Composiciones y métodos para modular la producción de pigmentos en plantas.

Un polinucleótido aislado que comprende una secuencia que codifica un polipéptido con al menos el 90 % de identidad con las secuencias de aminoácidos de SEC ID Nº: 1

, en el que el % de identidad se calcula con respecto a la longitud completa de la secuencia de aminoácidos, y en el que el polipéptido es un factor de transcripción capaz de al menos uno de:

i) regular por incremento la producción de antocianina en una planta; y

ii) regular por incremento un promotor de un gen en la vía biosintética de antocianina.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/NZ2006/000221.

Solicitante: THE NEW ZEALAND INSTITUTE FOR PLANT AND FOOD RESEARCH LIMITED.

Nacionalidad solicitante: Nueva Zelanda.

Dirección: MT ALBERT RESEARCH CENTRE 120 MT ALBERT ROAD MT ALBERT, AUCKLAND NUEVA ZELANDA.

Inventor/es: ESPLEY,RICHARD, HELLENS,ROGER, ALLAN,ANDREW.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/82 (para células vegetales)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/415 (de vegetales)
google+ twitter facebookPin it
Ilustración 1 de Composiciones y métodos para modular la producción de pigmentos en plantas.
Ilustración 2 de Composiciones y métodos para modular la producción de pigmentos en plantas.
Ilustración 3 de Composiciones y métodos para modular la producción de pigmentos en plantas.
Ilustración 4 de Composiciones y métodos para modular la producción de pigmentos en plantas.
Ver la galería de la patente con 11 ilustraciones.
Composiciones y métodos para modular la producción de pigmentos en plantas.

Texto extraído del PDF original:

DESCRIPCIÓN

Composiciones y métodos para modular la producción de pigmentos en plantas

Campo técnico

La presente invención está en el campo del desarrollo de pigmentos en plantas.

Técnica anterior

La acumulación de pigmentos de antocianina es un determinante importante de la calidad de la fruta. Los pigmentos proporcionan diferenciación de cultivares esencial para los consumidores y participan en los atributos de salud de la fruta de la manzana (Boyer y Liu, 2004).

Los pigmentos de antocianina pertenecen al variado grupo de metabolitos secundarios ubicuos, conjuntamente conocidos como flavonoides. En las plantas, los flavonoides participan en numerosas funciones biológicas, que incluyen la defensa, mientras que los compuestos de antocianina pigmentados en particular desempeñan una función fisiológica vital como atrayentes en interacciones planta/animal.

Los precursores predominantes para todos los flavonoides, que incluyen antocianinas, son malonil-CoA y p- cumaroil-CoA. A partir de estos precursores, la enzima chalcona sintasa (CHS) forma la chalcona, la primera etapa comprometida hacia la producción de antocianina y el establecimiento del esqueleto C15. Entonces, la chalcona se isomeriza por chalcona isomerasa (CHI) para producir chalcona naringenina y a partir de aquí una etapa de hidroxilación mediante flavanona 3-hidroxilasa (F3H) convierte la naringenina en dihidroflavonol. La reducción de la dihidroflavonona por dihidroflavonol 4-reductasa (DFR) produce leucoantocianina, que se convierte en el compuesto coloreado antocianindina por leucoantocianidina dioxigenasa (LDOX), mientras que la etapa de glicosilación final está mediada por uridin difosfato (UDP)-glucosa:flavonoide 3-0-glucosiltransferasa (UFGT). La diferencia en el color de la antocianina puede ser debida a varios factores que incluyen la estructura molecular y el tipo y número de grupos hidroxilo, azúcares y ácidos unidos, y el entorno celular tal como el pH o la ultraestructura. De los muchos pigmentos de antocianina está la cianidina, en la forma de cianidin 3-0-galactósido, que es principalmente responsable de la coloración roja de la piel de la manzana y se han descrito bien las enzimas en esta vía biosintética para la manzana (Kim et al., 2003, Plant Science 165,403-413; Honda et al., 2002, Plant Physiology and Biochemistry 40, 955-962). Se ha observado desde hace tiempo que las antocianinas se elevan en respuesta a estímulos ambientales, del desarrollo y patógenos particulares. La investigación en la fruta de la manzana ha demostrado tanto la regulación ambiental como del desarrollo de la acumulación de antocianinas. Puede inducirse la biosíntesis de pigmentos cuando la fruta se somete a luz blanca, o más significativamente, luz UV, un fenómeno también observado en otras especies. Además, los niveles de antocianinas pueden elevarse por almacenamiento a temperatura fría de la fruta. Hay evidencia de la inducción coordinada de enzimas antocianinas en un modo del desarrollo en la fruta de la manzana con pronunciada actividad enzimática de antocianinas y la pigmentación correlacionada aumenta en fruta inmadura y luego de nuevo en la maduración que parece depender del cultivar.

Estudios muestran que hay regulación de genes altamente específica en la vía de antocianina por unión específica de factores de transcripción (TF) como complejos con elementos promotores (Holton y Cornish, 1995, Plant Cell 7, 1071-1083). Esta regulación también puede extenderse a genes no de la vía tales como proteínas del transporte de antocianinas.

Se ha mostrado que los TF MYB desempeñan una función importante en la regulación transcripcional de las antocianinas. Los MYB de planta participan en el control de vías tan diversas como el metabolismo secundario (incluyendo la vía de antocianinas), desarrollo, transducción de señales y resistencia a enfermedades (Jin y Martin, 1999, Plant Mol Biol, 41, 577-585). Se caracterizan por un dominio de unión a ADN estructuralmente conservado que consiste en repeticiones imperfectas individuales o múltiples; aquellas asociadas a la vía de antocianinas tienden a la clase de dos repeticiones (R2R3). La regulación también puede ser específica para grupos discretos de genes, tanto tempranos como tardíos, en la vía biosintética de antocianina. En las hojas de perilla, Perilla frutescens, se ha observado regulación conducida por TF en prácticamente todas las etapas de la biosíntesis de antocianinas desde CHS hasta los genes de transporte de la proteína antocianina resultante, mientras que en uva, Vitis vinifera, la regulación específica por MybA está limitada al punto final de la producción de proteína (UFGT).

Hay aproximadamente 140 TF MYB R2R3 en Arabidopsis, divididos en 24 subgrupos (Stracke et al. 2001, Current Opinion in Plant Biology, 4, 447-556). La Producción del Pigmento de Antocianina 1 (PAP1) MYB (Borevitz et al., 2000, Plant Cell, 12, 2383-2394) se clasifica en el subgrupo 10 (cuando se usa filogenia de Stracke et al., 2001) y demuestra un alto grado de conservación de aminoácidos con otros reguladores de antocianina conocidos. Cuando PAP1 se expresó en exceso en Arabidopsis transgénica esto condujo a la regulación por incremento de varios genes en la vía de biosíntesis de antocianinas desde PAL hasta CHS y DFR (Borevitz et al., 2000, Plant Cell, 12, 2383- 2394; Tohge et al., 2005, Plant Journal, 42, 218-235).

En general, los MYB interaccionan estrechamente con TF de hélice de bucle de hélice básica (bHLH), y esto se ha estudiado ampliamente en relación con la producción de flavonoides (Mol et al., 1996; Winkel-Shirley, 2001). Ejemplos incluyen los MYB ZmC y bHLH ZmB de maíz y MYB AN2 y bHLH AN1/JAF13 de petunia (Goff et al., 1992 Genes Dev, 6, 864-875; Mol et al., 1998, Trends in Plant Science, 3, 212-217). Evidentemente, hay un grado de conservación, en diferentes especies, para esta coordinación. Sin embargo, una asociación MYB-bHLH no es siempre necesaria. Resultados de la expresión en exceso de PAP1 sugirieron que, al igual que MYB P de maíz (Grotewold et al., 2000 Proc Natl Acad Sci USA, 97, 13579-13584) y MYB12 de Arabidopsis (Mehrtens et al., 2005 Plant Physiology, 138, 1083-1096), PAP1 no requirió un co-regulador de bHLH expresado en exceso para conducir a un enorme aumento en la producción de antocianina. Sin embargo, estudios adicionales mostraron que PAP1 interacciona estrechamente con bHLH conduciendo a la fuerte activación del promotor (DFR) en ensayos in vivo (Zimmermann et al., 2004 Plant J, 40, 22-34). Más recientemente, análisis integrados de transcriptoma y metaboloma de líneas que expresan en exceso PAP1 confirmaron que PAP1 regula por incremento bHLH TT8 (At4 g09820) 18 veces (Tohge et al., 2005, Plant J, 42, 218-235). Esta dependencia sobre un co-regulador está asociada a un pequeño número de cambios de aminoácidos en el dominio de unión de R2R3 altamente conservado como es evidente en la comparación entre el MYB P de maíz independiente de bHLH y C1 de maíz dependiente de bHLH, y es suficiente para dirigir la activación de distintos conjuntos de genes diana (Grotewold et al., 2000, Proc Natl Acad Sci USA, 97, 13579-13584). En este estudio, la sustitución de solo seis aminoácidos del dominio R2R3 de C1 en las posiciones correspondientes en P1 produjo un mutante con comportamiento dependiente de bHLH similar a C1. Más recientemente se sugirió que esto puede ser un mecanismo clave que permite a MYB discriminar entre genes diana (Hernandez et al., 2004, J. Biol. Chem, 279, 48205-48213). Estos aminoácidos clave están marcados en la Figura 1. A diferencia de PAP1, FaMYB1, reprime la biosíntesis de antocianinas durante el desarrollo tardío de la fruta fresa. A pesar de esta función alternativa, FaMYB1 comparte homología con MYB de activación y puede interaccionar con (activación) bHLH tales como AN1 y JAF13 de Petunia (Aharoni et al., 2001, Plant J, 28, 319-332). A pesar de que los residuos clave son los mismos para activadores tipo PAP y represores tipo FaMYB, los activadores tienden a clasificarse en el subgrupo 10, mientras que los represores se clasifican en el subgrupo 17 (según Stracke et al.).

Un nivel adicional de regulación de antocianinas implica una clase separada de proteínas, que contiene dominios WD40, que forman complejos con proteínas MYB y bHLH (como se revisa en Ramsay y Glover, 2005, Trends in Plant Science, 10, 63-70). Ejemplos incluyen an11 en petunia (de Vetten et al., 1997 Genes Dev, 11, 1422-1434) y

TTG1 en Arabidopsis (Walker et al., 1999, Plant Cell, 11, 1337-1350). El control transcripcional de las antocianinas puede complicarse adicionalmente por regulación específica de tejido (Kubo et al., 1999, Plant Cell, 11, 1217-1226) y posiblemente diferentes capas de regulación dependientes de estímulos tales como frío, luz y señales de desarrollo (Davuluri et al., 2005, Nature Biotechnology, 23, 890-895).

Aunque estudios en la activación y represión de la síntesis de antocianinas en la fruta de la manzana han mostrado regulación del desarrollo y medioambiental, hasta la fecha los factores de transcripción que regulan la síntesis de antocianinas no se han identificado en esta especie o cualquier otra fruta caduca. El control de la acumulación de antocianinas en la manzana es una cuestión clave en el entendimiento y manipulación del color de la fruta. La identificación de los factores que ejercen ese control proporciona herramientas para moderar el grado y distribución de la pigmentación derivada de antocianinas en el tejido de fruta.

Es, por tanto, un objetivo de la invención proporcionar secuencias de factores de transcripción que regulen la producción de antocianina en las especies de manzana y/o al menos proporcionen al público una elección útil.

Sumario de la invención

En el primer aspecto, la invención proporciona un polinucleótido aislado que comprende una secuencia que codifica un polipéptido con al menos el 90 % de identidad con la secuencia de aminoácidos de SEC ID Nº: 1, en el que el % de identidad se calcula con respecto a la longitud completa de la secuencia de aminoácidos, y en el que el polipéptido es un factor de transcripción que puede ser al menos uno de i) regular por incremento la producción de antocianina en una planta; y i) regular por incremento el promotor de un gen en la vía biosintética de antocianina.

Preferentemente, el polipéptido tiene la secuencia de aminoácidos de SEC ID Nº:1.

En otra realización, la secuencia tiene al menos el 70 % de identidad con la secuencia de una cualquiera de SEC ID Nº: 5 y 102. Preferentemente, la secuencia tiene al menos el 70 % de identidad con la secuencia codificante de una cualquiera de SEC ID Nº: 5 y 102.

En otra realización, la secuencia tiene al menos el 70 % de identidad con la secuencia de SEC ID Nº: 5.

Preferentemente, la secuencia tiene al menos el 70 % de identidad con la secuencia codificante de SEC ID Nº: 5. Más preferentemente, la secuencia tiene la secuencia de SEC ID Nº: 5. Más preferentemente, la secuencia tiene la secuencia codificante de SEC ID Nº: 5.

En una realización, el gen que va a regularse codifica dihidroflavonol 4-reductasa (DFR).

En una realización alternativa, el gen que va a regularse codifica chalcona sintasa (CHS).

En otro aspecto, el polinucleótido aislado comprende además: en el que el polipéptido comprende la secuencia de SEC ID Nº:101.

Preferentemente, el polipéptido de variante se deriva de una especie de Rosaceae.

En otro aspecto, la invención proporciona un polinucleótido que codifica un polipéptido de la invención.

En otro aspecto, la invención proporciona un anticuerpo producido contra un polipéptido de la invención.

En otro aspecto, la invención proporciona una construcción genética que comprende un polinucleótido de uno cualquiera de la invención.

En otro aspecto, la invención proporciona una célula huésped que comprende una construcción genética de la invención.

En otro aspecto, la invención proporciona una célula huésped genéticamente modificada para expresar un polinucleótido de uno cualquiera de la invención.

En otro aspecto, la invención proporciona una célula de planta que comprende la construcción genética de la invención.

En otro aspecto, la invención proporciona una célula de planta genéticamente modificada para expresar un polinucleótido de la invención.

En otro aspecto, la invención proporciona una planta que comprende la célula de planta de la invención.

En otro aspecto, la invención proporciona un método para producir un polipéptido de la invención, comprendiendo el método la etapa de cultivar una célula huésped que comprende una construcción genética de la invención.

En otro aspecto, la invención proporciona una célula de planta o planta con producción de antocianina alterada, comprendiendo el método la etapa de transformación de una célula de planta o planta con una construcción genética que incluye: a) al menos un polinucleótido que codifica un polipéptido de la invención.

