, los restos de aminoácido 1-110, los restos de aminoácido 1-100, los restos de aminoácido 1-99, los restos de aminoácido 1-95, los restos de aminoácido 1-85, los restos de aminoácido 1-80, los restos de aminoácido 1-75, los restos de aminoácido 1-73, los restos de aminoácido 1-70, los restos de aminoácido 1-65 o los restos de aminoácido 1-60, donde el resto de aminoácido amino-terminal es el número 1. De acuerdo con estos aspectos, el virus de la gripe porcina atenuado está preferiblemente modificado por ingeniería genética. Un virus de la gripe porcina atenuado de la descripción puede ser TX/98/del 126, TX/98/del 99 o TX/98/del 73.

El virus de la gripe porcina atenuado de la presente invención puede ser un virus quimérico que expresa una secuencia heteróloga, por ejemplo, antígenos de otras cepas de vacuna (por ejemplo, usando genética inversa, redistribución o tecnología de plásmidos sin auxiliar). Como alternativa, los virus de la gripe atenuados pueden diseñarse, usando genética inversa, redistribución o tecnología de plásmidos sin auxiliar con virus modificados por ingeniería genética, para que expresen epítopos completamente exógenos, por ejemplo, antígenos de otros patógenos infecciosos, antígenos tumorales, o antígenos de direccionamiento, Los virus de la gripe porcina atenuados pueden expresar una secuencia heteróloga derivada de otros agentes infecciosos porcinos, agentes infecciosos no porcinos, tipos porcinos u otros tipos de antígenos tumorales (por ejemplo, antígeno carcinoembrionario (CEA), antígeno de cáncer de mama tal como EGFR (receptor del factor de crecimiento epidérmico), antígeno HER2 (pi85HER2), epítopo HER2 neu, antígeno canceroso-50 (CA-50), antígeno canceroso 15-3 (CA15-3) asociado con cáncer de mama, antígeno asociado a carcinoma (CAA), antígeno de melanoma, y antígenos asociados a melanoma 100, 25, y 150). El virus de la gripe porcina atenuado puede contener un segmento derivado de otro virus. Como el segmento de ARN de NS es el más corto entre los ocho ARN virales, es posible que el ARN de NS tolere inserciones más largas de secuencias heterólogas que otros genes virales. Además, el segmento de ARN de NS dirige la síntesis de altos niveles de proteína en células infectadas, lo que sugiere que sería un segmento ideal para inserciones de antígenos exógenos. Secuencias ejemplares incluyen epítopos del virus del síndrome reproductor y respiratorio porcino, citomegalovirus porcino, coronavirus respiratorio porcino, virus de la encefalomiocarditis porcina, diarrea epidémica porcina y determinantes antigénicos de patógenos porcinos no virales tales como bacterias incluyendo, aunque sin limitación, Brucella suis, y parásitos, incluyendo, aunque sin limitación, ascárides (Ascarii suum), tricocéfalos (Trichuris suis).

Preferiblemente, la secuencia heteróloga no es una secuencia de ácido nucleico que altera el fenotipo atenuado del virus. Por consiguiente, preferiblemente, las secuencias de ácido nucleico que codifican proteínas, polipéptidos o péptidos con actividad antagonizante de interferón no se modifican por ingeniería en el virus de la gripe porcina. El virus quimérico puede expresar un antígeno tumoral. El virus quimérico, puede expresar un epítopo de un patógeno foráneo.

5.2 Selección de virus de la gripe porcina atenuados

En la presente memoria se describen métodos para seleccionar virus de la gripe porcina que tengan el fenotipo deseado, es decir, virus de la gripe porcina atenuados o virus de la gripe porcina que tengan baja actividad IFN (es decir, una reducción del 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90% o más en comparación con virus de la gripe porcina de tipo silvestre, por ejemplo, A/Porcino/Texas/4199-2/98, en las mismas condiciones) o ausencia de actividad antagonista de IFN si se obtiene de variantes naturales, variantes espontáneas (es decir, variantes que evolucionan durante la propagación del virus), variantes naturales mutagenizadas, virus de redistribución y/o modificados por ingeniería genética (véase, por ejemplo, la patente de Estados Unidos Nº 6.635.416). Dichos virus pueden seleccionarse mejor en ensayos de crecimiento diferencial que comparan el crecimiento en sistemas hospedadores IFN-deficientes frente a IFN-competentes. Se seleccionan los virus que muestran mejor crecimiento en los sistemas IFN-deficientes frente a los sistemas IFN-competentes; preferiblemente, se seleccionan los virus que crecen hasta títulos al menos un log, al menos dos log, tres log, o 1 a 50, 1 a 25, 1 a 20, 1 a 10 o 1 a 5 log mayores en sistemas IFN-deficientes en comparación con un sistema IFN-competente. Los sistemas IFN-deficientes ejemplares incluyen, aunque sin limitación, huevos embrionados jóvenes (por ejemplo, huevos embrionados de 6 a 10 días de vida, 6 a 9 días de vida, 6 a 8 días de vida o 6 a 7 días de vida), líneas celulares IFN-deficientes (tales como células VERO o líneas celulares modificadas por ingeniería genética tales como knockouts STAT1, knockouts PKR, etc.). También pueden usarse huevos embrionados o líneas celulares pretratadas con compuestos que inhiben el sistema IFN (incluyendo fármacos, anticuerpos, antisentido, ribozimas, etc.) como sistema IFN-deficiente. Además, pueden usarse huevos deficientes en el sistema IFN, por ejemplo, huevos producidos por aves STAT1 negativas, especialmente aves de corral, incluyendo aunque sin limitación pollos transgénicos, patos o pavos, como sistema IFN-deficiente. Los virus de la gripe porcina atenuados que muestran títulos al menos 1 a 50, 1 a 25, 1 a 20, 1 a 10 o 1 a 5 log inferiores en huevos de 10 días de vida frente a huevos de 6-7, 6-8, o 6-9 días de vida se considerarán alterados en su capacidad para inhibir la respuesta de IFN.

Con propósitos de selección, pueden usarse sistemas transitorios IFN-deficientes en vez de sistemas manipulados genéticamente. Por ejemplo, el sistema hospedador puede tratarse con compuestos que inhiben la producción de IFN y/o componentes de la respuesta de IFN (por ejemplo, fármacos, anticuerpos contra IFN, anticuerpos contra el receptor de IFN, inhibidores de PKR, moléculas antisentido y ribozimas, etc.). El crecimiento del virus de la gripe porcina atenuado puede compararse en controles no tratados IFN-competentes frente a sistemas tratados IFN- deficientes.

El crecimiento del virus de la gripe porcina (medido por el título) puede compararse, por ejemplo, en una diversidad de células, líneas celulares, o sistemas de modelo animal que expresan IFN y los componentes de la respuesta de IFN, frente a células, líneas celulares, o sistemas de modelo animal deficientes para IFN o componentes de la respuesta de IFN. Pueden usarse técnicas que son bien conocidas en la técnica para la propagación de virus en líneas celulares (véase, por ejemplo, los ejemplos de trabajo infra). Puede compararse el crecimiento del virus de la gripe porcina en una línea celular IFN-competente frente a una línea celular modificada por ingeniería genética IFN- deficiente.

Los virus de la gripe porcina puede seleccionarse usando sistemas de ensayo de IFN por ejemplo, sistemas de ensayo basados en transcripción en que la expresión de un gen indicador está controlada por un promotor sensible a IFN. Puede medirse la expresión del gen indicador en células infectadas frente a no infectadas para identificar virus que induzcan de forma eficaz una respuesta de IFN, pero que sean incapaces de antagonizar la respuesta de IFN. Por ejemplo, pueden diseñarse células de ensayo para que expresen de forma transitoria o constitutiva genes indicadores tales como el gen indicador de luciferasa o el gen indicador de cloranfenicol transferasa (CAT) bajo el control de un elemento de respuesta estimulado por interferón, tal como el promotor estimulado por IFN del gen ISG- 54K (Bluyssen et al., 1994, Eur. J. Biochem. 220:395-402). Las células se infectan con el virus de la gripe porcina de ensayo y se compara el nivel de expresión del gen indicador con el de células no infectadas o células infectadas con virus de la gripe porcina de tipo silvestre. Un aumento en el nivel de expresión del gen indicador después de la infección con el virus de la gripe porcina atenuado de ensayo indicaría que el virus de la gripe porcina de ensayo está induciendo una respuesta de IFN. Como alternativa, la inducción de respuestas de IFN puede determinarse midiendo la activación transcripcional dependiente de IFN después de la infección con el virus de la gripe porcina atenuado del ensayo. Puede analizarse la expresión de genes que se sabe que se inducen por IFN, por ejemplo, Mx, PKR, 2-5-oligoadenilatosintetasa, el complejo principal de histocompatibilidad (MHC) clase I, etc., por técnicas conocidas para los expertos en la materia (por ejemplo, transferencias de Northern, transferencias de Western, PCR, etc.). La inducción de respuestas de IFN también puede determinarse midiendo la estado fosforilado de componentes de la ruta de IFN después de la infección con un virus de la gripe porcina de ensayo, por ejemplo, IRF- 3, que se fosforila en respuesta a ARN bicatenario. En respuesta a IFN tipo I, la quinasa Jakl y la quinasa TyK2, las subunidades del receptor de IFN, STAT1, y STAT2 se fosforilan rápidamente en la tirosina. Por tanto, para determinar si el virus de la gripe porcina induce respuestas de IFN, se infectan células, tales como células 293, con el virus mutante de ensayo y después de la infección, se lisan las células. Los componentes de la ruta IFN, tales como la quinasa Jakl o la quinasa TyK2, se inmunoprecipitan de los lisados celulares infectados, usando sueros o anticuerpos policlonales específicos, y se determina el estado fosforilado de la tirosina de la quinasa por ensayos de inmunotransferencia con un anticuerpo anti-fosfotirosina (por ejemplo, véase Krishnan et al. 1997, Eur. J, Biochem. 247: 298-305). Un estado fosforilado potenciado de cualquiera de los componentes de la ruta IFN después de la infección con el virus de la gripe porcina indicaría la inducción de respuestas de IFN por el virus de la gripe porcina.

Además, la inducción de respuestas de IFN después de la infección con un virus de la gripe porcina de ensayo puede determinarse midiendo la capacidad de unirse a secuencias de ADN específicas o la translocación de factores de transcripción inducida en respuesta a infección viral, por ejemplo, IRF3, STAT1, STAT2, etc. En particular, STAT1 y STAT2 se fosforilan y translocan desde el citoplasma hasta el núcleo en respuesta a IFN tipo I. La capacidad de unirse a secuencias de ADN específicas o la translocación de factores de transcripción puede medirse por técnicas conocidas para los expertos en la materia, por ejemplo, ensayos de desplazamiento en gel por electromovilidad, tinción celular, etc. Otros ensayos que pueden usarse se describen en la solicitud de patente de Estados Unidos Nº 09/829,711. En un aspecto preferido, sin embargo, se usan ensayos de crecimiento diferencial para seleccionar virus que tienen el fenotipo deseado, ya que el sistema hospedador usado (IFN-competente frente a IFN-deficiente) aplica la presión de selección apropiada.

Los virus de la gripe porcina atenuados de la presente invención se seleccionan de forma óptima en células de cerdo, incluyendo células de cerdo primarias, secundarias y líneas celulares de cerdo. Puede usarse cualquier célula de cerdo que sea capaz de cultivar el virus de la gripe porcina. Las células de cerdo preferidas incluyen líneas celulares renales porcinas, líneas celulares de testículo porcino y pulmón porcino. Las células de cerdo representativas incluyen, aunque sin limitación, células PK(D1), células PK(15), células PK13, células NSK, células LLC-PK1, células LLC-PK1A, células ESK-4, células ST, células PT-K75, células PK-2a/CL 13 o células SJPL.

Los virus de la gripe porcina de la invención pueden seleccionarse en células de cerdo por comparación con virus de la gripe porcina de tipo silvestre, por ejemplo, A/Porcino/Texas/4199-2/98, en las mismas condiciones de cultivo. Los virus de la gripe porcina atenuados se seleccionan en base a características tales como tasas más lentas de crecimiento, menores lesiones pulmonares tras infección de los cerdos, títulos virales reducidos en fluido de lavado broncoalveolar (BALF) y detección reducida del virus en frotis nasales en comparación con virus de la gripe porcina de tipo silvestre. Dichos virus de la gripe porcina atenuados tienen virulencia disminuida porque tienen una capacidad reducida de replicarse en sistemas competentes de interferón en comparación con virus de la gripe porcina de tipo silvestre pero pueden generar una respuesta inmunitaria.

Las células de cerdo pueden infectarse con virus de la gripe porcina de tipo silvestre, por ejemplo, A/Porcino/Texas/4199-2/98, y mutantes de NS1 a una MOI específica y los títulos virales en el sobrenadante pueden determinarse en momento específicos post-infección. Puede usarse infección de las células de cerdo a MOI entre 0,0005 y 0,001, 0,001 y 0,01, 0,01 y 0,1, 0,1 y 1, o 1 y 10, o una MOI de 0,0005, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1,5 o 10. En una realización, se usa una MOI de 0,001. Los títulos virales pueden determinarse de aproximadamente 2 a 10 días, 3 a 7 días, 3 a 5 días o 2, 3, 4, 5, 6, 7, 8, 9 o 10 días post-infección. En un aspecto específico, los títulos virales se determinan 5 días post-infección. Después de cultivar el virus en células de cerdo, pueden ensayarse los títulos virales en el sobrenadante. Puede usarse cualquier sistema para medir títulos de virus de la gripe. Se describen sistemas representativos en la Sección 5.7. En un aspecto particular, los títulos virales en el sobrenadante se determinan por formación de placas en diversos puntos temporales en células MDCK.

Los sistemas de selección descritos en la presente memoria abarcan medir la inducción de IFN determinando si un extracto de la célula o huevo infectado con el virus de la gripe porcina atenuado de ensayo es capaz de conferir actividad protectora contra infección viral. Más específicamente, se infectan grupos de huevos embrionados de gallina de 10 días edad con el virus de la gripe porcina mutante de ensayo o el virus de la gripe porcina de tipo silvestre. Aproximadamente 15 a 20 horas post-infección, se recoge el fluido alantoideo y se ensaya para la actividad IFN determinando la dilución más alta con actividad protectora contra infección por virus de la gripe porcina en células de cultivo tisular.

La patogénesis de virus de la gripe porcina mutantes de la invención también puede evaluarse en cerdos in vivo. Los ensayos útiles incluyen evaluar lesiones pulmonares en lóbulos pulmonares, frotis nasales y determinación de títulos virales en fluido de lavado broncoalveolar (BALF) por cualquier método conocido en la técnica.

5.3 Propagación de virus de la gripe porcina atenuado

En la presente memoria se describenmétodos para propagar virus de la gripe porcina atenuados en células (por ejemplo, células de cerdo), huevos embrionados, y animales. Los virus de la gripe porcina atenuados de la presente invención pueden propagarse en cualquier sustrato que permita que el virus crezca hasta títulos que permitan un uso del virus de la gripe porcina atenuado, descrito en la presente memoria. Los virus de la gripe porcina atenuados de la presente invención pueden propagarse en cualquier sustrato que permita que el virus crezca hasta títulos comparables a los determinados para cepas de virus de la gripe porcina de tipo silvestre en sustratos IFN- competentes. Los virus de la gripe porcina atenuados de la invención pueden propagarse en sustratos IFN- deficientes. Los sustratos que son útiles para la selección de los virus de la gripe porcina atenuados de la invención no tienen que usarse para la propagación y viceversa.

De acuerdo con los métodos descritos en la presente memoria, los virus de la gripe porcina atenuados que pueden cultivarse en células (por ejemplo, células de cerdo), huevos embrionados, y animales se seleccionan entre cepas de origen natural, variantes o mutantes, virus mutagenizados, virus de redistribución y/o modificados por ingeniería genética. Los métodos descrito en la presente memoria abarcan el cultivo de los virus de la gripe porcina atenuados, preferiblemente usando condiciones de cultivo apropiadas (véanse por ejemplo, las condiciones de cultivo expuestas en la siguiente Sección 6), y recogiendo el virus descendiente.

Los virus de la gripe porcina atenuados de la invención pueden propagarse en células de cerdo. Las células de cerdo puede ser o no IFN-deficientes o producir niveles inferiores de IFN. Las células de cerdo preferidas incluyen líneas celulares renales porcinas, líneas celulares de testículo porcino y líneas celulares pulmonares porcinas. Las células de cerdo representativas incluyen, aunque sin limitación, células PK(D1), células PK(15), células PK13, células SJPL, células NSK, células LLC-PK1, células LLC-PK1A, células ESK-4, células ST, células PT-K75, y células PK-2a/GL 13. En otro aspecto específico, los virus de la gripe porcina atenuados se propagan en células de pollo, por ejemplo, fibroblastos embrionarios de pollo derivados de huevos embrionados de 6 días de vida.

En ciertos aspectos, en la presente memoria se describen métodos para propagar los virus de la gripe porcina atenuados descritos en la presente memoria en huevos embrionados, por ejemplo, de 6 a 14 días de vida. En otros aspectos, pueden usarse huevos embrionados jóvenes o inmaduros para propagar los virus de la gripe porcina atenuados de la invención. Los huevos embrionados inmaduros abarcan huevos que son huevos de menos de diez días de vida, preferiblemente huevos de seis a nueve días de vida, huevos de seis a ocho días de vida, huevos de seis a siete días de vida o huevos de seis días de vida. Los huevos embrionados inmaduros también abarcan huevos que imitan de forma artificial huevos de hasta, pero de menor de diez días de vida, como resultado de alteraciones en las condiciones de cultivo, por ejemplo, cambios en las temperaturas de incubación; tratamiento con fármacos; o cualquier otra alteración que produzca un huevo con un desarrollo retardado, de modo que el sistema IFN no esté completamente desarrollado en comparación con huevos de diez a doce días de vida. Los virus de la gripe porcina pueden propagarse en diferentes localizaciones del huevo embrionado, por ejemplo, la cavidad alantoidea. Los huevos embrionados pueden ser huevos de gallina.

La descripción abarca métodos y sustratos IFN-deficientes para el cultivo y aislamiento de virus de la gripe porcina atenuados. Véase, por ejemplo, la patente de Estados Unidos Nº 6.573.079. Los sustratos IFN-deficientes que pueden usarse para apoyar el crecimiento de virus de la gripe porcina atenuados incluyen, aunque sin limitación, células de origen natural, líneas celulares, huevos embrionados, y sistemas IFN-deficientes, por ejemplo, células Vero, huevos embrionados jóvenes; células recombinantes o líneas celulares que se modifican para ser IFN- deficientes, por ejemplo, líneas celulares IFN-deficientes derivadas de knockouts STAT1, knockouts IRF3, knockouts IRF7, knockouts PKR, etc.; huevos embrionados obtenidos de aves IFN-deficientes, especialmente aves de corral (por ejemplo, pollos, patos, pavos) incluyendo bandadas que se crían para ser IFN-deficientes o aves transgénicas (por ejemplo, knockouts STAT1). En ciertos aspectos, el sustrato IFN-deficiente no es células Vero y/o no una línea celular STAT1-deficiente.

El sistema, células, líneas celulares, huevos o animales hospedadores pueden modificarse por ingeniería genética para que expresen transgenes que codifican inhibidores del sistema IFN, por ejemplo, mutantes dominantes- negativos, tales como STAT1 que carece del dominio de unión a ADN, ARN antisentido, ribozimas, inhibidores de la producción de IFN, inhibidores de la señalización de IFN, y/o inhibidores de genes antivirales inducidos por IFN. Debe reconocerse que los animales que se crían o se modifican por ingeniería genética para que sean IFN- deficientes estarán algo inmunocomprometidos, y deben mantenerse en un entorno controlado sin enfermedad. Por tanto, deben tomarse medidas apropiadas (incluyendo el uso de antibióticos en la dieta) para limitar el riesgo de exposición a agentes infecciosos de animales IFN-deficientes transgénicos, tales como ratones, bandadas de gallinas reproductoras, patos, pavos etc. Como alternativa, el sistema hospedador, por ejemplo, células, líneas celulares, huevos o animales puede tratarse con un compuesto que inhibe la producción de IFN y/o la ruta de IFN por ejemplo, fármacos, anticuerpos, moléculas antisentido, moléculas de ribozima que abordan el gen STAT1, y/o genes antivirales inducidos por IFN.

