Inventos patentados en España.

Inventos patentados en España.

Inventos patentados en España en los últimos 80 años. Clasificación Internacional de Patentes CIP 2013.

MUTANTES POR DELECIÓN DE GLICOSILTRANSFERASAS DE NEISSERIA PARA BIOSÍNTESIS DE OLIGOSACÁRIDOS Y GENES QUE LAS CODIFICAN.

Patente Europea. Resumen:

Un procedimiento de fabricar una estructura oligosacárida de Neisseria que comprende las etapas de delecionar un marco de lectura abierta que codifica una glicosiltransferasa de una cepa de Neisseria seleccionada de la lista que consiste en: LgtA

, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae la SEC ID Nº 3, LgtB, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae la SEC ID Nº 8, LgtC, , siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae de la SEC ID Nº 4, LgtD, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae de la SEC ID Nº 5 e LgtE, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae 6, y preparar la estructura oligosacárida alterada de Neisseria a partir de dicha cepa.

Solicitante: THE ROCKEFELLER UNIVERSITY.

Nacionalidad solicitante: Estados Unidos de América.

Dirección: 1230 YORK AVENUE NEW YORK, NEW YORK 10021-6399 ESTADOS UNIDOS DE AMERICA.

Inventor/es: Gotschlich,Emil C.

Fecha de Publicación de la Concesión: 2 de Enero de 2012.

Fecha Solicitud PCT: 25 de Septiembre de 1995.

Clasificación Internacional de Patentes: C07K14/22 (..de Neisseriaceae (F), p. ej. Acinetobacter [6]), C12P19/18 (.preparados por acción de una transferasa glicosílica, p. ej. alfa-, beta- o gamma-ciclodextrinas [3]), C12N9/10D, C12N9/10D1.

Clasificación PCT: C12N1/20 (.Bacterias; Sus medios de cultivo [3]), C12N5/10 (.Células modificadas por introducción de material genético extraño, p. ej. células transformadas por virus [5]), C12N15/54 (....Transferasas (2) [5]), C12N9/10 (.Transferasas (2.) (ribonucleasas 9/22) [3]), A61K39/095 (..Neisseria [3]), C12P19/18 (.preparados por acción de una transferasa glicosílica, p. ej. alfa-, beta- o gamma-ciclodextrinas [3]).

Clasificación antigua: C12N1/20 (.Bacterias; Sus medios de cultivo [3]), C12N5/10 (.Células modificadas por introducción de material genético extraño, p. ej. células transformadas por virus [5]), C12N15/54 (....Transferasas (2) [5]), C12N9/10 (.Transferasas (2.) (ribonucleasas 9/22) [3]), A61K39/095 (..Neisseria [3]), C12P19/18 (.preparados por acción de una transferasa glicosílica, p. ej. alfa-, beta- o gamma-ciclodextrinas [3]).

Países PCT: Austria, Bélgica, Suiza, Alemania, Dinamarca, España, Francia, Reino Unido, Grecia, Italia, Liechtensein, Luxemburgo, Países Bajos, Suecia, Mónaco, Portugal, Irlanda, Eslovenia, Lituania, Letonia.

Volver al resumen de la patente.

Descripción:

Mutantes por deleción de glicosiltransferasas de neisseria para biosíntesis de oligosacáridos y genes que las codifican Campo de la invención La presente invención se refiere a glicosiltransferasas útiles para la biosíntesis de oligosacáridos, genes que codifican dichas glicosiltransferasas y procedimientos recombinantes de producir las enzimas y los oligosacáridos producidos de este modo. Antecedentes de la invención Neisseria y Lipooligosacárido (LOS) Aunque las especies de Neisseria colonizan habitualmente muchos huéspedes mamíferos, los seres humanos son la única especie sujeta a enfermedad invasiva por miembros de esta especie. Neisseria meningitidis es el agente etiológico de septicemia y meningitis que se pueden producir de forma epidémica. Neisseria gonorrhoeae es el agente causal de gonorrea y sus múltiples complicaciones. Estos organismos, particularmente los gonococos, tienen una notable habilidad probada para variar el conjunto antigénico de las moléculas expuestas en su superficie, principalmente sus pilosidades adhesivas y proteínas relacionadas con la opacidad (opa). Las características principales de los mecanismos genéticos para la variación de las pilosidades (Meyer y col., 1982, Cell 30:45; Haas y Meyer, 1986, Cell 44:107; Koomey y col., 1987, Genetics 117:391; Swanson y Koomey, 1989, American Society for Microbiology, Washington, 743-761) y la expresión de la proteína opa ((Stem y col., 1986, Cell 47:61; Meyer et al., 1990, Ann. Rev. Microbiol. 44:451; Bhat y col., 1991, Molec. Microbiol. 5:1889) se conocen bien. Como otras bacterias gramnegativas, las especies de Neisseria portan LPS en la cubierta externa de sus membranas externas (Johnston y Gotschlich, 1974, J. Bactetiol. 119; 250). En contraste con las moléculas de LPS de alto peso molecular con repeticiones de cadenas O que se observan en muchas bacterias entéricas, el LPS de Neisseria ssp. tiene un tamaño modesto y, por tanto, a menudo se denomina lipooligosacárido o LOS. Aunque el tamaño molecular del LOS es similar al observado en los mutantes del LPS en bruto de Salmonella ssp, esta sustancia tiene una considerable diversidad antigénica. En el caso de los meningococos se ha desarrollado un esquema de tipado serológico que separa las cepas en 12 inmunotipos (Zollinger y Mandrell, 1977, Infect. Immun. 18:424; Zollinger y Mandrell, 1980, Infect. Immun. 28:451). Mediante los estudios de Jennings y col. (Jennings y col., 1983, Carbohyd. Res. 121:233; Michon y col., 1990, J. Biol. Chem. 265:7243; Gamian y col., 1992, J. Biol. Chem. 267:922; Pavliak y col., 1993, J. Biol. Chem. 268:14146) se ha conseguido una comprensión bastante completa de la estructura del LPS de los meningococos (revisado recientemente (Verheul y col., 1993, Microbiol. Rev. 57:34). En el caso de Neisseria gonorrhoeae, la variabilidad antigénica es tan pronunciada que ha sido difícil alcanzar un esquema de clasificación serológica. En parte esto se debe a la heterogeneidad del LOS sintetizado por una cepa concreta; las preparaciones de LOS con frecuencia contienen varias bandas muy próximas mediante SDS-PAGE (Mandrell y col., 1986, Infect. Immun. 54:63). Además, los estudios con anticuerpos monoclonales indican que los gonococos pueden cambiar las características serológicos del LOS que expresa y que esta variación antigénica se produce con una frecuencia de 10 -2 a 10 -3 , lo que indica que debe existir algún mecanismo genérico para alcanzar estas variaciones de frecuencia alta (Schneider y col., 1988, Infect. Immun. 56:942: Apicella y col., 1987, Infect. lmmun. 55:1755). Dada la heterogeneidad molecular y la variación antigénica del LOS producido por los gonococos, la determinación de la química estructural de este antígeno ha sido un problema difícil y sólo recientemente se ha dispuesto de información definitiva en base a análisis muy sofisticados (Yamasaki y col., 1991, Biochemistry 30:10566; Kerwood y col., 1992, Biochemistry 31:12760; John y col., 1991, J. Biol. Chem. 266:19303; Gibson y col., 1993, J. Bacteriol. 175:2702). Estos se resumen en la Figura 1. De interés concreto es la presencia del tetrasacárido Galß14GlcNAcß13Galß14Glcß14, que es un imitador perfecto de lacto-Nneotetraosa del esfingolípido praglobósido (Mandrell y col., 1988, J. Exp. Med. 168:107; Tsai y Civin, 1991, Infect. Immun. 59: 3604). En el LOS, este tetrasacárido con frecuencia lleva un residuo de N-acetil galactosamina GalNAcß13Galß14GlcNAcß13Galß14Glcß14) adicional e imita a los gangliósidos. En algunas cepas de gonococos se encuentra una cadena lateral alternativa que tiene la estructura Gal14Galß14Glcß14HepR (John y col., 1991, J. Biol. Chem. 266:19303). Esta es un imitador de la porción sacárida de los globo-glicolípidos (Mandrell, 1992, Infect. Immun. 60:3017) y es la estructura que normalmente se encuentra en el inmunotipo L1 de Neisseria meningitidis. Las moléculas de LOS tienen una serie de actividades biológicas. Son potentes moléculas endotóxicas que se cree que son la toxina responsable de la necrosis cortical suprarrenal que se observa en la enfermedad meningocócica grave. Sirven como antígeno diana para gran parte de la actividad bactericida presente en sueros de seres humanos normales o convalecientes (Rice y col., 1980, J. Immunol. 124:2105). Los gonococos poseen una actividad sialiltransferasa muy inusual que es capaz de usar CMP-NANA suministrado externamente y añadir ácido N-acetil-neuramínico al LOS sobre la superficie del organismo (Nairn y col., 1988, J. Gen. Microbiol. 134:3295; 2   Parsons y col., 1989, Microb. Pathog. 7:63; Mandrell y col., 1990, J. Exp. Med. 171:1649). Los meningococos de los grupos B y C tienen la capacidad de sintetizar CMP-NANA y con frecuencia sialinan su LOS sin requerir CMP-NANA exógeno (Mandrell et al., 1991, J. Bacteriol. 173: 2823). En la cepa 6275 de Neisseria meningitidis, inmunotipo L3, la unidad de ácido siálico está unida en 23 al residuo Gal terminal de la lacto-N-neotetraosa (Yamasaki y col., 1993, J. Bacteriol. 175:4565). Los niveles de CMP-NANA que se encuentran en varios ambientes del huésped son suficientes para soportar esta reacción (Apicella y col., 1990, J. Infect. Dis. 162:506). La sialización del LOS hace que los gonococos sean resistentes al efecto bactericida del suero dependiente de anticuerpos-complemento (Parsons y col., 1989, Microb. Pathog. 7:63). La resistencia no sólo es frente al efecto bactericida mediado por los anticuerpos frente al LOS, sino también a otros antígenos de superficie (Wetzler y col., 1992, Infect. Immun. 60:39). van Putten ha demostrado que la exposición de los gonococos a CMP-NANA reduce marcadamente su capacidad para invadir las células epiteliales en cultivo tisular (Van Putten, 1993, EMBO J. 12:4043). Estos hallazgos sugieren con certeza que la capacidad de los gonococos para variar la naturaleza química del LOS les proporciona la capacidad de lidiar con diferentes ambientes del huésped (Mandrell y Apicella, 1993, Immunobiology 187:382). Quizá más revelador es que se ha encontrado que la variación de LOS se selecciona in vivo en infecciones de seres humanos. Una variante A MS11mk de una cepa de gonococos de laboratorio bien caracterizada se usó para inocular voluntarios (Swanson y col., 1988. J. Exp. Med. 168:2121). En los dos individuos infectados durante un periodo de 4 a 6 días, la población de gonococos recuperada en su orina se desplazó de forma creciente hacia dos variantes que expresaban LOS antigénicamente diferentes (Schneider et al, 1991.J Exp Med. 174:1601. Un análisis estructural reveló que la variante inoculada A producía un LOS truncado que sólo contenían el grupo ß-lactosilo unido a HepI, mientras que una de las nuevas variantes (variante C) producía un LOS completo (Kerwood y col., 1992, Biochemistry 31:12760). Esto sugiere que es probable que la adición de azúcares adicionales GalNAcß13Galß14GlcNAcß13 esté bajo el control de un mecanismo de variación de la fase. Se dispone de poca información sobre la genética de la síntesis de LOS en Neisseria. Un avance importante ha sido la creación (Dudas y Apicella, 1988. Infect. Immun 56:499) y la caracterización bioquímica (John y col, 1991. J. Biol. Chem. 266:19303) de cinco mutantes de piocina de la cepa de gonococos 1291. Datos inmunológicos y bioquímicos sobre dubbed 1291a-e muestran que 1291a. 1291c.1291d y 1291e producen LOS con acortamiento secuencial de la cadena de lacto-N-neotetraosa, de los que el mutante 1291e carece de la sustitución de glucosa sobre la heptosa. La mutante 1291b sintetiza la estructura alternativa del LOS Gal14Gaß14Glc (véase la Figura 1). Ahora sólo se define la base genética de la mutante 1291e. Es una mutación de fosfoglucomutasa (pgm), que impide la síntesis de UDP-glucosa y, por tanto, la adición del primer residuo de la unidad de lacto-N- neotetraosa (Zhou y col. 1994, J. Biol. Chem. 269:11162: Sandlin y Stein, 1994, J. Bacterial.176:2930). También se ha demostrado que las mutantes gaIE de meningococos o gonococos producen LOS truncado de acuerdo con la incapacidad de sintetizar UDP-galactosa (Robertson y col., 1993, Molec. Microbiol. 8:891; Jennings et al., 1993, Molec. Microbiol. 10:361). Biosíntesis de oligosacáridos Los oligosacáridos son polímeros de un número variable de residuos, enlaces y subunidades. La subunidad básica es un monosacárido de hidrato de carbono o azúcar, tal como manosa, glucosa, galactosa, N-acetilglucosamina, Nacetilgalactosamina y similares. El número de posibles diferentes cadenas de oligosacáridos estereoisoméricos es enorme. Los oligosacáridos y polisacáridos desempeñan un papel importante en la función y actividad de las proteínas, ya que sirven como moduladores de la semivida y, en algunos casos, proporcionan estructura. Como se ha indicado anteriormente, los oligosacáridos son cruciales para la variabilidad antigénica y, por tanto, la evasión del sistema inmunitario, de Neisseria, especialmente gonococos. Se han desarrollado numerosas técnicas clásicas para la síntesis de hidratos de carbono, pero estas técnicas tienen la dificultad de requerir protección y desprotección selectivas. La síntesis orgánica de oligosacáridos se ve dificultada además por la labilidad de muchos enlaces glicosídicos, las dificultades para conseguir un acoplamiento regioselectivo del azúcar y, en general, los bajos rendimientos sintéticos. Para resumir, al contrario que la experiencia con la síntesis peptídica, la química orgánica sintética tradicional no puede proporcionar síntesis cuantitativa y fiable de incluso oligosacáridos bastante sencillos. Con el aislamiento de las glicosiltransferasas se ha producido avances recientes en la síntesis de oligosacáridos. Estas enzimas se pueden usar in vitro para preparar oligosacáridos y polisacáridos (véase, p. ej., Roth, patente de EE.UU. nº 5.180,674, concedida el 19 de enero de 1993). La aventaja de la biosíntesis con glicosiltransferasas es que los enlaces glicosídicos formados por las enzimas son altamente estereo y regioespecíficos. No obstante, cada enzima cataliza la unión de residuos de azúcar específicos a otras moléculas aceptoras específicas, por ejemplo un oligosacárido o lípido. Por tanto, la síntesis de un oligosacárido deseado puede estar limitada por la disponibilidad de las glicosiltransferasas (véase Roth, publicación de patente internacional nº WO 93/13198, publicada el 8 de julio 3   de 1993). Otro inconveniente de la biosíntesis es que las propias glicosiltransferasas normalmente están presentes en cantidades bastante bajas en las células. Es difícil obtener suficiente de la enzima para que sea practicable comercialmente. Por tanto, en la técnica existe una gran necesidad de glicosiltransferasas. Existe la necesidad adicional de genes que codifiquen dichas glicosiltransferasas para proporcionar una fuente ilimitada de glicosiltransferasas mediante tecnología recombinante. La mención de cualquier referencia en el presente documento no debe interpretarse como admisión de que dicha referencia está disponible como técnica anterior a la presente invención. Sumario de la invención La presente invención está dirigida a la reivindicación 1. De acuerdo con esto, en un aspecto, la divulgación está dirigida a un ácido nucleico purificado que puede hibridar en condiciones moderadamente estrictas a un ácido nucleico correspondiente al locus de LOS de Neisseria, por ejemplo un ácido nucleico que tiene una secuencia nucleotídica correspondiente o complementaria a la secuencia nucleotídica que se muestra en la Figura 2 (SEC ID Nº 1). Preferentemente, el ácido nucleico de la divulgación puede hibridar con una porción de la secuencia codificadora de un gen del locus de LOS, es decir una porción de la secuencia nucleotídica que se muestra en la Figura 2 (SEC ID Nº 1) que codifica una glicosiltransferasa funcionalmente activa. En realizaciones específicas, la invención se refiere a un ácido nucleico que tiene una secuencia nucleotídica correspondiente o complementaria a una porción de la secuencia nucleotídica que se muestra en la Figura 2 (SEC ID Nº 1) que codifica una glicosiltransferasa funcionalmente activa. En un aspecto adicional, el ácido nucleico una glicosiltransferasa funcionalmente activa. En un realización específica, la divulgación está dirigida a un ácido nucleico que tiene una secuencia nucleotídica correspondiente o complementaria a la secuencia nucleotídica que se muestra en la Figura 2 (SEC ID Nº 1). Las glicosiltransferasas funcionalmente activas de la divulgación se caracterizan porque catalizan una reacción seleccionada del grupo que consiste en: adición de Gal ß14 a GlcNAc o Glc; adición de GalNAc o GlcNAc ß13 a Gal; y adición de Gal 14 a Gal. El ácido nucleico de la divulgación codifica una glicosiltransferasa funcionalmente activa. No obstante, los ácidos nucleicos de la divulgación incluyen oligonucleótidos útiles como cebadores para la reacción en cadena de la polimerasa (PCR) o para sondas para detectar la presencia y el nivel de transcripción de un gen de glicosiltransferasa. En realizaciones específicas de la divulgación, ejemplos en el presente documento, el ácido nucleico codifica una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 3, SEC ID Nº 4. SEC ID Nº 5, SEC ID Nº 6 o SEC ID Nº 8. La divulgación además se refiere a un vector de expresión que comprende el ácido nucleico que codifica una glicosiltransferasa de la invención asociada operativamente con una secuencia control de la expresión. De acuerdo con esto, la divulgación se extiende a células huésped recombinantes transformadas con dicho vector de expresión. En otro aspecto, la divulgación está dirigida a un procedimiento para producir una glicosiltransferasa que comprende cultivar la célula huésped recombinante en condiciones que permitan la expresión de la glicosiltransferasa; y recuperar la glicosiltransferasa expresada. En un primer aspecto, la divulgación está dirigida a una glicosiltransferasa que tiene una secuencia de aminoácidos de, SEC ID Nº 3, SEC ID Nº 4, SEC ID Nº 5, SEC ID Nº 6 o SEC ID Nº 8, o un fragmento funcionalmente activo de la misma. La divulgación además contempla una composición que comprende una glicosiltransferasa conjugada a un soporte de fase sólida, en la que la glicosiltransferasa se selecciona del grupo que consiste en una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 3, o un fragmento funcionalmente activo de la misma, una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 8, o un fragmento funcionalmente activo de la misma; una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 4, o un fragmento funcionalmente activo de la misma; y una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 5, o un fragmento funcionalmente activo de la misma; y una glicosiltransferasa que tiene 4   una secuencia de aminoácidos de SEC ID Nº 6, o un fragmento funcionalmente activo de la misma. Habiendo proporcionado nuevas glicosiltransferasas y genes que las codifican, la divulgación proporciona además, de acuerdo con ello, procedimientos para preparar oligosacáridos, por ejemplo dos o más sacáridos. En realizaciones específicas, la divulgación se refiere a un procedimiento de añadir Gal-NAc o GlcNAc ß13 a Gal, que comprende poner en contacto una mezcla de reacción que comprende GalNAc o Glc-NAc activada con un resto aceptor que comprende un residuo Gal en presencia de la glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 3; un procedimiento para añadir Galß14 a GlcNAc o Glc, que comprende poner en contacto una mezcla de reacción que comprende una Gal activada con un resto aceptor que comprende un residuo GlcNAc o Glc en presencia de la glicosiltransferasa que tiene una secuencia de aminoácido de la SEC ID Nº 8; un procedimiento para añadir Gal 14 a Gal, que comprende poner en contacto una mezcla de reacción que comprende una Gal activada con un resto aceptor que comprende un residuo Gal en presencia de la glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 4; un procedimiento para añadir GalNAc o GlcNAc ß13 a Gal, que comprende poner en contacto una mezcla de reacción que comprende una GalNAc o GlcNAc activada con un resto aceptor que comprende un residuo Gal en presencia de la glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 5; un procedimiento para añadir Gal ß14 a GlcNAc o Glc, que comprende poner en contacto una mezcla de reacción que comprende una Gal activada con un resto aceptor que comprende un residuo GlcNAc o Glc en presencia de la glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 6. En una realización preferida de la divulgación, los oligosacáridos se preparan sobre un vehículo que es no tóxico para un mamífero, en particular un ser humano, tal como un alcohol isoprenoide o poliisoprenoide lipídico. Un ejemplo específico de dicho vehículo es fosfato de dolicol. En una realización específica de la divulgación, el oligosacárido está unido al vehículo a través de un enlace lábil, de modo que permita la eliminación química del oligosacárido del vehículo lipídico. Como alternativa, se pede usar una oligosacárido transferasa, por ejemplo para transferir el oligosacárido desde un vehículo lipídico a una proteína. En otra realización más de la divulgación, las glicosiltransferasas se pueden expresar en un sistema de expresión eucariota, para proporcionar la glicosilación de una proteína expresada en dicho sistema. Una ventaja importante de la presente divulgación es que proporciona la síntesis de antígenos oligosacáridos de Neisseria con independencia del lípido A, que es muy tóxico. El uso del LOS natural de Neisseria, aunque en teoría es deseable para preparación de vacunas, falla. La porción del lípido A de LOS es una potente endotoxina y muy tóxica. El tratamiento químico del LOS mediante, por ejemplo, hidrólisis, destruye la antigenicidad del oligosacárido, dejando un producto inútil. Por tanto, es altamente deseable disponer de una fuente de oligosacáridos de Neisseria unidos a lípidos no tóxicos para preparación de vacunas. Por tanto, la divulgación proporciona glicosiltransferasas y estrategias para preparar una serie de oligosacáridos. tales como, entre otros, Gal14Galß14Glc, Galß14GlcNAcß13Galß14Glc, y GalNAcß13Galß14GlcNAcß13Galß14Glc. De acuerdo con esto, es un objeto principal de la invención proporcionar glicosiltransferasas útiles para la síntesis de oligosacáridos. Es otro objeto de la invención proporcionar la síntesis de oligosacáridos característica de Neisseria meningitidis y N. gonorrhoeae. Es otro objeto de la divulgación proporcionar la síntesis de oligosacáridos característica de oligosacáridos de mamífero, incluidos los oligosacáridos centrales del grupo de sangre. Es otro objeto adicional de la divulgación proporcionar vacunas que tienen la unidad de oligosacárido de LOS, pero carece del lípido A. Otro objeto adicional de la invención es proporcionar la síntesis de oligosacáridos terapéuticamente útiles. Estos y otros objetos del presente documento se aclararán mediante referencia a las siguientes Figuras y Descripción detallada. Descripción breve de las figuras Figura 1: Estructuras alternativas observadas en LOS de gonococos. R1 se refiere a la región central interna del LOS que consiste en dos residuos de ácido ceto-desoxi-octulosónico (KDO). Estos, a su vez, están unidos a una   estructura del lípido A. R2, en gonococos, es, normalmente, GlcNAcß12Hep13. La estructura del panel superior contiene un tetrasacárido idéntico a la lacto-N-neotetraosa encontrada en los glicolípidos de paraglobósido. En muchas cepas, este tetrasacárido porta un GalNAcß13 terminal. El panel inferior muestra una estructura trisacárida alternativa con el Gal 14 terminal unido. Este trisacárido se observó en meningococos del serotipo L1 y en algunas cepas de gonococos. Se indican las porciones de las dos estructuras reconocidas por los anticuerpos monoclonales usados en este estudio (4C4) (Dudas y Apicella, 1988, Infect. Immun. 