En otro aspecto, la invención proporciona un método de producir una célula de planta o planta con producción de antocianina alterada, comprendiendo el método la etapa de transformar una célula de planta o planta con una construcción genética que incluye: a) al menos uno de los polinucleótidos de uno cualquiera de la invención.

En otro aspecto, la invención proporciona una planta producida por el método de la invención.

En otro aspecto, la invención proporciona un método para seleccionar una planta alterada en la producción de antocianina, comprendiendo el método probar una planta para expresión alterada de un polinucleótido de la invención.

En otro aspecto, la invención proporciona un método para seleccionar una planta alterada en la producción de antocianina, comprendiendo el método probar una planta para expresión alterada de un polipéptido de la invención.

En otro aspecto, la invención proporciona una planta seleccionada por el método de la invención.

Preferentemente, los factores de transcripción y variantes de la invención, que pueden regular la producción de antocianina en plantas, pueden regular la producción de las antocianinas seleccionadas del grupo que incluye, pero no se limitan a: cianidin-3-glucósido, cianidin-3-0-rutinósido, cianadin-3-glucósido y cianadin-3-pentósido.

Preferentemente, las plantas o células vegetales con producción de antocianina alterada, producidas por o seleccionadas por los métodos de la invención, están alteradas en la producción de antocianina seleccionadas del grupo que incluye, pero no se limitan a: cianadin-3-glucosidasa, cianidin-3-0-rutinósido, cianadin-3-glucósido y cianadin-3-pentósido.

Los polinucleótidos y variantes de polinucleótidos de la invención pueden derivarse de cualquier especie o pueden producirse por medios recombinantes o sintéticos.

En una realización, el polinucleótido o variante se deriva de una especie de planta.

En otra realización, el polinucleótido o variante se deriva de una especie de planta gimnosperma.

En otra realización, el polinucleótido o variante se deriva de una especie de planta angiosperma.

En otra realización, el polinucleótido o variante se deriva de una especie de planta dicotiledónea.

Los polipéptidos y variantes de polipéptidos de la invención pueden derivarse de cualquier especie, o pueden producirse por medios recombinantes o sintéticos.

En una realización, los polipéptidos o variantes de la invención se derivan de especies de planta.

En otra realización, los polipéptidos o variantes de la invención se derivan de especies de plantas gimnospermas.

En otra realización, los polipéptidos o variantes de la invención se derivan de especies de plantas angiospermas.

En otra realización, los polipéptidos o variantes de la invención se derivan de especies de plantas dicotiledóneas.

En otra realización, el polipéptido o variante se deriva de una especie de planta monocotiledónea.

Las células vegetales y plantas de la invención pueden ser de cualquier especie.

En una realización, las células de planta y plantas de la invención son de especies gimnospermas.

En otra realización, las células de planta y plantas de la invención son de especies angiospermas.

En otra realización, las células de planta y plantas de la invención son de especies dicotiledóneas.

En otra realización, las células de planta y plantas de la invención son de especies monocotiledóneas.

Especies de plantas preferidas (para el polinucleótido y variantes, polipéptidos y variantes y células vegetales y plantas de la invención) incluyen especies de plantas frutales seleccionados de un grupo que comprende, pero no se limitan a, los siguientes géneros: Malus, Pyrus Prunis, Rubus, Rosa, Fragaria, Actinidia, Cydonia, Citrus y Vaccinium.

Especies de plantas frutales particularmente preferidas son: Malus domestica, Actidinia deliciosa, A. chinensis, A. eriantha, A. arguta e híbridos de las cuatro especies de Actinidia, Prunis persica, Pyrus L., Rubus, Rosa y Fragaria.

Plantas preferidas (para el polinucleótido y variantes, polipéptidos y variantes y células vegetales y plantas de la invención) también incluyen especies de planta vegetales seleccionadas de un grupo que comprende, pero no se limita a, los siguientes géneros: Brassica, Lycopersicon y Solanum.

Especies de plantas vegetales particularmente preferidas son: Lycopersicon esculentum y Solanum tuberosum.

Plantas preferidas (para el polinucleótido y variantes, polipéptidos y variantes y células vegetales y plantas de la invención) también incluyen especies de plantas de cultivo seleccionadas de un grupo que comprende, pero no se limita a, los siguientes géneros: Glycine, Zea, Hordeum y Oryza.

Especies de plantas de cultivo particularmente preferidas incluyen Glycine max, Zea mays y Oryza sativa.

Plantas preferidas (para el polinucleótido y variantes, polipéptidos y variantes y células vegetales y plantas de la invención) también incluyen aquellas de la familia Rosaceae.

Géneros de Rosaceae preferidos incluyen Exochorda, Maddenia, Oemleria, Osmaronia, Prinsepia, Prunus,

Maloideae, Amelanchier, Aria, Aronia, Chaenomeles, Chamaemespilus, Cormus, Cotoneaster, Crataegus, Osmaronia, Prinsepia, Prunus, Maloideae, Amelanchier, Aria, Aronia, Chaenomeles, Chamaemespilus, Cormus, Cotoneaster, Crataegu, Cydonia, Dichotomanthes, Docynia, Docyniopsis, Eriobotrya, Eriolobus, Heteromeles, Kageneckia, Lindleya, Malacomeles, Malus, Mespilus, Osteomeles, Peraphyllum, Photinia, Pseudocydonia, Pyracantha, Pyrus, Rhaphiolepis, Sorbus, Stranvaesia, Torminalis, Vauquelinia, Rosoideae, Acaena, Acomastylis,

Agrimonia, Alchemilla, Aphanes, Aremonia, Bencomia, Chamaebatia, Cliffortia, Coluria, Cowania, Dalibarda, Dendriopoterium, Dryas, Duchesnea, Erythrocoma, Fallugia, Filipendula, Fragaria, Geum, Hagenia, Horkelia, Ivesia, Kerria, Leucosidea, Marcetella, Margyricarpus, Novosieversia, Oncostylus, Polylepis, Potentilla, Rosa, Rubus, Sanguisorba, Sarcopoterium, Sibbaldia, Sieversia, Taihangia, Tetraglochin, Waldsteinia, Rosaceae incertae sedis, Adenostoma, Aruncus, Cercocarpus, Chamaebatiaria, Chamaerhodos, Gillenia, Holodiscus, Lyonothamnus, Neillia,

Neviusia, Physocarpus, Purshia, Rhodotypos, Sorbaria, Spiraea y Stephanandra.

Especies de Rosaceae preferidas incluyen Exochorda giraldii, Exochorda racemosa, Exochorda, Exochorda giraldii, Exochorda racemosa, Exochorda serratifolia, Maddenia hypoleuca, Oemleria cerasiformis, Osmaronia cerasiformis, Prinsepia sinensis, Prinsepia uniflora, Prunus alleghaniensis, Prunus americana, Prunus andersonii, Prunus angustifolia, Prunus apetala, Prunus argentea, Prunus armeniaca, Prunus avium, Prunus bifrons, Prunus brigantina,

Prunus bucharica, Prunus buergeriana, Prunus campanulata, Prunus caroliniana, Prunus cerasifera, Prunus cerasus, Prunus choreiana, Prunus cocomilia, Prunus cyclamina, Prunus davidiana, Prunus debilis, Prunus domestica, Prunus dulcis, Prunus emarginata, Prunus fasciculata, Prunus ferganensis, Prunus fordiana, Prunus fremontii, Prunus fruticosa, Prunus geniculata, Prunus glandulosa, Prunus gracilis, Prunus grayana, Prunus hortulana, Prunus ilicifolia, Prunus incisa, Prunus jacquemontii, Prunus japonica, Prunus kuramica, Prunus laurocerasus, Prunus leveilleana,

Prunus lusitanica, Prunus maackii, Prunus mahaleb, Prunus mandshurica, Prunus maritima, Prunus maximowiczii, Prunus mexicana, Prunus microcarpa, Prunus mira, Prunus mume, Prunus munsoniana, Prunus nigra, Prunus nipponica, Prunus padus, Prunus pensylvanica, Prunus persica, Prunus petunnikowii, Prunus prostrata, Prunus pseudocerasus, Prunus pumila, Prunus rivularis, Prunus salicina, Prunus sargentii, Prunus sellowii, Prunus serotina, Prunus serrulata, Prunus sibirica, Prunus simonii, Prunus spinosa, Prunus spinulosa, Prunus subcordata, Prunus

subhirtella, Prunus takesimensis, Prunus tenella, Prunus texana, Prunus tomentosa, Prunus tschonoskii, Prunus umbellata, Prunus verecunda, Prunus virginiana, Prunus webbii, Prunus x yedoensis, Prunus zippeliana, Prunus sp. BSP-2004-1, Prunus sp. BSP-2004-2, Prunus sp. EB-2002, Amelanchier alnifolia, Amelanchier arborea, Amelanchier asiatica, Amelanchier bartramiana, Amelanchier canadensis, Amelanchier cusickii, Amelanchier fernaldii, Amelanchier florida, Amelanchier humilis, Amelanchier intermedia, Amelanchier laevis, Amelanchier lucida,

Amelanchier nantucketensis, Amelanchier pumila, Amelanchier quinti-martii, Amelanchier sanguinea, Amelanchier stolonifera, Amelanchier utahensis, Amelanchier wiegandii, Amelanchier x neglecta, Amelanchier bartramiana x Amelanchier sp. 'dentata', Amelanchier sp. 'dentata', Amelanchier sp. 'erecta', Amelanchier sp. 'erecta' x Amelanchier laevis, Amelanchier sp. 'serotina', Aria alnifolia, Aronia prunifolia, Chaenomeles cathayensis, Chaenomeles speciosa, Chamaemespilus alpina, Cormus domestica, Cotoneaster apiculatus, Cotoneaster lacteus, Cotoneaster pannosus,

Crataegus azarolus, Crataegus columbiana, Crataegus crus-galli, Crataegus curvisepala, Crataegus laevigata, Crataegus mollis, Crataegus monogyna, Crataegus nigra, Crataegus rivularis, Crataegus sinaica, Cydonia oblonga, Dichotomanthes tristaniicarpa, Docynia delavayi, Docyniopsis tschonoskii, Eriobotrya japonica, Eriobotrya prinoides, Eriolobus trilobatus, Heteromeles arbutifolia, Kageneckia angustifolia, Kageneckia oblonga, Lindleya mespiloides, Malacomeles denticulata, Malus angustifolia, Malus asiatica, Malus baccata, Malus coronaria, Malus doumeri, Malus

florentina, Malus floribunda, Malus fusca, Malus halliana, Malus honanensis, Malus hupehensis, Malus ioensis, Malus kansuensis, Malus mandshurica, Malus micromalus, Malus niedzwetzkyana, Malus ombrophilia, Malus orientalis, Malus prattii, Malus prunifolia, Malus pumila, Malus sargentii, Malus sieboldii, Malus sieversii, Malus sylvestris, Malus toringoides, Malus transitoria, Malus trilobata, Malus tschonoskii, Malus x domestica, Malus x domestica x Malus sieversii, Malus x domestica x Pyrus communis, Malus xiaojinensis, Malus yunnanensis, Malus sp., Mespilus

germanica, Osteomeles anthyllidifolia, Osteomeles schwerinae, Peraphyllum ramosissimum, Photinia fraseri, Photinia pyrifolia, Photinia serrulata, Photinia villosa, Pseudocydonia sinensis, Pyracantha coccinea, Pyracantha fortuneana, Pyrus calleryana, Pyrus caucasica, Pyrus communis, Pyrus elaeagrifolia, Pyrus hybrid cultivar, Pyrus pyrifolia, Pyrus salicifolia, Pyrus ussuriensis, Pyrus x bretschneideri, Rhaphiolepis indica, Sorbus americana, Sorbus aria, Sorbus aucuparia, Sorbus californica, Sorbus commixta, Sorbus hupehensis, Sorbus scopulina, Sorbus sibirica,

Sorbus forminalis, Stranvaesia davidiana, Torminalis clusii, Vauquelinia californica, Vauquelinia corymbosa, Acaena anserinifolia, Acaena argentea, Acaena caesiiglauca, Acaena cylindristachya, Acaena digitata, Acaena echinata, Acaena elongata, Acaena eupatoria, Acaena fissistipula, Acaena inermis, Acaena laevigata, Acaena latebrosa, Acaena lucida, Acaena macrocephala, Acaena magellanica, Acaena masafuerana, Acaena montana, Acaena multifida, Acaena novaezelandiae, Acaena ovalifolia, Acaena pinnatifida, Acaena splendens, Acaena subincisa,

Acaena x anserovina, Acomastylis elata, Acomastylis rossii, Acomastylis sikkimensis, Agrimonia eupatoria, Agrimonia nipponica, Agrimonia parviflora, Agrimonia pilosa, Alchemilla alpina, Alchemilla erythropoda, Alchemilla japonica, Alchemilla mollis, Alchemilla vulgaris, Aphanes arvensis, Aremonia agrimonioides, Bencomia brachystachya, Bencomia caudata, Bencomia exstipulata, Bencomia sphaerocarpa, Chamaebatia foliolosa, Cliffortia burmeana, Cliffortia cuneata, Cliffortia dentata, Cliffortia graminea, Cliffortia heterophylla, Cliffortia nitidula, Cliffortia

odorata, Cliffortia ruscifolia, Cliffortia sericea, Coluria elegans, Coluria geoides, Cowania stansburiana, Dalibarda repens, Dendriopoterium menendezii, Dendriopoterium pulidoi, Dryas drummondii, Diyas octopetala, Duchesnea chrysantha, Duchesnea indica, Erythrocoma triflora, Fallugia paradoxa, Filipendula multijuga Filipendula purpurea, Filipendula ulmaria, Filipendula vulgaris, Fragaria chiloensis, Fragaria daltoniana, Fragaria gracilis, Fragaria grandiflora, Fragaria iinumae, Fragaria moschata, Fragaria nilgerrensis, Fragaria nipponica, Fragaria nubicola,

Fragaria orientalis, Fragaria pentaphylla, Fragaria vesca, Fragaria virginiana, Fragaria viridis, Fragaria x ananassa, Fragaria sp. CFRA 538, Fragaria sp., Geum andicola, Geum borisi, Geum bulgaricum, Geum calthifolium, Geum chiloense, Geum geniculatum, Geum heterocarpum, Geum macrophyllum, Geum montanum, Geum reptans, Geum rivale, Geum schofieldii, Geum speciosum, Geum urbanum, Geum vernum, Geum sp. 'Chase 2507 K', Hagenia abyssinica, Horkelia cuneata, Horkelia fusca, Ivesia gordoni, Kerria japonica, Leucosidea sericea, Marcetella

maderensis, Marcetella moquiniana, Margyricarpus pinnatus, Margyricarpus setosus, Novosieversia glacialis, Oncostylus cockaynei, Oncostylus leiospermus, Polylepis australis, Polylepis besseri, Polylepis crista-gaili, Polylepis hieronymi, Polylepis incana, Polylepis lanuginosa, Polylepis multijuga, Polylepis neglecta, Polylepis pauta, Polylepis pepei, Polylepis quadrijuga, Polylepis racemosa, Polylepis reticulata, Polylepis rugulosa, Polylepis sericea, Polylepis subsericans, Polylepis tarapacana, Polylepis tomentella, Polylepis weberbaueri, Potentilla anserina, Potentilla arguta,