Adjunto se describen métodos para cultivar y aislar virus de la gripe porcina que tienen actividad antagonista de IFN alterada en células y líneas celulares que no tienen de forma natural una ruta IFN o tienen una ruta IFN deficiente o tienen una deficiencia en el sistema IFN, por ejemplo, niveles bajos de expresión de IFN en comparación con células de tipo silvestre. En un aspecto particular, en la presente memoria se describen métodos para cultivar virus de la gripe porcina atenuados de la invención en fibroblastos embrionarios de pollo derivados de huevos embrionados de 6 días de edad, o células Vero, o huevos embrionados IFN-comprometidos (por ejemplo, huevos embrionados inmaduros tales como huevos embrionados de 6, 7 u 8 días de vida). En otro aspecto, en la presente memoria se describen métodos para cultivar virus de la gripe porcina atenuados en células donde las células no son células Vero.

En la presente memoria se describen métodos para cultivar y aislar virus de la gripe porcina a partir de un sustrato IFN-deficiente modificado por ingeniería genética. En la presente memoria se describen cerdos y aves transgénicas en que está mutado un gen esencial para el sistema IFN, por ejemplo, STAT1, que pondrían huevos que son IFN deficientes. Adicionalmente, en la presente memoria se describen transgénicos de ave que expresan factores de transcripción dominantes-negativos, por ejemplo, STAT1 que carece del dominio de unión a ADN, ribozimas, ARN antisentido, inhibidores de la producción de IFN, inhibidores de la señalización de IFN, e inhibidores de genes antivirales inducidos en respuesta a IFN.

En la presente memoria se describen líneas celulares o animales recombinantes, en particular cerdos y aves, en que se ha mutado (por ejemplo, interrumpido, es decir, es un "knockout") uno o más genes esenciales para la síntesis de IFN, la ruta de IFN, y/o un gen antiviral inducido por IFN, por ejemplo, receptor de interferón, STAT1, PKR, ERF3, ERF7, etc. El animal recombinante puede ser cualquier animal (tal como un ratón, un cerdo o una ave, por ejemplo, pollo, pavo, gallina, pato, etc. (véase, por ejemplo, Sang, 1994, Trends Biotechnol. 12:415; Perry, et al., 1993, Transgenic Res. 2:125; Stern, CD., 1996, Curr Top Microbiol Immunol 212:195-206; y Shuman, 1991, Experientia 47:897 para revisiones respecto a la producción de transgénicos de ave)). En un aspecto específico, el animal recombinante es un cerdo. Dicha línea celular o animal puede generarse por cualquier método conocido en la técnica para alterar un gen en el cromosoma de la célula o animal. Dichas técnicas incluyen, aunque sin limitación, microinyección pronuclear (Hoppe y Wagner, 1989, Patente de Estados Unidos Nº 4.873.191); transferencia génica mediada por retrovirus en líneas germinales (Van der Putten et al., 1985, Proc. Natl. Acad. Sci., USA 82:6148-6152); direccionamiento génico en células madre embrionarias (Thompson et al., 1989, Cell 56:313); electroporación de embriones (Lo, 1983, Mol Cell. Biol. 3:1803); y transferencia génica mediada por esperma (Lavitrano et al.; 1989, Cell 57:717); etc. Para una revisión de dichas técnicas, véase Gordon, 1989, Transgenic Animals, Intl. Rev. Cytol. 115:171.

En particular, puede producirse un animal genosuprimido (knockout) STAT1 promoviendo la recombinación homóloga entre un gen STAT1 en su cromosoma y un gen STAT1 exógeno que se ha vuelto biológicamente inactivo (preferiblemente por inserción de una secuencia heteróloga, por ejemplo, un gen de resistencia a antibiótico). Se describen métodos de recombinación homóloga para alterar genes en el genoma de ratón, por ejemplo, en Capecchi (1989, Science 244:1288) y Mansour et al. (1988, Nature 336:348-352).

En resumen, todo o una parte de un clon genómico de STAT1 se aísla del ADN genómico de la misma especie que la célula o animal knockout. El clon genómico de STAT1 puede aislarse mediante cualquier método conocido en la técnica para el aislamiento de clones genómicos (por ejemplo, sondeando una biblioteca genómica con una sonda derivada de una secuencia STAT1 tal como STAT1 de cerdo (Nº de acceso a Genbank ABl 16564 y NM_213769) y aquellas secuencias proporcionadas en, véase, Meraz et al. 1996, Cell 84: 431-442; Durbin et al. 1996, Cell 84: 443- 450, y referencias citadas en ese documento). Una vez aislado el clon genómico, se introduce todo o una parte del clon en un vector recombinante. Preferiblemente, la parte del clon introducida en el vector contiene al menos una parte de un exón del gen STAT1, es decir, contiene una secuencia codificante de la proteína STAT1. Después se introduce una secuencia no homóloga a la secuencia STAT1, preferiblemente un marcador de selección positiva, tal como un gen que codifica un gen de resistencia antibiótico, en el exón del gen STAT1. El marcador de selección se une preferiblemente de forma funcional a un promotor, más preferiblemente un promotor constitutivo. La secuencia no homóloga se introduce en cualquier parte en la secuencia codificante de STAT1 que alterará la actividad STAT1, por ejemplo, en una posición donde se ha demostrado que mutaciones puntuales u otras mutaciones inactivan la función proteica STAT1. Por ejemplo, pero no a modo de limitación, la secuencia no homóloga puede insertarse en la secuencia codificante para la parte de la proteína STAT1 que contiene todo o una parte del dominio quinasa (por ejemplo, la secuencia de nucleótidos que codifica al menos 50, 100, 150, 200 o 250 aminoácidos del dominio quinasa).

El marcador de selección positiva es preferiblemente un gen de resistencia a neomicina (gen neo) o un gen de resistencia a higromicina (gen hygro). El promotor puede ser cualquier promotor conocido en la técnica; a modo de ejemplo el promotor puede ser el promotor de la fosfoglicerato quinasa (PGK) (Adra et al., 1987, Gene 60:65-74), el promotor PolII (Soriano et al., 1991, Cell 64:693-701), o el promotor MCI, que es un promotor sintético diseñado para la expresión en células madre derivadas de embrión (Thomas y Capecchi, 1987, Cell 51:503-512). El uso de un marcador de selección, tal como un gen de resistencia a antibiótico, permite la selección de células que han incorporado el vector de direccionamiento (por ejemplo, la expresión del producto génico neo confiere resistencia a G418, y la expresión del producto génico hygro confiere resistencia a higromicina).

Un marcador de selección negativa para una etapa de contraselección para recombinación homóloga, en oposición a no homóloga, del vector puede insertarse fuera del inserto del clon genómico de STAT1. Por ejemplo, dicho marcador de selección negativa es el gen de la timidina quinasa de HSV (HSV-tk), cuya expresión hace a las células sensibles a ganciclovir. El marcador de selección negativa está preferiblemente bajo el control de un promotor tal como, aunque sin limitación el promotor de PGK, el promotor PolII o el promotor MCI.

Cuando sucede recombinación homóloga, las partes del vector que son homólogas al gen STAT1, así como el inserto no homólogo dentro de las secuencias génicas de STAT1, se incorporan en el gen STAT1 en el cromosoma, y el resto del vector se pierde. Por tanto, como el marcador de selección negativa está fuera de la región de homología con el gen STAT1, las células en que ha sucedido recombinación homóloga (o su descendencia), no contendrán el marcador de selección negativa. Por ejemplo, si el marcador de selección negativa es el gen HSV-tk, las células en que ha sucedido recombinación homóloga no expresarán la timidina quinasa y sobrevivirán a la exposición a ganciclovir. Este procedimiento permite la selección de células en que ha sucedido recombinación homóloga, en comparación con la recombinación no homóloga en que es probable que el marcador de selección negativa también esté incorporado en el genoma junto con las secuencias de STAT1 y el marcador de selección positiva. Por tanto, las células en que ha sucedido recombinación no homóloga muy probablemente expresarían la timidina quinasa y serían sensibles a ganciclovir.

Una vez preparado el vector de direccionamiento, se linealiza con una enzima de restricción para la cual existe un sitio único en el vector de direccionamiento, y el vector linealizado se introduce en células madre derivadas de embrión (ES) (Gossler et al., 1986, Proc. Natl. Acad. Sci. USA 83:9065-9069) por cualquier método conocido en la técnica, por ejemplo por electroporación. Si el vector de direccionamiento incluye un marcador de selección positiva y un marcador de contraselección negativa, las células ES en que ha sucedido recombinación homóloga pueden seleccionarse por incubación en medio selectivo. Por ejemplo, si los marcadores de selección son el gen de resistencia neo y el gen HSV-tk, las células se exponen a G418 (por ejemplo, aproximadamente 300 g/ml) y ganciclovir (por ejemplo, aproximadamente 2 M).

Puede usarse cualquier técnica conocida en la técnica para genotipado, por ejemplo aunque sin limitación análisis de transferencia de Southern o la reacción en cadena de la polimerasa, para confirmar que las secuencias de STAT1 alteradas se han recombinado de forma homóloga en el gen STAT1 en el genoma de las células ES. Como el mapa de restricción del clon genómico de STAT1 es conocido y la secuencia de la secuencia codificante de STAT1 es conocida (véase Meraz et al. 1996, Cell 84:431, Durbin et al. 1996, Cell 84:443-450, y todas las referencias citadas en esos documentos), puede determinarse el tamaño de un fragmento de restricción o producto de amplificación por PCR particular generado a partir de ADN de alelos tanto alterados como no alterados. Por tanto, ensayando un fragmento de restricción o producto de PCR, se puede determinar el tamaño del cual difiere entre el gen STAT1 alterado y no alterado, si ha sucedido recombinación homóloga para alterar el gen STAT1.

Después, células ES con el locus STAT1 alterado pueden introducirse en blastocitos por microinyección y después los blastocitos pueden implantarse en los úteros de ratonas pseudopreñadas usando técnicas habituales. El animal que se desarrolla a partir de los blastocitos implantados es quimérico para el alelo alterado. Los machos quiméricos pueden cruzarse con hembras, y este cruce puede diseñarse de tal modo que la transmisión de la línea germinal del alelo esté ligada a la transmisión de un cierto color de pelaje. La transmisión de la línea germinal del alelo puede confirmarse por transferencia de Southern o análisis de PCR, como se ha descrito anteriormente, del ADN genómico aislado de muestras tisulares.

Puede usarse cualquier gen cuyo producto sea importante para la regulación de interferones. Otras mutaciones en la ruta de interferón que pueden usarse de acuerdo con la presente descripción incluyen versiones deficientes en quinasa de Jakl, TyK2 o factores de transcripción que carecen de los dominios de unión a ADN STAT1, y STAT2 (véase, por ejemplo, Krishnan et al., 1997, Eur. J. Biochem. 247: 298-305).

Para la purificación de virus, el virus de la gripe porcina atenuado se retira del cultivo celular y se separa de los componentes celulares, típicamente mediante procedimientos de aclarado bien conocidos, por ejemplo, tales como centrifugación en gradiente y cromatografía en columna, y puede aislarse adicionalmente según se desee usando procedimientos bien conocidos para los expertos en la materia, por ejemplo, ensayos de placa.

5.4 Usos de virus atenuados

Pueden usarse virus de la gripe porcina atenuados de la invención como vectores virales para la producción de proteínas heterólogas como se describe en la patente de Estados Unidos Nº 5.820.871.

Pueden usarse virus de la gripe porcina atenuados de la invención en ensayos de selección para identificar proteínas virales con función antagonizante de interferón, para identificar proteínas virales que tengan capacidad de replicación del complemento de un virus atenuado con capacidad alterada de antagonizar respuestas de interferón celular y ensayos de selección para identificar agentes anti-virales que inhiban la actividad antagonista de interferón e inhiban la replicación viral como se describe en la patente de Estados Unidos Nº 6.635.416.

Pueden usarse virus de la gripe porcina atenuados de la invención para producir anticuerpos que pueden usarse en inmunoensayos de diagnóstico, inmunoterapia pasiva, y generación de anticuerpos antiidiotipo. Por ejemplo, puede administrarse un virus de la gripe porcina atenuado que comprende un genoma que comprende una mutación en el gen de NS1 y una secuencia heteróloga (por ejemplo, un antígeno tumoral) a un sujeto (por ejemplo, un cerdo) para generar anticuerpos que después pueden aislarse y usarse en ensayos de diagnóstico, inmunoterapia pasiva y generación de anticuerpos antiidiotipo. Los anticuerpos generados pueden aislarse mediante técnicas convencionales conocidas en la técnica (por ejemplo, cromatografía de inmunoafinidad, centrifugación, precipitación, etc.) y usarse en inmunoensayos de diagnóstico, inmunoterapia pasiva y generación de anticuerpos antiidiotipo. Los anticuerpos aislados, antes de usarse en inmunoterapia pasiva, pueden modificarse, por ejemplo, los anticuerpos pueden quimerizarse o humanizarse. Véanse, por ejemplo, las patentes de Estados Unidos Nº 4.444.887 y 4.716.111; y las publicaciones internacionales Nº WO 98/46645, WO 98/50433, WO 98/24893, WO98/16654, WO96/34096, WO 96/33735, y WO 91/10741, para revisiones sobre la generación de anticuerpos quiméricos y humanizados.

Los anticuerpos aislados de sujetos a los que se ha administrado un virus de la gripe porcina atenuado de la invención también pueden usarse para controlar el tratamiento y/o el progreso de la enfermedad. Puede usarse cualquier sistema de inmunoensayo conocido en la técnica para este propósito incluyendo, aunque sin limitación, sistemas de ensayo competitivo y no competitivo usando técnicas tales como radioinmunoensayo, ELISA (ensayo inmunoabsorbente ligado a enzimas), inmunoensayos tipo "sándwich", reacciones de precipitina, reacciones de precipitina por difusión en gel, ensayos de inmunodifusión, ensayos de aglutinación, ensayos de fijación del complemento, ensayos inmuno-radiométricos, inmunoensayos fluorescentes, inmunoensayos de proteína A y ensayos de inmunoelectroforesis, por nombras unos pocos.

Los anticuerpos generados por los virus de la gripe porcina atenuados de la invención también pueden usarse en la producción de anticuerpos antiidiotipo. El anticuerpo antiidiotipo después puede, a su vez, usarse para inmunización, para producir una subpoblación de anticuerpos que se unan al antígeno inicial del microorganismo patogénico (Jerne, 1974, Ann. Immunol. (París) 125c:373; Jerne et al., 1982, EMBO J. 1:234).

En procedimientos de inmunización, la cantidad de inmunógeno a usar y el programa de inmunización se determinarán por el médico experto en la materia y se administrarán por referencia a la respuesta inmunitaria y los títulos de anticuerpo del sujeto.

5.5 Formulaciones de vacuna/formulaciones inmunogénicas

En la presente memoria se describen formulaciones de vacuna y formulaciones inmunogénicas que comprenden un virus de la gripe porcina atenuado que tiene una capacidad alterada de antagonizar la respuesta IFN celular (es decir, virus de la gripe porcina con mutaciones en el gen de NS1 que alteran la capacidad del virus de inducir una respuesta de IFN celular), y un excipiente adecuado. El virus de la gripe porcina atenuado, usado en la formulación de vacuna o formulación inmunogénica, puede seleccionarse entre mutantes o variantes de origen natural, virus mutagenizados o virus modificados por ingeniería genética. El virus de la gripe porcina atenuado puede estar modificado por ingeniería genética. El virus de la gripe porcina atenuado puede estar aislado o purificado. Las cepas atenuadas de virus de la gripe porcina también pueden generarse mediante técnicas de redistribución, tecnología de plásmidos sin auxiliar o usando una combinación del enfoque de genética inversa o tecnología de plásmidos sin auxiliar y técnicas de redistribución. Las variantes de origen natural incluyen virus aislados de la naturaleza así como variantes que suceden de forma espontánea generadas durante la propagación del virus, que tienen una capacidad alterada de antagonizar la respuesta de IFN celular. El virus de la gripe porcina atenuado puede usarse en sí mismo como el principio activo en la formulación de vacuna o formulación inmunogénica. Como alternativa, el virus de la gripe porcina atenuado puede usarse como el vector o "estructura" de vacunas o formulaciones inmunogénicas producidas de forma recombinante. Para este fin, pueden usarse técnicas recombinantes tales como genética inversa (o, para virus segmentados, combinaciones de las técnicas de genética inversa y redistribución) para diseñar mutaciones o introducir antígenos exógenos en el virus de la gripe porcina atenuado usado en la formulación de vacuna o formulación inmunogénica. De este modo, pueden diseñarse vacunas para inmunización contra variantes de cepa, o como alternativa, contra agentes infecciosos o antígenos de enfermedad completamente diferentes.

Puede construirse casi cualquier secuencia génica heteróloga en los virus de la gripe porcina atenuados de la invención para su uso en vacunas o formulaciones inmunogénicas. Preferiblemente, pueden expresarse epítopos que inducen una respuesta inmunitaria protectora contra cualquiera de una diversidad de patógenos, o antígenos que se unen a anticuerpos neutralizantes por o como parte de los virus. Por ejemplo, las secuencias génicas heterólogas que pueden construirse en los virus de la invención para su uso en vacunas y formulaciones inmunogénicas incluyen, aunque sin limitación, determinantes antigénicos de patógenos no virales tales como bacterias y parásitos. Puede expresarse todo o partes de los genes de inmunoglobulina. Por ejemplo, pueden construirse regiones variables de inmunoglobulinas anti-idiotipo que imitan dichos epítopos en los virus de la invención. Pueden expresarse antígenos asociados a tumor. Ejemplos de antígenos tumorales incluyen, aunque sin limitación, antígeno de pan-carcinoma KS 1/4, antígeno de carcinoma de ovario (CA125), fosfato ácido prostático, antígeno específico de próstata, antígeno asociado a melanoma p97, antígeno de melanoma gp75, antígeno de melanoma de alto peso molecular (HMW-MAA), antígeno de membrana específico de próstata, antígeno carcinoembrionario (CEA), antígeno de mucina epitelial polimórfica, antígeno globular de la grasa de la leche, antígenos asociados a tumor colorrectal (tales como: CEA, TAG-72, CO17-1A; GICA 19-9, CTA-1 y LEA), antígeno de linfoma de Burkitt-38.13, CD19, antígeno-CD20 de linfoma B, CD33, antígenos específicos de melanoma (tales como gangliósido GD2, gangliósido GD3, gangliósido GM2, gangliósido GM3), tipo de trasplante específico de tumor del antígeno de superficie celular (TSTA) (tal como antígenos tumorales inducidos por virus incluyendo virus tumorales de ADN e antígeno T y antígenos de envuelta de virus tumorales de ARN), antígeno oncofetal-alfa- fetoproteína tal como CEA de colon, antígeno oncofetal de tumor de vejiga, antígeno de diferenciación (tal como human antígeno de carcinoma pulmonar L6 y L20), antígenos de fibrosarcoma, antígeno-Gp37 de células T de leucemia, neoglucoproteína, esfingolípidos, antígenos de cáncer de mama (tales como EGFR (receptor del factor de crecimiento epidérmico), antígeno HER2 (p185HER2) y epítopo HER2 neu), mucina epitelial polimórfica (PEM), antígeno-APO-1 de linfocitos humanos malignos, antígeno de diferenciación (tal como antígeno I encontrado en eritrocitos fetales, endodermo primario, antígeno I encontrado en eritrocitos adultos, embriones preimplante, I(Ma) encontrado en adenocarcinomas gástricos, M18, M39 encontrados en epitelio de mama, SSEA-1 encontrado en células mieloides, VEP8, VEP9, Myl, VTM-D5, D156-22 encontrados en cáncer colorrectal, TRA-1-85 (grupos sanguíneo H), C14 encontrado en adenocarcinoma de colon, F3 encontrado en adenocarcinoma pulmonar, AH6 encontrado en cáncer gástrico, hapteno Y, Ley encontrado en células de carcinoma embrionario, TL5 (grupos sanguíneo A), receptor de EGF encontrado en células A431, serie E1 (grupos sanguíneo B) encontrada en cáncer pancreático, FC10.2 encontrado en células de carcinoma embrionario, antígeno de adenocarcinoma gástrico, CO- 514 (grupos sanguíneo Lea) encontrado en adenocarcinoma, NS-10 encontrado en adenocarcinomas, CO-43 (grupo sanguíneo Leb), G49 encontrado en el receptor de EGF de células A431, MH2 (grupo sanguíneo ALeb/Ley) encontrado en adenocarcinoma de colon, 19.9 encontrado en cáncer de colon, mucinas de cáncer gástrico, T5A7 encontrado en células mieloides, R24 encontrado en melanoma, 4.2, GD3, D1.1, OFA-1, GM2, OFA-2, GD2 y Ml:22:25:8 encontrados en células de carcinoma embrionario, y SSEA-3 y SSEA-4 encontrados en embriones en fase de 4 a 8 células), péptido derivado del receptor de células T de un linfoma cutáneo de células T, proteína C-reactiva (CRP), antígeno canceroso-50 (CA-50), antígeno canceroso 15-3 (CA15-3) asociado con cáncer de mama, antígeno canceroso-19 (CA-19) y antígeno canceroso-242 asociados con cánceres gastrointestinales, antígeno asociado a carcinoma (CAA), cromogranina A, antígeno de mucina epitelial (MC5), antígeno específico de epitelio humano (HEA), antígeno de Lewis(a), antígeno de melanoma, antígenos asociados a melanoma 100, 25, y 150, antígeno asociado a carcinoma tipo mucina, proteína relacionada con resistencia a múltiples fármacos (MRPm6), proteína relacionada con resistencia a múltiples fármacos (MRP41), proteína del oncogén Neu (C-erbB-2), enolasa específica de neuronas (NSE), P-glucoproteína (producto génico mdr1), antígeno relacionado con resistencia a múltiples fármacos, pI70, antígeno relacionado con resistencia a múltiples fármacos, antígeno específico de próstata (PSA), CD56, y NCAM.