56:499) 3F11 (Mandrell y col., 1988, J. Exp. Med. 168-107; Yamasaki y col., 1991, Mol. Immunol. 28:1233) 1 1-M (Yamasaki et al., 1991, Mol. Immunol. 28:1233), 2-1-L8 (Kerwood y col., 1992, Biochemistry 31:12760; Schneider y col., 1991, J. Exp. Med. 174:1601; Schneider y col., 1985, Infect. Immun. 50:672) 9-2-L378 y 17-1-L1. Figura 2: (A) Mapa genético del locus de LOS basado en la secuencia de ADN. Información de secuencia: pb 1- 2725 se obtuvo del plásmido pPstCla, pb 2725-5859 del plásmido p3400 (véase materiales y procedimientos). IS se refiere a un área de la secuencia que tiene homología con una secuencia de inserción de enseria previamente comunicada IS1106 (Knight y col., 1992, Molec. Microbiol. 6:1565). Se indican las posiciones de los marcos de lectura lgtA-E. Se encontraron tres tractos de poli-G en IgtA (17 pb), IgtC (10 pb) y IgtD (11 pb) y se indican con barras negras verticales. Secuencias de aminoácidos de (B) LgtA (SEC ID Nº 3), (C) LgtB (SEC ID Nº 8), (D) LgtC (SEC ID Nº 4), (E) LgtD (SEC ID Nº 5) y (F) LgtE (SEC ID Nº 6), y (G-M) la secuencia nucleotídica del locus IgT (SEC ID Nº 1). Figura 3 (A, B): Homología de los productos proteicos de lgtA e lgtD. La estructura primaria de dos proteínas es muy similar, particularmente en la primera mitad de las secuencias. Los residuos de glicina a partir de la posición 86 reflejan la codificación de las regiones de poli-G en los respectivos genes. Se usó el programa Bestfit del paquete GCG y los símbolos , : representan grados de similitud en base a la matriz Dayhoff PAM-250. Figura 4 (A, B): Homología de los productos proteicos de lgtB e lgtE. La estructura primaria de dos proteínas es muy similar, particularmente en la primera mitad de las secuencias. Estas secuencias también tienen una homología significativa con los genes lex-1 (Cope y col., 1991, Molec. Microbiol. 5:1113) o lic2A (High y col., 1993, Molec. Microbiol. 9:1275) de Haemophilus influenzae. Para los significados de los símbolos, véase la Figura 3. Figura 5 (A, B): Homología de los productos proteicos de rfaI e IgtC. Los genes rfaI y rfaJ de E. coli están relacionados muy estrechamente. Sirven como glucosiltransferasas de dos residuos de glucosa en la región central del LPS (Pradet y col., 1992, J. Bacteriol. 174:4736). Las glicinas en la posición 54-56 en lgtC están codificadas por el tracto poli-G. Para los significados de los símbolos, véase la Figura 3. Figura 6: Deleciones en el locus de LOS. Se construyeron tres inserciones y cinco deleciones en el locus de LOS, tal como se detalla en la sección de procedimientos. Se indican los sitios de restricción que se usaron. Las inserciones están marcadas con triángulos y la extensión de las deleciones con recuadros punteados. Las flechas abiertas indican los marcos de lectura abierta alteradas por la construcción. En cada uno de las construcciones se insertó el marcador ermC de eritromicina en el sitio de la inserción o la deleción. Figura 7: SDS-PAGE teñida con plata de las preparaciones de LOS. Se realizó electroforesis en gel de las muestras de LOS purificadas de 375 ng y se tiñó tal como se ha descrito en materiales y procedimientos. Encima del gel se indica la estructura del LOS de las bandas principales que se ha deducido que están presentes en cada una de las preparaciones. Estas estructuras se basan en la reactividad con anticuerpos monoclonales que se muestran en la Figura 8, pero se presentan en esta Figura para facilitar la interpretación de los patrones observados. R es la región central interna y lípido A. 1291e es un mutante resistente a piocina (Dudas y Apicella, 1988, Infect. Immun. 56:499). Figura 8: Reactividad de LOS de la cepa F62 wt y las mutantes con anticuerpos monoclonales. Los nombres de los anticuerpos monoclonales siguientes se abreviaron: 17-1-L1 (L1), 9-2-L378 (L3), 2-1-L8 (L8). El LOS purificado se aplicó a membranas Immobilon-P, se dejó reaccionar con los anticuerpos y se desarrolló como se describe en materiales y procedimientos. La especificidad de los anticuerpos monoclonales se resume en la Figura 1. Descripción detallada de la invención Como se ha tratado con anterioridad, la presente divulgación proporciona cinco nuevas glicosiltransferasas, genes que codifican las glicosiltransferasas y procedimientos para la biosíntesis de de oligosacáridos usando dichas glicosiltransferasas. Las glicosiltransferasas de la invención se pueden usar para biosíntesis in vitro de varios oligosacáridos. Tales como el oligosacárido central de los antígenos del grupo sanguíneo humano, es decir lacto-Nneotetraosa. La clonación y la expresión de las glicosiltransferasas de la divulgación se pueden conseguir usando técnicas estándar, como se divulga en el presente documento. Dichas glicosiltransferasas son útiles para la biosíntesis de oligosacáridos in vitro o, como alternativa, los genes que codifican dichas glicosiltransferasas se pueden transfeccionar en células, por ejemplo células de levaduras o células eucariotas para proporcionar glicosilación 6   alternativa de proteínas y lípidos. La presente invención se base, en parte, en el descubrimiento y clonación de un locus implicado en la biosíntesis de LOS gonocóccico de la cepa de gonococos F62, El locus contiene cinco marcos de lectura abiertos. El primero y el segundo marco de lectura son homólogos, pero no idénticos, del cuarto y quinto marcos de lectura, respectivamente. Interpuesto hay un marco de lectura adicional que tiene una homología distante con los genes rfaI y rfaJ de E. coli, ambas glicosiltransferasas implicadas en la biosíntesis central de LPS. El segundo y el quinto marcos de lectura muestran una fuerte homología con el gen lex-1 o lic2A de Haemophilus influenzae, pero no contienen las repeticiones CAAT encontradas en este gen. Se construyeron deleciones de cada uno de estos cinco genes, de combinaciones de genes y de todo el locus y se introdujeron en la cepa gonocóccica F62 parental mediante transformación. A continuación, los fenotipos LOS se analizaron mediante SDS-PAGE y reactividad con anticuerpos monoclonales. El análisis de los mutantes de gonococos indica que cuatro de estos genes son las glicosiltransferasas que añaden GalNAcß13Galß14Glc-NAcß13Galß14 al sustrato Glcß14HepR de la región central interna. El gen con homología con rfaI/rfaJ de E. coli está implicado en la adición del residuo de galactosa unido por enlace en la biosíntesis de la estructura alternativa de LOS Gal14Galß14Glcß14HepR. Dado que estos genes codifican LOS glicosiltransferasas, se han denominado lgtA, lgtB, lgtC, lgtD y lgtE. El análisis de la secuencia de ADN reveló que lgtA, lgtC y lgtD contienen tractos de poli-G, que en la cepa F62 eran, respectivamente, de 17, 10 y 11 pb. Por tanto, tres de las enzimas biosintéticas de LOS son potencialmente susceptibles a la terminación prematura mediante cambios en el marco de lectura. Es probable que estas características estructurales sean responsables de la variación genética de alta frecuencia de LOS de gonococos. Las abreviaturas usadas a lo largo de la presente memoria descriptiva incluyen: Lipopolisacárido, LPS; Lipooligosacárido, LOS; ácido N-acetil-neuramínico-citidina monofosfato, CMP-NANA; silvestre wt; galactosa; Glc, glucosa; NAc, N-acetilo (p. ej., GalNAc o GlcNAc). De acuerdo con la presente invención se pueden emplear técnicas convencionales de biología molécula, microbiología y de ADN recombinante, dentro de la experiencia en la técnica. Dichas técnicas se explican completamente en la literatura. Véase, por ejemplo, Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual," Segunda Edición (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (en el presente documento "Sambrook y col., 1989"); "DNA Cloning: A Practical Approach," Volúmenes I y II (D.N. Glover ed. 1985); "Oligonucleotide Synthesis" (M.J. Gait ed. 1984); "Nucleic Acid Hybridization " [B.D. Hames & S.J. Higgins eds. (1985)]; "Transcription And Translation" [B.D. Hames & S.J. Higgins, eds. (1984)]; "Animal Cell Culture" [R.I. Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press, (1986)]; B. Perbal, "A Practical Guide To Molecular Cloning" (1984). Por tanto, si aparecen en el presente documento, los términos siguientes tendrán las definiciones que se indican a continuación. Una célula se ha transformado con ADN exógeno o heterólogo cuando dicho ADN se ha introducido en el interior de la célula; la célula puede expresar un gen o genes codificados por dicho ADN. El ADN transformante puede o no integrarse (unido de forma covalente) en el ADN cromosómico que compone el genoma de la célula o puede estar contenido en un replicón autónomo. En procariotas, células de levadura o de mamífero, por ejemplo, el ADN transformante se puede mantener en un elemento episomal, tal como un plásmido. Un clon es una población de células derivadas de una única célula o ancestro común mediante mitosis. Una molécula de ácido nucleico se refiere a la forma polimérica éster fosfato de ribonucleótidos (adenosina, guanosina, uridina o citidina; moléculas de ARN) o desoxirribonucleósidos (desoxiadenosina, desoxiguanosina, desoxitimidina o desoxicitidina; moléculas de ADN) en forma monocatenaria o una hélice bicatenaria. Son posibles las hélices bicatenarias de ADN-ADN, ADN-ARN y ARN-ARN. El término molécula de ácido nucleico y, en particular, molécula de ADN o ARN, sólo se refiere a la estructura primaria y secundaria de la molécula, y no se limita a una forma terciaria concreta. Por tanto, este término incluye ADN bicatenario que se encuentra, entre otros, en moléculas de ADN lineal o circular (p. ej., fragmentos de restricción), virus, plásmidos y cromosomas. Al tratar la estructura de las moléculas de ADN bicatenarias concretas, las secuencias se pueden describir en el presente documento de acuerdo con la convención normal de proporcionar únicamente la secuencia en la dirección 5 a 3 a lo largo de la hebra no transcrita de ADN (es decir, la hebra tiene una secuencia homóloga al ARNm). Una molécula de ADN recombinante es una molécula de ADN que ha sufrido una manipulación biológica molecular. Una molécula de ácido nucleico es hibridable con otra molécula de ácido nucleico, tal como ADNc, ADN genómico o ARN, cuando una forma monocatenaria de la molécula de ácido nucleico puede hibridar con la otra molécula de ácido nucleico en las condiciones adecuadas de temperatura y fuerza iónica en solución (véase Sambrook y col., 1989, ant.). Las condiciones de temperatura y fuerza iónica determinan la "rigurosidad" de la hibridación. La 7   hibridación requiere que los dos ácidos nucleicos contengan secuencias complementarias, aunque en función de la rigurosidad de la hibridación es posible que se formen apareamientos erróneos entre bases. La rigurosidad adecuada para hibridar ácidos nucleicos depende de la longitud de los ácidos nucleicos y el grado de complementariedad, variables bien conocidas en la técnica. Cuanto mayor es el grado de similitud u homología entre dos secuencias de nucleótidos, mayor es el valor de Tm para los híbridos de los ácidos nucleicos que tienen dichas secuencias. La estabilidad relativa (correspondiente a una Tm más alta) de las hibridaciones de los ácidos nucleicos disminuye en el orden siguiente: ARN:ARN, ADN:ARN, ADN:ADN. Para híbridos de una longitud mayor de 100 nucleótidos se han derivado ecuaciones para calcular la Tm (véase, Sambrook y col., ant., 9.50-9.51). Para hibridación con ácidos nucleicos más cortos, es decir oligonucleótidos, la posición de las apareamientos erróneos se convierte en más importante, y la longitud del oligonucleótido determina su especificidad (véase, Sambrook y col., ant., 11.7-11.8). Preferentemente, una longitud mínima para un ácido nucleico hibridables es, de al menos, aproximadamente 10 nucleótidos; más preferentemente, de al menos aproximadamente 15 nucleótidos; más preferentemente la longitud es de al menos aproximadamente 20 nucleótidos. Una secuencia codificadora de ADN es una secuencia de ADN bicatenario que se transcribe y se traduce en un polipéptido in vivo cuando se introduce bajo el control de las secuencias reguladoras adecuadas. Los límites de la secuencia codificadora están determinados por un codón de iniciación en el extremo 5' (amino) y un codón de finalización de la traducción en el extremo 3' (carboxi). Una secuencia codificadora puede incluir, entre otras, secuencias procarióticas, ADNc de ARNm eucariota, secuencias de ADN genómico de ADN eucariota (p. ej., de mamífero) e incluso secuencias de ADN sintéticas. Si la secuencia codificadora está destinada a la expresión en una célula eucariota, normalmente una señal de poliadenilación y secuencia de terminación de la transcripción se localizará en 3 de la secuencia codificadora. Las secuencias de control de la transcripción y de la traducción son secuencias reguladoras de ADN, tales como promotores, potenciadores, terminadores y similares, que proporcionan la expresión de una secuencia codificadora en una célula huésped. Aunque los genes individuales que codifican glicosiltransferasas de la invención se encuentran en un único locus con secuencias no codificadoras muy cortas entre ellos, la variación de fase que tiene como resultado la deleción de cualquiera de lgtA, lgtB o lgtc no impide el reinicio de la transcripción en los genes posteriores. Por tanto, el locus proporcionado en el presente documento incluye secuencias de inicio de la transcripción para la transcripción en Neisseria. Como alternativa, las secuencias codificadoras de la invención se pueden someter a ingeniería para expresión bajo el control de secuencias control heterólogas. Una secuencia promotora es una región reguladora de ADN capaz de unir la ARN polimerasa en una célula e iniciar la transcripción de una secuencia codificadora (dirección 3) posterior. Para los fines de definir la presente invención, la secuencia promotora se une a su extremo 3 mediante el sitio de inicio de la transcripción y se extiende hacia arriba (en dirección 5) para incluir el número mínimo de bases o elementos necesarios para iniciar la transcripción a niveles detectables por encima del normal. Dentro de la secuencia promotora se encontrará un sitio de inicio de la transcripción (convenientemente definido mediante, por ejemplo, mapeo con la nucleasa S1), así como los dominios de unión a proteína (secuencias consenso) responsables de la unión de la ARN polimerasa. Los promotores eucariotas a menudo, aunque no siempre, contienen cajas TATA y cajas CAT. Una secuencia codificadora está bajo el control de las secuencias de control de la transcripción y la traducción en una célula cuando la ARN polimerasa transcribe la secuencia codificadora en ARNm, que a su vez se traduce en la proteína codificada por la secuencia codificadora. Se puede incluir una secuencia señal antes de la secuencia codificadora. Esta secuencia codifica un péptido señal, N-terminal del polipéptido, que dirige la célula huésped a translocar el polipéptido a la superficie de la célula o a los orgánulos en el interior de la célula o a secretar el polipéptido en el medio y este péptido señal normalmente se escinde de forma selectiva mediante la maquinaria de transporte proteico. Las secuencias señal se pueden encontrar asociadas con una diversidad de proteínas nativas de procariotas y eucariotas. La incorporación de una secuencia señal puede ser deseable para una expresión a niveles elevadas de una glicosiltransferasa de la invención por bacterias, levaduras, células de insectos (baculovirus) o células eucariotas, para evitar que afecte a la glicosiltransferencia en la célula huésped. Una molécula es antigénica cuando es capaz de interaccionar específicamente con una molécula de reconocimiento antigénico del sistema inmunológico, tal como una inmunoglobulina (anticuerpo) o un receptor antigénico de linfocitos T. Como se ha mencionado anteriormente, el resto hidrato de carbono (oligosacárido) del LOS de Neisseria es un importante determinante antigénico, que determina el serotipo del meningococo (Zollinger y Mandrell, 1977, Infect. Immun. 