Potentilla bifurca, Potentilla chinensis, Potentilla dickinsii, Potentilla erecta, Potentilla fragarioides, Potentilla fruticosa, Potentilla indica, Potentilla micrantha, Potentilla multifida, Potentilla nivea, Potentilla norvegica, Potentilla palustris,

Potentilla peduncularis, Potentilla reptans, Potentilla salesoviana, Potentilla stenophylla, Potentilla tridentata, Rosa abietina, Rosa abyssinica, Rosa acicularis, Rosa agrestis, Rosa alba, Rosa alba x Rosa corymbifera, Rosa altaica, Rosa arkansana, Rosa arvensis, Rosa banksiae, Rosa beggeriana, Rosa blanda, Rosa bracteata, Rosa brunonii, Rosa caesia, Rosa californica, Rosa canina, Rosa carolina, Rosa chinensis, Rosa cinnamomea, Rosa columnifera,

Rosa corymbifera, Rosa cymosa, Rosa davurica, Rosa dumalis, Rosa ecae, Rosa eglanteria, Rosa elliptica, Rosa fedtschenkoana, Rosa foetida, Rosa foliolosa, Rosa gallica, Rosa gallica x Rosa dumetorum, Rosa gigantea, Rosa glauca, Rosa helenae, Rosa henryi, Rosa hugonis, Rosa hybrid cultivar, Rosa inodora, Rosa jundzillii, Rosa laevigata, Rosa laxa, Rosa luciae, Rosa majalis, Rosa marretii, Rosa maximowicziana, Rosa micrantha, Rosa mollis, Rosa montana, Rosa moschata, Rosa moyesii, Rosa multibracteata, Rosa multiflora, Rosa nitida, Rosa odorata,

Rosa palustris, Rosa pendulina, Rosa persica, Rosa phoenicia, Rosa platyacantha, Rosa primula, Rosa pseudoscabriuscula, Rosa roxburghii, Rosa rubiginosa, Rosa rugosa, Rosa sambucina, Rosa sempervirens, Rosa sericea, Rosa sertata, Rosa setigera, Rosa sherardii, Rosa sicula, Rosa spinosissima, Rosa stellata, Rosa stylosa, Rosa subcanina, Rosa subcollina, Rosa suffulta, Rosa tomentella, Rosa tomentosa, Rosa tunquinensis, Rosa villosa, Rosa virginiana, Rosa wichurana, Rosa willmottiae, Rosa woodsii; Rosa x damascena, Rosa x fortuniana, Rosa x

macrantha, Rosa xanthina, Rosa sp., Rubus alceifolius, Rubus allegheniensis, Rubus alpinus, Rubus amphidasys, Rubus arcticus, Rubus argutus, Rubus assamensis, Rubus australis, Rubus bifrons, Rubus caesius, Rubus caesius x Rubus idaeus, Rubus canadensis, Rubus canescens, Rubus caucasicus, Rubus chamaemorus, Rubus corchorifolius, Rubus crataegifolius, Rubus cuneifolius, Rubus deliciosus, Rubus divaricatus, Rubus ellipticus, Rubus flagellaris, Rubus fruticosus, Rubus geoides, Rubus glabratus, Rubus glaucus, Rubus gunnianus, Rubus hawaiensis,

Rubus hawaiensis x Rubus rosifolius, Rubus hispidus, Rubus hochstetterorum, Rubus humulifolius, Rubus idaeus, Rubus lambertianus, Rubus lasiococcus, Rubus leucodermis, Rubus lineatus, Rubus macraei, Rubus maximiformis, Rubus minusculus, Rubus moorei, Rubus multibracteatus, Rubus neomexicanus, Rubus nepalensis, Rubus nessensis, Rubus nivalis, Rubus niveus, Rubus nubigenus, Rubus occidentalis, Rubus odoratus, Rubus palmatus, Rubus parviflorus, Rubus parvifolius, Rubus parvus, Rubus pectinellus, Rubus pedatus, Rubus pedemontanus,

Rubus pensilvanicus, Rubus phoenicolasius, Rubus picticaulis, Rubus pubescens, Rubus rigidus, Rubus robustus, Rubus roseus, Rubus rosifolius, Rubus sanctus, Rubus sapidus, Rubus saxatilis, Rubus setosus, Rubus spectabilis, Rubus sulcatus, Rubus tephrodes, Rubus trianthus, Rubus tricolor, Rubus trifidus, Rubus trilobus, Rubus trivialis, Rubus ulmifolius, Rubus ursinus, Rubus urticifolius, Rubus vigorosus, Rubus sp. JPM-2004, Sanguisorba albiflora, Sanguisorba alpina, Sanguisorba ancistroides, Sanguisorba annua, Sanguisorba canadensis, Sanguisorba filiformis,

Sanguisorba hakusanensis, Sanguisorba japonensis, Sanguisorba minor, Sanguisorba obtusa, Sanguisorba officinalis, Sanguisorba parviflora, Sanguisorba stipulata, Sanguisorba tenuifolia, Sarcopoterium spinosum, Sibbaldia procumbens, Sieversia pentapetala, Sieversia pusilla, Taihangia rupestris, Tetraglochin cristatum, Waldsteinia fragarioides, Waldsteinia geoides, Adenostoma fasciculatum, Adenostoma sparsifolium, Aruncus dioicus, Cercocarpus betuloides, Cercocarpus ledifolius, Chamaebatiaria millefolium, Chamaerhodos erecta, Gillenia

stipulata, Gillenia trifoliata, Holodiscus discolor, Holodiscus microphyllus, Lyonothamnus floribundus, Neillia affinis, Neillia gracilis, Neillia sinensis, Neillia sparsiflora, Neillia thibetica, Neillia thyrsiflora, Neillia uekii, Neviusia alabamensis, Physocarpus alternans, Physocarpus amurensis, Physocarpus capitatus, Physocarpus malvaceus, Physocarpus monogynus, Physocarpus opulifolius, Purshia tridentata, Rhodotypos scandens, Sorbaria arborea, Sorbaria sorbifolia, Spiraea betulifolia, Spiraea cantoniensis, Spiraea densiflora, Spiraea japonica, Spiraea nipponica,

Spiraea x vanhouttei, Spiraea sp., Stephanandra chinensis, Stephanandra incisa y Stephanandra tanakae.

Géneros de Rosaceae particularmente preferidos incluyen: Malus, Pyrus, Cydonia, Prunus, Eriobotrya y Mespilus.

Especies de Rosaceae particularmente preferidas incluyen: Malus domestica, Malus sylvestris, Pyrus communis,

Pyrus pyrifolia, Pyrus bretschneideri, Cydonia oblonga, Prunus salicina, Prunus cerasifera, Prunus persica, Eriobotrya japonica, Prunus dulcis, Prunus avium, Mespilus germanic y Prunus domestica.

Géneros de Rosaceae más particularmente preferidos incluyen Malus y Prunus

Especies de Rosaceae particularmente preferidas incluyen Malus domestica y Prunus cerasifera.

El término “planta” pretende incluir una planta entera, cualquier parte de una planta, propágulas y progenie de una planta.

El término 'propágula' significa cualquier parte de una planta que pueda usarse en la reproducción o propagación, tanto sexual como asexual, que incluye semillas y esquejes.

Descripción detallada

En esta memoria descriptiva en la que se ha hecho referencia a memorias descriptivas de patentes, otros documentos externos, u otras fuentes de información, esto es generalmente con el fin de proporcionar un contexto para tratar las características de la invención. A menos que se establezca específicamente de otro modo, referencia a tales documentos externos no debe interpretarse como una admisión de que tales documentos, o tales fuentes de información, en cualquier jurisdicción, sean estado de la técnica, o formen parte del conocimiento general común en la materia.

El término que comprende, y equivalentes gramaticales del mismo, pretende significar “que consiste al menos en parte de...”.

Polinucleótidos y fragmentos

El término “polinucleótido(s),” como se usa en el presente documento, significa un polímero de desoxirribonucleótidos o ribonucleótidos mono o bicatenario de cualquier longitud, pero preferentemente al menos 15 nucleótidos, e incluyen como ejemplos no limitantes secuencias codificantes y no codificantes de un gen, secuencias sentido y antisentido, complementos, exones, intrones, ADN genómico, ADNc, pre-ARNm, ARNm, ARNr, ARNsi, miARN, ARNt, ribozimas, polipéptidos recombinantes, secuencias de ADN o de ARN aisladas y purificadas que se producen naturalmente, secuencias de ARN y de ADN sintéticas, sondas de ácido nucleico, cebadores y fragmentos.

Un “fragmento” de una secuencia de polinucleótidos proporcionada en el presente documento es una subsecuencia de nucleótidos contiguos que es capaz de hibridación específica con una diana de interés, por ejemplo, una secuencia que tiene al menos 15 nucleótidos de longitud. Los fragmentos de la invención comprenden 15 nucleótidos, preferentemente al menos 20 nucleótidos, más preferentemente al menos 30 nucleótidos, más preferentemente al menos 50 nucleótidos, más preferentemente al menos 50 nucleótidos y lo más preferentemente al menos 60 nucleótidos de nucleótidos contiguos de un polinucleótido de la invención. Un fragmento de una secuencia de polinucleótidos puede usarse en tecnología antisentido, de silenciamiento génico, hélice tríplex o de ribozima, o como un cebador, una sonda, incluida en una micromatriz, o usarse en métodos de selección basados en polinucleótidos de la invención.

El término “cebador” se refiere a un polinucleótido corto, normalmente que tiene un grupo 3'OH libre, que se hibrida con un molde y se usa para cebar la polimerización de un polinucleótido complementario a la diana.

El término “sonda” se refiere a un polinucleótido corto que se usa para detectar una secuencia de polinucleótidos, que es complementario a la sonda, en un ensayo basado en hibridación. La sonda puede consistir en un “fragmento” de un polinucleótido como se define en el presente documento.

Polipéptidos y fragmentos

El término “polipéptido”, como se usa en el presente documento, engloba cadenas de aminoácidos de cualquier longitud, pero preferentemente al menos 5 aminoácidos, que incluye proteínas de longitud completa, en las que residuos de aminoácidos están unidos por enlaces peptídicos covalentes. Los polipéptidos de la presente invención pueden ser productos naturales purificados, o pueden producirse parcial o completamente usando técnicas recombinantes o sintéticas. El término puede referirse a un polipéptido, un agregado de un polipéptido tal como un dímero u otro multímero, un polipéptido de fusión, un fragmento de polipéptido, una variante de polipéptido, o derivado de los mismos.

Un “fragmento” de un polipéptido es una subsecuencia del polipéptido que realiza una función que se requiere para la actividad biológica y/o proporciona estructura tridimensional del polipéptido. El término puede referirse a un polipéptido, un agregado de un polipéptido tal como un dímero u otro multímero, un polipéptido de fusión, un fragmento de polipéptido, una variante de polipéptido, o derivado de los mismos que pueda realizar la actividad enzimática anterior.

El término “aislado”, como se aplica a las secuencias de polinucleótidos o de polipéptidos desveladas en el presente documento, se usa para referirse a secuencias que se eliminan de su entorno celular natural. Una molécula aislada puede obtenerse por cualquier método o combinación de métodos que incluyen técnicas bioquímicas, recombinantes y sintéticas.

El término “recombinante” se refiere a una secuencia de polinucleótidos que se elimina de secuencias que la rodean en su contexto natural y/o se recombina con secuencias que no están presentes en su contexto natural.

Una secuencia de polipéptidos “recombinante” se produce por traducción de una secuencia de polinucleótidos “recombinante”.

El término “derivado de”, con respecto a polinucleótidos o polipéptidos de la invención que se derivan de un género o especie particular, significa que el polinucleótido o polipéptido tiene la misma secuencia que un polinucleótido o polipéptido encontrado naturalmente en esos géneros o especies. El polinucleótido o polipéptido, derivado de un género o especie particular, puede, por tanto, producirse sintéticamente o recombinantemente.

Variantes

Como se usa en el presente documento, el término “variante” se refiere a secuencias de polinucleótidos o de polipéptidos diferentes de las secuencias específicamente identificadas, en las que uno o más nucleótidos o residuos de aminoácidos se deleciona, sustituye o añade. Las variantes pueden ser variantes alélicas que se producen naturalmente, o variantes que no se producen naturalmente. Las variantes pueden ser de la misma especie o de otras especies y pueden englobar homólogos, parálogos y ortólogos. En ciertas realizaciones, las variantes de los polipéptidos y polipéptidos inventivos poseen actividades biológicas que son las mismas o similares a las de los polipéptidos o polipéptidos inventivos. El término “variante” con referencia a polipéptidos y polipéptidos engloba todas las formas de polipéptidos y polipéptidos como se definen en el presente documento.

Variantes de polinucleótidos

Las secuencias de polinucleótidos de variante presentan preferentemente al menos el 50 %, más preferentemente al menos el 51 %, más preferentemente al menos el 52 %, más preferentemente al menos el 53 %, más preferentemente al menos el 54 %, más preferentemente al menos el 55 %, más preferentemente al menos el 56 %, más preferentemente al menos el 57 %, más preferentemente al menos el 58 %, más preferentemente al menos el 59 %, más preferentemente al menos el 60 %, más preferentemente al menos el 61 %, más preferentemente al menos el 62 %, más preferentemente al menos el 63 %, más preferentemente al menos el 64 %, más preferentemente al menos el 65 %, más preferentemente al menos el 66 %, más preferentemente al menos el 67 %, más preferentemente al menos el 68 %, más preferentemente al menos el 69 %, más preferentemente al menos el 70 %, más preferentemente al menos el 71 %, más preferentemente al menos el 72 %, más preferentemente al menos el 73 %, más preferentemente al menos el 74 %, más preferentemente al menos el 75 %, más preferentemente al menos el 76 %, más preferentemente al menos el 77 %, más preferentemente al menos el 78 %, más preferentemente al menos el 79 %, más preferentemente al menos el 80 %, más preferentemente al menos el 81 %, más preferentemente al menos el 82 %, más preferentemente al menos el 83 %, más preferentemente al menos el 84 %, más preferentemente al menos el 85 %, más preferentemente al menos el 86 %, más preferentemente al menos el 87 %, más preferentemente al menos el 88 %, más preferentemente al menos el 89 %, más preferentemente al menos el 90 %, más preferentemente al menos el 91 %, más preferentemente al menos el 92 %, más preferentemente al menos el 93 %, más preferentemente al menos el 94 %, más preferentemente al menos el 95 %, más preferentemente al menos el 96 %, más preferentemente al menos el 97 %, más preferentemente al menos el 98 %, y lo más preferentemente al menos el 99 % de identidad con una secuencia de la presente invención. La identidad se encuentra sobre una ventana de comparación de al menos 20 posiciones de nucleótidos, preferentemente al menos 50 posiciones de nucleótidos, más preferentemente al menos 100 posiciones de nucleótidos, y lo más preferentemente sobre la longitud entera de un polinucleótido de la invención.