Puede formularse una vacuna o formulación inmunogénica de virus de la gripe porcina recombinante vivo o una vacuna o formulación inmunogénica de virus de la gripe porcina recombinante inactivado. Un virus de la gripe porcina puede inactivarse por métodos bien conocidos para los expertos en la materia. Los métodos habituales usan formalina y calor para la inactivación. Véase, por ejemplo, la patente de Estados Unidos Nº 6.635.246. Otros métodos incluyen los descritos en las patentes de Estados Unidos Nº 5.891.705; 5.106.619 y 4.693.981.

Puede preferirse una vacuna o formulación inmunogénica viva porque la multiplicación en el hospedador conduce a un estímulo prolongado de tipo y magnitud similares a lo que sucede en infecciones naturales, y por lo tanto, confiere inmunidad sustancial de larga duración. La producción de dichas formulaciones de vacuna y formulaciones inmunogénicas de virus de la gripe porcina recombinante vivo puede conseguirse usando métodos convencionales que implican la propagación de virus de la gripe porcina en cultivo celular o en el alantoides del embrión de pollo seguida de purificación. Además, los virus de la gripe porcina atenuados pueden inducir una contundente respuesta de IFN que tiene otras consecuencias biológicas in vivo, produciendo protección contra posteriores enfermedades infecciosas y/o induciendo respuestas antitumorales.

Las formulaciones de vacuna y formulaciones inmunogénicas pueden incluir virus de la gripe porcina modificados por ingeniería genética que tienen mutaciones en el gen de NS1 incluyendo, aunque sin limitación, los mutantes de gripe de NS1 truncado descritos en los ejemplos de trabajo, infra. También pueden formularse usando variantes naturales. Cuando se formulan como una vacuna de virus vivo, puede usarse un intervalo de aproximadamente 102 a 108, preferiblemente de aproximadamente 103 a 107, más preferiblemente de 104 ufp a aproximadamente 5 x 106, y lo más preferiblemente debe usarse de 104 a 107 ufp por dosis.

El virus de la gripe porcina puede contener mutaciones en el segmento génico NS1 que pueden no provocar una actividad antagonista de IFN alterada o un fenotipo inductor de IFN sino que más bien provocan funciones virales alteradas y un fenotipo atenuado por ejemplo, inhibición alterada de la exportación nuclear de ARNm que contiene poli(A), inhibición alterada de corte y ayuste de pre-ARNm, inhibición alterada de la activación de PKR mediante el secuestro de ARNbc, efecto alterado sobre la traducción del ARN viral e inhibición alterada de la poliadenilación del ARNm del hospedador (por ejemplo, véase Krug en Textbook of Gripe, Nicholson et al. Ed. 1998, 82-92, y referencias citadas en ese documento).

Pueden usarse muchos métodos para introducir las formulaciones de vacuna y formulaciones inmunogénicas descritas anteriormente, éstos incluyen, aunque sin limitación, las vías intranasal, intratraqueal, oral, intradérmica, intramuscular, intraperitoneal, intravenosa, y subcutánea. Puede ser preferible introducir la formulación de vacuna o formulación inmunogénica del virus de la gripe porcina mediante la vía natural de infección del patógeno para el cual está diseñada la vacuna, o mediante la vía natural de infección del virus de tipo silvestre. Cuando se usa una preparación de vacuna o formulación inmunogénica de virus de la gripe porcina atenuado vivo, puede ser preferible introducir la formulación mediante la vía natural de infección para el virus de la gripe. Puede usarse la capacidad del virus de la gripe de inducir una vigorosa respuesta inmunitaria secretora y celular de forma ventajosa. Por ejemplo, la infección del tracto respiratorio por virus de la gripe porcina atenuados puede inducir una fuerte respuesta inmunitaria secretora, por ejemplo en el sistema urogenital, con protección concomitante contra un agente causante de enfermedad particular.

En un aspecto específico, puede ser deseable administrar las composiciones descritas en la presente memoria de forma local al área que necesita tratamiento; esto puede conseguirse por, por ejemplo, y no a modo de limitación, infusión local durante cirugía, por inyección, mediante un catéter, o mediante un implante, siendo dicho implante de un material poroso, no poroso, o gelatinoso, incluyendo membranas, tales como membranas sialásticas, o fibras. En un aspecto, la administración puede ser por inyección directa en el sitio (o sitio anterior) de infección.

Podría administrarse una vacuna o formulación inmunogénica descrita en la presente memoria, que comprende de 102 a 108 ufp, preferiblemente de aproximadamente 103 a 107, más preferiblemente de 104 ufp a aproximadamente 5 x 106 ufp de virus de la gripe porcina atenuado con actividad antagonista de IFN alterada, una vez a un sujeto. Como alternativa, podría administrarse una vacuna o formulación inmunogénica descrita en la presente memoria, que comprende de 102 a 108, preferiblemente de aproximadamente 103 a 107, más preferiblemente de 104 a aproximadamente 5 x 106 ufp de virus mutantes con actividad antagonista de IFN alterada, dos veces, tres veces, cuatro veces, cinco veces, seis veces, siete veces, ocho veces, nueve veces, o diez veces a un sujeto con un intervalo de 2 a 6 meses, 2 a 8 meses, 2 a 10 meses, o 2 a 12 meses entre dosis. Como alternativa, podría administrarse una vacuna o formulación inmunogénica descrita en la presente memoria, que comprende de 102 a 108, preferiblemente de aproximadamente 103 a 107, más preferiblemente de 104 ufp a aproximadamente 5 x 106 ufp de virus mutantes con actividad antagonista de IFN alterada, tan a menudo como fuera necesario a un sujeto. El sujeto puede ser un cerdo.

Una formulación de vacuna o una formulación inmunogénica puede no provocar protección completa de una infección (por ejemplo, una infección viral), pero provoca un título inferior o cantidad reducida del patógeno (por ejemplo, un virus) en comparación con un sujeto no tratado. Los beneficios incluyen, aunque sin limitación, menor gravedad de los síntomas de la infección y una reducción en la duración de la enfermedad o afección asociada con la infección.

La formulación de vacuna o formulación inmunogénica de la invención puede usarse para proteger contra infecciones por virus de la gripe porcina. En otros aspectos, se usa una formulación de vacuna descrita en la presente memoria para proteger contra infección por otro virus porcino incluyendo, aunque sin limitación, el virus del síndrome reproductor y respiratorio porcino, citomegalovirus porcino, coronavirus respiratorio porcino, virus de la encefalomiocarditis porcina, diarrea epidémica porcina. La formulación de vacuna o formulación inmunogénica de la invención puede usarse para proteger contra infecciones por patógenos diferentes a un virus porcino.

Una formulación inmunogénica de la invención puede usarse para prevenir, tratar, controlar o mejorar afecciones en que es beneficiosa la inducción de una respuesta inmunitaria contra un antígeno particular.

5.6 Formulaciones farmacéuticas

La presente invención abarca formulaciones farmacéuticas que comprenden virus de la gripe porcina de la presente invención con actividad antagonista de IFN alterada a usarse como agentes anti-virales o agentes anti-tumorales o como agentes contra enfermedades tratables por IFN. Las formulaciones farmacéuticas pueden tener utilizada como un profiláctico anti-viral y pueden administrarse a un cerdo en riesgo de quedar infectado o se espera que esté expuesto a un virus, por ejemplo, virus de la gripe porcina. Las formulaciones farmacéuticas pueden tener utilidad como agente terapéutico o profiláctico para una enfermedad tratable por IFN y por tanto, pueden usarse para tratar, prevenir, controlar o mejorar trastornos tratables por IFN. Las formulaciones farmacéuticas pueden tener utilidad como un agente terapéutico o profiláctico para una enfermedad porcina tratable por IFN y por tanto, pueden usarse para tratar, prevenir, controlar o mejorar trastornos porcinos tratables por IFN. En aspectos específicos, las formulaciones farmacéuticas descritas en la presente memoria tienen utilidad como un agente terapéutico o profiláctico para una enfermedad tratable por IFN y por tanto, pueden usarse para tratar, prevenir, controlar o mejorar trastornos tratables por IFN en burros, cebras, camellos, perros, aves (por ejemplo, patos). Las formulaciones farmacéuticas de la invención pueden tener utilidad como un agente terapéutico o profiláctico para una enfermedad tratable por IFN y por tanto, pueden usarse para tratar, prevenir, controlar o mejorar trastornos tratables por IFN en cerdos.

Una formulación farmacéutica de la invención puede comprender un virus de la gripe porcina atenuado quimérico de la presente invención que comprende una secuencia heteróloga. La secuencia heteróloga puede codificar un epítopo de un antígeno foráneo o tumoral. Puede seleccionarse un antígeno foráneo de otro virus, una bacteria o un parásito. Las formulaciones farmacéuticas pueden usarse para tratar tumores o prevenir la formación de tumores, por ejemplo, en cerdos que tienen cáncer o en aquellos que están en alto riesgo de desarrollar neoplasias o cáncer. Por ejemplo, puede tratarse a un sujeto (por ejemplo, un cerdo, burro, u otro animal que pueda infectarse con virus de la gripe porcina o en que pueda replicarse el virus de la gripe porcina) con cáncer para prevenir la tumorigénesis adicional. Como alternativa, puede tratarse a cerdos que están o se espera que estén expuestos a carcinógenos.

Como alternativa, puede tratarse a cerdos que tienen que estar expuestos a radiación antes de la exposición y después de ello. Los cánceres específicos que pueden tratarse con las composiciones de la presente invención incluyen, aunque sin limitación, cánceres del útero, glándula mamaria, páncreas, piel, ganglio linfático, vulva y testículo.

Las propiedades antitumorales de los virus y formulaciones de la invención pueden estar al menos parcialmente relacionadas con su capacidad de inducir IFN y respuestas de IFN. Como alternativa, las propiedades antitumorales de los virus de la gripe porcina atenuados de la invención pueden estar relacionadas con su capacidad de crecer específicamente en y eliminar células tumorales, muchas de las cuales se sabe que tienen deficiencias en el sistema IFN. Independientemente del mecanismo o mecanismos moleculares responsables de las propiedades antitumorales, los virus de la gripe porcina atenuados de la invención pueden usarse para tratar tumores o para prevenir la formación de tumores.

En la presente memoria se describen los virus de la gripe porcina con un fenotipo antagonista de IFN alterado que están dirigidos a órganos, tejidos y/o células específicas en el cuerpo para inducir efectos terapéuticos o profilácticos de forma local. Una ventaja de dicho enfoque es que los virus de la gripe porcina que inducen IFN descritos en la presente memoria están dirigidos a sitios específicos, por ejemplo la localización de un tumor, para inducir IFN en de un modo específico de sitio para un efecto terapéutico en lugar de inducir IFN de forma sistémica, que puede tener efectos tóxicos.

Los virus de la gripe porcina que inducen IFN descritos en la presente memoria pueden modificarse por ingeniería usando los métodos descritos en la presente memoria para expresar proteínas o péptidos que dirigirían los virus a un sitio particular. En un aspecto específico, los virus de la gripe porcina que inducen IFN estarían dirigidos a sitios de tumores. En dicho aspecto, los virus de la gripe porcina pueden modificarse por ingeniería para expresar el sitio de combinación con antígeno de un anticuerpo que reconoce un antígeno específico de tumor, dirigiendo de este modo al virus de la gripe porcina que induce IFN al tumor. En otro aspecto, cuando el tumor a abordar expresa un receptor de hormonas, tal como tumores de mama u ovario que expresan receptores de estrógenos, el virus de la gripe porcina que induce IFN puede modificarse por ingeniería para expresar la hormona apropiada. En otro aspecto más, cuando el tumor a abordar expresa un receptor para un factor de crecimiento, por ejemplo VEGF, EGF, o PDGF, el virus que induce IFN puede modificarse por ingeniería para expresar el factor de crecimiento apropiado o fragmento del mismo. Por tanto, de acuerdo con la descripción, los virus de la gripe porcina que inducen IFN pueden modificarse por ingeniería para expresar cualquier producto génico diana, incluyendo péptidos, proteínas, tales como enzimas, hormonas, factores de crecimiento, antígenos o anticuerpos, que funcionarán dirigiendo el virus de la gripe porcina al sitio que necesita tratamiento (por ejemplo, terapia anti-viral, antibacteriana, anti-microbiana o anti- cancerosa).

Los métodos de introducción incluyen, aunque sin limitación, las vías intradérmica, intramuscular, intraperitoneal, intravenosa, subcutánea, intranasal, epidural, y oral. Las formulaciones farmacéuticas de la presente invención pueden administrarse por cualquier vía conveniente, por ejemplo por infusión o inyección en embolada, por absorción a través de revestimientos epiteliales o mucocutáneos (por ejemplo, mucosa oral, mucosa rectal e intestinal, etc.) y pueden administrarse junto con otros agentes biológicamente activos. La administración puede ser sistémica o local. Además, en un aspecto preferido, puede ser deseable introducir las formulaciones farmacéuticas de la invención en los pulmones mediante cualquier vía adecuada. También puede emplearse administración pulmonar, por ejemplo, mediante el uso de un inhalado o nebulizador, y formulación con un agente que forma aerosol.

En un aspecto específico, puede ser deseable administrar las formulaciones farmacéuticas de la invención de forma local al área que necesita tratamiento; esto puede conseguirse por, por ejemplo, y no a modo de limitación, infusión local durante cirugía, aplicación tópica, por ejemplo, junto con un vendaje para heridas después de cirugía, por inyección, mediante un catéter, mediante un supositorio, o mediante un implante, siendo dicho implante de un material poroso, no poroso, o gelatinoso, incluyendo membranas, tales como membranas sialásticas, o fibras. En un aspecto, la administración puede ser por inyección en el sitio (o sitio anterior) de un tumor maligno o tejido neoplásico o pre-neoplásico.

En otro aspecto, la formulación farmacéutica puede suministrarse en una matriz biológica. Se describe un ejemplo de una matriz biológica en la patente de Estados Unidos Nº 5.962.427, y la publicación de solicitud de patente de Estados Unidos U.S. 2002/0193338.

En otro aspecto más, la formulación farmacéutica puede suministrarse en un sistema de liberación controlada. En una realización, puede usarse una bomba (véase Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321:574). En otro aspecto, pueden usarse materiales poliméricos (véase Medical Applications of Controlled Release, Langer y Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen y Ball (eds.), Wiley, Nueva York (1984); Ranger y Peppas, 1983, J. Macromol. Sci. Rev. Macromol. Chem. 23:61; véase también Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol. 25:351 (1989); Howard et al., 1989, J. Neurosurg. 71:105). En otro aspecto más, puede colocarse un sistema de liberación controlada en proximidad de la diana de la composición, es decir, el pulmón, lo que requiere por tanto solamente una fracción de la dosis sistémica (véase, por ejemplo, Goodson, 1984, en Medical Applications of Controlled Release, supra, vol. 2, pág. 115-138). Se analizan otros sistemas de liberación controlada en la revisión de Langer (1990, Science 249:1527-1533).

Las formulaciones farmacéuticas de la presente invención comprenden una cantidad eficaz de un virus de la gripe porcina atenuado de la invención, y un vehículo farmacéuticamente aceptable. La expresión "farmacéuticamente aceptable" significa aprobado por una agencia reguladora del gobierno federal o estatal o enumerado en la farmacopea de Estados Unidos u otras farmacopeas generalmente reconocidas para su uso en animales, y más particularmente en seres humanos. El término "vehículo" se refiere a un diluyente, adyuvante, excipiente, o medio con que se administra la formulación farmacéutica. También pueden emplearse soluciones salinas y soluciones acuosas de dextrosa y glicerol como vehículos líquidos, particularmente para soluciones inyectables. Los excipientes farmacéuticos adecuados incluyen almidón, glucosa, lactosa, sacarosa, gelatina, malta, arroz, harina, tiza, gel de sílice, estearato sódico, monoestearato de glicerol, talco, cloruro sódico, leche desnatada en polvo, glicerol, propilenglicol, agua, etanol y similares. Estas composiciones puede adoptar la forma de soluciones, suspensiones, emulsiones, comprimidos, píldoras, cápsulas, polvos, formulaciones de liberación sostenida y similares. La composición puede formularse como un supositorio. La formulación oral puede incluir vehículos convencionales tales como calidades farmacéuticas de manitol, lactosa, almidón, estearato de magnesio, sacarina sódica, celulosa, carbonato de magnesio, etc. Se describen ejemplos de vehículos farmacéuticos adecuados en "Remington's Pharmaceutical Sciences" por E.W.Martin. Dichas composiciones contendrán una cantidad eficaz de la terapia, preferiblemente en forma purificada, junto con una cantidad adecuada de vehículo para proporcionar la forma para administración apropiada al paciente. La formulación debe adecuarse al modo de administración. La formulación particular también puede depender de si el virus de la gripe porcina está vivo o inactivado.

La cantidad de la formulación farmacéutica de la invención que será eficaz en el tratamiento, prevención, control o mejora de un trastorno o afección particular dependerá de la naturaleza del trastorno o afección, y puede determinarse por técnicas clínicas convencionales. Además, pueden emplearse opcionalmente ensayos in vitro para ayudar a identificar intervalos óptimos de dosificación. La dosis precisa a emplear en la formulación también dependerá de la vía de administración, y la gravedad de la enfermedad o trastorno, y debe decidirse de acuerdo con el criterio del médico y las circunstancias de cada paciente. Sin embargo, intervalos adecuados de dosificación para administración son generalmente de aproximadamente 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 105, 106, 5 x 106, 107, 5 x 107, 108, 5 x 108, 1 x 109, 5 x 109, 1 x 1010, 5 x 1010, 1 x 1011, 5 x 1011 o 1012 ufp, y lo más preferiblemente de aproximadamente 104 a aproximadamente 1012 ufp, y puede administrarse a un sujeto una vez, dos veces, tres o más veces con intervalos tan frecuentes como sea necesario. Las formulaciones farmacéuticas de la presente invención que comprenden 102, 5 x 102,103, 5 x 103, 104, 5 x 104, 105, 5 x 105, 106, 5 x 106, 107, 5 x 107, 108, 5 x 108, 1 x 109, 5 x 109, 1 x 1010, 5 x 1010, 1 x 1011, 5 x 1011 o 1012 ufp, y los más preferiblemente de aproximadamente 104 a aproximadamente 1012 ufp de un virus de la gripe porcina atenuado de la presente invención con actividad antagonista de IFN alterada, pueden administrarse a un sujeto por vía intranasal, intratraqueal, intramuscular o subcutánea. Las dosis eficaces pueden extrapolarse de las curvas de respuesta a dosis obtenidas de sistemas de ensayo in vitro o en modelo animal.

La formulación farmacéutica de la invención puede usarse para prevenir, controlar, tratar o mejorar infecciones por virus, bacterias o parásitos. La formulación farmacéutica de la invención puede usarse para prevenir, controlar, tratar o mejorar el cáncer en un cerdo. La formulación farmacéutica de la invención puede usarse para prevenir, controlar, tratar o mejorar otras enfermedades tratables por IFN.

5.7 Terapias útiles en combinación con virus de la gripe porcina

En la presente memoria se describen métodos para prevenir, controlar, tratar, y/o mejorar enfermedades y trastornos incluyendo, aunque sin limitación, infecciones por virus de la gripe porcina, afecciones asociadas con infección por virus de la gripe porcina, infecciones diferentes a infecciones por virus de la gripe porcina, afecciones asociadas con infecciones diferentes a infecciones por virus de la gripe porcina, trastornos tratables por IFN (por ejemplo, cáncer) y afecciones en que se usa un virus de la gripe porcina atenuado de la invención como un vector para inducir una respuesta inmunitaria contra un antígeno asociado con la afección, que comprende administrar to un sujeto que lo necesita una cantidad eficaz de uno o más virus de la gripe porcina atenuados descritos en la presente memoria y una cantidad eficaz de una o más terapias (por ejemplo, agentes profilácticos o terapéuticos) diferentes a virus de la gripe porcina atenuados. Las terapias incluyen, aunque sin limitación, moléculas pequeñas, fármacos sintéticos, péptidos, polipéptidos, proteínas, ácidos nucleicos (por ejemplo, nucleótidos de ADN y ARN incluyendo, aunque sin limitación, secuencias de nucleótidos antisentido, triples hélices, iARN, y secuencias de nucleótidos que codifican proteínas, polipéptidos o péptidos biológicamente activos), anticuerpos, moléculas inorgánicas sintéticas o naturales, agentes miméticos, y moléculas orgánicas sintéticas o naturales.