18:424; Zollinger y Mandrell, 1980, Infect. Immun. 28:451). Una porción antigénica de una molécula puede ser la porción que es inmunodominante para el anticuerpo o puede ser una porción usada para generar un anticuerpo frente a la molécula conjugando la porción antigénica con una molécula vehículo para inmunización. Una molécula que es antigénica no tiene que ser inmunogénica por sí misma, es decir capaz de 8   producir una respuesta inmunitaria sin un vehículo. Una composición que comprende A (en la que A es una proteína sencilla, molécula de ADN, vector etc.) está sustancialmente libre de B (en la que B comprende una o más proteínas, moléculas de ADN, vectores contaminantes etc.), cuando al menos aproximadamente el 75 % en peso de las proteínas, ADN, vectores (en función de la categoría de la especie a la que pertenecen A y B) en la composición es A. Preferentemente, A comprende al menos aproximadamente 90 % en peso de la especie A+B en la composición, más preferentemente al menos aproximadamente 99 % en peso. También se prefiere que una composición, que carece sustancialmente de contaminación, contenga sólo una especie de peso molecular único que tenga la actividad o característica de la especie de interés. La expresión farmacéuticamente aceptable se refiere a entidades moleculares y composiciones que son fisiológicamente tolerables y que normalmente no producen reacciones adversas, alérgicas o perjudiciales, tales como molestias gástricas, mareos y similares, cuando se administran a un ser humano. Preferentemente, como se usa en el presente documento, la expresión farmacéuticamente aceptable significa aprobado por una agencia reguladora del gobierno federal o estatal o enumerado en la farmacopea de EE.UU. u otra farmacopea generalmente reconocida para uso en animales y, más particularmente, en seres humanos. El término vehículo refiere a un diluyente, adyuvante, excipiente o vehículo con el que se administra el compuesto. Dichos vehículos farmacéuticos pueden ser líquidos estériles, tales como agua y aceites, incluidos los de origen en petróleo, animal, vegetal o sintético, tal como aceite de cacahuete, aceite de soja, aceite mineral, aceite de sésamo y similares. Como vehículos, preferentemente se emplean agua o soluciones salinas acuosas y soluciones acuosas de dextrosa y glicerol, particularmente para soluciones inyectables. Las composiciones farmacéuticamente aceptables de la invención carecen de cantidades de lípido A eficaces para producir una respuesta en un sujeto mamífero, en particular un sujeto humano. El término adyuvante se refiere a un compuesto o mezcla que potencia la respuesta inmunitaria a un antígeno. Un adyuvante puede servir como depósito tisular que libera lentamente el antígeno y, también, como activador del sistema linfoide que potencia inespecíficamente la respuesta inmunitaria (Hood y col., Immunology, Segunda Ed. , 1984, Benjamin/Cummings: Menlo Park, California, p. 384). A menudo, una exposición primaria con un antígeno solo, en ausencia de un adyuvante, no producirá una respuesta inmunitaria humoral o celular. Entre dichos adyuvantes se incluyen adyuvante completo de Freund, adyuvante incompleto de Freund, saponina, geles minerales, tales como hidróxido de aluminio, sustancias de superficie activa, tales como lisolecitina, polioles plurónicos, polianiones, péptidos, emulsiones en aceite o hidrocarburo, hemocianina de lapa californiana, dinitrofenol y adyuvantes humanos potencialmente útiles, tales como BCG (bacilo de Calmette-Guerin) y Corynebacterium parvum. Preferentemente, el adyuvante es farmacéuticamente aceptable. Aislamiento de genes para glicosiltransferasas La presente divulgación proporciona la secuencia codificadora de longitud completa del locus LOS de Neisseria y, por tanto, permite obtener uno cualquiera o los cinco genes, denominados en el presente documento genes lgt, que codifican glicosiltransferasas características de dicho locus. Cualquier célula bacteriana de Neisseria puede servir potencialmente como la fuente de ácido nucleico para la clonación molecular de un gen lgt. En una realización específica de la divulgación, más adelante, los genes se aíslan de Neisseria gonorrhoeae. El ADN puede obtenerse mediante procedimientos estándar conocidos en la técnica a partir de ADN clonado (p. ej., una biblioteca de ADN) mediante síntesis química, mediante clonación de ADNc o mediante la clonación de ADN genómico o fragmentos de los mismos, se puede purificar a partir de la célula deseada (véase, por ejemplo, Sambrook y col., 1989, ant.; Glover, D.M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, Reino Unido, Vol. I, II). Por ejemplo, un ADN genómico de N. gonorrhoeae se puede digerir con una endonucleasa o endonucleasas de restricción, por ejemplo Sau3A, en un vector fago digerido con una endonucleasa o endonucleasas de restricción, por ejemplo BamHI/EcoRI, para la creación de una biblioteca genómica de fagos. Cualquiera que sea la fuente, el gen se clonará molecularmente en un vector adecuado para la propagación del gen. En la clonación molecular del gen desde ADN genómico, se generan fragmentos de ADN, algunos de los cuales codificarán el gen deseado. El ADN se puede escindir en sitios específicos usando varias enzimas de restricción. Como alternativa, se puede usar ADNasa en presencia de manganeso en un fragmento de ADN o el ADN se puede romper físicamente mediante, por ejemplo, ultrasonidos. A continuación, los fragmentos de ADN lineal pueden separarse de acuerdo con el tamaño mediante técnicas estándar, incluidas, entre otras, electroforesis en gel de agarosa y poliacrilamida, y cromatografía en columna. Una vez que se han generado los fragmentos de ADN se puede identificar el fragmento de ADN específico que contiene el gen lgt deseado mediante numerosas formas. Por ejemplo, los fragmentos de ADN generados se pueden someter a detección selectiva mediante hibridación del ácido nucleico con la sonda marcada sintetizada 9   con una secuencia, tal como se divulga en el presente documento (Benton y Davis, 1977, Science 19b:180; Grunstein y Hogness, 1975, Proc. Natl. Acad. Sci. U.S.A. 72: 3961). Hibridarán los fragmentos de ADN con homología sustancial con la sonda. La presente divulgación proporciona ejemplos específicos de fragmentos de ADN que se pueden usar como sondas de hibridación para las glicosiltransferasas, por ejemplo SEC ID Nº 1. Como se ha descrito con anterioridad, la presencia del gen se puede detectar mediante ensayos en base a las propiedades físicas, químicas o inmunológicas de su producto expresado. Por ejemplo, los clones de ADN que producen una proteína que, por ejemplo, tienen una migración electroforética similar o idéntica, comportamiento de enfoque isoeléctrico, mapas de digestión proteolítica, actividad proteolítica o propiedades funcionales, en particular actividad glicosiltransferasa, la capacidad de una proteína Lgt para mediar en la transferencia de un azúcar a una molécula aceptora. Como alternativa, el gen lgt putativo puede estar mutado y su papel como glicosiltransferasa se puede establecer detectando una variación en la estructura del oligosacárido de LOS. Alternativas a aislar el ADN genómico de lgt incluyen, entre otros, sintetizar químicamente la secuencia del propio gen a partir de una secuencia conocida que codifica una Lgt, por ejemplo como se muestra en la SEC ID Nº 1. En otra realización, el ADN de un gen lgt se puede aislar mediante PCR usando los cebadores oligonucleotídicos diseñados a partir de las secuencias nucleotídicas divulgadas en el presente documento. Son posibles otros procedimientos y entran dentro del ámbito de la invención. El gen identificado y aislado se puede insertar después en un vector de clonación adecuado. Se puede usar un gran número de sistemas vector-huésped conocidos en la técnica. Posibles vectores incluyen, entre otros, plásmidos o virus modificados, pero el sistema de vector debe ser compatible con la célula huésped usada. En un aspecto específico de la invención, la secuencia codificadora Igt se inserta en un vector de clonación de E.coli. Otros ejemplos de vectores incluyen, entre otros, bacteriófagos tales como derivados del lambda, o plásmidos tales como derivados de pBR322 o derivados del plásmido pUC, por ejemplo vectores pGEX, pmal-c, pFLAG, etc. La inserción en un vector de clonación puede realizarse, por ejemplo, uniendo el fragmento de ADN en un vector de clonación que tiene un extremo cohesivo complementario. No obstante, si los sitios de restricción complementarios usados para fragmentar el ADN no están presentes en el vector de clonación, los extremos de las moléculas de ADN se pueden modificar enzimáticamente. Como alternativa, se puede producir cualquier sitio deseado uniendo las secuencias nucleotídicas (ligadores) sobre los extremos de ADN; estos ligadores ligados pueden comprender oligonucleótidos específicos sintetizados químicamente que codifican las secuencias de reconocimiento de endonucleasas de restricción. En una realización específica se pueden usar cebadores para PCR que contienen dichos sitios ligadores para amplificar el ADN para clonar. Las moléculas recombinantes se pueden introducir en las células huésped mediante transformación, transfección, infección, electroporación etc., de modo que se generen muchas copias de la secuencia génica. La transformación de las células huésped con moléculas de ADN recombinante que incorporan el gen Igt aislado o la secuencia de ADN sintetizado permite la generación de múltiples copias del gen. Por tanto, el gen se puede obtener en grandes cantidades cultivando los transformantes, aislando las moléculas de ADN recombinante de los transformantes y, cuando sea necesario, recuperando el gen insertado del ADN recombinante aislado. La presente divulgación también se refiere a vectores que contienen genes que codifican formas truncadas de la enzima (fragmentos) y derivados de Lgt que tienen la misma actividad funcional que un Lgt. La producción y uso de los fragmentos y derivados relacionados con un Lgt entran dentro del alcance de la presente divulgación. En una realización específica de la divulgación, el fragmento o derivado está funcionalmente activo, es decir capaz de mediar en la transferencia de un azúcar a una molécula aceptora. Los fragmentos truncados de las glicosiltransferasas se pueden preparar eliminando el extremo N, el extremo C o regiones internas de la proteína que no son necesarias para la actividad funcional. Normalmente, dichas porciones que se eliminan sólo incluirán unos pocos, por ejemplo entre 1 y 5, residuos de aminoácidos, pero se pueden eliminar segmentos más grandes. Las moléculas quiméricas, por ejemplo proteínas de fusión, que contienen toda o una porción funcionalmente activa de una glicosiltransferasa de la invención unida a otra proteína también están previstas en la divulgación. Una proteína de fusión glicosiltransferasa comprende al menos una porción funcionalmente activa de una proteína que no es glicosiltransferasa unida mediante un enlace peptídico a al menos una porción funcionalmente activa de un polipéptido de glicosiltransferasa. Las secuencias que no son glicosiltransferasa pueden ser un terminal amino o carboxi de las secuencias de glicosiltransferasa. La expresión de una proteína de fusión puede tener como resultado una proteína de fusión glicosiltransferasa enzimáticamente inactiva. Una molécula de ADN recombinante que codifica dicha proteína de fusión comprende una secuencia que codifica al menos una porción funcionalmente activa de una proteína no glicosiltransferasa unida en el marco a la secuencia codificadora de glicosiltransferasa y, preferentemente, codifica un sitio de escisión para una proteasa específica, por ejemplo trombina o Factor Xa, preferentemente en la unión glicosiltransferasa-no glicosiltransferasa. En una realización específica de la   divulgación, la proteína de fusión se puede expresar en Escherichia coli. En particular, los derivados de Lgt pueden fabricarse alterando las secuencias de ácido nucleico codificantes mediante sustituciones, adiciones o deleciones que proporcionan moléculas funcionalmente equivalente. Debido a la degeneración de las secuencias nucleotídicas codificadoras, en la práctica de la presente invención se pueden usar otras secuencias de ADN que codifican sustancialmente las mismas secuencias de aminoácidos que un gen Igt. Estas incluyen, entre otras, las secuencias de nucleótidos que comprenden todos o porciones de los genes Igt que se alteran mediante la sustitución de codones diferentes que codifican el mismo residuo de aminoácido dentro de la secuencia, produciendo de este modo un cambio silente. Asimismo, los derivados de Lgt de la divulgación incluyen, entre otros, los que contienen, como secuencia de aminoácidos primarios, toda o parte de la secuencia de aminoácidos de una Lgt, incluidas las secuencias alteradas en las que los residuos de aminoácido funcionalmente equivalentes están sustituidos por residuos dentro de la secuencia que tienen como resultado una sustitución conservadora de aminoácidos. Por ejemplo, uno o más residuos de aminoácidos dentro de la secuencia pueden sustituirse por otro aminoácido de una polaridad similar, que actúa como equivalente funcional, que tiene como resultado una alteración silente. Los sustitutos de un aminoácido dentro de la secuencia se pueden seleccionar de otros miembros de la clase a la que pertenece el aminoácido. Por ejemplo, los aminoácidos no polares (hidrófobos) incluyen alanina, leucina, isoleucina, valina, prolina, fenilalanina, triptófano y metionina. Los aminoácidos neutros polares incluyen glicina, serina, treonina, cisteína, tirosina, asparagina y glutamina. Los aminoácidos con carga positiva (básicos) incluyen arginina, lisina e histidina. Los aminoácidos con carga negativa (ácidos) incluyen ácido aspártico y ácido glutámico. Los genes que codifican derivados de Lgt y análogos de la divulgación se pueden producir mediante varios procedimientos conocidos en la técnica (p. ej., Sambrook et al., 1989, ant.). La secuencia se puede escindir en sitios adecuados con endonucleasa(s) de restricción, seguido de modificación enzimática adicional si se desea, aislar y ligar in vitro. En la producción del gen que codifica un derivado o análogo de Lgt deberán tomarse precauciones para garantizar que el gen modificado permanece dentro del mismo marco de lectura traduccional que el gen Igt, sin interrumpir por señales de terminación de la traducción, en la región génica en la que está codificada la actividad deseada. Adicionalmente, la secuencia de ácido nucleico de Igt puede mutarse in vitro o in vivo para crear y/o destruir secuencias de traducción, iniciación y/o terminación, o para crear variaciones en las regiones codificadoras y/o formar nuevos sitios de endonucleasas de restricción o destruir los ya existentes, para facilitar modificaciones in vitro adicionales. Se puede usar cualquier técnica de mutagénesis conocida en la técnica, incluidas, entre otras, mutagénesis dirigida a sitio in vitro (Hutchinson, C., y col., 1978, J. Biol. Chem. 253:6551; Zoller y Smith, 1984, DNA 3:479-488; Oliphant y col., 1986, Gene 44:177; Hutchinson y col., 1986, Proc. Natl. Acad. Sci. U.S.A. 83:710), uso de ligadores TAB® (Pharmacia), etc. Para la mutagénesis dirigida a sitio se prefieren las técnicas de PCR (véase Higuchi, 1989, "Using PCR to Engineer DNA", en PCR Technology: Principles and Applications for DNA Amplification, H. Erlich, ed., Stockton Press, Capítulo 6, pág. 61-70). A este respecto, es notable que los genes lgtA, IgtB, e IgtC contengan tiras largas de poli-G que son particularmente susceptibles a mutación por variación de fase. Expresión de una glicosiltransferasa El gen que codifica una Lgt, o un fragmento funcionalmente activo u otro derivado de la misma, se pueden insertar en un vector de expresión adecuado, es decir un vector que contenga los elementos necesarios para las transcripción y traducción de la secuencia de codificación de proteínas insertada. Asimismo, preferentemente, un vector de expresión de la divulgación incluye un origen de replicación. Las señales transcripciones y traduccionales necesarias también se pueden suministrar mediante el gen Igt nativo y/o sus regiones flanqueantes. Para expresar la secuencia codificadora de proteínas se pueden usar numerosos sistemas de huésped-vector. No obstante, preferentemente, se usa un sistema de expresión bacteriana para proporcionar un nivel de expresión alto de la proteína con una mayor probabilidad de la conformación nativa. Posibles sistemas huésped-vector incluyen, entre otros, sistemas de células de mamífero infectados con virus (p. ej., virus de vaccinia, adenovirus etc.); sistemas de células de insectos infectadas con virus (p. e., baculovirus); microorganismos tales como levaduras que contienen vectores de levaduras o bacterias transformadas con bacteriófagos, ADN, ADN plasmídico o ADN de cósmido. Los elementos de expresión de los vectores varían en su concentración y especificidad. Dependiendo del sistema de huésped-vector usado, se puede usar cualquier número de elementos de transcripción y de traducción adecuados. Preferentemente, se produce la forma periplásmica de Lgt (que contiene una secuencia señal) para exportar la proteína al periplasma de Escherichia coli o al sistema de expresión basado en Bacillus subtillis. Cualquiera de los procedimientos descritos previamente para la inserción de fragmentos de ADN en un vector se puede usar para construir vectores de expresión que contienen un gen quimérico que consta de las señales de control de la transcripción/traducción adecuadas y las secuencias codificadoras de la proteína. Estos procedimientos pueden incluir técnicas de ADN recombinante y sintéticas in vitro y recombinantes in vivo 11   (recombinación genética). La expresión de la secuencia de ácido nucleico que codifica una glicosiltransferasa o fragmento peptídico se puede regular mediante