La identidad de secuencias de polinucleótidos puede determinarse del siguiente modo. La secuencia de polinucleótidos objeto se compara con una secuencia de polinucleótidos candidata usando BLASTN (del paquete de programas BLAST, versión 2.2.5 [Nov 2002]) en bl2seq (Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences - a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett. 174:247-250), que está públicamente disponible de NCBI (ftp://ftp.ncbi.nih.gov/blast/). Se utilizan los parámetros por defecto de bl2seq, excepto que debe apagarse el filtrado de partes de baja complejidad.

La identidad de secuencias de polinucleótidos puede examinarse usando los siguientes parámetros de la línea de comandos de Unix: El parámetro -F F apaga el filtrado de secciones de complejidad baja. El parámetro -p selecciona el algoritmo apropiado para el par de secuencias. El programa b12seq informa de la identidad de secuencias como tanto el número como el porcentaje de nucleótidos idénticos en una línea “Identidades =”.

La identidad de secuencias de polinucleótidos también puede calcularse sobre la longitud entera del solapamiento entre secuencias de polinucleótidos candidatas y objeto usando programas de alineamiento de secuencias globales (por ejemplo, Needleman, S. B. y Wunsch, C. D. (1970) J. Mol. Biol. 48,443-453). Una implementación completa del algoritmo de alineamiento global de Needleman-Wunsch se encuentra en el programa de Needle en el paquete EMBOSS (Rice, P. Longden, I. y Bleasby, A. EMBOSS: The European Molecular Biology Open Software Suite, Trends in Genetics June 2000, vol 16, No 6. pp.

276-277) que puede obtenerse de htt://www.hgmp.mrc.ac.uk/Software/EMBOSS/. El servidor del Instituto Europeo de Bioinformática también proporciona el servicio para realizar los alineamientos globales de EMBOSS-Needle entre dos secuencias en línea en http:/www.ebi.ac.uk/emboss/align/.

Alternativamente, puede usarse el programa GAP que calcula un alineamiento global óptimo de dos secuencias sin penalizar huecos terminales. GAP se describe en el siguiente documento: Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235.

Variantes de polinucleótidos de la presente invención también engloban aquellas que presentan una similitud con una o más de las secuencias específicamente identificadas que es probable que preserven la equivalencia funcional de aquellas secuencias y que no podría esperarse razonablemente que se hubieran producido por casualidad al azar. Tal similitud de secuencias con respecto a los polipéptidos puede determinarse usando el programa bl2seq públicamente disponible del paquete de programas BLAST (versión 2.2.5 [Nov 2002]) de NCBI (ftp://ftp.ncbi.nih.gov/blast/).

La similitud de secuencias de polinucleótidos puede examinarse usando los siguientes parámetros de la línea de comandos de Unix: El parámetro -F F apaga el filtrado de secciones de complejidad baja. El parámetro -p selecciona el algoritmo apropiado para el par de secuencias. Este programa encuentra regiones de similitud entre las secuencias y para cada región tal informa un “valor de E” que es el número esperado de veces que podría esperarse ver una coincidencia tal por casualidad en una base de datos de un tamaño de referencia fijo que contiene secuencias al azar. El tamaño de esta base de datos está fijado por defecto en el programa bl2seq. Para valores de E pequeños, mucho más pequeñas de uno, el valor de E es aproximadamente la probabilidad de una coincidencia al azar tal.

Secuencias de polinucleótidos de variante presentan preferentemente un valor de E inferior a 1 x 10-6, más preferentemente inferior a 1 x 10-9, más preferentemente inferior a 1 x 10-12, más preferentemente inferior a 1 x 10-15, más preferentemente inferior a 1 x 10-18, más preferentemente inferior a 1 x 10-21, más preferentemente inferior a 1 x 10-30, más preferentemente inferior a 1 x 10-40, más preferentemente inferior a 1 x 10-50, más preferentemente inferior a 1 x 10-60, más preferentemente inferior a 1 x 10-70, más preferentemente inferior a 1 x 10-80, más preferentemente inferior a 1 x 10-90 y lo más preferentemente inferior a 1 x 10-100 cuando se comparan con una cualquiera de las secuencias específicamente identificadas.

Alternativamente, los polinucleótidos de variante de la presente invención se hibridan con las secuencias de polinucleótidos especificadas, o complementos de las mismas, bajo condiciones rigurosas.

La expresión “se hibridan bajo condiciones rigurosas”, y equivalentes gramaticales de la misma, se refiere a la capacidad de una molécula de polinucleótido para hibridarse con una molécula de polinucleótido diana (tal como una molécula de polinucleótido diana inmovilizada sobre una transferencia de ADN o ARN, tal como una transferencia Southern o transferencia Northern) bajo condiciones definidas de temperatura y concentración de sales. La capacidad para hibridarse bajo condiciones de hibridación rigurosas puede determinarse hibridando inicialmente bajo condiciones menos rigurosas, luego aumentando la rigurosidad hasta la rigurosidad deseada.

Con respecto a moléculas de polinucleótidos superiores a aproximadamente 100 bases de longitud, condiciones de hibridación rigurosas típicas son no superiores a 25 a 30 ºC (por ejemplo, 10 ºC) por debajo de la temperatura de fusión (Tm) del dúplex nativo (véanse generalmente Sambrook et al., Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Ausubel et al., 1987, Current Protocols in Molecular Biology, Greene Publishing). Tm para moléculas de polinucleótidos de más de aproximadamente 100 bases puede calcularse por la fórmula Tm = 81,5 + 0,41 % (G + C-log (Na+). (Sambrook et al., Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Bolton y McCarthy, 1962, PNAS 84:1390). Condiciones rigurosas típicas para polinucleótidos de más de 100 bases en longitud serían condiciones de hibridación tales como prelavado en una disolución de 6X SSC, 0,2 % de SDS; hibridación a 65 ºC, 6X SSC, 0,2 % de SDS durante la noche; seguido de dos lavados de 30 minutos cada uno en 1X SSC, 0,1 % de SDS a 65 ºC y dos lavados de 30 minutos cada uno en 0,2X SSC, 0,1 % de SDS a 65 ºC.

Con respecto a las moléculas de polinucleótidos que tienen una longitud inferior a 100 bases, condiciones de hibridación rigurosas a modo de ejemplo son 5 a 10 ºC por debajo de Tm. En promedio, la Tm de una molécula de polinucleótido de longitud inferior a 100 pb se reduce aproximadamente (500/ longitud de oligonucleótido) ºC.

Con respecto a los miméticos de ADN conocidos como ácidos nucleicos peptídicos (PNA) (Nielsen et al., Science. 1991 Dec 6;254(5037):1497-500), los valores de Tm son superiores a aquellos para híbridos de ADN-ADN o ADN- ARN, y pueden calcularse usando la fórmula descrita en Giesen et al., Nucleic Acids Res. 1998 Nov 1;26(21):5004- 6. Condiciones de hibridación rigurosas a modo de ejemplo para un híbrido de ADN-PNA que tiene una longitud inferior a 100 bases son 5 a 10 ºC por debajo de Tm.

Los polinucleótidos de variante de la presente invención también engloban polinucleótidos que se diferencian de las secuencias de la invención pero que, como consecuencia de la degeneración del código genético, codifican un polipéptido que tiene actividad similar a un polipéptido codificado por un polinucleótido de la presente invención. Una alteración de secuencias que no cambia la secuencia de aminoácidos del polipéptido es una “variación silenciosa”.

Excepto para ATG (metionina) y TGG (triptófano), otros codones para el mismo aminoácido pueden cambiarse por técnicas reconocidas en la técnica, por ejemplo, para optimizar la expresión de codones en un organismo huésped particular.

Alteraciones de la secuencia de polinucleótidos que producen sustituciones conservativas de uno o varios aminoácidos en la secuencia de polipéptidos codificada sin alterar significativamente su actividad biológica también están incluidas en la invención. Un experto conocerá métodos para hacer sustituciones de aminoácidos fenotípicamente silenciosas (véase, por ejemplo, Bowie et al., 1990, Science 247, 1306).

Polinucleótidos de variante debidos a variaciones silenciosas y sustituciones conservativas en la secuencia de polipéptidos codificada pueden determinarse usando el programa b12seq públicamente disponible del paquete de programas BLAST (versión 2.2.5 [Nov 2002]) de NCBI (ftp://ftp.ncbi.nih.gov/blast/) mediante el algoritmo tblastx como se ha descrito previamente.

Variantes de polipéptidos

El término “variante” con referencia a polipéptidos engloba polipéptidos que se producen naturalmente, producidos recombinantemente y sintéticamente. Las secuencias de polipéptidos de variante preferentemente presentan al menos el 50 %, más preferentemente al menos el 51 %, más preferentemente al menos el 52 %, más preferentemente al menos el 53 %, más preferentemente al menos el 54 %, más preferentemente al menos el 55 %, más preferentemente al menos el 56 %, más preferentemente al menos el 57 %, más preferentemente al menos el 58 %, más preferentemente al menos el 59 %, más preferentemente al menos el 60 %, más preferentemente al menos el 6 %, más preferentemente al menos el 62 %, más preferentemente al menos el 63 %, más preferentemente al menos el 64 %, más preferentemente al menos el 65 %, más preferentemente al menos el 66 %, más preferentemente al menos el 67 %, más preferentemente al menos el 68 %, más preferentemente al menos el 69 %, más preferentemente al menos el 70 %, más preferentemente al menos el 71 %, más preferentemente al menos el 72 %, más preferentemente al menos el 73 %, más preferentemente al menos el 74 %, más preferentemente al menos el 75 %, más preferentemente al menos el 76 %, más preferentemente al menos el 77 %, más preferentemente al menos el 78 %, más preferentemente al menos el 79 %, más preferentemente al menos el 80 %, más preferentemente al menos el 81 %, más preferentemente al menos el 82 %, más preferentemente al menos el 83 %, más preferentemente al menos el 84 %, más preferentemente al menos el 85 %, más preferentemente al menos el 86 %, más preferentemente al menos el 87 %, más preferentemente al menos el 88 %, más preferentemente al menos el 89 %, más preferentemente al menos el 90 %, más preferentemente al menos el 91 %, más preferentemente al menos el 92 %, más preferentemente al menos el 93 %, más preferentemente al menos el 94 %, más preferentemente al menos el 95 %, más preferentemente al menos el 96 %, más preferentemente al menos el 97 %, más preferentemente al menos el 98 %, y lo más preferentemente al menos el 99 % de identidad con una secuencias de la presente invención. La identidad se encuentra sobre una ventana de comparación de al menos 20 posiciones de aminoácidos, preferentemente al menos 50 posiciones de aminoácidos, más preferentemente al menos 100 posiciones de aminoácidos, y lo más preferentemente sobre la longitud entera de un polipéptido de la invención.

La identidad de secuencias de polipéptidos puede determinarse del siguiente modo. La secuencia de polipéptidos objeto se compara con una secuencia de polipéptidos candidata usando BLASTP (del paquete de programas BLAST, versión 2.2.5 [Nov 2002]) en bl2seq, que está públicamente disponible de NCBI (ftp://ftp.ncbi.nih.gov/blast/). Se utilizan los parámetros por defecto de bl2seq, excepto que debe apagarse el filtrado de regiones de baja complejidad.

La identidad de secuencias de polipéptidos también puede calcularse sobre la longitud entera del solapamiento entre secuencias de polinucleótidos candidatas y objeto usando programas de alineamiento de secuencias globales. EMBOSS-Needle (disponible en http:/www.ebi.ac.uk/emboss/align/) y GAP (Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235), como se ha tratado anteriormente, también son programas de alineamiento de secuencias globales adecuados para calcular la identidad de secuencias de polipéptidos.

Un método preferido para calcular la identidad de secuencias de polipéptidos se basa en alinear secuencias para comparar usando Clustal W (Thompson et al 1994, Nucleic Acid Res 11 (22)4673-4680).

Las variantes de polipéptido de la presente invención también engloban aquellas que presentan una similitud con una o más de las secuencias específicamente identificadas que es probable que preserven la equivalencia funcional de aquellas secuencias y que no podría esperarse razonablemente que se hubieran producido por casualidad al azar. Tal similitud de secuencias con respecto a polipéptidos puede determinarse usando el programa bl2seq públicamente disponible del paquete de programas BLAST (versión 2.2.5 [Nov 2002]) de NCBI (ftp://ftp.ncbi.nih.gov/blast/). La similitud de secuencias de polipéptidos puede examinarse usando los siguientes parámetros de la línea de comandos de Unix: Las secuencias de polipéptidos de variante preferentemente presentan un valor de E inferior a 1 x 10-6, más preferentemente inferior a 1 x 10 -9, más preferentemente inferior a 1 x 10 -12, más preferentemente inferior a 1 x 10 - 15, más preferentemente inferior a 1 x 10 -18, más preferentemente inferior a 1 x 10 -21, más preferentemente inferior a 1 x 10 -30, más preferentemente inferior a 1 x 10-40, más preferentemente inferior a 1 x 10 -50, más preferentemente inferior a 1 x 10 -60, más preferentemente inferior a 1 x 10 -70, más preferentemente inferior a 1 x 10 -80, más preferentemente inferior a 1 x 10 -90 y lo más preferentemente 1x10-100 cuando se comparan con una cualquiera de las secuencias específicamente identificadas.