Puede usarse cualquier terapia (por ejemplo, agentes profilácticos o terapéuticos) que se sabe que es útil, o que se ha usado o se está usando actualmente para la prevención, control, tratamiento, o mejora de una infección por virus de la gripe porcina, infecciones diferentes a infecciones por virus de la gripe porcina, afecciones asociadas con infecciones diferentes a infecciones por virus de la gripe porcina, trastornos tratables por IFN, afecciones en que se usa un virus de la gripe porcina atenuado de la invención como un vector para inducir una respuesta inmunitaria contra un antígeno asociado con la afección, o cualquier otra enfermedad porcina, en combinación con un virus de la gripe porcina atenuado de acuerdo con la presente descripción. Véase, por ejemplo, Taylor, Pig Diseases, 6ª Ed., Diamond Farm Book Pubns, 1995; Straw et al., Diseases of Swine, 8ª Ed., Iowa State University Press, 1999, para información respecto a terapias, en particular agentes profilácticos o terapéuticos, que se han usado o se están usando actualmente para prevenir, tratar, controlar, y/o mejorar enfermedades porcinas. Ejemplos de agentes profilácticos y terapéuticos incluyen, aunque sin limitación, agentes anti-neoplásicos; agentes anti-virales, agentes anti-inflamatorios (por ejemplo, adrenocorticoides, corticosteroides (por ejemplo, beclometasona, budesonida, flunisolida, fluticasona, triamcinolona, metilprednisolona, prednisolona, prednisona, hidrocortisona)) y antibióticos (por ejemplo, dactinomicina (antiguamente actinomicina), bleomicina, eritomicina, penicilina, mitramicina, y antramicina (AMC)).

5.7.1 Terapias anti-neoplásicas

Puede usarse cualquier terapia (por ejemplo, agente terapéutico o profiláctico) que se sane que es útil, se ha usado, o se está usando actualmente para la prevención, tratamiento, control, o mejora del cáncer o uno o más síntomas del mismo, en composiciones y métodos descritos en la presente memoria. Las terapias (por ejemplo, agentes terapéuticos o profilácticos) incluyen, aunque sin limitación, péptidos, polipéptidos, proteínas de fusión, moléculas de ácido nucleico, moléculas pequeñas, agentes miméticos, fármacos sintéticos, moléculas inorgánicas, y moléculas orgánicas. Ejemplos no limitantes de terapias para el cáncer incluyen quimioterapias, radioterapias, terapias hormonales, y/o terapias biológicas/inmunoterapias.

En aspectos particulares, el agente anti-neoplásico puede ser, aunque sin limitación: un agente quimioterapéutico (por ejemplo, acivicina, aclarrubicina, clorhidrato de acodazol, acronina, adozelesina, aldesleukina, altretamina, ambomicina, acetato de ametantrona, aminoglutetimida, amsacrina, anastrozol, antramicina, asparaginasa, azacitidina, azetepa, batimastat, bleomicina, benzodepa, bicalutamida, clorhidrato de bisantreno, dimesilato de bisnafide, bizelesina, sulfato de bleomicina, brequinar sodio, bropirimina, busulfán, cactinomicina, calusterona, campatecina, caracemida, carbetimer, carboplatino, carmustina, clorhidrato de carrubicina, carzelesina, cedefingol, clorambucilo, cirolemicina, cisplatino, cladribina, mesilato de crisnatol, ciclofosfamida, citarabina, ciclosporina A, combretastatina A4, análogo de combretastatina, factor citolítico, citostatina, dacliximab, docetaxel, dacarbazina, dactinomicina, clorhidrato de daunorrubicina, docetaxel, doxorrubicina, droloxifeno, propionato de dromostanolona, duazomicina, edatrexato, clorhidrato de eflomitina, elsamitrucina, enloplatino, enpromato, epipropidina, clorhidrato de epirrubicina, erbulozol, clorhidrato de esorrubicina, estramustina, etanidazol, etopósido, fazarabina, fenretinida, floxuridina, fluorouracilo, flurocitabina, fosquidona, gemcitabina, hidroxiurea, idarrubicina, clorhidrato de idarrubicina, ifosfamida, ilmofosina, iproplatino, ifosfamida, clorhidrato de irinotecano, acetato de lanreotida, letrozol, acetato de leuprolida, clorhidrato de liarozol, lometrexol sodio, lomustina, clorhidrato de losoxantrona, masoprocol, mercaptopurina, metotrexato, metoprina, meturedepa, mitindomida, raitocarcina, mitocromina, mitomicina, mitoxantrona, ácido micofenólico, nitrosoureas, nocodazol, nogalamicina, ormaplatino, oxisurano, paclitaxel, plicamicina, complejo de platino, compuestos de platino, complejo de platino-triamina, procarbizina, puromicina, taxol, tioguanina, talisomicina, tecogalano sodio, tegafur, clorhidrato de teloxantrona, vapreotida, verteporfina, sulfato de vinblastina, sulfato de vincristina, vindesina, sulfato de vindesina, sulfato de vinepidina, sulfato de vinglicinato, sulfato de vinleurosina, tartrato de vinorelbina, sulfato de vinrrosidisina, sulfato de vinzolidina, vorozol, zeniplatino, y zinostatina),inhibidores de metaloproteinasa de matriz, inhibidores de tirosina quinasa, tirfostinas, antagonistas del receptor de uroquinasa, inhibidor del gen de resistencia a múltiples fármacos, terapia basada en el supresor tumoral múltiple 1, inhibidor del activado de plasminógeno, bisfosfonatos (por ejemplo, pamidronato (Aredria), clondronato sodio (Bonefos), ácido zoledrónico (Zometa), alendronato (Fosamax), etidronato, ibandronato, cimadronato, risedromato, y tiludromato), una citoquina (por ejemplo, IL-2, IFN-, IFN-, EFN-, factor inhibidor de leucemia, interferón alfa de leucocitos, gonadotropina coriónica humana, y trombopoyetina), una hormona (por ejemplo, hormona estimuladora de tiroides), un anticuerpo (por ejemplo, un anticuerpo anti-CD2, un anticuerpo anti-CD20, y un anticuerpo inmunoespecífico para uno o más receptores de galanina), vitamina D (por ejemplo, 20-epi-1,25 dihidroxivitamina D3), un inhibidor de angiogánesis, un oligonucleótido antisentido, un modulador génico de apoptosis, un regulador de apoptosis, un antagonista de BCR/ABL, un inhibidor derivado de cartílago, un agonista de estrógeno, un antagonista de estrógeno, un inhibidor de gelatinasa, un inhibidor de glutatión, un inhibidor de la HMG CoA reductasa (por ejemplo, atorvastatina, cerivastatina, fluvastatina, lescol, Iupitor, lovastatina, rosuvastatina, y simvastatina), un péptido inmunoestimulador, un inhibidor del receptor del factor-1 de crecimiento tipo insulina, un agonista de interferón, leuprolida+estrógeno+progesterona, leuprorelina, un ARN bicatenario desapareado, un inhibidor del proteasoma, un modulador inmunitario basado en proteína A, un inhibidor de proteína quinasa C, un inhibidor de proteína tirosina fosfatasa, un antagonista de raf, un inhibidor de la ras farnesil proteína transferasa, una ribozima, iARN, un modulador de la transducción de señales, un inhibidor de células madre, un inhibidor de la división de células madre, un inhibidor de telomerasa, un agonista del receptor de timopoyetina, y un inhibidor de la traducción.

En aspectos específicos, se usa la radioterapia que comprende el uso de rayos x, rayos gamma y otras fuentes de radiación para destruir las células cancerosas, en combinación con los virus de la gripe porcina atenuados descritos en la presente memoria. En aspectos preferidos, el tratamiento de radiación se administra como radiación con rayos externos o teleterapia, donde la radiación está dirigida desde una fuente remota. En otros aspectos preferidos, el tratamiento de radiación se administra como terapia interna o braquiterapia, donde se coloca una fuente radiactiva dentro del cuerpo cerca de las células cancerosas o una masa tumoral.

Las terapias contra el cáncer y sus dosificaciones, vías de administración y uso recomendado son conocidas en la técnica y se ha descrito en documentación tal como Physicians' Desk Reference (58ª ed., 2004) y Merck Veterinary Manual (8ª ed., 1998).

5.7.2 Terapias anti-angiogénesis

Puede usarse cualquier agente anti-angiogénico bien conocido para los expertos en la materia en las composiciones y métodos descritos en la presente memoria. Ejemplos no limitantes de agentes anti-angiogénicos incluyen proteínas, polipéptidos, péptidos, proteínas de fusión, anticuerpos (por ejemplo, quiméricos, monoclonales, policlonales, Fv, ScFv, fragmentos Fab, fragmentos F(ab)2, y fragmentos de unión a antígeno de los mismos) tales como anticuerpos que se unen inmunoespecíficamente a TNF, moléculas de ácido nucleico (por ejemplo, moléculas antisentido o triples hélices), moléculas orgánicas, moléculas inorgánicas, y moléculas pequeñas que reducen o inhiben o neutralizan la angiogénesis. En particular, ejemplos de agentes anti-angiogénicos incluyen, aunque sin limitación, endostatina, angiostatina, apomigren, antitrombina III anti-angiogénica, los fragmentos proteolíticos de 29 kba N-terminal y de 40 kDa C-terminal de fibronectina, un antagonista del receptor uPA, el fragmento proteolítico de 16 kDa de prolactina, el fragmento proteolítico de 7,8 kDa del factor plaquetario-4, el fragmento anti-angiogénico de 24 aminoácidos del factor plaquetario-4, el factor anti-angiogénico denominado 13.40, el fragmento anti-angiogénico de 22 aminoácidos de trombospondina I, el fragmento anti-angiogénico de 20 aminoácidos de péptidos que contienen SPARC, ROD y NGR, los péptidos anti-angiogénicos pequeños de laminina, fibronectina, procolágeno y EGF, antagonistas de integrina v3 (por ejemplo, anticuerpos anti-integrina v3), antagonistas del factor de crecimiento de fibroblastos ácido (aFGF), antagonistas del factor de crecimiento de fibroblastos básico (bFGF), antagonistas del factor de crecimiento del endotelio vascular (VEGF) (por ejemplo, anticuerpos anti-VEGF), y antagonistas del receptor de VEGF (VEGFR) (por ejemplo, anticuerpos anti-VEGFR).

5.7.3 Terapias anti-virales

Puede usarse cualquier agente anti-viral bien conocido para los expertos en la materia en las composiciones y los métodos descritos en la presente memoria. Ejemplos no limitantes de agentes anti-virales incluyen proteínas, polipéptidos, péptidos, proteínas de fusión, anticuerpo, moléculas de ácido nucleico, moléculas orgánicas, moléculas inorgánicas, y moléculas pequeñas que inhiben y/o reducen la adhesión de un virus a su receptor, la internalización de un virus en una célula, la replicación de un virus, o la liberación de virus desde una célula. En particular, los agentes anti-virales incluyen, aunque sin limitación, análogos nucleosídicos (por ejemplo, zidovudina, aciclovir, gangciclovir, vidarabina, idoxuridina, trifluridina, y ribavirina), foscarnet, amantadina, rimantadina, saquinavir, indinavir, ritonavir, alfa-interferones y otros interferones, y AZT.

En aspectos específicos, el agente anti-viral es un agente inmunomodulador que es inmunoespecífico para un antígeno viral. Como se emplea en esta memoria, la expresión "antígeno viral" incluye, aunque sin limitación, cualquier péptido, polipéptido y proteína viral (por ejemplo, 3AB, 3ABC del virus de la fiebre aftosa, GP5 del virus del síndrome reproductor y respiratorio porcino, gE del virus de la pseudorrabia, nucleoproteína del virus de la transmisible porcina, neuraminidasa del virus de la gripe, hemaglutinina del virus de la gripe, glucoproteína del virus del herpes simple (por ejemplo, gB, gC, gD, y gE) y antígeno superficial de hepatitis B) que es capaz de provocar una respuesta inmunitaria. Los anticuerpos útiles en este aspecto para el tratamiento de una enfermedad infecciosa viral incluyen, aunque sin limitación, anticuerpos contra antígenos de virus patogénicos, incluyendo como ejemplos y sin limitación: adenoviridae (por ejemplo, mastadenovirus y aviadenovirus), herpesviridae (por ejemplo, virus del herpes simple 1, virus del herpes simple 2, virus del herpes simple 5, y virus del herpes simple 6), leviviridae (por ejemplo, levivirus, fase MS2 de enterobacterias, allolevirus), poxviridae (por ejemplo, chordopoxvirinae, parapoxvirus, avipoxvirus, capripoxvirus, leporiipoxvirus, suipoxvirus, molluscipoxvirus, y entomopoxvirinae), papovaviridae (por ejemplo, poliomavirus y papilomavirus), paramyxoviridae (por ejemplo, paramixovirus, virus de paragripe 1, mobilivirus (por ejemplo, virus del sarampión), rubulavirus (por ejemplo, virus de las paperas), pneumonovirinae (por ejemplo, pneumovirus, virus sincitial respiratorio humano), y metapneumovirus (por ejemplo, pneumovirus aviar y metapneumovirus humano)), picornaviridae (por ejemplo, enterovirus, rinovirus, hepatovirus (por ejemplo, virus de la hepatitis A humana), cardiovirus, y aftovirus), reoviridae (por ejemplo, ortoreovirus, orbivirus, rotavirus, cipovirus, fijivirus, fitoreovirus, y orizavirus), retroviridae (por ejemplo, retrovirus tipo B de mamífero, retrovirus tipo C de mamífero, retrovirus tipo C de aves, grupo de retrovirus tipo D, retrovirus BLV-HTLV, lentivirus (por ejemplo, virus de la inmunodeficiencia humana 1 y virus de la inmunodeficiencia humana 2), espumavirus), flaviviridae (por ejemplo, virus de hepatitis C), hepadnaviridae (por ejemplo, virus de hepatitis B), togaviridae (por ejemplo, alfavirus (por ejemplo, virus sindbis) y rubivirus (por ejemplo, virus de la rubéola)), rhabdoviridae (por ejemplo, vesiculovirus, lyssavirus, ephemerovirus, citorhabdovirus, y necleorhabdovirus), arenaviridae (por ejemplo, arenavirus, virus de la coriomeningitis linfocítica, virus Ippy, y virus lassa), y coronaviridae (por ejemplo, coronavirus y torovirus).

Ejemplos específicos de anticuerpos disponibles útiles para el tratamiento de una enfermedad infecciosa viral incluyen, aunque sin limitación, PRO542 (Progenies) que es un anticuerpo de fusión con CD4 útil para el tratamiento de infección por VIH; Ostavir (Protein Design Labs, Inc., CA) que es un anticuerpo humano útil para el tratamiento de virus de la hepatitis B; y Protovir (Protein Design Labs, Inc., CA) que es un anticuerpo IgG1 humanizado útil para el tratamiento de citomegalovirus (CMV).

Las terapias anti-virales y sus dosificaciones, vías de administración y uso recomendado son conocidas en la técnica y se han descrito en documentación tal como Physicians' Desk Reference (58ª ed., 2004) y Merck Veterinary Manual (8ª ed., 1998). Está disponible información adicional sobre infecciones virales en Cecil Textbook of Medicine (18ª ed., 1988).

5.7.4 Terapias con antibiótico

Puede usarse cualquier agente antibiótico bien conocido para los expertos en la materia en las composiciones y los métodos descritos en la presente memoria. Los agentes antibacterianos o antibióticos que pueden usarse en combinación con los complejos descritos en la presente memoria incluyen, aunque sin limitación: antibióticos aminoglucosídicos (por ejemplo, apramicina, arbekacina, bambermicinas, butirosina, dibekacina, neomicina, neomicina, undecilenato, netilmicina, pafomomicina, ribostamicina, sisomicina, y espectinomicina), antibióticos de anfenicol (por ejemplo, azidanfenicol, cloranfenicol, florfeniicol, y tianfenicol), antibióticos de ansamicina (por ejemplo, rifamida y rifampina), carbacefems (por ejemplo, loracarbef), carbapenems (por ejemplo, biapenem e imipenem), cefalosporinas (por ejemplo, cefaclor, cefadroxil, cefamandol, cefatrizina, cefazedona, cefozoprano, cefpimizol, cefpiramida, y cefpirome), cefamicinas (por ejemplo, cefbuperazona, cefinetazol, y cefminox), monobactamas (por ejemplo, aztreonam, carumonam, y tigemonam), oxacefems (por ejemplo, flomoxef, y moxalactama), penicilinas (por ejemplo, amdinocilina, amdinocilina pivoxil, amoxicilina, bacampicilina, ácido bencilpenicilínico, bencilpenicilina sodio, epicilina, fenbenicilina, floxacilina, penamicilina, yodhidrato de penetamato, penicilina o-benetamina, penicilina 0, penicilina V, penicilina V benzatina, penicilina V hidlrabamina, penimepiciclina, y fencihicilina potasio), lincosamidas (por ejemplo, clindamicina, y lincomicina), macrólidos (por ejemplo, azitromicina, carbomicina, claritomicina, diritromicina, eritromicina, y acistrato de eritromicina), anfomicina, bacitracina, capreomicina, colistut, enduracidina, enviomicina, tetraciclinas (por ejemplo, apiciclina, clortetraciclina, clomociclina, y demeclociclina), 2,4-diaminopirimidinas (por ejemplo, brodimoprim), nitrofuranos (por ejemplo, furaltadona, y cloruro de furazolio), quinolonas y análogos de las mismas (por ejemplo, cinoxacina, ciprofloxacina, clinafloxacina, flumequina, y grepagloxacina), sulfonamidas (por ejemplo, acetil sulfametoxipirazina, bencilsulfamida, noprilsulfamida, ftalilsulfacetamida, sulfacrisoidina, y sulfacitina), sulfonas (por ejemplo, diatimosulfona, glucosulfona sodio, y solasulfona), cicloserina, mupirocina y tuberina.