una segunda secuencia de ácido nucleico de modo que la glicosiltransferasa o el péptido se expresa en un huésped transformado con la molécula de ADN recombinante. Por ejemplo, la expresión de una glicosiltransferasa puede controlarse mediante cualquier elemento promotor/potenciador conocido en la técnica, pero estos elementos reguladores deben ser funcionales en el huésped seleccionado para expresión. Para la expresión en bacterias se requieren promotores bacterianos. Se prefieren promotores virales eucarióticos o eucarióticos, incluidos promotores específicos de tejido, cuando un vector que contiene un gen Igt se inyecta directamente en un sujeto para expresión transitoria, lo que tiene como resultado una protección heteróloga contra la infección bacteriana, como se describe con detalle más adelante. Promotores que se pueden usar para controlar la expresión del gen Igt incluyen, entre otros, la región del promotor temprano de SV40 (Benoist y Chambon, 1981, Nature 290:304-310), el promotor contenido en la repetición larga en 3 del virus del sarcoma de Rous (Yamamoto, et al., 1980, Cell 22:787-797), el promotor de la timidina quinasa del herpes (Wagner y col., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), las secuencias reguladoras del gen de la metalotioneína (Brinster y col., 1982, Nature 296:39-42); vectores de expresión procariótica tales como el promotor de la ß-lactamasa (Villa-Kamaroff, y col., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), o el promotor tac (DeBoer, y col., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25); véase también "Useful proteins from recombinant bacteria" en Scientific American, 1980, 242:74- 94; y similares. Los vectores de expresión que contienen insertos del gen Igt se pueden identificar mediante cuatro enfoques generales. (a) Amplificación por PCR del ADN plasmídico deseado o del ARNm específico, (b) hibridación de ácido nucleico, (c) presencia o ausencia de funciones de gen marcador y (d) expresión de secuencias insertadas. En el primer enfoque, los ácidos nucleicos se pueden amplificar mediante PCR con incorporación de radionúclidos o se pueden teñir con bromuro de etidio para proporcionar la detección del producto amplificado. En el segundo enfoque, la presencia de un gen extraño insertado en un vector de expresión se puede detectar mediante hibridación de ácido nucleico usando sondas que comprenden secuencias que son homólogas a un gen Igt insertado. En el tercer enfoque, el sistema vector/huésped recombinante se puede identificar y seleccionar en base a la presencia o ausencia de ciertas funciones de gen marcador (p. ej., actividad de ß-galactosidasa, actividad Pho, actividad de timidina quinasa, resistencia a antibióticos, fenotipo de transformación, formación de cuerpos de oclusión en baculovirus etc.) causadas por la inserción de genes extraños en el vector. Si el gen Igt se inserta dentro de la secuencia del gen marcador del vector, los recombinantes que contienen el inserto de Igt pueden identificarse mediante la ausencia de la función del gen marcador. En el cuarto enfoque, los vectores de expresión recombinantes se pueden identificar analizando la actividad del producto del gen Igt expresado por el recombinante. Dichos ensayos se pueden basar en, por ejemplo, las propiedades físicas o funcionales del producto del gen Igt en sistemas de ensayo in vitro, por ejemplo actividad glicosiltransferasa. Una vez que se han establecido el sistema huésped adecuado y las condiciones de crecimiento se pueden propagar los vectores de expresión recombinantes y preparar en cantidad. Biosíntesis de oligosacáridos Las glicosiltransferasas de la presente divulgación se pueden usar en la biosíntesis de oligosacáridos. Las glicosiltransferasas relacionadas con la invención son capaces de efectuar conjugación estereoespecífica de una unidad sacárida activada específica con una molécula aceptora específica. Dichos sacáridos activados consisten, en general, en derivados difosfato de uridina, guanosina y citosina de los sacáridos, en los que el nucleósido difosfato sirve como grupo saliente. Por tanto, el sacárido activado puede ser un sacárido-UDP, un sacárido-GDP o un sacárido-CDP. En realizaciones específicas, el sacárido activado es UDP-GleNAC, UDP-GalNAc o UDP-Gal. El término molécula aceptora, como se usa en el presente documento, se refiere a la molécula a la que la glicosiltransferasa transfiere un azúcar activado. Como es bine conocido en la técnica, la síntesis de hidratos de carbono progresa mediante acoplamiento secuencial de residuos de azúcar a un lípido, por ejemplo fosfato de dolicol. En células eucariotas, cuyas proteínas glicosilato, el oligosacárido o polisacárido se transfieren desde un vehículo lipídico activado al polipéptido sobre el lado luminal del retículo endoplásmico. En procariotas, el hidrato de carbono se puede sintetizar directamente sobre una molécula de lípido de A. Es probable que las glicosiltransferasas de la invención sean sensibles a la porción central del hidrato de carbono en crecimiento y la molécula lipídica. Por tanto, en un aspecto preferido, la molécula aceptora, o vehículo, contiene un lípido, preferentemente un lípido de alcohol poliisoprenoide tal como fosfato de dolicol. Se puede obtener una eficiencia sintética máxima del uso del lípido A como vehículo. Aunque el lípido A no es útil como vehículo para la administración directa del oligosacárido resultante a un sujeto, por ejemplo como una preparación de vacuna, puede ser adecuado para usar con un enlace lábil para la posterior escisión (en condiciones suaves) y la separación del oligosacárido del vehículo lipídico. Además, cabe destacar que las glicosiltransferasas sólo funcionarán de forma eficiente para añadir u sacárido activado específico a un residuo sacárido sobre la molécula aceptora que corresponde a la molécula aceptora natural. Por ejemplo, LgtE cataliza la transferencia de Gal a 12   Glcß14Hep. Por tanto, cuando una glicosiltransferasa media la unión de GalNAc a Glc, la naturaleza del residuo Glc (esté unido directa o indirectamente al vehículo, por ejemplo) afectará a la eficiencia de la reacción. Es improbable que se produzca una síntesis eficiente en ausencia de un vehículo o usando otro que no sea un vehículo lipídico. No obstante, incluso una síntesis ineficiente puede ser deseable y la práctica de la presente invención no se limita al uso de moléculas aceptoras que contienen lípidos sino que se extiende a sacáridos, polisacáridos, polipéptidos, glicoproteínas y similares. Para la síntesis de un oligosacárido, una glicosiltransferasa se pone en contacto con un sacárido activado adecuado y una molécula aceptora adecuada en las condiciones eficaces para transferir y unir covalentemente el sacárido a la molécula aceptora. Las condiciones de tiempo, temperatura y pH adecuadas y óptimas para la transferencia de una unidad sacárida concreta pueden determinarse mediante análisis de rutina; en general serán aceptables las condiciones fisiológicas. También pueden ser deseables ciertos co-reactivos; por ejemplo, puede ser más eficaz poner en contacto la glicosiltransferasa con el sacárido activado y la molécula aceptora en presencia de un catión divalente. De acuerdo con la divulgación, las enzimas glicosiltransferasas pueden inmovilizarse de forma covalente o no covalente sobre un soporte de fase sólida tal como SEPHADEX, SEPHAROSE o resina poli(acrilamida-co-Nacriloxisucciinimida) (PAN). Se puede realizar una reacción específica en una solución de reacción aislada, con separación fácil de la enzima de la fase sólida desde los productos de reacción. La inmovilización de la enzima también permite una corriente biosintética continua, con las glicosiltransferasas específicas unidas a un soporte sólido, con los soportes dispuestos al azar o en zonas distintas en el orden especificado en una columna, con el paso de la solución de reacción a través de la columna y elución del oligosacárido deseado al final. En la patente de EE.UU. bº 5.180.674, concedida el 19 de enero de 1993 a Roth se describe un procedimiento eficiente para fijar la glicosiltransferasa a un soporte sólido y usar dichas glicosiltransferasas inmovilizadas. Un oligosacárido, por ejemplo un disacárido, preparado usando una glicosiltransferasa en relación con la presente invención puede servir como molécula aceptora para la síntesis posterior, usando otras glicosiltransferasas en relación con la invención o glicosiltransferasas conocidas en la técnica (véase, por ejemplo, Roth, patente de EE.UU. Nº 5.180.674, y Roth, publicación de patente internacional nº WO 93/13198, publicada el 8 de julio de 1993). Las composiciones oligosacáridas relacionadas con la invención son útiles en una amplia variedad de aplicaciones terapéuticas y diagnósticas. Por ejemplo, las composiciones sacáridas se pueden usar como agentes de bloqueo para los receptores de superficie celular en el tratamiento de numerosas enfermedades que implican adhesión celular. Como alternativa, las composiciones sacáridas útiles como suplementos nutricionales, antibacterianos, agentes anti-metástasis, agentes antiinflamatorios (p. ej., para unión a lectinas asociadas con inflamatorios o receptores de superficie celular), por mencionar algunos, se contemplan en la presente invención. Como se ha indicado anteriormente, las glicosiltransferasas relacionadas con la invención se pueden usar junto con otras glicosiltransferasas conocidas en la técnica o que se va a describir que sintetizan oligosacáridos o polisacáridos complejos. Como alternativa, las glicosiltransferasas relacionadas con la invención se pueden usar para sintetizar oligosacáridos representativos de los oligosacáridos encontrados en varias cepas de Neisseria. La invención proporciona la reivindicación 1 delecionando los marcos de lectura abiertos del locus o seleccionando únicamente algunas de las glicosiltransferasas de la invención para síntesis, se pueden preparar estructuras oligosacáridas alternativas. Estas se pueden usar en preparaciones de vacunas eficaces contra variantes de Neisseria, en particular subunidades de vacunas contra gonococos y meningococos. Como alternativa, las glicosiltransferasas relacionadas con la presente invención se pueden usar para preparar oligosacáridos correspondientes a oligosacáridos asociados con glicolípidos humanos. Por tanto, en realizaciones específicas, la presente divulgación proporciona la síntesis de un oligosacárido correspondiente a lacto-N- neotetraosa del esfingolípido paraglobósido; un oligosacárido que imita los gangliósidos; y un imitador de la porción sacárida de globoglicolípidos, que es la estructura que normalmente se encuentra en Neisseria meningitidis inmunotipo L1. Los oligosacáridos de la presente divulgación corresponden a los oligosacáridos centrales de los antígenos de grupo sanguíneo y, por tanto, tienen gran utilidad en la preparación de dichos antígenos de grupo sanguíneo para fines diagnósticos o terapéuticos. De acuerdo con esto, un procedimiento para preparar un oligosacárido que tiene la estructura GalNAcß13- Galß14GlcNAcß13Galß14Glc (es decir, gangliósido) comprende realizar secuencialmente las etapas de: a. poner en contacto una mezcla de reacción que comprende una Gal activada con un resto aceptor que comprende un residuo Glc en presencia de una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 6 o un fragmento funcionalmente activo de la misma. b. poner en contacto una mezcla de reacción que comprende una GlcNAc activada con el resto aceptor que 13   comprende un residuo Galß14Glc en presencia de una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 3, o un fragmento funcionalmente activo de la misma; c. poner en contacto una mezcla de reacción que comprende una Gal activada con un resto aceptor que comprende un residuo GlcNAcß13Galß14Glc en presencia de una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 8 y d. poner en contacto una mezcla de reacción que comprende una GlcNAc activada con el resto aceptor que comprende un residuo Galß14GlcNAcß13Galß14Glc en presencia de una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 5, o un fragmento funcionalmente activo de la misma. De forma similar, un procedimiento para preparar un oligosacárido que tiene la estructura Galß14GlcNAcß13Galß14Glc (es decir, lacto-N-neotetraosa) comprende realizar secuencialmente las etapas de: a. poner en contacto una mezcla de reacción que comprende una Gal activada con un resto aceptor que comprende un residuo Glc en presencia de una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 6 o un fragmento funcionalmente activo de la misma. b. poner en contacto una mezcla de reacción que comprende una GlcNAc activada con el resto aceptor que comprende un residuo Galß14Glc en presencia de una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 3, o un fragmento funcionalmente activo de la misma; y c. poner en contacto una mezcla de reacción que comprende una Gal activada con un resto aceptor que comprende un residuo GlcNAcß13Galß14Glc en presencia de una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 8. En otra realización de la divulgación, un procedimiento para preparar un oligosacárido que tiene la estructura Gal14Galß14Glc (es decir, globoglicolípidos) comprende realizar secuencialmente las etapas de: a. poner en contacto una mezcla de reacción que comprende una Gal activada con el resto aceptor que comprende un residuo Galc en presencia de una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 6, o un fragmento funcionalmente activo de la misma; y b. poner en contacto una mezcla de reacción que comprende una Gal activada con el resto aceptor que comprende un residuo Galß14Glc en presencia de una glicosiltransferasa que tiene una secuencia de aminoácidos de SEC ID Nº 4, o un fragmento funcionalmente activo de la misma. Dichos oligosacáridos se pueden preparar usando el lípido A como vehículo. Preferentemente, si el glicolípido resultante se va a usar en una vacuna, un lípido no tóxico, tal como dolicol fosfato, se usa como vehículo. Vacunación La inmunidad activa contra cepas de Neisseria se pueden inducir mediante inmunización (vacunación) con una cantidad inmunogénica de un oligosacárido preparado de acuerdo con la presente invención en mezcla con un adyuvante, en el que el oligosacárido es el componente antigénico de la vacuna. Preferentemente, el oligosacárido está conjugado con una proteína vehículo. Como alternativa, cuando el antígeno es un glicolípido se puede incorporar en un liposoma. El oligosacárido solo no puede producir infección bacteriana, aunque el oligosacárido sobre el lípido A es tóxico y la inmunidad activa producida por la vacunación de acuerdo con la presente invención puede dar lugar a una respuesta inmunitaria inmediata. La selección de un adyuvante depende del sujeto que se va a vacunar. Preferentemente, se usa un adyuvante farmacéuticamente aceptable. Por ejemplo, una vacuna para un ser humano deberá evitar los adyuvantes de emulsión en aceite o hidrocarburo, incluido el adyuvante completo e incompleto de Freund. Un ejemplo de un adyuvante adecuado para usar con seres humanos es el alumbre (gel de alúmina). No obstante, una vacuna para un animal puede contener adyuvantes no adecuados para usar con seres humanos. Una vacuna de la invención, es decir una vacuna que comprende un oligosacárido correspondiente a un determinante antigénico sobre una cepa de Neisseria, se puede administrar por cualquier vía parenteral, incluidas, entre otras, intramuscular, intraperitoneal, intravenosa y similares. La administración de una cantidad de un oligosacárido de Neisseria suficiente para inhibir la adhesión de la bacteria a su célula diana puede también ser eficaz para tratar la infección por meningococos o gonococos. Un experto en la 14   técnica puede determinar la cantidad requerida usando técnicas estándar. Expresión de glicosiltransferasas para glicosilación intracelular La presente invención contempla además transformar una célula huésped con una glicosiltransferasa o glicosiltransferasas de la invención. Cabe esperar que la expresión de la glicosiltransferasa, posiblemente en una célula que caree una o más glicosiltransferasas endógenas, pueda tener como resultado una nueva glicosilación de lípidos y proteínas en dichas células eucariotas y una nueva glicosilación de lípidos en células procariotas. Por ejemplo, la transformación de una bacteria con moléculas lipídicas no tóxicas puede proporcionar la expresión de oligosacáridos de Neisseria sobre dicha bacteria, que pueden usarse después directamente en una vacuna de células enteras. Como alternativa, la expresión de dicha glicosiltransferasa en líneas celulares de levaduras, insectos o mamíferos puede tener como resultado una nueva glicosilación de lípidos y proteínas expresadas por estas células. Anticuerpos frente a oligosacáridos de Neisseria y diagnóstico y terapia con los mismos Al igual que los oligosacáridos se pueden usar en vacunas, también se pueden usar para generar anticuerpos frente a ellos mismos, anticuerpos que, a su vez, se pueden usar para detectar dicha cepa concreta de bacterias o para inmunidad pasiva. Los anticuerpos incluyen, entre otros, policlonales, monoclonales, quiméricos, de cadena sencilla, fragmentos Fab y una biblioteca de expresión de Fab. Se pueden usar varios procedimientos conocidos en la técnica para la producción de anticuerpos policlonales frente a oligosacáridos. Para la producción del anticuerpo se pueden inmunizar varios animales huéspedes mediante inyección con el oligosacárido, incluidos, entre otros, conejos, ratones, ratas, ovejas, cabras etc. En una realización de la divulgación, el oligosacárido se puede conjugar con un vehículo inmunogénico, por ejemplo seroalbúmina bovina (BSA) o hemocianina de lapa californiana (KLH). Dependiendo de la especie huésped se pueden usar varios adyuvantes para incrementar la respuesta inmunológica. Para la preparación de anticuerpos monoclonales dirigidos hacia el oligosacárido, o fragmento, análogo, o derivado del mismo, se puede usar cualquier técnica que proporcione la producción de moléculas de anticuerpos mediante líneas celulares continuas en cultivo. Estas incluyen, entre otras, la técnica del hibridoma inicialmente desarrollada por Köhler y Milstein 1975, Nature 256:495-49), así como la técnica del trioma, la técnica del hibridoma de células B humanas (Kosbor, y col., Immunology Today, 4:72) y la técnica del hibridoma con EBV para producir anticuerpos monoclonales humanos (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pág. 77-96). En una realización adicional de la divulgación, los anticuerpos monoclonales se pueden producir en animales sin gérmenes usando la reciente tecnología (PCT/US90/02545). De acuerdo con la divulgación, se pueden usar anticuerpos humanos y se pueden obtener usando hibridomas humanos (Cote et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030) o transformando linfocitos B humanos con el virus de EBV in vitro (Cole y col., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, pág. 77-96). De hecho, de acuerdo con la divulgación, se pueden usar técnicas desarrolladas para la producción de anticuerpos quiméricos (Morrison y col., 1984, J. Bacteriol. 