El parámetro -F F apaga el filtrado de secciones de complejidad baja. El parámetro -p selecciona el algoritmo apropiado para el par de secuencias. Este programa encuentra regiones de similitud entre las secuencias y para cada región tal informa un “valor de E” que es el número esperado de veces que podría esperarse ver una coincidencia tal por casualidad en una base de datos de un tamaño de referencia fijo que contiene secuencias al azar. Para valores de E pequeños, mucho menores a uno, esto es aproximadamente la probabilidad de una coincidencia al azar tal.

Sustituciones conservativas de uno o varios aminoácidos de una secuencia de polipéptidos descrita sin alterar significativamente su actividad biológica también están incluidas en la invención. Un experto conocerá métodos para hacer sustituciones de aminoácidos fenotípicamente silenciosas (véase, por ejemplo, Bowie et al., 1990, Science 247, 1306).

Construcciones, vectores y componentes de los mismos

El término “construcción genética” se refiere a una molécula de polinucleótido, normalmente ADN bicatenario, que puede tener insertada en ella otra molécula de polinucleótido (la molécula de polinucleótido de inserción) tal como, pero no se limita a, una molécula de ADNc. Una construcción genética puede contener los elementos necesarios que permiten transcribir la molécula de polinucleótido de inserción, y, opcionalmente, traducir el transcrito en un polipéptido. La molécula de polinucleótido de inserción puede derivarse de la célula huésped, o puede derivarse de una célula u organismo diferente y/o puede ser un polinucleótido recombinante. Una vez dentro de la célula huésped, la construcción genética puede integrarse en el ADN cromosómico del huésped. La construcción genética puede enlazarse a un vector.

El término “vector” se refiere a una molécula de polinucleótido, normalmente ADN bicatenario, que se usa para transportar la construcción genética en una célula huésped. El vector puede ser capaz de replicación en al menos un sistema huésped adicional, tal como E. coli.

El término “construcción de expresión” se refiere a una construcción genética que incluye los elementos necesarios que permiten transcribir la molécula de polinucleótido de inserción, y, opcionalmente, traducir el transcrito en un polipéptido. Una construcción de expresión normalmente comprende en una dirección 5' a 3': a) un promotor funcional en la célula huésped en la que se transformará la construcción, b) el polinucleótido que va a expresarse, y c) un terminador funcional en la célula huésped en la que se transformará la construcción.

El término “región codificante” o “marco de lectura abierto” (ORF) se refiere a la hebra codificante de una secuencia de ADN genómico o una secuencia de ADNc que puede producir un producto de transcripción y/o un polipéptido bajo el control de secuencias reguladoras apropiadas. La secuencia codificante se identifica por la presencia de un codón de iniciación de la traducción de 5' y un codón de terminación de la traducción de 3'. Cuando se inserta en una construcción genética, una “secuencia codificante” es capaz de ser expresada cuando está operativamente enlazada a secuencias promotoras y terminadoras.

“Operativamente enlazado” significa que la secuencia que va a expresarse se coloca bajo el control de elementos reguladores que incluyen promotores, elementos reguladores específicos de tejido, elementos reguladores temporales, potenciadores, represores y terminadores.

El término “región no codificante” se refiere a secuencias sin traducir que están en la dirección 5' del sitio de iniciación traduccional y en la dirección 3' del sitio de terminación traduccional. Estas secuencias también se denominan respectivamente 5' UTR y 3' UTR. Estas regiones incluyen elementos requeridos para la iniciación y terminación de la transcripción y para la regulación de la eficiencia de traducción.

Los terminadores son secuencias, que terminan la transcripción, y se encuentran en los extremos sin traducir 3' de genes en la dirección 3' de la secuencia traducida. Los terminadores son determinantes importantes de la estabilidad del ARNm y en algunos casos se ha encontrado que tienen funciones reguladoras espaciales.

El término “promotor” se refiere a elementos reguladores en cis no trascritos en la dirección 5' de la región codificante que regulan la transcripción génica. Los promotores comprenden elementos iniciadores en cis que especifican el sitio de iniciación de la transcripción y cajas conservadas tales como la caja TATA, y motivos que están unidos por factores de transcripción.

Un “transgén” es un polinucleótido que se toma de un organismo y se introduce en un organismo diferente por transformación. El transgén puede derivarse de la misma especie o de una especie diferente de la especie del organismo en la que se introduce el transgén.

Una “planta transgénica” se refiere a una planta que contiene material genético nuevo como resultado de manipulación genética o transformación. El nuevo material genético puede derivarse de una planta de la misma especie como planta transgénica resultante o de una especie diferente. Una “repetición invertida” es una secuencia que se repite, en la que la segunda mitad de la repetición está en la hebra complementaria, por ejemplo, (5')GATCTA.......TAGATC(3') (3')CTAGAT.......ATCTAG(5') La transcripción de ultra-lectura producirá un transcrito que se somete a apareamiento de bases complementarias para formar una estructura de horquilla a condición de que haya un espaciador de 3-5 pb entre las regiones repetidas.

El término “regulación de la producción de antocianina” pretende incluir tanto aumentar como disminuir la producción de antocianina. Preferentemente, el término se refiere a aumentar la producción de antocianina. Las antocianinas que pueden regularse incluyen, pero no se limitan a, cianindin-3-glucósido, cianidin-3-0-rutinósido, cianadin-3- galactósido y cianadin-3-pentósido.

Los términos “para alterar la expresión de” y “expresión alterada” de un polinucleótido o polipéptido de la invención pretenden englobar la situación en la que el ADN genómico correspondiente a un polinucleótido de la invención se modifica, conduciendo así a la expresión alterada de un polinucleótido o polipéptido de la invención. La modificación del ADN genómico puede ser mediante transformación genética u otros métodos conocidos en la técnica para inducir mutaciones. La “expresión alterada” puede relacionarse con un aumento o disminución en la cantidad de ARN mensajero y/o polipéptido producido y puede también producir actividad alterada de un polipéptido debido a alteraciones en la secuencia de un polinucleótido y polipéptido producido.

Los solicitantes han identificado secuencias de polinucleótidos (SEC ID Nº: 5 a 8) que codifican polipéptidos (SEC ID Nº: 1 a 4), respectivamente, de manzana, que son factores de transcripción que pueden regular la producción de antocianina en plantas. Los solicitantes también han identificado variantes de polinucleótidos (SEC ID Nº: 22 a 47) de SEC ID Nº: 5 que codifican variantes de polipéptido (SEC ID Nº: 9 a 21) de SEC ID Nº: 1. Un resumen de la relación entre los polinucleótidos y polipéptidos se encuentra en la Tabla 3 (Resumen de secuencias).

La invención proporciona construcciones genéticas, vectores y plantas que comprenden las secuencias de polinucleótidos. La invención también proporciona plantas que comprenden las construcciones genéticas y vectores de la invención.

La invención proporciona plantas alteradas, con respecto a plantas de control adecuadas, en la producción de pigmentos de antocianina. La invención proporciona tanto plantas con elevada como reducida producción de pigmentos de antocianina. La invención también proporciona métodos para la producción de tales plantas y métodos de selección de tales plantas.

Plantas de control adecuadas pueden incluir plantas no transformadas de la misma especie y variedad, o plantas de la misma especie o variedad transformadas con una construcción de control.

Los usos de las composiciones de la invención incluyen la producción de fruta, u otras parte de la planta, con elevados niveles de pigmentación por antocianinas, por ejemplo, producción de manzanas con piel rojo y o carne roja.

La invención también proporciona métodos para seleccionar células vegetales transformadas y plantas seleccionando células vegetales y plantas que tienen elevado pigmento de antocianina, indicando el elevado pigmento antociánico que las plantas se transforman para expresar un polinucleótido o polipéptido de la invención.

Métodos para aislar o producir polinucleótidos

Las moléculas de polinucleótidos de la invención pueden aislarse usando una variedad de técnicas conocidas para aquellos expertos habituales en la materia. A modo de ejemplo, tales polipéptidos pueden aislarse mediante el uso de la reacción en cadena de la polimerasa (PCR) descrita en Mullis et al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser, incorporada en el presente documento por referencia. Los polipéptidos de la invención pueden amplificarse usando cebadores, como se definen en el presente documento, derivados de las secuencias de polinucleótidos de la invención.

Otros métodos para aislar polinucleótidos de la invención incluyen el uso de todos, o porciones de, los polipéptidos que tienen la secuencia expuesta en el presente documento como sondas de hibridación. La técnica de hibridar sondas de polinucleótidos marcadas con polinucleótidos inmovilizados sobre soportes sólidos tales como filtros de nitrocelulosa o membranas de nailon puede usarse para cribar las bibliotecas de ADN genómico o ADNc. Condiciones de hibridación y de lavado a modo de ejemplo son: hibridación durante 20 horas a 65 ºC en 5,0 X SSC, 0,5 % de dodecilsulfato de sodio, 1 X disolución de Denhardt; lavado (tres lavados de veinte minutos cada uno a 55 ºC) en 1,0 X SSC, 1 % (peso/volumen) de dodecilsulfato de sodio, y opcionalmente un lavado (durante veinte minutos) en 0,5 X SSC, 1 % (peso/volumen) de dodecilsulfato de sodio, a 60 ºC. Puede realizarse un lavado adicional opcional (durante veinte minutos) en condiciones de 0,1 X SSC, 1 % (peso/volumen) de dodecilsulfato de sodio, a 60 ºC.

Los fragmentos de polinucleótidos de la invención pueden producirse por técnicas muy conocidas en la técnica, tales como digestión con endonucleasa de restricción, síntesis de oligonucleótidos y amplificación por PCR.

Puede usarse una secuencia de polinucleótidos parcial en los métodos muy conocidos en la técnica para identificar la secuencia de polinucleótidos de longitud completa correspondiente. Tales métodos incluyen métodos basados en PCR, 5'RACE (Frohman MA, 1993, Methods Enzymol. 218: 340-56) y método basado en hibridación, métodos basados en ordenador/bases de datos. Además, a modo de ejemplo, la PCR inversa permite la adquisición de secuencias desconocidas, que flanquean las secuencias de polinucleótidos desveladas en el presente documento, empezando con cebadores basados en una región conocida (Triglia et al., 1998, Nucleic Acids Res 16, 8186, incorporado en el presente documento por referencia). El método usa varias enzimas de restricción para generar un fragmento adecuado en la región conocida de un gen. El fragmento se circulariza entonces por ligación intramolecular y se usa como molde de PCR. Se diseñan cebadores divergentes a partir de la región conocida. Con el fin de ensamblar físicamente clones de longitud completa, pueden utilizarse enfoques estándar de biología molecular (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987).

Puede ser beneficioso, cuando se produce una planta transgénica a partir de una especie particular, transformar una planta tal con una secuencia o secuencias derivadas de esa especie. El beneficio puede ser atenuar inquietudes públicas referentes a la transformación de especies cruzadas en la generación de organismos transgénicos.

Adicionalmente, cuando la regulación por disminución de un gen es el resultado deseado, puede ser necesario utilizar una secuencia idéntica (o al menos altamente similar) a aquella en la planta, para la que se desea expresión reducida. Por estos motivos, entre otros, se desea ser capaz de identificar y aislar ortólogos de un gen particular en varias especies de plantas diferentes. Pueden identificarse variantes (incluyendo ortólogos) por los métodos descritos.

Métodos para identificar variantes

Métodos físicos

Pueden identificarse polipéptidos de variante usando métodos basados en PCR (Mullis et al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser). Normalmente, la secuencia de polinucleótidos de un cebador, útil para amplificar variantes de moléculas de polinucleótidos de la invención por PCR, puede basarse en una secuencia que codifica una región conservada de la secuencia de aminoácidos correspondiente.

Alternativamente, pueden emplearse métodos de cribado de bibliotecas, muy conocidos para aquellos expertos en la materia (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987). Cuando se identifican variantes de la secuencia de la sonda, la rigurosidad de la hibridación y/o de los lavados normalmente se reducirá relativamente a cuando se buscan coincidencias de secuencias exactas.

También pueden identificarse variantes de polipéptido por métodos físicos, por ejemplo, cribando bibliotecas de expresión usando anticuerpos producidos contra polipéptidos de la invención (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987) o identificando polipéptidos de fuentes naturales con la ayuda de tales anticuerpos.

Métodos basados en ordenador

Las secuencias de variantes de la invención, que incluyen tanto variantes de polinucleótidos como de polipéptidos, también pueden identificarse por métodos basados en ordenador muy conocidos para aquellos expertos en la materia, usando algoritmos de alineamiento de secuencias de dominio público y herramientas de búsqueda de similitud de secuencias para buscar bases de datos de secuencias (bases de datos de dominio público incluyen Genbank, EMBL, Swiss-Prot, PIR y otras). Véase, por ejemplo, Nucleic Acids Res. 29: 1-10 y 11-16, 2001 para ejemplos de recursos en línea. Las búsquedas de similitud recuperan y alinean secuencias diana para la comparación con una secuencia que va a analizarse (es decir, una secuencia de búsqueda). Los algoritmos de comparación de secuencias usan matrices de puntuación para asignar una puntuación global a cada uno de los alineamientos.

Una familia a modo de ejemplo de programas útiles para identificar variantes en bases de datos de secuencias es el paquete de programas BLAST (versión 2.2.5 [Nov 2002]) que incluye BLASTN, BLASTP, BLASTX, tBLASTN y tBLASTX, que están públicamente disponibles de (ftp://ftp.ncbi.nih.gov/blast/) o del Centro Nacional para Información Biotecnológica (NCBI), Biblioteca Nacional de Medicina, Building 38A, Room 8N805, Bethesda, MD 20894 EE.UU. El servidor del NCBI también proporciona el servicio de usar los programas para cribar varias bases de datos de secuencias públicamente disponibles. BLASTN compara una secuencia de búsqueda de nucleótidos con una base de datos de secuencias de nucleótidos. BLASTP compara una secuencia de búsqueda de aminoácidos con una base de datos de secuencias de proteínas. BLASTX compara una secuencia de búsqueda de nucleótidos traducida en todos los marcos de lectura con una base de datos de secuencias de proteínas. tBLASTN compara una secuencia de búsqueda de proteínas con una base de datos de secuencias de nucleótidos dinámicamente traducida en todos los marcos de lectura. tBLASTX compara las traducciones en los seis marcos de una secuencia de búsqueda de nucleótidos con las traducciones en los seis marcos de una base de datos de secuencias de nucleótidos. Los programas BLAST pueden usarse con parámetros por defecto o los parámetros pueden alterarse según se requiera para refinar el cribado.

El uso de la familia BLAST de algoritmos, que incluyen BLASTN, BLASTP y BLASTX, se describe en la publicación de Altschul et al., Nucleic Acids Res. 25: 3389-3402, 1997.