Ejemplos adicionales de agentes antibacterianos incluyen aunque sin limitación Acedapsona; Acetosulfona Sodio; Alamecina; Alexidina; Amdinocilina; Amdinocilina Pivoxil; Amiciclina; Amifloxacina; Mesilato de Amifloxacina; Amikacina; Sulfato de Amikacina; ácido Aminosalicílico; Aminosalicilato sodio; Amoxicilina; Anfomicina; Ampicilina; Ampicilina Sodio; Apalcilina Sodio; Apramicina; Aspartocina; Sulfato de Astromicina; Avilamicina; Avoparcina; Azitromicina; Azlocilina; Azlocilina Sodio; Clorhidrato de Bacampicilina; Bacitracina; Metileno Disalicilato de Bacitracina; Bacitracina Zinc; Bambermicinas; Benzoilpas Calcio; Beritromicina; Sulfato de Betamicina; Biapenem; Biniramicina; Clorhidrato de Bifenamina; Bispiritiona Magsulfex; Butikacina; Sulfato de Butirosina; Sulfato de Capreomicina; Carbadox; Carbenicilina Disodio; Carbenicilina Indanil Sodio; Carbenicilina Fenil Sodio; Carbenicilina Potasio; Carumonam Sodio; Cefaclor; Cefadroxil; Cefamandol; Nafato de Cefamandol; Cefamandol Sodio; Cefaparol; Cefatrizina; Cefazaflur Sodio; Cefazolina; Cefazolina Sodio; Cefbuperazona; Cefdinir; Cefepima; Clorhidato de Cefepima; Cefetecol; Cefixima; Clorhidrato de Cefmnenoxima; Cefmetazol; Cefmetazol Sodio; Cefonicid Monosodio; Cefonicid Sodio; Cefoperazona Sodio; Ceforanida; Cefotaxima Sodio; Cefotetano; Cefotetano Disodio; Clorhidrato de Cefotiam; Cefoxitina; Cefoxitina Sodio; Cefpimizol; Cefpimizol Sodio; Cefpiramida; Cefpiramida Sodio; Sulfato de Cefpiroma; Cefpodoxima Proxetil; Cefprozil; Cefroxadina; Cefsulodina Sodio; Ceftazidima; Ceftibuteno; Ceftizoxima Sodio; Ceftriaxona Sodio; Cefuroxima; Cefuroxima Axetil; Cefuroxima Pivoxetil; Cefuroxima Sodio; Cefacetril Sodio; Cefalexina; Clorhidrato de Cefalexina; Cefaloglicina; Cefaloridina; Cefalotina Sodio; Cefapirina Sodio; Cefradina; Clorhidrato de Cetociclina; Cetofenicol; Cloranfenicol; Palmitato de Cloranfenicol; Complejo de Pantotenato de Cloranfenicol; Succinato de Cloranfenicol Sodio; Fosfanilato de Clorhexidina; Cloroxilenol; Bisulfato de Clortetraciclina; Clorhidrato de Clortetraciclina; Cinoxacina; Ciprofloxacina; Clorhidrato de Ciprofloxacina; Cirolemicina; Claritromicina; Clorhidrato de Clinafloxacina; Clindamicina; Clorhidrato de Clindamicina; clorhidrato de Palmitato de Clindamicina; Fosfato de Clindamicina; Clofazimina; Cloxacilina Benzatina; Cloxacilina Sodio; Cloxiquina; Colistimetato Sodio; Sulfato de Colistina; Coumermicina; Coumermicina Sodio; Ciclacilina; Cicloserina; Dalfopristina; Dapsona; Daptomicina; Demeclociclina; Clorhidrato de Demeclociclina; Demeciclina; Denofungina; Diaveridina; Dicloxacilina; Dicloxacilina Sodio; Sulfato de Dihidroestreptomicina; Dipiritiona; Diritromicina; Doxiciclina; Doxiciclina Calcio; Doxiciclina Fosfatex; Doxiciclina Hiclato; Droxacina Sodio; Enoxacina; Epicilina; Clorhidrato de Epitetraciclina; Eritromicina; Acistrato de Eritromicina; Estolato de Eritromicina; Etilsuccinato de Eritromicina; Gluceptato de Eritromicina; Lactobionato de Eritromicina; Propionato de Eritromicina; Estearato de Eritromicina; Clorhidrato de Etambutol; Etionamida; Fleroxacina; Floxacilina; Fludalanina; Flumequina; Fosfomicina; Fosfomicina Trometamina; Fumoxicilina; Cloruro de Furazolio; Tartrato de Furazolio; Fusidato Sodio; Ácido Fusídico; Sulfato de Gentamicina; Gloximonam; Gramicidina; Haloprogina; Hetacilina; Hetacilina Potasio; Hexedina; Ibafloxacina; Imipenem; Isoconazol; Isepamicina; Isoniazid; Josamicina; Sulfato de Kanamicina; Kitasamicina; Levofuraltadona; Levopropilcilina Potasio; Lexitromicina; Lincomicina; Clorhidrato de Lincomicina; Lomefloxacina; Clorhidrato de Lomefloxacina; Mesilato de Lomefloxacina; Loracarbef; Mafenida; Meclociclina; Sulfosalicilato de Meclociclina; Fosfato de Megalomicina Potasio; Mequidox; Meropenem; Metaciclina; Clorhidrato de Metaciclina; Metenamina; Hippurato de Metenamina; Mandelato de Metenamina; Meticilina Sodio; Metioprim; Clorhidrato de Metronidazol; Fosfato de Metronidazol; Mezlocilina; Mezlocilina Sodio; Minociclina; Clorhidrato de Minociclina; Clorhidrato de Mirincamicina; Monensina; Monensina Sodio; Nafcilina Sodio; Nalidixato Sodio; Ácido Nalidíxico; Natamicina; Nebrabracina; Palmitato de Neomicina; Sulfato de Neomicina; Undecilenato de Neomicina; Sulfato de Netilmicina; Neutramicina; Nifuradeno; Nifuraldezona; Nifuratel; Nifuratrona; Nifurdazil; Nifurimida; Nifurpirinol; Niturquinazol; Nifurtiazol; Nitrociclina; Nitrofurantoina; Nitromida; Norfloxacina; Novobiocina Sodio; Ofloxacina; Ormetoprim; Oxacilina Sodio; Oximonam; Oximonam Sodio; Ácido Oxolínico; Oxitetraciclina; Oxitetraciclina Calcio; Clorhidrato de Oxitetraciclina; Paldimicina; Paraclorofenol; Paulomicina; Pefloxacina; Mesilato de Pefloxacina; Penamecilina; Penicilina G Benzatina; Penicilina G Potasio; Penicilina G Procaína; Penicilina G Sodio; Penicilina V; Penicilina V Benzatina; Penicilina V Hidrabamina; Penicilina V Potasio; Pentizidona Sodio; Aminosalicilato de Fenilo; Piperacilina Sodio; Pirbenicilina Sodio; Piridicilina Sodio; Clorhidrato de Pirlimicina; Clorhidrato de Pivampicilina; Pamoato de de Pivampicilina; Probenato de Pivampicilina; Sulfato de Polimixina B; Porfiromicina; Propikacina; Pirazinamida; Piritiona Zinc; Acetato de Quindecamina; Quinupristina; Racefenicol; Ramoplanina; Ranimicina; Relomicina; Repromicina; Rifabutina; Rifametano; Rifamexil; Rifamida; Rifampina; Rifapentina; Rifaximina; Rolitetraciclina; Nitrato de Rolitetraciclina; Rosaramicina; Butirato de Rosaramicina; Propionato de Rosaramicina; Fosfato de Rosaramicina Sodio; Estearato de Rosaramicina; Rosoxacina; Roxarsona; Roxitromicina; Sanciclina; Sanfetrinem Sodio; Sarmoxicilina; Sarpicilina; Scopafingina; Sisomicina; Sulfato de Sisomicina; Esparfloxacina; Clorhidrato de Espectinomicina; Espiramicina; Clorhidrato de Estalimicina; Esteffimicina; Sulfato de Estreptomicina; Estreptonicozid; Sulfabenz; Sulfabenzamida; Sulfacetamida; Sulfacetamida Sodio; Sulfacitina; Sulfadiazina; Sulfadiazina Sodio; Sulfadoxina; Sulfaleno; Sulfamerazina; Sulfameter; Sulfametazina; Sulfametizol; Sulfametoxazol; Sulfamonometoxina; Sulfamoxol; Sulfanilato Zinc; Sulfanitrano; Sulfasalazina; Sulfasomizol; Sulfatiazol; Sulfazamet; Sulfisoxazol; Sulfisoxazol Acetilo; Sulfisoxazol Diolamina; Sulfomixina; Sulopenem; Sultamicilina; Suncilina Sodio; clorhidrato de Talampicilina; Teicoplanina; Clorhidrato de Temafloxacina; Temocilina; Tetraciclina; Clorhidrato de Tetraciclina; Complejo de Fosfato de Tetraciclina; Tetroxoprim; Tianfenicol; Tifencilina Potasio; Ticarcilina Cresil Sodio; Ticarcilina Disodio; Ticarcilina Monosodio; Ticlatona; Cloruro de Tiodonio; Tobramicina; Sulfato de Tobramicina; Tosufloxacina; Trimetoprim; Sulfato de Trimetoprim; Trisulfapirimidinas; Troleandomicina; Sulfato de Trospectomicina; Tirotricina; Vancomicina; Clorhidrato de Vancomicina; Virginiamicina; Zorbamicina.

Las terapias con antibiótico y sus dosificaciones, vías de administración y uso recomendado son conocidas en la técnica y se han descrito en documentación tal como Physicians' Desk Reference (58ª ed., 2004) y Merck Veterinary Manual (8ª ed:, 1998).

5.7.5 Terapias inmunomoduladoras

Puede usarse cualquier agente inmunomodulador bien conocido para los expertos en la materia en los métodos y composiciones descritas en la presente memoria. Los agentes inmunomoduladores puede afectar a uno o más o todos los aspectos de la respuesta inmunitaria en un sujeto. Los aspectos de la respuesta inmunitaria incluyen, aunque sin limitación, la respuesta inflamatoria, la cascada del complemento, la diferenciación de leucocitos y linfocitos, la proliferación, y/o la función efectora, los recuentos de monocitos y/o basófilos, y la comunicación celular entre células del sistema inmunitario. En ciertos aspectos descritos en la presente memoria, un agente inmunomodulador modula un aspecto de la respuesta inmunitaria. En otros aspectos, un agente inmunomodulador modula más de un aspecto de la respuesta inmunitaria. En un aspecto, la administración de un agente inmunomodulador a un sujeto inhibe o reduce uno o más aspectos de las capacidades de respuesta inmunitaria del sujeto. En ciertos aspectos, un agente inmunomodulador no es un agente anti-inflamatorio. En ciertos aspectos, un agente inmunomodulador no es un agente anti-angiogénico. En ciertos aspectos, un agente inmunomodulador es un agente quimioterapéutico. En ciertos aspectos, un agente inmunomodulador no es un agente quimioterapéutico.

Ejemplos de agentes inmunomoduladores incluyen, aunque sin limitación, agentes proteicos tales como citoquinas, péptido miméticos, y anticuerpos (por ejemplo, humanos, humanizados, quiméricos, monoclonales, policlonales, Fv, ScFv, fragmentos Fab o F(ab)2 o fragmentos de unión a epítopo), moléculas de ácido nucleico (por ejemplo, moléculas de ácido nucleico antisentido y triples hélices), moléculas pequeñas, compuestos orgánicos, y compuestos inorgánicos. En particular, los agentes inmunomoduladores incluyen, aunque sin limitación, metotrexato, leflunomida, ciclofosfamida, citoxano, Immuran, ciclosporina A, minociclina, azatioprina, antibióticos (por ejemplo, FK506 (tacrolimus)), metilprednisolona (MP), corticosteroides, esteroides, micofenolato mofetil, rapamicina (sirolimus), mizoribina, desoxiespergualina, brequinar, malononitriloamindas (por ejemplo, leflunamida), moduladores del receptor de células T, y moduladores del receptor de citoquinas.

Ejemplos de moduladores del receptor de células T incluyen, aunque sin limitación, anticuerpos anti-receptor de células T (por ejemplo, anticuerpos anti-CD4 (por ejemplo, cM-T412 (Boeringer), IDEC-CE9,1® (IDEC y SKB), mAB 4162W94, Orthoclone y OKTcdr4a (Janssen-Cilag)), anticuerpos anti-CD2, anticuerpos anti-CD3 (por ejemplo, Nuvion (Product Design Labs), OKT3 (Johnson & Johnson), o Rituxan (IDEC)), anticuerpos anti-CD5 (por ejemplo, un inmunoconjugado anti-CD5 ligado a ricina), anticuerpos anti-CD7 (por ejemplo, CHH-380 (Novartis)), anticuerpos anti-CD8, anticuerpos monoclonales anti-ligando de CD40 (por ejemplo, EDEC-131 (IDEC)), anticuerpos anti-CD52 (por ejemplo, CAMPATH 1H (Ilex)), anticuerpos anti-CD2, anticuerpos anti-CD11a (por ejemplo, Xanelim (Genentech)), y anticuerpos anti-B7 (por ejemplo, IDEC-114) (IDEC))), CTLA4-immunoglobulin, y LFA-3TIP (Biogen, publicación internacional Nº WO 93/08656 y patente de Estados Unidos Nº 6.162.432).

Ejemplos de moduladores del receptor de citoquinas incluyen, aunque sin limitación, receptores solubles de citoquinas (por ejemplo, el dominio extracelular de un receptor de TNF- o un fragmento del mismo, el dominio extracelular de un receptor de IL-1 o un fragmento del mismo, y el dominio extracelular de un receptor de IL-6 o un fragmento del mismo), citoquinas o fragmentos de las mismas (por ejemplo, interleuquina IL-2, IL-3, DL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-23, TNF-, TNF-, interferón (IFN)-, IFN-, IFN-, y GM-CSF), anticuerpos anti-receptor de citoquinas (por ejemplo, anticuerpos anti-receptor de IFN, anticuerpos anti-receptor de IL-2 (por ejemplo, Zenapax (Protein Design Labs)), anticuerpos anti-receptor de IL-3, anticuerpos anti-receptor de IL- 4, anticuerpos anti-receptor de IL-6, anticuerpos anti-receptor de IL-9, anticuerpos anti-receptor de IL-10, anticuerpos anti-receptor de IL-12, anticuerpos anti-receptor de IL-13, anticuerpos anti-receptor de IL-15, y anticuerpos anti- receptor de IL-23), anticuerpos anti-citoquina (por ejemplo, anticuerpos anti-IFN, anticuerpos anti-TNF-, anticuerpos anti-IL-1, anticuerpos anti-IL-3, anticuerpos anti-IL-6, anticuerpos anti-IL-8 (por ejemplo, ABX-lL-8 (Abgenix)), anticuerpos anti-IL-9, anticuerpos anti-IL-12, anticuerpos anti-IL-13, anticuerpos anti-IL-15, y anticuerpos anti-IL-23).

En un aspecto específico, un modulador del receptor de citoquinas es IL-3, IL-4, IL-10, o un fragmento de las mismas. En otro aspecto, un modular del receptor de citoquinas es un anticuerpo anti-IL-1, anticuerpo anti-IL-6, anticuerpo anti-receptor de IL-12, o anticuerpo anti-TNF-. En otro aspecto, un modulador del receptor de citoquinas es el dominio extracelular de un receptor de TNF- o un fragmento del mismo.

En cierto aspectos, un agente inmunomodulador es un modulador del receptor de células B. Ejemplos de moduladores del receptor de células B incluyen, aunque sin limitación, CD19. El direccionamiento a receptores de células B proporciona un medio para modular las células B.

En un aspecto preferido, las proteínas, polipéptidos o péptidos (incluyendo anticuerpos) que se utilizan como agentes inmunomoduladores se obtienen de la misma especie que el destinatario de las proteínas, polipéptidos o péptidos para reducir la probabilidad de una respuesta inmunitaria contra esas proteínas, polipéptidos o péptidos. En otro aspecto preferido, cuando el sujeto es un cerdo, las proteínas, polipéptidos, o péptidos que se utilizan como agentes inmunomoduladores se obtienen de cerdo.

De acuerdo con los aspectos descritos en la presente memoria, se administra uno o más agentes inmunomoduladores a un sujeto antes de, después de, o de forma concomitante con un virus de la gripe porcina atenuado. Puede usarse cualquier técnica bien conocida para los expertos en la materia para medir uno o más aspectos de la respuesta inmunitaria en un sujeto particular, y de ese modo determinar cuándo es necesario administrar un agente inmunomodulador a dicho sujeto. En un aspecto preferido, se mantiene un recuento absoluto medio de linfocitos de aproximadamente 500 células/mm3, preferiblemente 600 células/mm3, 650 células/mm3, 700 células/mm3, 750 células/mm3, 800 células/mm3, 900 células/mm3, 1000 células/mm3, 1100 células/mm3, o 1200 células/mm3 en un sujeto.

Preferiblemente, se usan agentes que están disponibles en el mercado y son conocidos por funcionar como agentes inmunomoduladores, de acuerdo con los métodos descritos en la presente memoria. La actividad inmunomoduladora de un agente puede determinarse in vitro y/o in vivo mediante cualquier técnica bien conocida para los expertos en la materia incluyendo, por ejemplo, por ensayos CTL, ensayos de proliferación, e inmunoensayos (por ejemplo, ELISA) para la expresión de proteínas particulares tales como moléculas co- estimuladoras y citoquinas.

5.8 Dosificación y frecuencia de administración

La cantidad de un agente profiláctico o terapéutico o una composición descrita en la presente memoria que será eficaz en la prevención, tratamiento, control, y/o mejora de una infección por virus de la gripe porcina o una afección asociada con la misma, una infección diferente de una infección por virus de la gripe porcina o una afección asociada con la misma, una enfermedad tratable por IFN o una afección en que se usa un virus de la gripe porcina atenuado como un vector para inducir una respuesta inmunitaria contra un antígeno asociado con la afección, o la prevención de la reaparición, aparición, o desarrollo de uno o más síntomas de una infección por virus de la gripe porcina o una afección asociada con la misma, una infección diferente de una infección por virus de la gripe porcina o una afección asociada con la misma, una enfermedad tratable por IFN, o una infección en que se usa un virus de la gripe porcina atenuado como un vector para inducir una respuesta inmunitaria contra un antígeno asociado con la afección, puede determinarse por métodos clínicos convencionales. La frecuencia y dosificación también variarán de acuerdo con factores específicos para cada paciente dependiendo de las terapias específicas (por ejemplo, el agente o agentes terapéuticos o profilácticos específicos) administradas, la gravedad de trastorno, enfermedad, o afección, la vía de administración, así como la edad, peso corporal, respuesta, y el historial médico pasado del paciente. Por ejemplo, la dosificación de un agente profiláctico o terapéutico o una composición que será eficaz en el tratamiento, prevención, control, y/o mejora de una infección por virus de la gripe porcina o una afección asociada con la misma, una infección viral diferente de una infección por virus de la gripe porcina o una afección asociada con la misma, o una enfermedad tratable por IFN, o la prevención de la reaparición, aparición, o desarrollo de uno o más síntomas de una infección por virus de la gripe porcina o una afección asociada con la misma, una infección viral diferente de una infección por virus de la gripe porcina o una afección asociada con la misma, o una enfermedad tratable por IFN, puede determinarse mediante modelos animales tales como los conocidos para los expertos en la materia. Además, pueden emplearse opcionalmente ensayos in vitro para ayudar a identificar los intervalos óptimos de dosificación. Los regímenes adecuados pueden seleccionarse por los expertos en la materia considerando dichos factores y siguiendo, por ejemplo, dosificaciones presentadas en la bibliografía y recomendadas en Physician's Desk Reference (58ª ed., 2004), Merck Veterinary Manual (8ª ed., 1998), o Straw et al., Diseases of the Swine, Iowa State University Press (1999).

Dosis ejemplares de una vacuna o formulación inmunogénica incluyen de 102 a 108, de aproximadamente 103 a aproximadamente 107, de aproximadamente 104 a aproximadamente 5 x 106 ufp o de 104 a aproximadamente 107 ufp. En otros aspectos, la dosis de una vacuna o formulación inmunogénica descrita en la presente memoria administrada a un sujeto es de 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 105, 106, 5 x 106, 107, 5 x 107 o 108 ufp. Dosos ejemplares de una formulación farmacéutica incluyen 102, 5 x 102, 103, 5 x 103, 104, 5 x 104, 105, 5 x 105, 106, 5 x 106, 107, 5 x 107, 108, 5 x 108, 1 x 109, 5 x 109, 1 x 1010, 5 x 1010, 1 x 1011, 5 x 1011 o 1012 ufp. En ciertos aspectos, la dosis de la formulación farmacéutica administrada al sujeto es entre aproximadamente 102 a aproximadamente 1012, aproximadamente 102 a aproximadamente 1010, aproximadamente 102 a aproximadamente 108, aproximadamente 103 a aproximadamente 109, aproximadamente 103 a aproximadamente 107, aproximadamente 104 a aproximadamente 108, aproximadamente 104 a aproximadamente 5 x 106 ufp o aproximadamente 104 a aproximadamente 1012 ufp.

Las dosis ejemplares de una molécula pequeña incluyen cantidades de miligramos o microgramos de la molécula pequeña por kilogramo de sujeto o peso de la muestra (por ejemplo, aproximadamente 1 microgramo por kilogramo a aproximadamente 500 miligramos por kilogramo, aproximadamente 100 microgramos por kilogramo a aproximadamente 5 miligramos por kilogramo, o aproximadamente 1 microgramo por kilogramo a aproximadamente 50 microgramos por kilogramo).

Para anticuerpos, proteínas, polipéptidos, péptidos y proteínas de fusión descritas en la presente memoria, la dosificación administrada a un paciente es típicamente de 0,0001 mg/kg a 100 mg/kg del peso corporal del paciente. Preferiblemente, la dosificación administrada a un paciente es entre 0,0001 mg/kg y 20 mg/kg, 0,0001 mg/kg y 10 mg/kg, 0,0001 mg/kg y 5 mg/kg, 0,0001 y 2 mg/kg, 0,0001 y 1 mg/kg, 0,0001 mg/kg y 0,75 mg/kg, 0,0001 mg/kg y 0,5 mg/kg, 0,0001 mg/kg a 0,25 mg/kg, 0,0001 a 0,15 mg/kg, 0,0001 a 0,10 mg/kg, 0,001 a 0,5 mg/kg, 0,01 a 0,25 mg/kg o 0,01 a 0,10 mg/kg del peso corporal del paciente. Generalmente, los anticuerpos de cerdo tienen una semivida más larga dentro del cerdo que anticuerpos de otra especie debido a la respuesta inmunitaria contra los polipéptidos exógenos. Por tanto, a menudo son posibles dosificaciones inferiores de anticuerpos de cerdo y administración menos frecuente a los cerdos. Además, la dosificación y frecuencia de administración de anticuerpos o fragmentos de los mismos pueden reducirse potenciando la captación y penetración tisular de los anticuerpos mediante modificaciones tales como, por ejemplo, lipidación.