159-870; Neuberger y col., 1984, Nature 312:604-608; Takeda y col., 1985, Nature 314:452-454) mediante corte y empalme de los genes de una molécula anticuerpo de ratón específica de un oligosacárido junto con genes de una molécula anticuerpo humana de actividad biológica adecuada; dichos anticuerpos entran dentro del alcance de la presente divulgación. Dichos anticuerpos quiméricos humanos o humanizados se prefieren para usar en terapia de enfermedades o trastornos humanos, ya que es mucho menos probable que los anticuerpos humanos o humanizados, en comparación con los anticuerpos xenogénicos, induzcan una respuesta inmunitaria, en particular una respuesta alérgica, por sí mismos. De acuerdo con la divulgación, las técnicas descritas para la producción de anticuerpos de cadena sencilla (patente de EE.UU. 4.946.778) se pueden adaptar para producir anticuerpos de cadena sencilla específicos de oligosacárido. Una realización adicional de la divulgación usa las técnicas descritas para la construcción de bibliotecas de expresión de Fab (Huse, y col., Science, 246:1275-1281) para permitir la identificación rápida y fácil de fragmentos Fb monoclonales con la especificidad deseada para un oligosacárido, o sus derivados o análogos. Se pueden generar fragmentos de anticuerpos que contienen el idiotipo de la molécula anticuerpo mediante técnicas conocidas. Por ejemplo, entre estos fragmentos se incluyen ,entre otros: El fragmento F(ab)2 que se puede producir mediante digestión con pepsina de la molécula de anticuerpo; los fragmentos Fab que se pueden generar mediante la reducción de los puentes disulfuro de los fragmentos F(ab)2 , y los fragmentos Fab que se pueden generar tratando la molécula de anticuerpo con papaína y un agente reductor. En la producción de anticuerpos, la detección selectiva del anticuerpo deseado se puede efectuar mediante técnicas conocidas en la materia, por ejemplo radioinmunoensayo, ELISA (ensayo de inmunosorción ligada a enzima), inmunoensayos de tipo sándwich, ensayos inmunoradiométricos, reacciones de precipitina con difusión en gel, ensayos de inmunodifusión, inmunoensayos in situ (usando oro coloidal, marcadores enzimáticos o radioisótopos, por ejemplo), transferencias de tipo western, reacciones de precipitación, ensayos de aglutinación (p.   ej., ensayos de aglutinación en gel, ensayos de hemaglutinación), ensayos de fijación del complemento, ensayos de inmunofluorescencia, ensayos de proteína A y ensayos de inmunoelectroforesis etc. En una realización de la divulgación, la unión del anticuerpo se detecta detectando un marcador sobre el anticuerpo primario. En otra realización de la divulgación, el anticuerpo primario se detecta detectando la unión de un anticuerpo secundario o reactivo al anticuerpo primario. En otra realización de la divulgación, el anticuerpo secundario está marcado: En la técnica se conocen muchos medios para detectar la unión en un inmunoensayo y entran dentro del alcance de la presente divulgación. Por ejemplo, para seleccionar anticuerpos que reconocen un oligosacárido específico, se pueden someter a ensayo hibridomas generados para un producto que se une a un oligosacárido que contiene dicho epítopo. Para la selección de un anticuerpo específico de un oligosacárido de una especie o cepa concreta de Neisseria, se puede seleccionar sobre la base de la unión positiva con el oligosacárido expresado o aislado en las células de dicha especie o cepa. Los anteriores anticuerpos de la divulgación se pueden usar en procedimientos conocidos en la técnica en relación con la localización y actividad del oligosacárido, por ejemplo para transferencia de tipo western, oligosacárido en imagen in situ, medición de los niveles de los mismos en muestras fisiológicas adecuadas etc. El diagnóstico de infección con una bacteria grampositiva puede usar cualquier formato de inmunoensayo conocido en la técnica, según se desee, Los anticuerpos se pueden marcar para detección in vitro, por ejemplo con marcadores tales como enzimas, fluoróforos, cromóforos, radioisótopos, pigmentos, oro coloidal, partículas de látex y agentes quimioluminiscentes. Como alternativa, los anticuerpos se pueden marcar para detección in vivo, por ejemplo con radioisótopos (preferentemente tecnecio o yodo), reactivos de desplazamiento de resonancia magnética (tales como gadolinio y manganeso); o reactivos radioopacos. Como alternativa, los ácidos nucleicos y secuencias de los mismos de la divulgación se pueden usar en el diagnóstico de la infección con Neisseria, en particular para identificar una cepa concreta o para determinar qué genes de glicosiltransferasa, si alguno, están mutados. Por ejemplo, los genes Igt o fragmentos hibridables de los mismos se pueden usar para hibridación in situ con una muestra de un sujeto que e sospecha que alberga una infección bacteriana por Neisseria. En otra realización de la divulgación, se pueden identificar segmentos génicos de Neisseria usando amplificación por PCR con sondas basadas en los genes Igt de la invención. En un aspecto de la invención, la hibridación con una sonda o con los cebadores de PCR se puede realizar en condiciones rigurosas o con una secuencia específica de una cepa única o un número limitado de cepas de la bacteria; o ambos, lo que permite el diagnóstico de infección con dicha cepa concreta (o cepas). Como alternativa, la hibridación se puede realizar en condiciones menos rigurosas o la secuencia puede ser homóloga en alguna o todas las cepas de una bacteria, lo que permite el diagnóstico de la infección con dicha especie. La presente invención se entenderá mejor en una revisión de la siguientes descripción ilustrativa que presenta los detalles de los construíos y procedimientos seguidos en u desarrollo y validación. Ejemplo Este ejemplo describe un locus en la cepa F62 de Neisseria gonorrhoeae que contiene cinco genes. Cuatro de los genes son responsables de la adición secuencial de GalNAcß13Galß14Glc-NAcß13Galß14 al sustrato Glcß14HepR de la región central interna (Yamasaki y col., 1991, Biochemistry 30:10566). El quinto gen está implicado en la adición del residuo de galactosa unido mediante en la biosíntesis de la estructura alternativa de LOS Gal14Galß14Glcß14HepR (John y col., 1991, J. Biol. Chem. 266:19303). El análisis de la secuencia de ADN reveló que los primero, tercer y cuarto marcos de lectura contenían tractos de poli-G, que en la cepa F62 eran, respectivamente, de 17, 10 y 11 pb. Por tanto, tres de las enzimas biosintéticas de LOS son potencialmente susceptibles a la terminación prematura mediante cambios en el marco de lectura y se ha comunicado para los genes gonocóccicos de pilC (Jonsson y col., 1991, EMBO J. 10:477; Rudel y col., 1992, Molec. Microbiol. 6:3439). Es probable que estas características estructurales sean responsables de la variación genética de alta frecuencia de LOS de gonococos (Schneider y col., 1988, Infect. Imtnun. 56:942). Materiales y procedimientos Reactivos y sustancias químicas. La mayoría de las sustancias químicas de laboratorio se obtuvieron de Sigma- Aldrich (St. Louis, MO). Las enzimas de restricción se obtuvieron del New England Biolabs (Beverly, MA). Condiciones de medio y de crecimiento. Las cepas de E.coli se cultivaron en medio sólido o medio LB líquido (Sambrook y col., 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor); se añadieron antibióticos según sea aplicable. Se usó carbenicilna a 50 g/ml y eritromicina 200 g/ml. La cepa F62 de Neisseria gonorrhoeae se cultivó en agar GC (Swanson, 1978, Infect. Immun. 19:320) o agar GC que contiene 2 g/ml de eritromicina. Para aislamiento de LOS o de ADN genómico, los gonococos se cultivaron en 1,5 % de caldo de proteosa peptona (Difco Laboratories, Detroit MI), fosfato 30 mM, NaCl 8,5 mM suplementado con 1% de isovitalex (Becton Dickinson 16   Microbiology Systems, Cockeysville, MD). Procedimientos de ADN recombinante. Los plásmidos se purificaron usando columnas de Qiagen o las columnas de espín QIAprep obtenidas en Qiagen Inc. (Chatsworth, CA). La digestión con las enzimas de restricción, la electroforesis en gel, las uniones con ADN polimerasa T4 y la transformación de E. coli se efectuaron de acuerdo con Sambrook y col. (Sambrook y col., 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor). Se realizó hibridación de tipo southern en membranas Hybond N+ Amersham Co. (Arlington Heights, IL) con ADN marcado usando el kit ECL de Amersham Co. El ADN genómico se aisló como describen Moxon y col. (Moxon y col., 1984, J. Clin. Invest. 73:298). Se construyó un banco de genes del ADN genómico de la cepa F62 de Neisseria gonorrhoeae uniendo fragmentos de aproximadamente 20 kb obtenidos mediante digestión incompleta con Sau3A en 2001 digerido con BamHI/EcoRI (Karn y col, , 1984, Gene 32:217). La biblioteca de fagos se sometió a detección selectiva mediante hibridación con el plásmido marcado con cebador aleatorio pR10PI y se aislaron 5 clones mediante purificación de las placas. El fago de estos clones se purificó mediante sedimentación, seguida de flotación en CsCl (Davis y col., 1980, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) y se aisló el ADN. De uno de estos clones se aislaron dos fragmentos ClaI de 4,9 y 3,4 kb mediante electroforesis en gel y recuperación con Geneclean II (BIO 101 Inc., La Jolla, CA). Estos se unieron en pBluescript II SK cortado con ClaI de Stratagene (La Jolla, CA) y se denominaron p4900 and p3400 respectivamente. p4900 contenía un sitio PstI y el inserto y se subdividió en dos clones que contenían los insertos de 2,1 y 2,8 kb. El clon que contenía el inserto de 2,8 kb se denominó pPstCla. Los insertos en p3400 y pPstCla se secuenciaron mediante el procedimiento de terminación de la cadena (Sanger y col., 1977, Proc. Natl. Acad Sci. USA 74:5463) usando Sequenasa II, (United States Biochemical Co., Cleveland. OH). Toda la secuencia presentada en la Figura 2 se completó en ambas direcciones. La inserción y las deleciones que se muestran en la Figura 6 se construyeron del siguiente modo. I1, I3, 1 y 2 usaron el plásmido pPstCla cortado respectivamente con BsaBI, AscI, StyI y con doble corte con StyI y BsaBI. I2 y 3 usaron el plásmido p3400 cortad con AgeI o StyI. El locus completo se ensambló clonando el fragmento ClaI - ApaI de p3400 en pPstCla cortado con ClaI y ApaI, y el plásmido se denominó pLOS5. Las deleciones 4 y 5 se construyeron usando pLOS5 y digestión con StyI y BbsI o con StyI sola. En todos los casos (a excepción de la digestión con BsaBI), los plásmidos cortados se trataron con el fragmento Klenow de la ADN polimerasa de E. coli para hacer romos los extremos y se insertó ermC (marcador de resistencia a eritromicina). El gen de ermC se aisló del plásmido pIM13 (Projan y col., 1987, J. Bacteriol. 169:5131) como un fragmento de ClaI - HindIII y se clonó en los mismos sitios en el plásmido pHSS6 (Seifert y col., 1986, Proc. Natl. Acad. Sci. USA 83:735). De este plásmido se escindió como un fragmento NotI, los extremos romos mediante tratamiento con el fragmento Klenow de la ADN polimerasa, purificado mediante electroforesis en gel y recuperación con Geneclean II. La transformación de la cepa F62 de Neisseria gonorrhoeae piliada se realizó con plásmidos aislados de E. coli (Klugman y col., 1989, Infect. Immun. 57:2066) y los transformantes se seleccionaron en agar GC (Swanson, 1978, Infect. Immun. 19:320) con 2 g/ml de eritromicina. La fidelidad de la alteración genómica se cada uno de los transformantes de gonococos se comprobó mediante secuenciación de las uniones anteriores y posterior del gen ermC en su ADN genómico usando una técnica de PCR. Se sintetizaron dos cebadores biotinilados en 5 GCCGAGAAAACTATTGGTGGA (SEC ID Nº 9) y AAAACATGCAGGAATTGACGAT) (SEC ID Nº 10); estos se basaron en la secuencia de ermC cerca de sus extremos 5 y 3, respectivamente. Los cebadores se diseñaron de modo que sus extremos en 3 apuntaran hacia el gen ermC. Cada uno de estos cebadores se usó junto con un cebador adecuado que coincidía con la secuencia del locus LOS cerca de la inserción putativa. La PCR se realizó de acuerdo con las instrucciones suministradas en el kit GeneAmp PCR Reagent de Perkin Elmer (Branchburg, NJ) usando 25 ciclos. En todos los casos se obtuvo el producto del tamaño esperado. La secuencia de ADN de estos productos se determinó purificando el producto de PCR sobre perlas de estreptavidina magnética de Dynal, Inc. (Lake Success, NY) y secuenciando con el kit Sequenasa II de acuerdo con un protocolo proporcionado por Dynal, Inc., basado en el procedimiento desarrollado por Hultman y col. (Hultman et al., 1989, Nucleic Acids Res. 17:4937). Las secuencias se analizaron mediante programas informáticos en el paquete GCG de Genetics Computer Group, Inc. (Madison, WI). Procedimientos inmunológicos. Los anticuerpos monoclonales 17-1-L1 (L1), 9-2-L378 (L3), 2-1-L8 (L8) se obtuvieron como líquidos ascíticos filtrados. El anticuerpo 1-1-M se obtuvo como líquido ascítico y 3F11 y 4C4 se obtuvieron como sobrenadantes de cultivo tisular. Se extrajo el LOS de cada uno de los mutantes de gonococos mediante el procedimiento de fenol-agua en caliente (Westphal y Jann, 1965, Academic Press, New York 83-91) y se purificó tal como se ha descrito (Johnston y col., 1976, J. Exp. Med. 143:741). El LOS se diluyó hasta 200 g/ml en el tampón de transferencia de tipo western descrito por Towbin y col. (Towbin y col., 1979, Proc. Natl. Acad. Sci. USA 76:4350), y alícuotas de 1,5 l se colocaron sobre membrana P Immobilon- de Millipore Corp (Bedford, MA) colocada sobre papel de filtro 3MM Whatman (Whatman Ltd., Maidstone, Reino Unido) empapado en el tampón de transferencia. Las manchas se dejaron absorber en la membrana durante un periodo de 2 minutos y las tiras se 17   colocaron en tampón de bloqueo durante al menos 60 minutos. El tampón de bloqueo consistía en 3% de gelatina disuelta en NaCl 150 mM, Tris-HCl 10 mM, pH 7,5, MgCl2 5 mM, 0,02 % de NaN3. Las tiras se lavaron tres veces en el mismo tampón que contenía 1 % de gelatina. Las tiras se trataron durante 2 horas con anticuerpos monoclonales diluidos en tampón de bloqueo. Los anticuerpos disponibles como líquidos ascíticos se diluyeron 1/1000, los anticuerpos disponibles como sobrenadantes de cultivo tisular a 1/10. Las tiras se lavaron, se incubaron durante 60 minutos con una dilución 1/1000 de anti-IgG,IgA,IgM conjugada con fosfatasa de Cappel (Organon Teknika Co., West Chester, PA), se lavaron y se tiñeron tal como se ha descrito anteriormente. Electroforesis en gel. La electroforesis en gel de las muestras de LOS se realizó como han descrito Lesse y col (Less y col., 1990, J. Immunol. Meth. 126:109) y los geles se tiñeron con plata (Hitchcock y Brown, 1983, J. Bacteriol. 154-269). Resultados Clonación del locus de LOS. Durante los intentos de aislar el gen de la porina de Neisseria gonorrhoeae, repetidamente se aislaron clones de pBR322 que contenían un fragmento de ClaI de 4,9 kb que reaccionó mediante las manchas de colonias con un antisuero de conejo a la porina purificada. Se obtuvo un subclon inmunorreactivo, PR10PI, que consistía en un fragmento de RsaI-ClaI de 1305 pb y se determinó la secuencia de su ADN. Estas secuencia tenía homología con un gen aislado de Haemophilus influenzae denominado lex-1 (Cope y col., 1991, Molec. Microbiol. 5:1113) o lic2A (High y col., 1993, Molec. Microbiol. 9:1275) que se sabe que está implicado en la síntesis de LPS en dicha especie. Usando el subclon pR10PI como sonda. Las transferencias de tipo southern del ADN genómico de Neisseria gonorrhoeae digerido con ClaI reveló hibridación con dos fragmentos, 4,9 y 3,4 kb. No obstante, la digestión con algunas otras enzimas de restricción dio lugar a únicamente una sola banda. Es notable que la digestión con BfaI dio lugar a una única banda de 4,1 kb, lo que sugiere que las dos copias estaban estrechamente unidas (datos no mostrados). Un banco 2001 del ADN de la cepa F62 de Neisseria gonorrhoeae se sometió a detección selectiva mediante hibridación con pR10PI y se aislaron 5 clones. Uno de estos clones, cuando se digirió con ClaI o BfaI y se analizó mediante hibridación de tipo southern usando pR10PI como sonda dio lugar a un patrón idéntico al observado con el ADN genómico. Los fragmentos de ClaI adecuados de este clon 2001 se aislaron y se clonó en el sitio de ClaI de pBluescript II SK. Se determinó toda la secuencia del fragmento de 3400 de ClaI. El mapeo del clon que contiene el fragmento ClaI de 4900 pb indicó que había un único sitio PstI en el clon de aproximadamente 2,8 kb desde un lado, permitiendo dividir el clon en dos subclones. La secuencia parcial de los extremos del subclon de 2,1 kb indicaba que contenía un marco de codificación homólogo a la porción COOH-terminal de E. coli de la subunidad a de la glicil-tARN sintetasa ((glyS) y la mayoría de la subunidad ß de este gen (Webster et al., 1983, J. Biol. Chem. 258:10637). La longitud prevista del ADN necesario para coincidir con la secuencia de E.coli estaba presente; este clon no se investigó más. Secuencia de ADN del locus LOS. En la figura 2 se ilustra un resumen de las características encontradas mediante secuenciación de los dos clones. Tras el gen glyS se encontraron cinco marcos de lectura abiertos especiados estrechamente. El último marco tiene 46 pb en 5 del codón de terminación de una secuencia típica de una señal de terminación independiente de rho. Posteriormente, hay un área de aproximadamente 100 pb que tiene una sorprendente homología con la secuencia de inserción de neisseria IS1106 (Knight y col., 1992, Molec. Microbiol. 