Los “aciertos” con una o más secuencias de las bases de datos por una secuencia buscada producidos por BLASTN, BLASTP, BLASTX, tBLASTN, tBLASTX, o un algoritmo similar, alinean e identifican porciones de secuencias similares. Los aciertos están dispuestos en orden del grado de similitud y la longitud de solapamiento de secuencias. Los aciertos para una secuencia de base de datos generalmente representan un solapamiento sobre solo una fracción de la longitud de secuencia de la secuencia buscada.

Los algoritmos BLASTN, BLASTP, BLASTX, tBLASTN y tBLASTX también producen valores “esperados” para alineamientos. El valor esperado (E) indica el número de aciertos que puede “esperarse” ver por casualidad cuando se busca en una base de datos del mismo tamaño que contiene secuencias contiguas al azar. El valor esperado se usa como umbral de significancia para determinar si el éxito con una base de datos indica similitud real. Por ejemplo, un valor de E de 0,1 asignado a un acierto de polinucleótido se interpreta que significa que en una base de datos del tamaño de la base de datos cribada podría esperarse ver 0,1 coincidencias sobre la porción alineada de la secuencia con una puntuación similar simplemente por casualidad. Para secuencias que tienen un valor de E de 0,01 o menos sobre las porciones alineadas y coincidentes, la probabilidad de encontrar una coincidencia por casualidad en esa base de datos es del 1 % o menos usando el algoritmo BLASTN, BLASTP, BLASTX, tBLASTN o tBLASTX.

Pueden llevarse a cabo múltiples alineamientos de secuencias de un grupo de secuencias relacionadas con CLUSTALW (Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22:4673-4680, http://www-igbmc.u-strasbg.fr/BioInfo/ClustalW/Top.html) o T- COFFEE (Cedric Notredame, Desmond G. Higgins, Jaap Heringa, T-Coffee: A novel method for fast and accurate multiple sequence alignment, J. Mol. Biol. (2000) 302: 205-217)) o PILEUP, que usa alineamientos por parejas progresivos (Feng and Doolittle, 1987, J. Mol. Evol. 25, 351).

Están disponibles aplicaciones de software de reconocimiento de patrones para encontrar motivos o secuencias distintivas. Por ejemplo, MEME (múltiples Em para la obtención de motivos) encuentra motivos y secuencias distintivas en un conjunto de secuencias y MAST (alineamiento de motivos y herramienta de búsqueda) usa estos motivos para identificar motivos similares o los mismos motivos en secuencias de búsqueda. Los resultados de MAST se proporcionan como una serie de alineamientos con datos estadísticos apropiados y una visión general visual de los motivos encontrados. MEME y MAST se desarrollaron en la Universidad de California, San Diego.

PROSITE (Bairoch y Bucher, 1994, Nucleic Acids Res. 22, 3583; Hofmann et al., 1999, Nucleic Acids Res. 27, 215) es un método de identificación de las funciones de proteínas sin caracterizar traducidas de secuencias de ADN genómico o de ADNc. La base de datos PROSITE (www.expasy.org/prosite) contiene patrones y perfiles biológicamente significativos y se diseña de manera que pueda usarse con herramientas computacionales apropiadas para asignar una nueva secuencia a una familia de proteínas conocida o para determinar qué dominio(s) conocido(s) está(n) presentes en la secuencia (Falquet et al., 2002, Nucleic Acids Res. 30, 235). Prosearch es una herramienta que puede buscar en las bases de datos SWISS-PROT y EMBL con un patrón de secuencia dado o distintivo.

La función de un polinucleótido de variante de la invención como que codifica un factor de transcripción que puede regular la producción de pigmentos en un factor de transcripción de planta puede probarse para esta capacidad para regular la expresión de genes de biosíntesis de antocianina conocidos (por ejemplo, Ejemplo 4) o puede probarse para su capacidad para regular la producción de pigmentos (por ejemplo, Ejemplos 5 y 6).

Métodos para aislar polipéptidos

Los polipéptidos de la invención, que incluyen polipéptidos de variante, pueden prepararse usando métodos de síntesis de péptidos muy conocidos en la técnica tales como síntesis directa de péptidos usando técnicas en fase sólida (por ejemplo, Stewart et al., 1969, en Solid-Phase Peptide Synthesis, WH Freeman Co, San Francisco California, o síntesis automatizada, por ejemplo, usando un sintetizador de péptidos 431A de Applied Biosystems (Foster City, California). También pueden producirse formas mutadas de los polipéptidos durante tales síntesis.

Los polipéptidos y polipéptidos de variante de la invención también pueden purificarse de fuentes naturales usando una variedad de técnicas que son muy conocidas en la técnica (por ejemplo, Deutscher, 1990, Ed, Methods in Enzymology, Vol. 182, Guide to Protein Purification).

Alternativamente, los polipéptidos y polipéptidos de variante de la invención pueden expresarse recombinantemente en células huésped adecuadas y separarse de las células como se trata más adelante.

Métodos para producir construcciones y vectores

Las construcciones genéticas de la presente invención comprenden una o más secuencias de polinucleótidos de la invención y/o polinucleótidos que codifican polipéptidos de la invención, y pueden ser útiles para transformar, por ejemplo, organismos bacterianos, fúngicos, de insecto, de mamífero o de planta. Las construcciones genéticas de la invención pretenden incluir construcciones de expresión como se definen en el presente documento.

Los métodos para producir y usar construcciones genéticas y vectores son muy conocidos en la técnica y se describen generalmente en Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987; Ausubel et al., Current Protocolos in Molecular Biology, Greene Publishing, 1987).

Métodos para producir células huésped que comprenden polinucleótidos, construcciones o vectores

La invención proporciona una célula huésped que comprende una construcción genética o vector de la invención. Las células huésped pueden derivarse de, por ejemplo, organismos bacterianos, fúngicos, de insecto, de mamífero o de planta.

Las células huésped que comprende construcciones genéticas, tales como construcciones de expresión, de la invención son útiles en métodos muy conocidos en la técnica (por ejemplo Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987; Ausubel et al., Current Protocolos in Molecular Biology, Greene Publishing, 1987) para la producción recombinante de polipéptidos de la invención. Tales métodos pueden implicar el cultivo de células huésped en un medio apropiado en condiciones adecuadas para o propicias para la expresión de un polipéptido de la invención. El polipéptido recombinante expresado, que opcionalmente puede secretarse en el cultivo, puede entonces separarse del medio, células huésped o medio de cultivo por métodos muy conocidos en la técnica (por ejemplo, Deutscher, Ed, 1990, Methods in Enzymology, Vol 182, Guide to Protein Purification).

Métodos para producir células vegetales y plantas que comprenden construcciones y vectores

La invención proporciona además células vegetales que comprenden una construcción genética de la invención, y células vegetales modificadas para alterar la expresión de un polinucleótido o polipéptido de la invención. Plantas que comprenden tales células también forman un aspecto de la invención.

La producción de plantas alteradas en la producción de pigmentos puede lograrse mediante métodos de la invención. Tales métodos pueden implicar la transformación de células vegetales y plantas, con una construcción de la invención diseñada para alterar la expresión de un polinucleótido o polipéptido que puede regular la producción de pigmentos en tales células vegetales y plantas. Tales métodos también incluyen la transformación de células vegetales y plantas con una combinación de la construcción de la invención y una o varias de otras construcciones diseñadas para alterar la expresión de uno o más polipéptidos o polipéptidos que pueden regular la producción de pigmentos en tales células vegetales y plantas.

Métodos para transformar células vegetales, plantas y porciones de las mismas con polipéptidos se describen en Draper et al., 1988, Plant Genetic Transformation and Gene Expression. A Laboratory Manual. Blackwell Sci. Pub. Oxford, p. 365; Potrykus and Spangenburg, 1995, Gene Transfer to Plants. Springer-Verlag, Berlin; y Gelvin et al., 1993, Plant Molecular Biol. Manual. Kluwer Acad. Pub. Dordrecht. Una revisión de plantas transgénicas, que incluyen técnicas de transformación, se proporciona en Galun and Breiman, 1997, Transgenic Plants. Imperial College Press, London.

Métodos para la manipulación genética de plantas

Están disponibles varias estrategias de transformación de plantas (por ejemplo, Birch, 1997, Ann Rev Plant Phys Plant Mol Biol, 48, 297). Por ejemplo, pueden diseñarse estrategias para aumentar la expresión de un polinucleótido/polipéptido en una célula de planta, órgano y/o en una etapa de desarrollo particular en la que/cuando normalmente se expresa o para expresar ectópicamente un polinucleótido/polipéptido en una célula, tejido, órgano y/o en una etapa de desarrollo particular que/cuando no se expresa normalmente. El polinucleótido/polipéptido expresado puede derivarse de la especie de planta que va a transformarse o puede derivarse de una especie de planta diferente.

Pueden diseñarse estrategias de transformación para reducir la expresión de un polinucleótido/polipéptido en una célula de planta, tejido, órgano o en una etapa de desarrollo particular que/cuando normalmente se expresa. Tales estrategias son conocidas como estrategias de silenciamiento génico.

Las construcciones genéticas para la expresión de genes en plantas transgénicas normalmente incluyen promotores para conducir la expresión de uno o más polinucleótidos clonados, terminadores y secuencias de marcadores de selección para detectar la presencia de la construcción genética en la planta transformada.

Los promotores adecuados para su uso en las construcciones de la presente invención son funcionales en una célula, tejido u órgano de una planta monocotiledónea o dicotiledónea e incluyen promotores específicos de célula, tejido y órgano, promotores específicos del ciclo celular, promotores temporales, promotores inducibles, promotores constitutivos que son activos en la mayoría de los tejidos de planta y promotores recombinantes. La elección del promotor dependerá de la expresión temporal y espacial del polinucleótido clonado, así deseado. Los promotores pueden ser aquellos normalmente asociados a un transgén de interés, o promotores que se derivan de genes de otras plantas, virus y bacterias patógenas de plantas y hongos. Aquellos expertos en la materia serán capaces de seleccionar, sin excesiva experimentación, promotores que son adecuados para su uso en modificar y modular los rasgos de plantas usando construcciones genéticas que comprenden las secuencias de polinucleótidos de la invención. Ejemplos de promotores de plantas constitutivos incluyen el promotor 35S del CaMV, el promotor de nopalina sintasa y el promotor de octopina sintasa, y el promotor Ubi 1 de maíz. Promotores de plantas que son activos en tejidos específicos que responden a señales de desarrollo internas o estrés abiótico o biótico externo se describen en la bibliografía científica. Promotores a modo de ejemplo se describen, por ejemplo, en el documento WO 02/00894, que se incorpora en el presente documento por referencia.

Terminadores a modo de ejemplo que se usan comúnmente en la construcción genética de transformación de plantas incluyen, por ejemplo, el terminador 35S del virus del mosaico de la coliflor (CaMV), los terminadores de nopalina sintasa u octopina sintasa de Agrobacterium tumefaciens, el terminador del gen de zeína de Zea mays, el terminador de ADP-glucosa pirofosforilasa de Oryza sativa y el terminador PI-II de Solanum tuberosum.

Marcadores de selección comúnmente usados en la transformación de plantas incluyen el gen neomicina fofotransferasa II (NPT II) que confiere resistencia a kanamicina, el gen aadA, que confiere resistencia a espectinomicina y estreptomicina, fosfinotricina acetil transferasa (gen bar) para resistencia a Ignite (AgrEvo) y Basta (Hoechst), y el gen higromicina fosfotransferasa (hpt) para resistencia a higromicina.

También se contempla el uso de construcciones genéticas que comprenden genes indicadores (secuencias codificantes que expresan una actividad que es extraña para el huésped, normalmente una actividad enzimática y/o una señal visible (por ejemplo, luciferasa, GUS, GFP) que puede usarse para el análisis de expresión de promotores en plantas y tejidos de planta. La bibliografía de genes indicadores se revisa en Herrera-Estrella et al., 1993, Nature 303, 209, y Schrott, 1995, en: Gene Transfer to Plants (Potrykus, T., Spangenberg. Eds) Springer Verlag. Berlin, pp. 325-336.

Las estrategias de silenciamiento génico pueden centrarse en el propio gen o elementos reguladores que afectan la expresión del polipéptido codificado. “Elementos reguladores” se usa aquí en el sentido más amplio posible e incluye otros genes que interaccionan con el gen de interés.

Las construcciones genéticas diseñadas para reducir o silenciar la expresión de un polinucleótido/polipéptido de la invención pueden incluir una copia antisentido de un polinucleótido de la invención. En tales construcciones, el polinucleótido se pone en una orientación antisentido con respecto a un promotor y terminador.

Se obtiene un polinucleótido “antisentido” invirtiendo un polinucleótido o un segmento del polinucleótido de manera que el transcrito producido será complementario al transcrito de ARNm del gen, por ejemplo, 5'GATCTA 3' (hebra codificante) 3'CTAGAT 5' (hebra no codificante) 3'CUAGAU 5' ARNm 5'GAUCUCG 3' ARN antisentido Las construcciones genéticas diseñadas para el silenciamiento génico también pueden incluir una repetición invertida. Una 'repetición invertida' es una secuencia que se repite donde la segunda mitad de la repetición es en la hebra complementaria, por ejemplo, 5'-GATCTA......... TAGATC-3' 3'-CTAGAT.........ATCTAG-5' El transcrito formado puede someterse a apareamiento de bases complementarias para formar una estructura de horquilla. Normalmente se requiere un espaciador de al menos 3-5 pb entre la región repetida para permitir la formación de la horquilla.

Otro enfoque de silenciamiento implica el uso de un ARN antisentido pequeño dirigido al transcrito equivalente a un miARN (Llave et al., 2002, Science 297, 2053). Se contempla expresamente el uso de tal ARN antisentido pequeño correspondiente al polinucleótido de la invención.

El término construcción genética, como se usa en el presente documento, también incluye ARN antisentido pequeños y otros polipéptidos tales que afectan el silenciamiento génico.

La transformación con una construcción de expresión, como se define en el presente documento, puede también producir silenciamiento génico mediante un proceso conocido como supresión sentido (por ejemplo, Napoli et al., 1990, Plant Cell 2, 279; de Carvalho Niebel et al., 1995, Plant Cell, 7, 347). En algunos casos, la supresión sentido puede implicar la expresión en exceso de la secuencia codificante completa o parcial, pero también puede implicar la expresión de la región no codificante del gen, tal como un intrón o una región sin traducir de 5' o 3' (UTR). Pueden usarse construcciones sentido parciales quiméricas para silenciar coordinadamente múltiples genes (Abbott et al., 2002, Plant Physiol. 128(3): 844-53; Jones et al., 1998, Planta 204: 499-505). También se contempla el uso de tales estrategias de supresión sentido para silenciar la expresión de un polinucleótido de la invención.