Preferiblemente, las dosificaciones de agentes profilácticos o terapéuticos usados en las terapias de combinación descritas en la presente memoria son inferiores que aquellas que se han usado o se están usando actualmente para prevenir, tratar, controlar, y/o mejorar una infección por virus de la gripe porcina o una afección o síntomas asociados con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN, o una afección en que se usa un virus de la gripe porcina atenuado como un vector para inducir una respuesta inmunitaria contra un antígeno asociado con la afección. Las dosificaciones recomendadas de agentes actualmente usados para la prevención, tratamiento, control, o mejora de una infección por virus de la gripe porcina o una afección o síntomas asociados con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN, o una afección en que se usa un virus de la gripe porcina atenuado como un vector para inducir una respuesta inmunitaria contra un antígeno asociado con la afección, puede obtenerse de cualquier referencia en la técnica incluyendo, aunque sin limitación, Hardman et al. eds., 2001, Goodman & Gilman's The Pharmacological Basis Of Basis Of Therapeutics, 10ª ed., Mc-Graw-Hill, Nueva York; Physicians' Desk Reference (PDR) 58ª ed., 2004, Medical Economics Co., Inc., Montvale, NJ, y Merck Veterinary Manual (8ª ed., 1998); Taylor,

Pig Diseases, 6a Ed., Diamond Farm Book Pubns, 1995; y Straw et al., Diseases of Swine, 8a Ed., Iowa State University Press, 1999.

En diversos aspectos, las terapias (por ejemplo, agentes profilácticos o terapéuticos) se administran menos de 5 minutos separadas, menos de 30 minutos separadas, 1 hora separadas, a aproximadamente 1 hora separadas, a aproximadamente 1 a aproximadamente 2 horas separadas, a aproximadamente 2 horas a aproximadamente 3 horas separadas, a aproximadamente 3 horas a aproximadamente 4 horas separadas, a aproximadamente 4 horas a aproximadamente 5 horas separadas, a aproximadamente 5 horas a aproximadamente 6 horas separadas, a aproximadamente 6 horas a aproximadamente 7 horas separadas, a aproximadamente 7 horas a aproximadamente 8 horas separadas, a aproximadamente 8 horas a aproximadamente 9 horas separadas, a aproximadamente 9 horas a aproximadamente 10 horas separadas, a aproximadamente 10 horas a aproximadamente 11 horas separadas, a aproximadamente 11 horas a aproximadamente 12 horas separadas, a aproximadamente 12 horas a aproximadamente 18 horas separadas, 18 horas a 24 horas separadas, 24 horas a 36 horas separadas, 36 horas a 48 horas separadas, 48 horas a 52 horas separadas, 52 horas a 60 horas separadas, 60 horas a 72 horas separadas, 72 horas a 84 horas separadas, 84 horas a 96 horas separadas, o 96 horas a 120 horas separadas. En aspectos preferidos, se administran dos o más terapias en la misma visita del paciente.

En ciertos aspectos, se administran cíclicamente una o más composiciones descritas en la presente memoria y una o más terapias (por ejemplo, agentes profilácticos o terapéuticos). La terapia cíclica implica la administración de una primera terapia (por ejemplo, un primer agente profiláctico o terapéutico) durante un periodo de tiempo, seguida de la administración de una segunda terapia (por ejemplo, un segundo atente profiláctico o terapéutico) durante un periodo de tiempo, opcionalmente seguida de la administración de una tercera terapia (por ejemplo, agente profiláctico o terapéutico) durante un periodo de tiempo y así sucesivamente, y la repetición de esta administración secuencial, es decir, el ciclo para reducir el desarrollo de resistencia contra una de las terapias, para evitar o reducir los efectos secundarios de una de las terapias, y/o para mejorar la eficacia de las terapias.

Una vacuna o composición inmunogénica de la invención puede administrarse a un sujeto en una única dosis seguida de una segunda dosis de 3 a 6 semanas después. Pueden administrarse vacunaciones de refuerzo al sujeto a intervalos de 6 a 12 meses después de la segunda vacunación. El sujeto puede ser un mamífero. El sujeto puede ser un cerdo con infección por gripe porcina A.

La administración de las mismas composiciones de la invención puede repetirse y las administraciones pueden separarse en al menos 1 día, 2 días, 3 días, 5 días, 10 días, 15 días, 30 días, 45 días, 2 meses, 75 días, 3 meses, o al menos 6 meses. La administración de la misma terapia (por ejemplo, agente profiláctico o terapéutico) diferente de una composición de la invención puede repetirse y la administración puede separarse por al menos 1 día, 2 días, 3 días, 5 días, 10 días, 15 días, 30 días, 45 días, 2 meses, 75 días, 3 meses, o al menos 6 meses.

5.9 Ensayos biológicos

5.9.1 Ensayos in vitro

El crecimiento de los virus de la gripe porcina atenuados de la presente invención puede evaluarse en células de cerdo, por ejemplo, células PK, otras células de cerdo como se describe en la presente memoria, y otras células IFN-competente e IFN-deficientes. En un aspecto específico, se infectan células PK a una MOI de 0,0005 y 0,001, 0,001 y 0,01, 0,01 y 0,1,0,1 y 1, o 1 y 10, o una MOI de 0,0005, 0,001, 0,005, 0,01, 0,05, 0,1, 0,5, 1, 5 o 10 y se incuban con medio sin suero suplementado con fluido alantoideo al 5% (F. Cook, University of Kentucky, Lexington, KY). Los títulos virales se determinan en el sobrenadante por placas HA en células MDCK como se describe a continuación. Otras células en que pueden evaluarse los títulos virales incluyen, aunque sin limitación, células PK, células Vero, células endoteliales de vena umbilical humana primarias (HUVEC), línea celular de epitelio humano H292, células HeLa, y células renales embrionarias porcinas RES.

Los ensayos virales incluyen aquellos que miden la replicación viral alterada (determinada, por ejemplo, por formación de placas) o la producción de proteínas virales (determinada, por ejemplo, por análisis de transferencia de western) o ARN virales (determinada, por ejemplo, por RT-PCR o análisis de transferencia de northern) en células cultivadas in vitro usando métodos que son bien conocidos en la técnica.

La inducción de respuestas de IFN puede determinarse midiendo el estado fosforilado de componentes de la ruta de IFN después de infección con el virus mutante de ensayo, por ejemplo, ERF-3, que se fosforila en respuesta a ARN bicatenario. En respuesta a IFN tipo I, quinasa Jak1 y quinasas TyK2, las subunidades del receptor de IFN, STAT1, y STAT2 se fosforilan rápidamente en la tirosina. Por tanto, para determinar si el virus de la gripe porcina atenuado induce respuestas de IFN, se infectan células, tales como células 293, con el virus mutante de ensayo y después de la infección, se lisan las células. Los componentes de la ruta de IFN, tales como la quinasa Jak1 o la quinasa TyK2, se inmunoprecipitan de los lisados celulares infectados, usando sueros o anticuerpos policlonales específicos, y se determina el estado de tirosina fosforilada de la quinasa por ensayos de inmunotransferencia con un anticuerpo anti- fosfotirosina (por ejemplo, véase Krishnan et al. 1997, Eur. J. Biochem. 247: 298-305). Un estado fosforilado potenciado de cualquiera de los componentes de la ruta de IFN después de infección con el virus de la gripe porcina atenuado indicaría inducción de respuestas de IFN por el virus de la gripe porcina atenuado.

La inducción de respuestas de IFN puede determinarse midiendo la activación transcripcional dependiente de IFN después de infección con el virus de la gripe porcina atenuado de ensayo. En esta realización, puede analizarse la expresión de genes que se sabe que se inducen por IFN, por ejemplo, Mx, PKR, 2-5-oligoadenilatosintetasa, complejo principal de histocompatibilidad (MHC) clase I, etc., por técnicas conocidas para los expertos en la materia (por ejemplo, transferencias de northern, transferencias de western, PCR, etc.). Como alternativa, las células de ensayo tales como células renales embrionarias o células de sarcoma osteogénico, se modifican para expresar de forma transitoria o constitutiva genes indicadores tales como el gen indicador de luciferasa o gen indicador de cloranfenicol transferasa (CAT) bajo el control de un elemento de respuesta estimulado por interferón, tal como el promotor estimulado por IFN del gen ISG-54K (Bluyssen et al., 1994, Eur. J. Biochem. 220:395-402). Las células se infectan con el virus de la gripe porcina atenuado de ensayo y el nivel de expresión del gen indicador se compara con el de células no infectadas o células infectadas con virus de tipo silvestre. Un aumento en el nivel de expresión del gen indicador después de infección con el virus de ensayo indicaría que el virus de la gripe porcina atenuado de ensayo está induciendo una respuesta de IFN.

La medición de la inducción de IFN también puede evaluarse determinando si un extracto de la célula o huevo infectado con el virus de la gripe porcina atenuado de ensayo es capaz de conferir actividad protectora contra infección viral. Más específicamente, se infectan grupos de huevos embrionados de gallina de 10-12 días de vida o huevos embrionados de gallina de 10 días de vida con el virus de la gripe porcina atenuado de ensayo o el virus de tipo silvestre. Aproximadamente de 15 a 20 horas post-infección, se recoge el fluido alantoideo y se ensaya para la actividad IFN determinan la dilución más alta con actividad protectora contra infección por virus de la gripe porcina en células de cultivo tisular, tales como células MDCK.

5.9.2 Ensayos in vivo

La virulencia disminuida de los virus de la gripe porcina atenuados de la presente invención puede evaluarse en un sujeto, en particular, cerdos. En un ejemplo, se compara la capacidad de inducir lesiones pulmonares y causar infección en cerdos con virus de la gripe porcina de tipo silvestre y virus simulado. Las lesiones pulmonares pueden evaluarse como un porcentaje de lóbulos pulmonares que están sanos por inspección visual. Los animales se sacrifican 5 días p.i. por administración intravenosa de pentobarbital, y se retiran sus pulmones en su totalidad. El porcentaje de la superficie de cada lóbulo pulmonar que está afectado por lesiones macroscópicas se estima visualmente. Los porcentajes se promedian para obtener un valor medio para los 7 lóbulos pulmonares de cada animal.

En otros ensayos, pueden ensayarse frotis nasales y BALF para determinar la carga o el título de virus. Los frotis nasales pueden tomarse durante la necropsia para determinar la carga viral post-infección. Las muestras también pueden tomarse con cuidado de cerdos vivos para determinar la carga viral post-infección. El BALF puede obtenerse después de retirar los pulmones de la cavidad torácica aclarando los pulmones (mediante la tráquea) con aproximadamente 30 ml de medio de McCoy sin suero.

Para la cuantificación del virus en muestras tisulares, se homogenizan las muestras tisulares en solución salina tamponada con fosfato (PBS), y se adsorben los homogenados aclarados durante 1 h a 37 ºC en monocapas de células MDCK. Las monocapas infectadas después se recubren con una solución de medio esencial mínimo que contiene albúmina de suero bovino (BSA) al 0,1%, DEAE-dextrano al 0,01%, NaHCO3 al 0,1%, y agar al 1%. Las placas se incuban de 2 a 3 días hasta que puedan visualizarse placas. Se realizan ensayos de dosis infecciosa en cultivo tisular (DICT) para titular el virus de muestras infectadas con PR8 del siguiente modo. Se incuban monocapas confluyentes de células MDCK en placas de 96 pocillos con diluciones log de homogenados tisulares aclarados en medio. De dos a tres días después de la inoculación, se evalúan alícuotas de 0,05 ml de cada pocillo para el crecimiento viral por ensayo de hemaglutinación (ensayo HA).

En otros ensayos más, se realizan evaluaciones histopatológicas después de infección. Se examinan los cornetes nasales y la tráquea para cambios epiteliales e inflamación subepitelial. Se examinan los pulmones para cambios epiteliales bronquiolares e inflamación peribronquiolar en bronquiolos grandes, medianos, y pequeños o terminales. Los alvéolos también se evalúan para cambios inflamatorios. Los bronquiolos medianos se clasifican en una escala de 0 a 3+ del siguiente modo: 0 (normal: revestido por células epiteliales columnares medianas a altas con límites apicales ciliados y núcleos pseudoestratificados basales; inflamación mínima); 1+ (capa epitelial columnar e incluso en contorno con proliferación ligeramente aumentada; cilios aún visibles en muchas células); 2+ (cambios prominentes en la capa epitelial que varían desde atenuación a marcada proliferación; células desorganizadas y contorno de capa irregular en el límite luminal); 3+ (capa epitelial marcadamente alterada y desorganizada con células necróticas visible en el lumen; algunos bronquiolos atenuados y otros en marcada proliferación reactiva).

La tráquea se clasifica en una escala de 0 a 2,5+ del siguiente modo: 0 (normal: revestida por células epiteliales columnares medianas a altas con límite apical ciliado, núcleos basales y pseudoestratificados. Citoplasma evidente entre el límite apical y el núcleo. Pequeño foco ocasional con células escamosas); 1+ (metaplasia escamosa focal de la capa epitelial); 2+ (metaplasia escamosa difusa de la gran parte de la capa epitelial, los cilios pueden ser evidentes de forma focal); 2,5+ (metaplasia escamosa difusa con muy pocos cilios evidentes).

La inmunohistoquímica del virus de la gripe porcina se realiza usando un anticuerpo monoclonal específico para NP. La tinción se clasifica de 0 a 3+ del siguiente modo: 0 (sin células infectadas); 0,5+ (pocas células infectadas); 1+ (pocas células infectadas, como células individuales ampliamente separadas); 1,5+ (pocas células infectadas, en forma individual ampliamente separadas y en pequeños grupos); 2+ (cantidades moderadas de células infectadas, que afectan habitualmente a grupos de células adyacentes en partes de la capa epitelial que reviste los bronquiolos, o en pequeños focos sublobulares en los alvéolos); 3+ (numerosas células infectadas, que afectan a la mayor parte de la capa epitelial en los bronquiolos, o extendidas en focos sublobulares grandes en los alvéolos).

5.9.3 Determinación del título viral

El título viral se determina inoculando diluciones en serie de virus de la gripe porcina en cultivos celulares (por ejemplo, cultivos de cerdo), embriones de pollo, o animales vivos (por ejemplo, cerdos). Después de incubación del virus durante un tiempo específico, el virus se aísla usando métodos convencionales.

La cuantificación física del título del virus puede realizarse usando PCR aplicada a sobrenadantes virales (Quinn y Trevor, 1997; Morgan et al, 1990), ensayos de hemaglutinación, dosis infecciosas en cultivo tisular (DICT50) o dosis infecciosas en huevo (DIH50).

El ensayo HA se realiza en placas de 96 pocillos con fondo en V. Se incubaron diluciones en serie de factor dos de cada muestra en PBS durante 1 h en hielo con un volumen igual de una suspensión al 0,5% de eritrocitos de pollo en PBS. Los pocillos positivos contenían una capa homogénea adherente de eritrocitos; los pocillos negativos contenían un sedimento no adherente.

5.9.4 Determinación de los títulos de anticuerpo inhibidores de hemaglutinación

En un método, el ensayo de inhibición de HA, se determinan los niveles de anticuerpos que inhiben (HI) la hemaglutinación (HA) en muestras como se ha descrito previamente (Palmer et al., 1975, Advanced laboratory techniques for gripe diagnosis. U.S. Department of Health, Education and Welfare Immunology Series. U.S.

Department of Health, Education and Welfare, Washington, D.C.). En resumen, se incuban muestras durante una noche a 37 ºC con 4 volúmenes de enzima que destruye el receptor (Denka Seikett Go., Tokio, Japón) preparada a partir de Vibrio cholerae. Después de la inactivación de la enzima que destruye el receptor por incubación de las muestras a 56 ºC durante 60 min, se mezclan diluciones en serie de factor dos de suero con 4 unidades HA de virus de la gripe porcina. Los ensayos se revelan añadiendo glóbulos rojos de pollo al 0,5% (vol/vol), y los títulos de anticuerpo HI se definen como el recíproco de la dilución más alta que causa inhibición completa de la aglutinación.

5.9.5 Estudios de toxicidad

La toxicidad y/o eficacia de las composiciones de la presente invención puede determinarse por procedimientos farmacéuticos convencionales en cultivos celulares o animales experimentales, por ejemplo, para determinar la DL50 (dosis letal para el 50% de la población) y la DE50 (dosis terapéuticamente eficaz en el 50% de la población). La proporción de dosis entre efectos tóxicos y terapéuticos es el índice terapéutico y puede expresarse como la proporción DL50/DE50. Se prefieren terapias que muestran grandes índices terapéuticos. Aunque pueden usarse terapias que muestras efectos secundarios tóxicos, debe tenerse cuidado de diseñar un sistema de suministro que dirija dichos agentes al sitio de tejido afectado para minimizar el daño potencial a células no infectadas y, de ese modo, reducir los efectos secundarios.

Los datos obtenidos de los ensayos de cultivo celular y estudios en animales pueden usarse en la formulación de un intervalo de dosificación de las terapias para su uso en sujetos (por ejemplo, cerdos). La dosificación de dichos agentes está preferiblemente dentro de un intervalo de concentraciones en circulación que incluyen la DE50 con poca o ninguna toxicidad. La dosificación puede variar dentro de este intervalo dependiendo de la dosificación empleada y la vía de administración utilizada. Para cualquier terapia usada en el método descrito en la presente memoria, la dosis terapéuticamente eficaz puede estimarse inicialmente a partir de ensayos de cultivo celular. Puede formularse una dosis en modelos animales para conseguir un intervalo de concentración plasmática en circulación que incluya la CI50 (es decir, la concentración del compuesto de ensayo que consigue una inhibición la mitad de la máxima de los síntomas) determinada en cultivo celular. Dichas información puede usarse para determinar de forma más precisa las dosis útiles en sujetos (por ejemplo, cerdos). Los niveles en plasma pueden medirse, por ejemplo, por cromatografía líquida de alto rendimiento.

Además, puede usarse cualquier ensayo conocido para los expertos en la materia para evaluar la utilidad profiláctica y/o terapéutica de una composición, una terapia de combinación descrita en la presente memoria para infección por virus de la gripe porcina o una afección o síntomas asociados con la misma, una infección diferente a una infección por virus de la gripe porcina o una afección o síntoma asociado con la misma, una enfermedad tratable por IFN, o una afección en que se usa un virus de la gripe porcina atenuado como un vector para inducir una respuesta inmunitaria contra un antígeno asociado con la afección.

Los siguientes ejemplos se proporcionan para ilustrar adicionalmente la presente invención pero no se proporcionan para limitar de ningún modo el alcance de la presente invención.

6. Ejemplos

6.1 Ejemplo 1: Generación de virus Sw/Tx98 derivados de plásmido que codifican NS1 truncada

Se usó mutagénesis dirigida al sitio para generar diferentes deleciones en el segmento NS del virus de la gripe porcina de tal modo que se expresara NEP sin ninguna alteración mientras la NS1 estaba parcialmente delecionada. Esto se consiguió insertando un codón de parada en la ORF de NS1 seguido de una deleción en la ORF de NS1 que abarca nucleótidos no implicados en la expresión de NEP.

Células y virus. Se cultivaron células renales de cerdo-15 (PK-15), de testículo porcino (ST) y de riñón canino Madin-Darby (MDCK) tipo II en medio esencial mínimo (MEM) suplementado con suero bovino fetal (FBS) al 10%. Se cultivaron células renales de cría de hámster (BHK), 293T y A549 en DMEM con FBS al 10%. Todas las células se mantuvieron a 37 ºC y 5% de CO2. Se obtuvo el virus de la gripe A/Porcino/Texas/4199-2/98 (TX/98, subtipo H3N2) del registro en el St. Jude Children's Research Hospital, Memphis, TN. Los virus de la gripe se cultivaron en las cavidades alantoideas de huevos embrionados de gallina o en células MDCK. Se cultivó el virus de la estomatitis vesicular recombinante que expresa GFP (VSV-GFP) (Stojdl, 2003, Cancer Cell 4:263-75) y se tituló en células BHK para su uso en bioensayos de IFN.