6:1565). Posterior aclaración de la naturaleza de este locus, presentado a continuación, mostró los cinco marcos de lectura abiertos para LOS glicosiltransferasas y, por tanto, se han denominado lgtA lgtE- Las búsquedas de homología interna dentro de este locus indica que el ADN que codifica los primeros dos genes (lgtA, lgtB) se repite como los genes cuarto y quinto (lgtD, lgtE) y que se hay interpuesto un marco de lectura abierto adicional, IgtC. Esto está de acuerdo con los datos obtenidos mediante hibridación de tipo southern presentados anteriormente, en los que la sonda pR10PI que contiene el lgtB y una porción del gen lgtC hibridó con dos fragmentos ClaI, peor con sólo un fragmento BfaI (véanse las posiciones de los sitios BfaI en el locus LOS de la Figura 2). Con más detalle los 16 pb tras el codón de terminación de la ARNt sintetasa (glyS) es el comienzo de una estructura de bucle en tallo, seguido estrechamente de un sitio de unión al ribosoma (rbs) consenso y en 6 pb hay un TTG que se cree que es el codón de iniciación de IgtA. Los 2871 pb posteriores, en dirección 3 del comienzo del bucle en tallo (muy cerca después del codón de terminación de IgtC) existe una repetición casi perfecta de la estructura bucle en tallo, el rbs y el codón de iniciación de TTG de IgtD, con la se secuencia en 3' fuertemente homóloga para aproximadamente 500 pb. Las secuencias divergen en alguna medida. No obstante, al principio de lgtB y lgtE, la homología de nuevo pasa a ser casi perfecta durante aproximadamente 200 bases para diverger después hacia la parte última de los orfs. La similitud de las proteínas homólogas se ilustra en las Figuras 3 y 4. Esas comparaciones demuestran la conservación casi perfecta de la estructura primaria en las porciones N-terminal de las moléculas con una divergencia creciente hacia los extremos COOH de las proteínas. La secuencia de IgtC interpuesta entre las porciones referidas del locus no se repute dentro del locus o en el gema 18   de Neisseria gonorrhoeae (datos no mostrados). Parece ser homólogo con los genes rfaI o rfaJ de E. coli, que son genes muy estrechamente relacionados que sirven como glucosiltransferasas en la biosíntesis central de LPS (Pradel y col., 1992, J. Bacteriol. 174:4736). La similitud de rfaI con IgtC se ilustra en la figura 5. Se descubrió que tres de estos genes contenían dentro de su marco de codificación hileras de guanosinas que codifican las tiras de glicina (véase la Figura 2). Estas regiones poli-G se encontraron en lgtA (17 pb), lgtC (10 pb) y IgtD (11 pb); en cada caso, el número se residuos G era uno que mantuvo un marco de lectura intacto (véanse las Figuras 3 y 5). En cada uno de los tres genes, un cambio de 1 o 2 bases G produciría la terminación prematura del tránscrito. Fenotipo LOS de Neisseria gonorrhoea F62 con deleciones del locus de LOS. Con el fin de definir la función de los genes Igt, se construyeron inserciones o deleciones del locus LOS en los plásmidos propagados en e. coli. Las inserciones o deleciones en cada caso estaban marcadas con el gen ermC, que es un excelente marcador selectivo en Neisseria gonorrhoeae (Klugman y col., 1989, Infect. Immun. 57:2066). Las construcciones se resumen el la Figura 6. I1, I2 and I3 se refieren a las inserciones del marcador ermC en, respectivamente, un sitio BsaBl, Agel y AscI. De forma similar, las deleciones se construyeron escindiendo las porciones de los plásmidos y sustituyendo el marcador de eritromicina. Las flechas abiertas indican el gen o genes alterados. Cada uno de estos plásmidos se usó para transformar la cepa F62 de Neisseria gonorrhoeae y los transformantes se seleccionaron en placas que contenían eritromicina. La fidelidad de la alteración genómica de un prototipo de cada uno de los transformantes de gonococos se comprobó mediante secuenciación de las uniones anteriores y posteriores del gen ermC. Para simplificar la nomenclatura en ese informe, los mutantes de gonococos han recibido los nombres usados para identificar las construcciones plasmídicas de la Figura 6. El LOS de los mutantes se analizó mediante SDS-PAGE y se comparó con el LOS de la cepa 1291e. Esta cepa se aisló inicialmente por Dudas and Apicella (Dudas and Apicella, 1988, Infect. Immun. 56:499) como mutante resistente a piocina de la cepa 1291 silvestre y se ha caracterizado extensamente tanto química como genéticamente. El análisis químico ha demostrado que este mutante carece completamente de la sustitución de lacto-N-neotraosa en la heptosa 1 (John y col., 1991, J. Biol. Chem. 266:19303). Se ha definido la base genética de este mutante (Zhou y col., 1994, J. Biol. Chem. 269:11162; Sandlin y Stein, 1994, J. Bacteriol. 176:2930); es una mutación del gen pgm que codifica la fosfoglucomutasa. Esta mutación prohíbe la síntesis de UDP-glucosa y, por tanto, la adición de glucosa a la heptosa. Como se observa en la Figura 7, la cepa F62 silvestre parental da lugar a dos bandas LOS principales; su aspecto es indistinguible de os patrones de SDS-PAGE publicada anteriormente por otros trabajadores (Schneider y col., 1985, Amer. Soc. Microbiology, Washington 400-405). Los mutantes están dispuestos en el gel de acuerdo con el tamaño de la banda principal que contienen. El tamaño disminuye desde la banda superior del LOS de la F62 silvestre en cuatro fases claras al tamaño del LOS de 4 o I2 Dado que el mutante I2 (con una inserción en lgtE, el último gen en el locus) tiene el mismo fenotipo que 4 (que tiene una deleción completa del locus), sugiere que el producto lgtE realiza la primera etapa biosintética. Por tanto, las enzimas codificadas por lgtA-D, aunqye intactas, no tienen un sustrato sobre el que actuar. El mutante 5 (una deleción del locus con la excepción de lgtE) da lugar a un LOS que es un escalón mayor, lo que avala la idea de que este gen representa la etapa biosintética inicial. Obsérvese que el LOS de los mutantes I2 y A4 es percepetiblemente mayor que el LOS de la cepa 1291e, que se sabe que es incapaz de añadir glucosa, el primer residuo en la cadena de lacto-N-neotetraosa. Estos datos sugieren que lgtE codifica la enzima galactosiltransferasa, que añade la primera galactosa de lacto-N-neotetraosa. Las preparaciones de LOS también se estudiaron usando una técnica de transferencia puntual para determinar su reactividad con anticuerpos monoclonales. Los anticuerpos monoclonales empleados y sus especificidades comunicadas se muestran en la Figura 1. Las reacciones observadas con el LOS obtenido de la cepa parental y los mutantes se resumen en la Figura 8. La reactividad de la cepa F62 parental con 1-1-M, 3F11 y L8 fue como la notificada anteriormente por Mandrell y col. (Mandrell y col., 1985, Amer. Soc. Microbiology, Washington 379-384) y por Yamasaki y col. (Yamasaki y col., 1991, Mol. Immunol. 28:1233). Los mutantes A4 y I2 no reaccionan con ninguno de los anticuerpos. No obstante, 5 proporciona una fuerte reacción con los anticuerpos 4C4 y L8, lo que indica que el primer residuo de galactosa está presente. Esto está de acuerdo con los resultados del SDS-PAGE (véase la fig. 6) y avala el papel de lgtE como la galactosiltransferasa, También indica que deleciones antes de lgtE no inactivan de forma significativa su función mediante efectos polares. El LOS de la cepa silvestre parental F62 tiene una fuerte reactividad con L3 y una reactividad débil con 3F11. Se sabe que la reactividad 3F11 está impedida por la adición del residuo GalNAc (Schneider y col., J. Exp. Med. 174:1601); este no es el caso con el anticuerpo L3. El LOS silvestre reacciona con 1-1-M, el anticuerpo reactivo con el residuo terminal GalNAc está presente. La reactividad con 1-1-M se pierde en 3, que tiene una deleción únicamente en lgtD. Esto sugiere que este gen codifica la GalNAc transferasa. La reactividad con el anticuerpo L1 (específico de la estructura del Los alternativo capado con un 14Gal) no se observa con el LOS silvestre, está ausente en I1, y todas las deleciones que afectan a lgtC. La reactividad es más 19   fuerte en 1, que tiene una deleción únicamente en lgtA. Obsérvese que este mutante también ha perdido reactividad con 3F11 y L3. Estos dos hallazgos sugieren que lgtA codifica la GlcNAc transferasa y, cuando este residuo no se añade, la cadena incompleta es un sustrato para la acción de lgtc para producir la estructura alternativa de LOS. Obsérvese que los tamaños de los productos LOS observados en la Figura 7 están de acuerdo con los datos inmunológicos. Esta conclusión sugiere que lgtC codifica la -Gal transferasa. Esto está avalado además por la débil reactividad del 3 mutante con el anticuerpo L1. El mutante 3 tiene una deleción de lgtD y no puede añadir la GalNAc terminal, permitiendo que la -Gal transferasa modifique el grupo de lacto-N-neotretraosa para producir un globósido de tipo Pi (Maridrell, 1992, Infect. Immun. 60:3017). EL mutante I3 (con lgtB inactivo) ha perdido reactividad con 1-1-M, 3F11 y L1 y permanece sólo débilmente reactivo con L3. Junto con el tamaño del producto, estas observaciones sugieren que lgtB codifica la galactosil transferasa añadiendo Galß14 al residuo GlcNAc. La lectina de ricino RCA-I es específica de la galactosa terminal en el enlace ß (Nicolson y Blaustein, 1972, Biochim. Biophys. Acta 266:543; Lin y Li, 1980, Eur. J. Biochem. 105:453) y se usó para confirmar la presencia de esta estructura sobre las preparaciones de LOS. Usando los test de ELISA se descubrió que el LOS silvestre, de 3, 2 y 5, que se pensaba portador de una ßGal terminal, unido a la lectina (véase la Figura 7), mientras que 4, 12, 1 y I3 eran no reactivos (datos no mostrados). Discusión Se ha clonado un locus contiene cinco marcos de lectura abiertos. El efecto de ocho mutaciones definidas dentro de este locus sobre el tamaño y la reactividad serológica del LOS producido por transformantes gonocóccicos sugiere que estos genes son las glicosiltransferasas responsables de la biosíntesis de la mayoría de la cadena de lacto-N-tetraosa. Los datos obtenidos permiten una identificación de la función de cada uno de estos genes. Cabe destacar que lgtB and lgtE, que están estructuralmente estrechamente relacionados, también realizan una tarea biosintética aparentemente muy similar, es decir la adición de Galß14 a GlcNAc o Glc, respectivamente De forma similar, lgtA e lgtD estrechamente relacionados añaden GalNAc o GlcNAc ß13, respectivamente a un residuo de Gal. lgtC, que no está relacionado con los otros genes del locus, es responsable de la adición de un Gal14. La secuencia de ADN mostró que tres de los genes (lgtA, lgtC e IgtD) contiene tractos de guanosinas que codifican residuos de glicina en las proteínas. Estas proporcionan un potencial mecanismo para la variación de alta frecuencia de la expresión de estos genes. El deslizamiento en dichos tractos de poli-G está bien documentado, para controlar la expresión de los genes pilC de gonococos, con efectos resultantes sobre la capacidad de adhesión de los pelos a las células epiteliales humanas (Rudel y col., 1992, Molec. Microbiol. 6:3439). En la cepa F62, los números de las bases de cada una de las tres regiones polo-G fueron tales que las proteínas están en el marco, y esto coincide con la capacidad de F62 silvestre para producir un LOS completo, incluida la adición de GalNAc terminal. Tres aspectos de la biosíntesis de LOS parecen estar potencialmente sujetos a una variación de alta frecuencia. El primero es la afición del GalNAc terminal (lgtD). Esto produciría una alteración de la reactividad con el anticuerpo monoclonal 1-1-M y esta variación de fase ha sido comunicada por van Putten (Van Putten, 1993, EMBO J. 12: 4043). De forma similar, un cambio en lgtA produciría el fallo de la adición de GlcNAca la cadena en crecimiento y truncaría el LOS a nivel de ß lactosilo. Esta es una forma muy habitual de LOS en gonococos con una molécula de 3,6 kilodalton, que confiere resistencia al efecto bactericida de suero humano normal (Schneider y col., 1985, Infect. Immun. 50:672). Es tentador especular que la variación in vitro entre la variante A y C de MS11mk desde la cadena de ß-lactosilo hasta un LOS completo (Que tenía la ventaja selectiva in vivo en los voluntarios) podría explicarse conservando la expresión funcional de la GlcNAc transferasa de lgtA, Por último, la adición variable de 14Gal al ß-lactosilo (globotriosa de pk similar) o el grupo lacto-N-neotetraosa (globósido de Pi similar) (Mandrell, 1992, Infect. Immun. 60:3017) estaría bajo el control de la expresión de IgtC. La actividad de la lgtC transferasa parece competir ligeramente con las otras transferasas por el precursor y su actividad es evidente sólo si lgtA o lgtD son silentes. Pata el trisacárido Gal14Galß14Glc que se va a sintetizar, la GIcNAc transferasa lgtA debe estar inactiva y para la expresión del globósido similar a Pi Gal14Galß14Glc-NAcß13Galß14Glc, el gen IgtD de GalNAc transferasa debe estar silente. También se ha observado una comparable variación antigénica de frecuencia alta del LOS de Haemophilus influenzae y se ha atribuido a cambios en el marco traduccional producidos por desplazamientos en el número de repeticiones CAAT en dos loci distintos, licl (Weiser y col., 1989, Cell 59:657) y lic2 (High y col., 1993, Molec. Microbiol. 9:1275) Los desplazamientos que permiten la expresión del gen lic2 se correlacionan con la expresión de un epítopo con la estructura Gal14Galß1. Dado que el gen lic2 es homólogo a lgtB e lgtE, las galactosiltransferasas que unen Galß14 a respectivamente Glc o GlcNAc, es probable que esta sea su función en la síntesis de LOS de Haemophilus influenzae. Es importante que, mientras que estos patógenos mucosos han desarrollado mecanismos de desplazamiento de marco para producir variación antigénica del LOS, los homólogos gonocóccicos de lic2 (lgtB e lgtE) no son los que contienen tractos de poli-G. Aunque los mecanismos de desplazamiento de marco tratados anteriormente son adecuados para la regulación   on/off de la expresión génica, la estructura del locus también se proporciona una regulación más sutil del nivel de expresión de los genes. Se ha demostrado que la velocidad de crecimiento afecta a la distribución del peso molecular y al carácter antigénico de las especies de LOS producidas (Morse y col., 1983, Infect. Immun. 41:74 Aunque los autores no han determinado el tamaño de los tránscritos de ARN, es muy probable que lgtA, lgtB e lgtC (en el caso en el que los trastos de poli-G sean tales que se mantiene el marco de codificación) se transcriben juntos, El codón de terminación de lgta y el codón de iniciación de lgtB de hecho solapan y la distancia entre TAA e lgtB y el codón ATG de lgtC es únicamente de 11 pb, De forma similar, El codón de terminación de lgtD y el codón de iniciación de lgtE sólo están separados por 18 pb. Aunque la organización es tal que si cualquiera de los tres genes sometidos a variación de fase están en la configuración off, la transcripción puede reiniciarse de forma eficaz al principio del gen siguiente Esta capacidad para reiniciar la transcripción se observó claramente con las mutaciones construidas en este estudio. La correlación de la estructura del LOS con la función todavía está en sus primeras etapas. Los principales avances en el campo han sido el desarrollo de una comprensión de la estructura de las moléculas y la capacidad pare relacionarlo, a menudo de forma no ambigüa, con la reactividad con una serie de anticuerpos monoclonales bien caracterizados. A estos e añade la realización de que en el ambiente in vivo, que proporciona CMP-NANA, el organismo puede o no sialilar el LOS, en función de su el LOS sintetizado es una estructura aceptora competente. Es bien conocido que la sialilación induce un estado resistente en suero en muchas cepas. No obstante, el efecto de la sialilación en la infección local no está tan bien estudiada, van Putten ha mostrado que la sialilación de LOS tiene un marcado efecto inhibidor sobre la invasión celular epitelial, sin aparentemente alterar considerablemente la adhesión (Putten, 1993, EMBO J. 12:4043) Sus estudios sugieren que, en la infección mucosa las estructuras de LOS que no se pueden sialilar pueden ser importantes para la invasión de células eficiente. En el contexto de este informe, dichas estructuras se pudieron conseguir mediante la adición eficiente de GalNAc terminal o acortando la cadena del LOS silenciando la GlcNAc transferasa. La correlación de la química del LOS con la reacción biológica se ha visto complicada por la pérdida de los mutantes LOS existentes mediante selección con piocina (Dudas y Apicella, 1988, Infect. Immun. 56:499; Sandlin y col., 1993, Infect. Immun. 61: 3360). De hecho, un ejemplo con el mutante 1291e, que muestra la adición de la banda principal de peso molecular, una banda adicional mayor (véase la Figura 7)- La nueva idea proporcionada a la genética de la biosíntesis de gonococos permitirá la construcción de mutantes que no han perdido peso. Por ejemplo, , 4 y 5 deben ser mutantes estables, ya que no contienen genes con los tractos poli-G. La expresión de los genes que contenían los tractos de poli-G podrían estabilizase mediante ingeniería en las zonas de modo que la glicinas se codifican en otros codones. La presente invención no está limitada en su ámbito por las realizaciones específicas descritas en el presente documento, ya que con dichas realizaciones se pretenden ilustraciones sencillas de un aspecto de la invención y cualquier realización funcionalmente equivalente están dentro del alcance de la presente invención. De hecho, varias modificaciones de la invención, además de las mostradas y descritas en la presente memoria descriptiva, se pondrán de manifiesto para los expertos en la técnica a partir de la descripción anterior y las figuras adjuntas. También se pretende que dichas modificaciones entren dentro del alcance de las reivindicaciones adjuntas. También se entiende que todos los tamaños de pares de bases dados para nucleótidos son aproximados y se usan para el fin de la descripción. 21  