Las inserciones de polinucleótidos en construcciones genéticas diseñadas para el silenciamiento génico pueden corresponderse con secuencia codificante y/o secuencia no codificante, tal como promotor y/o intrón y/o secuencia 5' o 3' UTR, o el gen correspondiente.

Otras estrategias de silenciamiento génico incluyen enfoques negativos dominantes y el uso de construcciones de ribozima (McIntyre, 1996, Transgenic Res, 5, 257) Puede provocarse silenciamiento pre-transcripcional mediante mutación del propio gen o sus elementos reguladores. Tales mutaciones pueden incluir mutaciones puntuales, desplazamientos del marco, inserciones, deleciones y sustituciones.

Lo siguiente son publicaciones representativas que desvelan protocolos de transformación genética que pueden usarse para transformar genéticamente las siguientes especies de planta: Arroz (Alam et al., 1999, Plant Cell Rep.

18, 572); manzana (Yao et al., 1995, Plant Cell Reports 14, 407-412); maíz (patentes de EE.UU. nº de serie 5.177.010 y 5.981.840); trigo (Ortiz et al., 1996, Plant Cell Rep. 15, 1996, 877); tomate (patente de EE.UU. nº de serie 5.159.135); patata (Kumar et al., 1996 Plant J. 9, : 821); yuca (Li et al., 1996 Nat. Biotechnology 14, 736); lechuga (Michelmore et al., 1987, Plant Cell Rep. 6, 439); tabaco (Horsch et al., 1985, Science 227, 1229); algodón (patentes de EE.UU. nº de serie 5.846.797 y 5.004.863); céspedes (patentes de EE.UU. nº 5.187.073 y 6.020. 539); menta (Niu et al., 1998, Plant Cell Rep. 17, 165); plantas cítricas (Pena et al., 1995, Plant Sci,104, 183); alcaravea (Krens et al., 1997, Plant Cell Rep, 17, 39); banana (patente de EE.UU. nº de serie 5.792.935); soja (patentes de EE.UU. nº 5.416.011; 5.569.834; 5.824.877; 5.563.04455 y 5.968.830); piña (patente de EE.UU. nº de serie 5.952.543); álamo (patente de EE.UU. nº 4.795.855); monocotiledóneas en general (patentes de EE.UU. nº 5.591.616 y 6.037.522); brassica (patentes de EE.UU. nº 5.188.958; 5.463.174 y 5.750.871); cereales (patente de EE.UU. nº 6.074.877); pera (Matsuda et al., 2005); Prunus (Ramesh et al., 2006; Song y Sink 2005; Gonzalez Padilla et al., 2003); fresa (Oosumi et al., 2006; Folta et al., 2006), rosa (Li et al., 2003) y Rubus (Graham et al., 1995). La transformación de otras especies también se contempla por la invención. Están disponibles métodos y protocolos adecuados en la bibliografía científica.

Pueden emplearse varios otros métodos conocidos en la técnica para alterar la expresión de un nucleótido y/o polipéptido de la invención. Tales métodos incluyen, pero no se limitan a, Tilling (Till et al., 2003, Methods Mol Biol, 2 %, 205), la llamada tecnología “Deletagene” (Li et al., 2001, Plant Journal 27(3), 235) y el uso de factores de transcripción artificiales tales como factores de transcripción de dedo de cinc sintéticos (por ejemplo, Jouvenot et al., 2003, Gene Therapy 10, 513). Adicionalmente, anticuerpos o fragmentos de los mismos, dirigidos a un polipéptido particular, también pueden expresarse en plantas para modular la actividad de ese polipéptido (Jobling et al., 2003, Nat. Biotechnol., 21(1), 35). También pueden aplicarse enfoques de marcado de transposón. Adicionalmente pueden identificarse péptidos que interaccionan con un polipéptido de la invención mediante tecnologías tales como expresión en fase (Dyax Corporation). Tales péptidos que interaccionan pueden expresarse en o aplicarse a una planta para afectar la actividad de un polipéptido de la invención. Se contempla específicamente el uso de cada uno de los enfoques anteriores en la alteración de la expresión de un nucleótido y/o polipéptido de la invención.

Métodos de selección de plantas

También se proporcionan métodos para seleccionar plantas con producción de pigmentos alterada. Tales métodos implican probar plantas para expresión alterada de un polinucleótido o polipéptido de la invención. Tales métodos pueden aplicarse en una edad joven o etapa de desarrollo temprana cuando la producción de pigmentos alterada puede no ser necesariamente visible, para acelerar programas de cultivo dirigidos a mejorar el contenido de antocianinas.

La expresión de un polinucleótido, tal como un ARN mensajero, se usa frecuentemente como indicador de la expresión de un polipéptido correspondiente. Métodos a modo de ejemplo para medir la expresión de un polinucleótido incluyen, pero no se limitan a, análisis Northern, RT-PCR y análisis de transferencia puntual (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987). Los polinucleótidos o porciones de los polinucleótidos de la invención son así útiles como sondas o cebadores, como se define en el presente documento, en métodos para la identificación de plantas con niveles alterados de antocianina.

Los polipéptidos de la invención pueden usarse como sondas en experimentos de hibridación, o como cebadores en experimentos basados en PCR, diseñados para identificar tales plantas.

Alternativamente, pueden producirse anticuerpos contra polipéptidos de la invención. Métodos para producir y usar anticuerpos son estándar en la materia (véase, por ejemplo: Antibodies, A Laboratory Manual, Harlow A Lane, Eds, Cold Spring Harbour Laboratory, 1998). Tales anticuerpos pueden usarse en métodos para detectar la expresión alterada de polipéptidos que modulan el tamaño de la flor en plantas. Tales métodos pueden incluir ELISA (Kemeny, 1991, A Practical Guide to ELISA, NY Pergamon Press) y análisis Western (Towbin & Gordon, 1994, J Immunol Methods, 72, 313).

Estos enfoques para el análisis de la expresión de polinucleótidos o polipéptidos y la selección de plantas con expresión alterada son útiles en programas de cultivo convencionales diseñados para producir variedades con producción de pigmentos alterada.

Plantas

Las plantas de la invención pueden cultivarse y tanto autofecundarse como cruzarse con una cepa de planta diferente y pueden identificarse los híbridos resultantes, con las características fenotípicas deseadas. Pueden cultivarse dos o más generaciones para garantizar que las características fenotípicas objeto se mantengan o hereden establemente. Plantas resultantes de tales enfoques de cultivo estándar también forman un aspecto de la presente invención.

Breve descripción de los dibujos

La presente invención se entenderá mejor con referencia a los dibujos adjuntos en los que: La Figura 1 muestra la comparación de MdMYB10 (SEC ID Nº: 1) y MdMYB9 (SEC ID Nº: 2) con reguladores MYB de antocianinas conocidos de diversas especies en el dominio de unión R2R3. Las flechas indican residuos específicos que contribuyen a un motivo que participa en la interacción del cofactor bHLH en Arabidopsis (Zimmermann et al, 2000); estos mismos residuos son evidencia en MdMYB10 y MdMYB9, sugiriendo una interacción proteína-proteína similar.

La Figura 2 muestra un análisis filogenético que muestra la relación entre Arabidopsis y TF MYB de manzana. La fecha muestra la posición de MdMYB10 que se encuentra próximo a AtPAP1 en el subgrupo 10 de reguladores MYB de antocianinas. Reguladores de antocianinas conocidos se indican por un punto verde, otros genes incluidos en la figura con un punto negro son controles negativos que muestran que la acción de MdMYB10 es específica para este clado MYB y no MYB en general.

La Figura 3(A) muestra datos de análisis por qPCR de los genes biosintéticos de antocianina de manzana de CHS a UFGT como se enumera a la derecha en la corteza, piel y hoja en Red Field y Pacific Rose. Los números del eje x hacen referencia a lo siguiente; 1, 40 DAFB, 2, 67 DAFB, 3, 102 DAFB, 4, 130 DAFB, 5, 146 DAFB, 6, hoja de Red Field OP y 7, hoja de Pacific Rose.

La Figura 3(B) muestra secciones a través de la fruta de la manzana (Red Field OP en la fila superior, Pacific Rose en la fila inferior) en las etapas de desarrollo 1 a 5 como en 3(A). Es visiblemente evidente la elevada pigmentación en Red Field OP frente a Pacific Rose.

La Figura 4 muestra un análisis de la expresión de MdMYB10, MdbHLH3 y MdbHLH33. (A) Análisis por RT-PCR de MdMYB10 en Red Field (corteza, piel y hoja) y Pacific Rose (corteza, piel y hoja) y (B) datos de qPCR correspondientes de MdMYB10, MdbHLH3 y MdbHLH33. Carril de gel y número del eje x del siguiente modo; 1, 40 DAFB, 2, 67 DAFB, 3, 102 DAFB, 4,130 DAFB, 5, 146 DAFB, 6, hoja de Red Field y 7, hoja de Pacific Rose.

La Figura 5 muestra que el ensayo de luciferasa dual muestra actividad de promotor como se expresa como una relación de LUC con respecto a REN en la que un aumento en la actividad es igual a un aumento en LUC con respeto a REN para una combinación de TF de MYB con/sin TF de bHLH; (A) Arabidopsis TT4 (CHS)-promotor de Luc, (B) Arabidopsis TT3 (DFR)-promotor de Luc. 0, MYB solo, 1, MYB+AtTT8, 2, MYB+MdbHLH3, 3, MYB+MdbHLH33.

La Figura 6 muestra datos del ensayo transitorio en Nicotiana tabacum. (A) Muestra la medición de color por el cromámetro Minolta como se muestra como relación a*/b*. Un desplazamiento hacia el positivo indica un cambio de color de verde a rojo. (i) MdMYB10+MdbHLH3, (ii) MdMYB10 solo. (B) Muestra imágenes de microscopio que muestran el patrón de acumulación de antocianinas (gris más oscuro) en tejido de hoja de tabaco infiltrado con MdMyb10+ MdbHLH3 a 20x (izquierda) y 40x (derecha). Las barras de escala representan 50 micrómetros.

La Figura 7 muestra diagramas de HPLC que muestran (A) pétalo de Nicotiana tabacum y (B) hoja de Nicotiana tabacum infiltrada con MdMYB10+MdbHLH3. 1, cianidin-3-glucósido 2, petunidin-3-galactósido, 3 cianidin-3-0- rutinósido. No se observaron picos en hoja de tabaco de control (datos no mostrados). La Figura 8 muestra el alineamiento de secuencias de proteínas de la secuencia de polipéptidos de MdMyb10 con variantes de polipéptido de MdMYB10 y AtPAP1 (también llamado AtMYB75) para referencia. El número de acceso de AtMYB75 en la base de datos de GenBank es CAB09230. El alineamiento se creó usando el algoritmo Clustal W (Thompson et al., 1994).

La Figura 9 muestra el % de identidad de secuencias entre las secuencia de polipéptidos de MdMyb10, variantes de polipéptido de MdMYB10 y AtPAP1 para referencia. La tabla muestra el % de valores de identidad para todas las posibles combinaciones de secuencias para las secuencias que están incluidas en la Figura 8.

La Figura 10 muestra que la activación del promotor del gen At-DFR por MdMYB10 y PcfMYB10 (una variante de PcfMYB10) en combinación con TF bHLH de manzana en ensayos de transformación transitoria de tabaco afecta la actividad del promotor del gen At-DFR. El ensayo de luciferasa dual muestra la actividad promotora como se expresa como una relación de la luciferasa promotora DFR (LUC) con respecto a 35S de Renilla (REN) en la que un aumento en la actividad es igual a un aumento en LUC con respecto a REN. Se muestran los efectos de combinaciones de factores de transcripción MYB (Md MYB 10, PcfMYB10 y MdMYB8 (control -ve) con factores de transcripción bHLH Md bHLH 3 y MdbHLH33. Las barras de error mostradas son medias ± E.E. de 6 reacciones duplicadas.

La Figura 11 muestra que la expresión en exceso de MdMYB10 en células y/o plantas de manzana eleva la producción de antocianina. (A)(i) muestra células de callo pigmentado. A(ii) muestra una planta de manzana transformada con 35S-MdMYB10 (izquierda) y planta de control de vector vacío (derecha). La planta transformada con 35-MdMYB10 muestra claramente fuerte pigmentación en comparación con el control de vector vacío. (B) Muestra perfiles de antocianina de extractos de hoja de manzana 35S-MdMYB10 (línea superior) y control de vector vacío (línea inferior). Picos identificados a partir de diagramas de HPLC a 520 nm; cy-gal, cianidin-3-galactósido, con trazas menores de cy-glu, cianidin-3-glucósido y cy-pent, cianidin-3-pentósido.

Ejemplos

La invención se ilustrará ahora con referencia a los siguientes ejemplos no limitantes.

Cualquier ejemplo que no se encuentre dentro del alcance de las reivindicaciones se proporciona para fines de comparación solo.

Ejemplo 1: Identificación de un tejido de manzana apropiado y etapa de desarrollo útil para el aislamiento de

polinucleótidos que codifican factores de transcripción que regulan la producción de pigmentos

Materiales y métodos

Análisis de expresión en tiempo real (qPCR)

Se recogieron frutas de manzana en 6 momentos de tiempo durante la estación de la fruta de la manzana desde la primavera (octubre) hasta el verano (marzo) de 2003-2004: octubre (7 días después del pleno florecimiento, DAFB), noviembre (40 DAFB), diciembre (67 DAFB), enero (102 DAFB), febrero (130 DAFB) y marzo (146 DAFB) de árboles en el huerto de árboles frutales de HortResearch (Nelson, Nueva Zelanda). Se aisló ARN (adaptado de Chang et al., 1993) de la fruta (seis frutas del mismo árbol, piel y corteza por separado) y las hojas de 2 genotipos; el cultivar comercial de pulpa blanca Malus domestica var. Sciros (Pacific Rose™, derivado de un cruce entre Gala y Splendour) y el cultivar de pulpa roja Malus domestica var. Red Field, una planta de semillero de polinización abierta del cultivar 'Red Field' (un cruce entre 'Wolf River' y Malus domestica var. Niedzwetzkyana (Brooks y Olmo, 1972). Para el primer momento de tiempo del fruto en desarrollo, octubre (7 DAFB), no fue posible la satisfactoria eliminación de piel de la corteza y se han excluido los datos de esta muestra. La síntesis de ADNc de la primera cadena (tres duplicados para cada muestra que posteriormente se reunieron) fue precedida por tratamiento con DNasa y se realizó usando oligo dT según las instrucciones del fabricante (Transcriptor, Roche Applied Science). Se identificaron genes que codifican las enzimas de la vía de antocianinas de manzana y reguladores por homología en la base de datos HortResarch EST y, en el caso de posibles isoformas, se hizo selección según el perfil de expresión y tejido de biblioteca. Se diseñaron cebadores específicos de gen, correspondientes a estos genes, usando Vector NTI versión 9.0.0 (www.invitrogen.com) para un conjunto riguroso de criterios, permitiendo laaplicación de condiciones de reacción universales. Para comprobar la especificidad de la reacción, se usó RT-PCR según las instrucciones del fabricante (Platinum Taq, Invitrogen). La secuencia de cada par de cebadores y elnúmero de acceso relevante se muestran en la Tabla 1 suplementaria a continuación.