Construcción de plásmidos. Se infectaron células MDCK con virus TX/98 y se extrajo el ARN total usando reactivo Trizol de acuerdo con las instrucciones del fabricante (Invitrogen). Los ocho plásmidos de genética inversa pHW-Sw- PB2, pHW-Sw-PB1, pHW-Sw-PA, pHW-Sw-HA, pHW-Sw-NP, pHW-Sw-NA, pHW-Sw-M y pHW-Sw-NS (correspondientes a los ocho segmentos virales de gripe enumerados en la Tabla 1) se construyeron por amplificación por RT-PCR de segmentos individuales de ARN viral y clonación de los ADNc resultantes en el vector pHW2000 (Hoffmann et al., 2000, Proc. Natl. Acad. Sci. USA 97:6108-6113). Las secuencias de inserto para pHW- Sw-PB2, pHW-Sw-PBl, pHW-Sw-PA, pHW-Sw-HA, pHW-Sw-NP, pHW-Sw-NA, pHW-Sw-M y pHW-Sw-NS se proporcionan en las SEC ID Nº 1-8, respectivamente. En este sistema, se inserta el ADNc viral de gripe entre las secuencias promotoras y terminadoras de la ARN polimerasa I (polI). Esta unidad completa de transcripción de ARN poll está flanqueada por un promotor de ARN polimerasa II (polII) y un sitio de poliadenilación. La orientación de los dos promotores permite la síntesis de ARN viral con sentido negativo y ARNm con sentido positivo de un molde de ADNc viral. pHW-Sw-NS-73, pHW-Sw-NS-99 y pHW-Sw-NS-126 son derivados de pHW-Sw-NS. Estos plásmidos mutantes de NS1 se contruyeron mediante ligamiento trimolecular: Se ligaron dos productos de PCR en pHW2000- Sw-NS digerido con Sall/NgolV.

El primer producto de PCR era común a los tres plásmidos mutantes de NS1, y se obtuvo usando oligo pHW-3' (inverso, hibridación en la estructura del plásmido pHW2000) GGGTCAAGGAAGGCACGGGGGAGGGGC (SEC ID Nº 9) y oligo 5'NS-PacI (directo, hibridación en el gen NS1) GCGCTTAATTAAGAGGGAGCAATCGTTGGAG (SEC ID Nº 10) y pHW2000-Sw-NS como molde. Este producto de PCR se digirió con NgoIV y PacI.

El segundo producto de PCR fue específico para cada plásmido mutante de NS1, y se obtuvo usando: un cebador directo común, CMV5' (hibridación en el promotor CMV del plásmido pHW2000) GCCCCATTGACGCAAATGGGCGGTAGGCGTG (SEC ID Nº 11), y un cebador inverso específico (hibridación en el gen NS1): NS73-BglII-PacI-3' GCGCTTAATTAATCAAGATCTAGGATTCCTCTTTCAAAATCC (SEC ID Nº 12), NS99-BglII-PacI-3' GCTTAATTAATCAAGATCTATGACATTTCCTCGAGGGTCATG (SEC ID Nº 13) o NS126-BglII- PacI-3' GCGCTTAATTAATCAAGATCTACTTTTCCATGATCGCCTGGTCC (SEC ID Nº 14). Los tres correspondientes productos de PCR se digirieron con SalI y PacI, y se usaron en ligamiento trimolecular junto con el primer producto de PCR digerido con PacI/NgoIV y pHW2000-Sw-NS digerido con Sall/NgolV, para generar: pHW- Sw-Tx-73, pHW-Sw-Tx-99 y pHW-Sw-Tx-126. Estas construcciones contienen una deleción en la secuencia NS1, más la inserción de 4 codones de parada en las 3 fases después de esta deleción. Véase la Figura 1A. Aunque la ORF de la proteína de exportación nuclear (NEP) no está alterada en estas construcciones, la ORF de NS1 codifica solamente los primeros 73, 99 y 126 aminoácidos de la proteína NS1 de tipo silvestre (la longitud total de NS1 de tipo silvestre es 219 aminoácidos), respectivamente.

Las cepas virales se describen a continuación: Sw/TX/98 wt: contiene el gen de NS1 de tipo silvestre y representa un virus de la gripe porcina de triple- redistribución H3N2.

Sw/TX/98/del126: expresa los 126 aminoácidos N-terminales de la proteína NS1 de tipo silvestre.

Sw/TX/98/del99: expresa los 99 aminoácidos N-terminales de la proteína NS1 de tipo silvestre.

Sw/TX/98/del73: expresa los 72 aminoácidos N-terminal de la proteína NS1 de tipo silvestre.

Recuperación mediada por transfección de SIV recombinante. El rescate de virus de la gripe a partir del ADN plasmídico se realizó como se describe en Fodor et al. (1999, J Virol 73:9679-82) y Neumann et al. (1999, Proc Natl Acad Sci USA 96:9345-50) usando un sistema de ocho plásmidos (Hoffmann et al., 2000, Proc.Natl. Acad. Sci. USA 97:6108-6113). Para generar el virus de tipo silvestre (rWT) TX/98 recombinante se transfectaron 0,5 g de cada uno de los 8 plásmidos pHW en 106 células 293T en suspensión usando el reactivo Lipofectamina 2000 (Invitrogen). Los virus mutantes truncados de NS1 se generaron del mismo modo pero sustituyendo el plásmido pHW-Sw-NS por el correspondiente mutante para recuperar los mutantes de virus del73, del99 o del126. Los virus resultantes se pasaron y clonaron por purificación de placas en células MDCK. Se cultivaron soluciones madre de virus en huevos embrionados de gallina de 7 días de vida. La identidad de los virus recombinantes SIV se verificó por análisis electroforéticos en gel de los productos de RT-PCR derivados del ARN viral usando oligonucleótidos específicos para las regiones no codificantes comunes. El gen NS de tipo silvestre o las versiones delecionadas se confirmaron adicionalmente por secuenciación.

Resultados. Para generar SIV usando genética inversa, se clonaron los ocho ARN virales del virus Tx/98 en plásmidos de expresión antisentido para rescate viral (Hoffmann et al., 2000, Proc. Natl. Acad. Sci. USA 97:6108- 6113). Tras la transfección de estos plásmidos en células 293T, se recuperaron los virus infecciosos. Los SIV precursores (WT) y de tipo silvestre derivados de plásmido (rWT) crecieron hasta títulos similares en células MDCK y huevos embrionados. Cuando se inocularon en cerdos, el virus rWT produjo lesiones similares que el virus WT precursor. Se generaron tres mutantes SIV de NS1-truncada que codificaban proteínas NS1 de 73, 99 y 126 aminoácidos, en comparación con la proteína NS1 de longitud completa, de 219 aminoácidos de longitud (Fig. 1A). Análisis de RT-PCR y secuenciación confirmaron la presencia de los genes NS1 truncados en las preparaciones de virus rescatados (Fig. 1B).

6.2 Ejemplo 2; Caracterización de los mutantes de deleción de NS1 del virus de la gripe porcina y

A/Porcino/Texas/4199-2/98 de tipo silvestre

Para caracterizar el impacto de la deleción del gen de NS1 sobre las propiedades de replicación del virus de la gripe porcina, se comparó el crecimiento del tipo silvestre y los diferentes mutantes de deleción descritos en la Sección 6,1. Además, se comparó el efecto de estos mutantes sobre la producción de IFN.

Curvas de crecimiento de virus. Para analizar la replicación viral, se infectaron células PK-15 confluyentes a la multiplicidad de infección (MOI) indicada y se incubaron durante diferentes periodos de tiempo a 37ºC en MEM que contenía albúmina bovina al 0,3% (MEM/BA) y fluido alantoideo al 5%. Los títulos de virus se determinaron por ensayo de placa en células MDCK en MEM/BA suplementado con 1 g/ml de TPCK tripsina. Los títulos se expresaron como unidades formadoras de placas (UFP) por ml.

Para investigar las propiedades de crecimiento multiciclo de los virus mutantes de NS1 se infectaron células epiteliales de cerdo (PK-15) confluyentes a una MOI baja (MOI=0,001). Se titularon los sobrenadantes de las células infectadas en diferentes puntos temporales post-infección por ensayo de placa en células MDCK. La cinética de crecimiento de los mutantes de deleción de NS1 en células PK-15 fue claramente diferente en comparación con el virus de tipo silvestre. De forma interesante, el virus mutante 1-126 fue el más comprometido en el crecimiento, seguido de los mutantes 1-99 y 1-73 (Fig. 2A). Los tamaños de placa en células MDCK se correlacionaron con las diferencias de crecimiento en células PK-15 (Fig. 2C). Estos resultados indican que deleciones en la proteína NS1 del virus Sw/TX/98 provocan atenuación del crecimiento viral, tanto en células PK-15 como en células MDCK. En contraste, cuando se cultivaban virus mutantes de NS1 a una MOI alta (MOI=2) en células PK-15 no se detectaban diferencias importantes en la cinética de crecimiento (Fig. 2B). Esto muy probablemente indica que la replicación viral de los virus mutantes de NS1 no está restringida durante el primer ciclo de replicación, lo que sugiere que las células infectadas secretan citoquinas antivirales, tales como IFN, que inhiben las posteriores rondas de replicación.

Marcaje metabólico. Células PK-15 confluyentes sembradas en placas de 22-mm se infectaron de forma simulada o se infectaron con virus rWT, 1-73,1-99 o 1-126 a una MOI de 2. Las células se incubaron en MEM/BA a 37ºC durante diversos puntos temporales, y posteriormente se marcaron durante 2 h con 10 Ci de [3SS]Met-Cys en MEM que carecía de Met-Cys. Las células se lavaron con solución salina tamponada con fosfato (PBS) enfriada en hielo, se lisaron y se separaron los extractos celulares totales por electroforesis en gel dodecil sulfato sódico-poliacrilamida (SDS-PAGE). Las proteínas se visualizaron por autorradiografía.

El marcaje metabólico de células PK infectadas con virus (MOI=2) con [35S]-Met-Cys, no reveló diferencias en la cinética de la síntesis de proteína NP entre los virus rWT y mutantes 1-73,1-99 y 1-126 (Fig. 2D). Las proteínas mutantes NS1 no pudieron detectarse por marcaje.

Bioensayo para medir la producción de IFN. Se determinaron los niveles de IFN secretada por células infectadas con virus como se ha descrito previamente (Park et al., 2003, J. Virol. 70:9522-9532; Donelan, 2003, J Virol 77:13257-66), con algunas variaciones. Se trataron de forma simulada o se infectaron células PK-15 confluyentes sembradas en placas de 22-mm con virus rWT, del73, del99 o del126 a una MOI de 2. Después de la infección, las células se incubaron con MEM/BA que contenía fluido alantoideo al 5%, y en diferentes puntos temporales post- infección, se recogieron los sobrenadantes. Los virus presentes en el sobrenadante se inactivaron por UV colocando las muestras en hielo 15,24 cm debajo de una lámpara UV de 8-W (Fisher) durante 15 min con agitación constante. Se sembraron nuevas células PK-15 en placas de 96 pocillos el día antes y se incubaron con los sobrenadantes inactivados por UV durante 24 h. Después, las células PK-15 preincubadas se infectaron con VSV-GFP (MOI=0,1). Las células que expresaban GFP se visualizaron por microscopía de fluorescencia 16 horas post-infección.

Para ver si la atenuación observada del crecimiento in vitro de los virus de NS1-truncada estaba directamente correlacionado con la capacidad de estos virus de inhibir el sistema IFN-/, se investigó la inducción de IFN en células infectadas con los virus Sw/Tx/98 recombinantes. Se usaron sobrenadantes de células PK-15 infectadas para determinar los niveles de IFN-/ secretada usando un bioensayo basado en la inhibición de la replicación de VSV-GFP (Fig. 3A). Para este propósito, se infectaron células PK-15 (MOI=2) con SIV rWT y mutantes de NS1 y se recogieron los sobrenadantes para las determinaciones de IFN cada dos horas durante 10 h. Los resultados se muestran en la Fig. 3B. Los sobrenadantes de células infectadas de forma simulada no causaron inhibición de la expresión de GFP por VSV-GFP en células PK-15. En contraste, la replicación de VSV-GFP estuvo completamente anulada en células pretratadas con el sobrenadante de células infectadas con virus del 126 a las 10 h post-infección. No se detectó IFN-/ mediante este ensayo en los sobrenadantes de células infectadas con virus rWT. Todos los virus de NS1-truncada indujeron niveles detectables de IFN-/ en 6 h post-infección, siendo el virus 1-126 el inductor más potente de IFN-/, seguido de los virus del99 y del73. Se realizaron experimentos similares usando otras líneas celulares porcinas (ST) y humanas (A549) infectadas con virus con resultados básicamente idénticos.

Análisis de ARNm de lFN-y TNF-por RT-PCR. Se infectaron células PK-15 a una MOI de 2, y a las 24 horas post-infección, se extrajo el ARN total usando el kit Absolutely RNA RT-PCR Miniprep (Stratagene). Se realizó RT usando oligodT como cebador. La PCR se hizo usando pares de cebadores específicos para ARNm porcinos de IFN- (5-SWIFNB+ GGCCATGGCTAACAAGTGCATCC (SEC ID Nº 15), 3-SWIFNB- CCGGTCAGTTCCGGAGGTAATC (SEC ID Nº 16)) y TNF- (5'SW-TNFA ATGAGCACTGAGAGCATG (SEC ID Nº 17), 3'SW-TNFA TCACAGGGCAATGATCCC (SEC ID Nº 18)) (números de acceso a Genbank M86762 y X57321). Como control, se usaron cebadores específicos para -actina (Donelan, 2003 J Virol 77:13257-66) para amplificar un fragmento de 550-pb de -actina porcina. Los productos se secuenciaron y confirmaron como derivados de los ARNm esperados.

El análisis de RT-PCR de transcritos de IFN- y TNF- reveló la inducción de la expresión del ARNm de estas citoquinas en células PK-15 infectadas con virus mutantes de NS1, especialmente en células infectadas con virus 1- 126 (Fig. 3C). Estos datos indican que la potencia de inhibición de la producción de IFN por los virus Sw/Tx/98 recombinantes es del siguiente modo: rWT>del73>del99>del126.

6.3 Ejemplo 3: Patogénesis de virus mutantes/deleción TX/98 derivados de plásmido

La patogénesis de los virus de la gripe porcina específicos descritos en la Sección 6.1 se evaluó en cerdos. Se determinó la capacidad de Sw/Tx/98/del126, Sw/Tx/98/del99, y Sw/Tx/98/del73 de inducir lesiones pulmonares y causar infecciones en cerdos y se compararon con los resultados obtenidos para un virus simulado y el virus Sw/Tx/98 wt de tipo silvestre. Las lesiones pulmonares se evaluaron como el porcentaje de pulmón sano en que sucedieron lesiones usándose un promedio de siete lóbulos del pulmón para esta determinación. Se administraron los virus o el simulado como se describe en detalle a continuación y se obtuvieron frotis nasales o BALF durante la necropsia para determinar la carga de virus cinco días post-infección. Se realizó evaluación histopatológica. Se examinaron los cornetes nasales y la tráquea para cambios epiteliales e inflamación subepitelial. Los alvéolos también se evaluaron para cambios inflamatorios.

Este ejemplo demuestra que deleciones C-terminales del gen de NS1 provocan un fenotipo atenuado.

6.3.1 Métodos

Infección de cerdos. Se obtuvieron cerdos exogámicos libres de patógenos específicos de una granja porcina comercial en Iowa (EEUU). Se confirmó que los sueros de estos cerdos eran negativos para la presencia de anticuerpos de inhibición de la hemaglutinación (Palmer, 1975, (U.S. Department Of Health, Education, and Welfare, Washington, D.C.), pág. 51-52) contra SIV H3N2 (Sw/TX/98 y Sw/CO/99) y H1N1 (Sw/IA/30). Se alojaron grupos de cuatro a cinco cerdos en salas de aislamiento separadas. A la edad de 4 semanas, se anestesió a los cerdos por inyección intramuscular con una mezcla de ketamina, xilazina, zolazepam y tiletamina (Mengeling, 1996, Am J Vet Res 57:834-839) antes de inocularse por vía intratraqueal (mediante laringoscopio y tubo traqueal) con 1 ml de solución de virus que contenía 1 x 105 UFP. Durante 5 días, se controló a los cerdos para signos clínicos incluyendo letargia, anorexia, tos, hiperpnea/dispnea, descarga nasal y ocular y se registró su temperatura corporal diariamente. En el día 5, se sacrificó a los animales por administración intravenosa de pentobarbital (Fort Dodge Animal Health, Fort Dodge, EEUU), y se retiraron sus pulmones en su totalidad. El porcentaje de la superficie de cada lóbulo pulmonar es estaba afectado por lesiones macroscópicas se estimó visualmente. Los porcentajes se promediaron para obtener un valor medio para los 7 lóbulos pulmonares de cada animal. Se retiraron los cornetes nasales, la tráquea, y el lóbulo cardiaco derecho y se fijaron en formalina para evaluación histopatológica adicional. También se recogió sangre, fluido bronco-alveolar (BALF) y frotis nasales durante la necropsia. El BALF se obtuvo después de retirar los pulmones de la cavidad torácica aclarando los pulmones (mediante la tráquea) con aprox. 30 ml de medio de McCoy sin suero. Todos los experimentos en animales fueron en cumplimiento con el Institutional Animal Care and Use Committee of the National Animal Disease Center.

Observación clínica y muestreo. Durante 5 días, se controló a los cerdos para signos clínicos incluyendo letargia, anorexia, tos, hiperpnea/dispnea, descarga nasal y ocular y se registró su temperatura corporal diariamente. Se recogió sangre, BALF, y frotis nasales durante la necropsia. El BALF se obtuvo después de retirar los pulmones de la cavidad torácica aclarando los pulmones (mediante la tráquea) con aprox. 30 ml de medio de McCoy sin suero. Se ensayaron los frotis nasales y el BALF para determinar la carga de virus.

Titulaciones de virus de frotis nasales y BALF. Se ensayaron los frotis nasales y BALF para determinar la carga de virus. Se prepararon diluciones en serie de factor diez en medio de McCoy sin suero, suplementado con 5 g/ml de tripsina. Se inocularon células MDCK con las diluciones y se incubaron con medio más tripsina en placas de microtitulación a 37ºC durante 72 h. Las placas se examinaron para los efectos citopáticos después de 72 horas. Los títulos de virus se calcularon por el método de Reed y Muench (Reed, 1938, Am J Hyg 27:493-497).

Evaluación histopatológica: Se tiñeron los cornetes nasales y la tráquea con hematoxilina y eosina y se examinaron en el microscopio para cambios epiteliales e inflamación subepitelial. Los pulmones se examinaron para cambios epiteliales bronquiolares e inflamación peribronquiolar en bronquiolos grandes, medianos, y pequeños o terminales. También se evaluaron los alvéolos para cambios inflamatorios. Como las lesiones se encontraron de forma más consistente en vías aéreas de tamaño medio, se usaron los datos obtenidos de los bronquiolos medianos para las comparaciones. Los bronquiolos medianos se clasificaron en una escala de 0 a 3+ del siguiente modo: 0 (normal: revestido por células epiteliales columnares medianas a altas con límites apicales ciliados y núcleos pseudoestratificados basales; inflamación mínima); 1+ (capa epitelial columnar e incluso en contorno con proliferación ligeramente aumentada; cilios aún visibles en muchas células); 2+ (cambios prominentes en la capa epitelial que varían desde atenuación a marcada proliferación; células desorganizadas y contorno de capa irregular en el límite luminal); 3+ (capa epitelial marcadamente alterada y desorganizada con células necróticas visibles en el lumen; algunos bronquiolos atenuados y otros en marcada proliferación reactiva).

La tráquea se clasificó en una escala de 0 a 2,5+ del siguiente modo: 0 (normal: revestida por células epiteliales columnares medianas a altas con límite apical ciliado, núcleos basales y pseudoestratificados. Citoplasma evidente entre el límite apical y el núcleo. Pequeño foco ocasional con células escamosas); 1+ (metaplasia escamosa focal de la capa epitelial); 2+ (metaplasia escamosa difusa de gran parte de la capa epitelial, los cilios pueden ser evidentes de forma focal); 2,5+ (metaplasia escamosa difusa con muy pocos cilios evidentes).

La inmunohistoquímica del SIV se realizó usando un anticuerpo monoclonal específico para NP HB65 (American Type Culture Collection, Manassas, Virginia). El anticuerpo se produjo en forma de fluido ascítico de ratón. Se usó una dilución de 1/1000 de HB65 para la inmunohistoquímica. El ensayo se realizó usando el sistema Dako Envision IHC. La tinción se clasificó de 0 a 3+ del siguiente modo: 0 (sin células infectadas); 0,5+ (pocas células infectadas); 1+ (pocas células infectadas, como células individuales ampliamente separadas); 1,5+ (pocas células infectadas, en forma individual ampliamente separadas y en pequeños grupos); 2+ (cantidades moderadas de células infectadas, que afectan habitualmente a grupos de células adyacentes en partes de la capa epitelial que reviste los bronquiolos, o en pequeños focos sublobulares en los alvéolos); 3+ (numerosas células infectadas, que afectan a la mayor parte de la capa epitelial en los bronquiolos, o extendidas en focos sublobulares grandes en los alvéolos).