Reivindicaciones:

1.- Un procedimiento de fabricar una estructura oligosacárida de Neisseria que comprende las etapas de delecionar un marco de lectura abierta que codifica una glicosiltransferasa de una cepa de Neisseria seleccionada de la lista que consiste en: LgtA, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae la SEC ID Nº 3, LgtB, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae la SEC ID Nº 8, LgtC, , siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae de la SEC ID Nº 4, LgtD, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae de la SEC ID Nº 5 e LgtE, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae 6, y preparar la estructura oligosacárida alterada de Neisseria a partir de dicha cepa. 2.- Un procedimiento de fabricar una preparación de vacuna eficaz contra las nuevas cepas de Neisseria que comprende las etapas de delecionar un marco de lectura abierto que codifica una glicosiltransferasa de una cepa de Neisseria seleccionada de la lista que consiste en: LgtA, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae SEC ID Nº 3, LgtB, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae es de la SEC ID Nº 8, LgtC, , siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae de la SEC ID Nº 4, LgtD, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae de la SEC ID Nº 5 e LgtE, siendo su secuencia de aminoácidos de la cepa F62 de Neisseria gonorrhoeae 6, preparar una estructura oligosacárida alterada de Neisseria a partir de dicha cepa y formular dicha estructura oligosacárida de neisseria alterada de neisseria en una preparación de vacuna. 22   23   24     26   27   28   29     31   32   33   34     36   37   38   39     41   42   43   44  




Acerca de · Contacto · Patentados.com desde 2007 hasta 2014 // Última actualización: 01/08/2014.