Análisis estadístico. Se compararon las temperaturas corporales medias, el grado de cambios grandes e histopatológicos, y la replicación viral en grupos infectados y de control usando el ensayo t de Student bilateral. Se consideró que valores de probabilidad (P) <0,05 indican una diferencia estadísticamente significatica entre grupos.

6.3.2 Resultados

Se adquirieron cuarenta y siete cerdos exogámicos de 4 semanas de edad de una granja porcina comercial en Iowa. Se infectaron por vía intratraqueal grupos de 10 cerdos con 105 ufp de virus rWT y Sw/TX/98 mutantes de NS1. Se infectaron de forma simulada siete animales con medio solamente. La temperatura rectal media de cada grupo infectado aumentó hasta ≥40 ºC 1 a 3 días p.i. en las cohortes infectadas con virus rWT, 1-73 y 1-99 (datos no mostrados). No todos los animales infectados con el mutante de deleción de NS1 1-126 mostraron temperatura aumentada. Los signos clínicos, que comprendían dificultad respiratoria, secreción nasal, conjuntivitis, y tos comenzaron en los días 2 a 4 p.i. en el grupo infectado con virus rWT. La prevalencia de los signos clínicos difirió entre los virus respectivos. La mayoría de los signos clínicos se observaron de forma constante en los grupos infectados con el virus rWT mientras que algunos signos se observaron en las cohores infectadas con virus 1-99 y 1- 73. Se observó solamente temperatura elevada pero ningún otro signo clínico en los cerdos infectados con virus 1- 126.

Durante la necropsia en el día 5 p.i., se estimó el porcentaje de cada superficie pulmonar con lesiones macroscópicas. Como se muestra en la Fig. 4A, los animales de control infectados de forma simulada no tenían lesiones pulmonares macroscópicas. Los cerdos infectados con el virus rWT Sw/Tx/98 mostraron porcentaje significativamente mayor de lesiones pulmonares macroscópicas que cerdos infectados con los virus mutantes de deleción de NS1 1-99 (p=0,006) o 1-126 (p=0,004). Los cerdos infectados con el virus mutante de deleción de NS1 1-73 presentaron lesiones menos graves, sin embargo, esto no fue estadísticamente significativo (p>0,05). En general, las lesiones grandes observadas eran áreas marcadas consolidadas, de color ciruela, en lóbulos individuales. Los lóbulos diafragmáticos estaban menos implicados que los otros lóbulos. Los ganglios linfáticos mediastinales estaban habitualmente hiperémicos y agrandados.

Los bronquiolos medianos se examinaron microscópicamente en secciones tisulares del lóbulo pulmonar cardiaco derecho de cerdos infectados de 4 semanas de edad y se valoraron histopatológicamente (Fig. 4B). Los animales infectados de forma simulada así como los cerdos infectados con virus 1-126, mostraron ausencia de lesiones o lesiones mínimas, mientras que se detectaron lesiones de moderadas a graves en animales infectado con los virus rWT y Sw/TX/98 1-99 y 1-73 (Fig. 5A-D y 6A-D). Todos los animales infectado con el tipo silvestre precursor y algunos infectados con los virus 1-73 y 1-99 obtuvieron altos valores que reflejan alteración de la capa celular epitelial bronquial (caracterizada por necrosis epitelial aguda o posterior atenuación o proliferación reactiva). La mayoría de los animales infectados con virus 1-73 o 1-99 obtuvieron un valor moderado que refleja proliferación ligeramente aumentada de la capa epitelial bronquial. Los pulmones de animales infectados con el virus mutante de deleción de NS1 1-126 estaban casi desprovistos de lesiones. Como en las lesiones pulmonares macroscópicas, los cerdos infectados con 1-126 y 1-99 mostraron daño significativamente menor que cerdos infectados con rWT (1-126: p<0,0001; 1-99: p=0,0002). De forma interesante, las lesiones microscópicas en los bronquiolos de cerdos infectados con el virus mutante 1-73 también fueron significativamente menores en comparación con el virus rWT precursor (p=0,02).

También se analizaron los títulos de virus en el BALF en el día 5 p.i. Como se muestra en la Fig. 4C, todos los virus se replicaron en el tracto respiratorio de los cerdos. Los títulos de virus en BALF fueron significativamente mayores en animales infectados con virus rWT precursor en comparación con los mutantes de deleción de NS1. Este hallazgo se correlaciona con enfermedad grande y microscópica significativamente menos extensiva observada en cerdos infectados con mutantes de deleción de NS1 frente a virus Sw/Tx/98 de tipo silvestre.

6.4 Ejemplo 4: Uso de TX/98/del 126 como vacuna

Se ensayó la eficacia del mutante de deleción TX/98/del 126 atenuado en un estudio de vacunación de cerdos. Los experimentos se realizaron como se ha descrito en el Ejemplo 3, excepto que la vacunación con TX/98/del 126 se realizó dos veces en los días 0 y 21 con 1 x 105 UFP por cerdo por inoculación intratraqueal. La vacunación y exposición se hizo por inoculación intratraqueal (usando 1 ml de solución de virus/o medio como control). Los animales se expusieron 9 días o 10 días después con las siguientes preparaciones: ● 2x105 UFP por cerdo con virus H3N2 de tipo silvestre (A/Porcino/Texas/4199-2/98-exposición homóloga) ● 2x105 UFP por cerdo con virus H1N1 de tipo silvestre (A/Porcino/MN/37866/99 clásico H1N1-exposición heteróloga) ● Exposición simulada con 1 ml de medio Para la evaluación histopatológica, se tiñó el lóbulo cardiaco derecho de cada pulmón con hematoxilina y eosina y se examinó para cambios epiteliales bronquiolares e inflamación peribronquiolar en bronquiolos grandes, medianos, y pequeños o terminales. Como las lesiones se encontraron de forma más consistente en vías aéreas de tamaño medio, se usaron los datos obtenidos de los bronquiolos medianos para las comparaciones. Se valoró la gravedad de las lesiones mediante la distribución o grado de lesiones dentro de las secciones examinadas del siguiente modo: 0 - Ninguna vía aérea afectada; 1 - solamente unas pocas vías aéreas aisladas afectadas; 2 - grupo localizado de vías aéreas afectadas, a menudo dentro de uno o dos lóbulos; 3 - baja cantidad de vías aéreas afectadas pero por toda la mayoría de la sección; 4 - muchas vías aéreas afectadas, a menudo de forma grave, de todos los tamaños.

Se utilizó un examinador capacitado para la evaluación de las secciones tisulares. El examinador no era consciente del grupo de animales del que derivaban los tejidos.

La inmmunohistoquímica se hizo usando un anticuerpo monoclonal específico para la nucleoproteína de gripe. El valor de antígeno fue del siguiente modo: 0 = Ninguna célula positiva a antígeno. 1 = Solamente unas pocas células con tinción positiva en una vía aérea ocasional. 2 = Solamente unas pocas células con tinción positiva en vías aéreas dispersas que pueden estar localizadas.

3 = Cantidades moderadas de células con tinción positiva en una vía aérea ocasional. 4 = Cantidades moderadas de células con tinción positiva en vías aéreas y alvéolos dispersos.

El lavado pulmonar se ensayó para determinar la carga de virus. Se prepararon diluciones en serie de factor diez en medio de McCoy sin suero, suplementado con 5 g/ml de tripsina. Se inocularon células MDCK con las diluciones y se incubaron con medio más tripsina en placas de microtitulación a 37ºC durante 72 h. Las placas se examinaron para los efectos citopáticos después de 72 horas. Los títulos de virus se calcularon por el método de Reed y Muench.

Resultados. Se obtuvieron los siguientes resultados 5 días después de la exposición: 1. Cerdos no vacunados, no expuestos no tuvieron ningún cambio histopatológico y no albergaban antígeno de virus de la gripe en sus tejidos pulmonares (Fig. 7 y 8). No estaba presente el virus infeccioso o por debajo de los límites de detección (Fig. 9).

2. Cerdos no vacunados expuestos con virus H3N2 TX/98 de tipo silvestre mostraron daño histopatológico significativo y antígeno de virus de la gripe en sus tejidos pulmonares (Fig. 7 y 8). Los títulos de virus en el lavado pulmonar eran ≥106,25 DICT50/ml.

3. Cerdos no vacunados expuestos con virus H1N1 MN/99 de tipo silvestre mostraron daño histopatológico significativo y antígeno de virus de la gripe en sus tejidos pulmonares (Fig. 7 y 8). Los títulos de virus en el lavado pulmonar fueron ≥106,0 DICT50/ml.

4. Cerdos vacunaos, expuestos de forma simulada no tuvieron ningún cambio histopatológico y no albergaban antígeno de virus de la gripe en sus tejidos pulmonares (Fig. 7 y 8). No estaba presente el virus infeccioso o por debajo de los límites de detección (Fig. 9).

5. Cerdos vacunados, expuestos con H3N2 no tuvieron ningún cambio histopatológico y no albergaban antígeno de virus de la gripe en sus tejidos pulmonares (Fig. 7 y 8). No estaba presente el virus infeccioso o por debajo de los límites de detección (Fig. 9).

6. Cerdos vacunados, expuestos con H1N1 tuvieron significativamente menos cambios histopatológicos en sus tejidos pulmonares en comparación con cerdos no vacunados, expuestos con H1N1 (p<0,001). Estos cerdos no albergaban antígeno de virus de la gripe en sus tejidos pulmonares (Fig. 7 y 8). Había significativamente menos virus infeccioso (p<0,001) presente en el lavado pulmonar en comparación con los animales no vacunados, expuestos con H1N1 (Fig. 9).

En resumen, la vacunación de cerdos con el mutante TX/98/del 126 atenuado produjo inmunidad protectora contra exposición con un aislado de virus homólog (exposición con virus H3N2 A/Porcino/Texas/4199-2/98). Cuando los cerdos vacunados se exponían con un virus que pertenece a un subtipo diferente de gripe (exposición con virus H1N1 A/Porcino/MN/37866/99), esta exposición con virus heterólogo produjo significativamente menos lesiones en tejidos pulmonares y varga de virus en lavado pulmonar en comparación con los contoles no vacunados en el día 5 post-inoculación.

Estos datos indican que el mutante TX/98/del 126 atenuado tiene utilidad como vacuna de virus vivo modificado que muestra inmunidad protectora contra exposición homóloga/homotípica y considerable protección contra exposición heteróloga/heterotípica.

Lista de secuencias

<110> Mount Sinai School of Medicine of New York University St. Jude Children's Research Hospital The United States of America as represented by the Secretary of Agriculture <120> Virus de la gripe porcina modificado por ingeniería genética y usos de los mismos <130> 6923-116-228 <150> 60/576,418 <151> 2004-06-01 <160> 18 <170> FastSEQ para Windows Version 4.0 <210> 1 <211> 2318 <212> DNA <213> Secuencia Artificial <220> <223> inserto plasmídico PB2 <400> 1 <210> 2<211> 2348<212> DNA <213> Secuencia Artificial <220> <223> inserto plasmídico PB1 <400> 2 <210> 3 <211> 2240 <212> DNA <213> Secuencia Artificial <220> <223> inserto plasmídico PA <400> 3 <210> 4 <211> 1769 <212> DNA <213> Secuencia Artificial <220> <223> inserto plasmídico HA <400> 4 <210> 5 <211> 1572 <212> DNA <213> Secuencia Artificial <220> <223> inserto plasmídico NP <400> 5 <210> 6 <211> 1453 <212> DNA <213> Secuencia Artificial <220> <223> inserto plasmídico NA <400> 6 <210> 7 <211> 1032 <212> DNA <213> Secuencia Artificial <220> <223> inserto plasmídico M <400> 7 <210> 8 <211> 873 <212> DNA <213> Secuencia Artificial <220> <223> NS <400> 8 <210> 9 <211> 27 <212> DNA <213> Secuencia Artificial <220> <223> oligo pHW-3' (inverso) para hibridación en la estructura del plásmido pHW2000 <400> 9 gggtcaagga aggcacgggg gaggggc 27 <210> 10 <211> 31 <212> DNA <213> Secuencia Artificial <220> <223> oligo 5'NS-PacI para hibridación en el gen NS1 <400> 10 gcgcttaatt aagagggagc aatcgttgga g 31 <210> 11 <211> 31 <212> DNA <213> Secuencia Artificial <220> <223> cebador CMV5' que se hibrida en el promotor de CMV del plásmido pHW2000 <400> 11 gccccattga cgcaaatggg cggtaggcgt g 31 <210> 12 <211> 42 <212> DNA <213> Secuencia Artificial <220> <223> cebador inverso NS73- BglII-PacI-3' que se hibrida en el gen NS1 <400> 12 gcgcttaatt aatcaagatc taggattcct ctttcaaaat cc 42 <210> 13<211> 42<212> DNA <213> Secuencia Artificial <220> <223> cebador NS99-BglII-PacI-3' <400> 13 gcttaattaa tcaagatcta tgacatttcc tcgagggtca tg 42 <210> 14 <211> 44 <212> DNA <213> Secuencia Artificial <220> <223> cebador NS126-BglII-PacI-3' <400> 14 gcgcttaatt aatcaagatc tacttttcca tgatcgcctg gtcc 44 <210> 15 <211> 23 <212> DNA <213> Secuencia Artificial <220> <223> cebador específico 5-SWIFNB+ para IFN-beta porcino <400> 15 ggccatggct aacaagtgca tcc 23 <210> 16 <211> 22 <212> DNA <213> Secuencia Artificial <220> <223> cebador específico 3-SWIFNB- para IFN-beta porcino <400> 16 ccggtcagtt ccggaggtaa tc 22 <210> 17 <211> 18 <212> DNA <213> Secuencia Artificial <220> <223> cebador 5'SW-TNFA para NF-a (véase acceso a Genbank Nº M86762) <400> 17 atgagcactg agagcatg 18 <210> 18 <211> 18 <212> DNA <213> Secuencia Artificial <220> <223> cebador 3'SW-TNFA (véase acceso a Genbank Nº X57321) <400> 18 tcacagggca atgatccc 18

REIVINDICACIONES

1. Un virus de la gripe porcina atenuado modificado por ingeniería genética que tiene un fenotipo antagonista de interferón alterado, en donde dicho virus comprende un gen de NS1 de virus de la gripe porcina A/Porcino/Texas/4199-2/98 con una mutación que produce una proteína NS1 con una deleción de todos los restos de aminoácido de NS1 excepto los restos de aminoácido 1-126, en donde el aminoácido amino-terminal es el número 1 y la mutación en el gen de NS1 confiere un fenotipo antagonista de interferón alterado.

2. El virus de la gripe porcina atenuado, modificado por ingeniería genética, de la reivindicación 1, en donde el virus atenuado es una redistribución.

3. El virus de la gripe porcina atenuado modificado por ingeniería genética de una cualquiera de las reivindicaciones 1 a 2, en donde el virus atenuado es un virus quimérico que expresa una secuencia heteróloga.

4. El virus de la gripe porcina atenuado, modificado por ingeniería genética, de una cualquiera de las reivindicaciones 1 a 3, en donde el virus atenuado es un virus quimérico que expresa un epítopo de un patógeno foráneo.

5. El virus de la gripe porcina atenuado modificado por ingeniería genética de una cualquiera de las reivindicaciones 1 a 4, en donde el virus atenuado está modificado para codificar un epítopo de otro virus o al menos un segmento derivado de un virus diferente.

6. El virus de la gripe porcina atenuado, modificado por ingeniería genética, de una cualquiera de las reivindicaciones 1 a 5, en donde el virus atenuado es un virus quimérico que expresa un antígeno tumoral.

7. Una formulación inmunogénica que comprende el virus de la gripe porcina atenuado, modificado por ingeniería genética, de una cualquiera de las reivindicaciones precedentes, y un excipiente fisiológicamente aceptable.

8. La formulación inmunogénica de la reivindicación 7, en donde la concentración de virus de la gripe porcina atenuado modificado por ingeniería genética en la formulación inmunogénica es de aproximadamente 104 a aproximadamente 107 ufp/ml.

9. Una formulación farmacéutica que comprende el virus de la gripe porcina atenuado, modificado por ingeniería genética, de una cualquiera de las reivindicaciones 1 a 6, y un vehículo farmacéuticamente aceptable.

10. La formulación farmacéutica de la reivindicación 9, en donde la concentración del virus de la gripe porcina atenuado modificado por ingeniería genética en la formulación farmacéutica es de aproximadamente 104 a aproximadamente 1012 ufp/ml.

11. Un virus de la gripe porcina atenuado, modificado por ingeniería genética, según una cualquiera de las reivindicaciones 1 a 6 para su uso en inmunización o inducción de una respuesta inmunitaria en un cerdo.

12. Un virus de la gripe porcina atenuado modificado por ingeniería genética según una cualquiera de las reivindicaciones 1 a 6 para su uso en la prevención de una afección o un síntoma asociado con infección por virus de la gripe porcina en un cerdo.

13. Un virus de la gripe porcina atenuado, modificado por ingeniería genética, según una cualquiera de las reivindicaciones 1 a 6 para su uso en el tratamiento de una infección por virus de la gripe porcina en un cerdo.

14. Una formulación inmunogénica según la reivindicación 7 u 8 para su uso en inmunización o inducción de una respuesta inmunitaria en un cerdo.

15. Una formulación farmacéutica según la reivindicación 9 o 10 para su uso en la prevención de una afección o un síntoma asociado con infección por virus de la gripe porcina en un cerdo.

16. Una formulación farmacéutica según la reivindicación 9 o 10 para su uso en el tratamiento de una infección por virus de la gripe porcina en un cerdo.

17. Uso de una cantidad eficaz de la formulación inmunogénica de la reivindicación 7 u 8 en la preparación de un medicamento para su uso en inmunización o inducción de una respuesta inmunitaria en un cerdo.

18. El uso de la reivindicación 17, en donde la concentración del virus de la gripe porcina atenuado, modificado por ingeniería genética, en la formulación inmunogénica es de aproximadamente 104 a aproximadamente 107 ufp/ml.

19. Uso de una cantidad eficaz del virus de la gripe porcina atenuado modificado por ingeniería genética de una cualquiera de las reivindicaciones 1 a 6 en la preparación de un medicamento para su uso en la prevención de una afección o un síntoma asociado con virus de la gripe porcina en un cerdo.

20. Uso de una cantidad eficaz del virus de la gripe porcina atenuado modificado por ingeniería genética de una cualquiera de las reivindicaciones 1 a 6 en la preparación de un medicamento para su uso en el tratamiento de una infección por virus de la gripe porcina en un cerdo.

21. El uso de la reivindicación 19 o 20, en donde la concentración del virus de la gripe porcina atenuado, modificado por ingeniería genética, es de aproximadamente 104 a aproximadamente 1012 ufp/ml.

22. Un método para la producción de una vacuna, una formulación inmunogénica, o una formulación farmacéutica que comprende: (a) propagar en un sustrato el virus de la gripe porcina atenuado, modificado por ingeniería genética, de una cualquiera de las reivindicaciones 1 a 6 y (b) recoger el virus descendiente, en donde el sustrato es una célula, línea celular o huevo embrionado.

23. El método de la reivindicación 22, en donde el sustrato es una célula de cerdo o línea celular de cerdo.

24. El método de la reivindicación 22, en donde el sustrato es un huevo embrionado o un huevo embrionado de gallina.

25. El método de la reivindicación 24, en donde el huevo embrionado es de 6, 7 u 8 días de vida.

26. El método de una cualquiera de las reivindicaciones 22 a 24, en donde el sustrato es deficiente en interferón.

27. Una célula cultivada que contiene el virus de la gripe porcina atenuado, modificado por ingeniería genética, de una cualquiera de las reivindicaciones 1 a 6.

28. La célula cultivada de la reivindicación 27, en donde la célula es una célula de cerdo o una línea celular de cerdo.

29. La célula cultivada de la reivindicación 28, en donde la línea celular de cerdo es células PK(D1), células PK( 15), células PK13, células SJPL, células NSK, células LLG-PK1, células LLC-PK1A, células ESK-4, células ST, células PT-K75 o células PK-2a/CL 13.

30. La célula cultivada de una cualquiera de las reivindicaciones 27 o 28, en donde la célula es deficiente en interferón.

31. Un huevo embrionado que contiene el virus de la gripe porcina atenuado modificado por ingeniería genética de una cualquiera de las reivindicaciones 1 a 6.

32. El huevo embrionado de la reivindicación 31 que es de gallina.

33. El huevo embrionado de la reivindicación 31 o 32, en donde el huevo embrionado es deficiente en interferón.

34. El huevo embrionado de una cualquiera de las reivindicaciones 31 a 33, en donde el huevo embrionado tiene 6, 7 u 8 días de vida.