Tabla 1 Identificador Nombre del Cebador directo (SEC ID Nº:) Cebador inverso (SEC ID Nº:) del gen gen CN944824 MdCHS CN946541 MdCHI GGGATAACCTCGCGGCCAAA (83) CN491664 MdF3H AY227729 MdDFR GATAGGGTTTGAGTTCAAGTA (87) AF117269 MdLDOX CCAAGTGAAGCGGGTTGTGCT (89) AF117267 MdUFGT CCACCGCCCTTCCAAACACTCT (91) MdMYB10 MdbHLH33 CN934367 MdbHLH3 CN938023 MdActin Se llevó a cabo amplificación y análisis de ADN usando el sistema LightCycler (Roche LightCycler 1.5). Todas las reacciones se realizaron con LightCycler FastStart SYBR Green Master Mix (Roche Applied Science) siguiendo el método del fabricante. Se realizaron por triplicado reacciones usando 2 µl de 5x Master Mix, 0,5 µM de cada cebador, 1 µl de ADNc diluido y agua libre de nucleasa (Roche Applied Science) a un volumen final de 10 µl. Se incluyó un control de agua negativo en cada ejecución. Se usó el siguiente perfil térmico para todas las reacciones de qPCR: una etapa de pre-incubación a 95 ºC durante 5 minutos seguido de 40 ciclos de 95 ºC (5 segundos), 60 ºC (5 segundos) y 72 ºC (10 segundos). La fluorescencia se midió al final de cada etapa de hibridación. La amplificación fue seguida de un análisis de curvas de fusión con adquisición de datos continua de fluorescencia durante la fusión de 65 ºC a 95 ºC. Los datos sin procesar se analizaron con el software LightCycler versión 4 y la expresión se normalizó para actina de Malus domestica (MdActin, acceso CN938023) con la muestra de hoja de Pacific Rose que actúa de calibrador con un valor nominal de 1. Para cada gen se generó una curva patrón con una dilución sucesiva de ADNc y los cálculos de eficiencia de PCR resultantes (que oscilan entre 1,839 y 1,945) se importaron en el análisis de datos de expresión relativos.

Resultados

Análisis de expresión por qPCR de enzimas biosintéticas

Con el fin de identificar la etapa de desarrollo del fruto, cuando la regulación transcripcional de la síntesis de antocianinas es la mayor, se realizó el análisis de expresión de los principales genes biosintéticos. Una comparación de los niveles de transcrito que codifican los genes biosintéticos de antocianinas entre Pacific Rose y Red Field muestra notables diferencias. En todos los genes ensayados, que representan la mayoría de las etapas enzimáticas en la vía, niveles de transcrito en Red Field mostraron elevación significativa durante todas las etapas de desarrollo del fruto en comparación con los niveles encontrados en Pacific Rose (Figura 3).

La abundancia de transcritos de los genes biosintéticos en Red Field se potenció mediante el desarrollo del fruto en tanto piel como corteza, con un patrón general que indica los mayores niveles de transcrito en el momento de tiempo de enero. Esta configuración imita el grado de pigmentación observado durante el muestreo de tejido observándose la pigmentación más intensa pronto en el desarrollo (40 DAFB) y luego de nuevo a mediados del verano (102 DAFB), un nivel que posteriormente se mantiene hasta la maduración del fruto a finales del verano (Figura 3b). En tejido de corteza de Pacific Rose hubo nivel de transcritos comparativamente bajo para todos los genes de biosíntesis de antocianina, con una disminución general en la expresión durante el desarrollo del fruto. Se observó actividad moderada en la piel con un pico de expresión a mitad de camino en el desarrollo en 102 DAFB, concomitante con potenciados niveles de pigmentación durante la maduración del fruto. El nivel de expresión en las hojas de ambas variedades fue evidente, pero relativamente bajo con poco para distinguir entre Red Field y Pacific Rose.

Los resultados del análisis de qPCR de los niveles de transcritos de la enzima biosintética antocianina se analizaron para determinar el tejido/momento de tiempo más adecuado para el aislamiento relevante de factores de transcripción MYB. Los presentes inventores eligieron tejido de corteza de Red Field, que mostró el mayor nivel de expresión para los genes de biosíntesis de antocianinas.

Ejemplo 2: Aislamiento de polinucleótidos que codifican factores de transcripción que posiblemente regulan la producción de pigmentos en manzana.

Se realizó PCR usando ADNc de la muestra de corteza de Red Field (momento de tiempo de enero) usando cebadores degenerados (con una degeneración de 32 veces) diseñados en el dominio de unión R2R3 basándose en la secuencia de reguladores de antocianina en diversas especies. Se obtuvieron numerosos ADNc que codificaban los dominios R2R3 de MYB. Los resultados de los datos de secuenciación revelaron un ADNc con alta identidad con reguladores de antocianina y se obtuvo secuencia de longitud completa usando 5' RACE (GeneRacer, Invitrogen). La secuencia completa para el ADNc de MdMYB10 se recopiló a partir de fragmentos solapantes. Para comparar el transcrito de Red Field, posteriormente se aislaron ADNc de longitud completa de Malus domestica vars. Pacific Rose y Granny Smith. También se aisló MdMYB11 (DQ074463), un MYB del subgrupo 11 (según Stracke et al. 2001) y se secuenció por el mismo proceso. Otros candidatos a factor de transcripción se aislaron de la colección HortResearch EST: MdMYB9 un homólogo de manzana de TT2 de Arabidopsis (Nesi et al., 2001, AJ299452), y MdMYB8, un MYB de manzana que tiene poca homología de secuencias con reguladores de antocianina conocidos.

Estudios previos en otras especies han mostrado que un MYB del subgrupo 10 puede ser el determinante clave de la pigmentación. Dentro de bases de datos EST de manzana públicamente disponibles (185.000 secuencias de nucleótidos en agosto de 2005), no hay TF MYB que muestre alta homología mediante blasts de secuencia con PAP1 de Arabidopsis y MYB del subgrupo 10 de otras especies.

Alineamientos de secuencias solapantes de ADNc clonados después de PCR muestran que el mejor candidato, MdMYB10, comparte un alto grado de homología con otros TF MYB en el dominio R2R3 y, en particular, con reguladores de antocianina de otras especies (Figura 1). MdMYB10 está estrechamente relacionado con el MYB del subgrupo 10 de Arabidopsis, PAP1, con un 77 % de identidad de aminoácidos en el dominio de unión R2R3 y 58 % global. Para PAP2 de Arabidopsis, estas identidades en porcentaje de aminoácidos son del 75 % y 57 %, respectivamente, mientras que para otras especies las cifras para la identidad global son las siguientes: Petunia AN2 60 %, Tomate ANT1 57 %, Maíz C1 58 % y Maíz P 26 %.

Todos estos TF MYB tienen los residuos de aminoácidos que especifican interacción con bHLH (Grotewold et al., 2000). Por tanto, candidatos para estos cofactores se seleccionaron de la base de datos HortResearch EST. En la gran familia filogenética que constituye el TF tipo bHLH, hay un clado más pequeño llamado IIIf (Heim et al., 2003) que parece participar en la regulación de la biosíntesis de flavonoides. Dos TF de manzana de la base de datos HortResearch EST se agruparon dentro de este clado (datos no mostrados). Éstos se secuenciaron a longitud completa y se les dieron identificadores MdbHLH3 (CN934367), un homólogo putativo del gen TT8 de Arabidopsis y MdbHLH33, un homólogo putativo de Delila (de Antirrhinum, Goodrich et al., 1992).

Filogenia

Las secuencias EST de manzana se recortaron de las regiones de vector, adaptador y de secuencia de baja calidad y se subieron a Vector NTI versión 9.0.0 (www.invitrogen.com). La fase de agrupamiento de EST se realizó usando el programa Vector NTI AlignX. A continuación, los alineamientos se exportaron a GeneDoc versión 2.6.002 (http://www.psc.edu/biomed/genedoc/) como archivos en formato MSF. Se generaron árboles re-alineando los archivos exportados en CLUSTALX (v1.81) usando los parámetros por defecto (Thompson et al., 1997). Se llevó a cabo análisis filogenético usando el paquete de software PHYLIP (Felsenstein, 1993). Se usó TreeView (v.1.6.5) para mostrar los árboles resultantes (Page, 1996) o se generaron árboles circulares usando MEGA versión 2.1 (Kumar et al., 2001).

Ejemplo 3: Identificación de variantes de MdMyb10

Se recogió tejido de Malus domestica, Malus sylvestris (Ms, manzana cangrejo europea), Pyrus communis (Pc, pera), Pyrus pyrifolia (pera Ppy, Nashi), Pyrus bretschneideri (Pb, pera, YALI), Cydonia oblonga (Co, membrillo), Prunus salicina (Ps, ciruela japonesa, ciruela pasa), Prunus cerasifera (Pcf, ciruela-cereza), Prunus persica (Ppr, melocotón), Eriobotrya japonica (Ej, níspero japonés), Prunus dulcis (Pd, almendra), Prunus avium (Pav, cereza dulce), Mespilus germanica (Mg, níspero), Prunus domestica (Pdm, ciruela europea), Rubus idaeus (Ri, frambuesa roja), Prunus armeniaca (par, albaricoque) y Prunus insititia (Pi, endrina), todos los cuales son especies de Rosacea.

Se extrajo ADN genómico (ADNg), usando DNeasy Plant Mini Kit (QIAGEN, catálogo 69104) según las instrucciones del fabricante, de hojas de cada especie, excepto Pyrus pyrifolia (pera Ppy, Nashi), Pyrus bretschneideri (Pb, pera, YALI), en los que el ADN genómico se aisló de la cáscara de la fruta.

Se realizó PCR en el ADNg de las especies anteriores (por técnicas convencionales) usando combinaciones de los cebadores mostrados en la Tabla 2 a continuación.

Tabla 2 Cebador Secuencia (5' a 3') SEC ID Nº: RE73 (cebador degenerado)F AAAAGTTGCAGACTTAGATGGTTGAATTATTTGAAGCC 48 RE77R GAGAATCGATCCGCAATCGAGTGTTCC 49 RE78R ACCACCTGTTTCCCAAAAGCCTGTGAAGTCT RE79R CACAAGCTAGATGGTACCACAGAAGTGAGAATC 51 RE95F TAAGAGATGGAGGGATATAACG 52 RE96R CTAGCTATTCTTCTTTTGAATGATTC 53 RE108F GATCGATTCTCGCATGAAAACGGT 54 RE109R GACGACGTTTGTGGTGGCGTACT RE120F TGCCTGGACTCGAGAGGAAGACA 56 RE121R CCTGTTTCCCAAAAGCCTGTGAA 57 KL Ms1F CTTATAATTAGACTTCACAGGC 58 KL Ms2R CACCGTTTTCATGCGAGAAT 59 KL Md PAP1F GCAGATAAGAGATGGAGGGATATAACGAAAACCTGAG KL MdPAP1R TACACAAGCTAGATGGTACCACAGAAGTGAGAATC 61 KL PcfF GACTTTATGGAAGATGAAGTAGATC 62 KL PcfR AAGCGATAGTATATTATTGATGAAG 63 KL Pcf2F CTTGGGTGTGAGAAAAGGAG 64 KL Pcf3R CACGCTAAAAGAGAAATCAC KL Pcf4R GCTTGTGAAGCCTAATTATT 66 KL Ppr1F GAAAGATAAACCCCAAGAAA 67 KL Ppr2R TTTGAACTCTTGATGAAGCT 68 KL Ppr3F CTGCGAATTTGTATTGTATGTC 69 KL Ppr4R TTCCCACCAATCATTTCCAT KL Fv1F AAGAGAGGAGAGTTTGCAGAGG 71 KL Fv2R TAGTTCTTCACATCATTGGCAG 72 KL Fv6R AATATGCACCAGGAAGTCTTAAAGA 73 KL Fv7F AAATCTGCTTAATTTTCATGGAGGG 74 KL Rh1F TCAGAGAGAGAGAGATGGGTGGTATTCC 75 KL Rh2R CTTCCTCTTGTTCAAAGCTCCCTCTC 76 KL Rh3F AGAACTATTGGAATTGTCACTTGAG 77 KL Rh4R AGAATAAAATCACTTTCATAACCAC 78 KL Rosa deg 1F (cebador AGACTTCCRGGAAGRACWGCNAATGMTGTG 79 degenerado con una degeneración de 64 veces) KL Rosa deg 2R (cebador CCARTAATTTTTCACAKCATTNGC 80 degenerado con una degeneración de 16 veces) Se secuenciaron productos de PCR genómicos mediante procedimientos convencionales.

A partir de ADN genómico secuenciado se predijeron intrones y exones por métodos conocidos de comparación con datos de EST de MdMYB10, límites de intrón/exón conocidos y marcos de lectura abiertos. A partir de estos ADNc deducidos se generó proteína traducida. Un resumen del ADNg de variante, ADNc predicho y secuencias de polipéptidos predichas identificadas se incluye en la Tabla X. Se enumeran variantes de polipéptido de MdMyb10 en el listado de secuencias como SEC ID Nº: 9-21. Se enumeran variantes de polinucleótidos de MdMyb10 en el listado de secuencias como SEC ID Nº: 22-47. SEC ID Nº: 102 es una secuencia genómica de MdMyb10.

Las secuencias de polipéptidos de variante (junto con MdMyb10 y AtPAP1 para referencia) se alinearon usando Vector NTI versión 9.0, que usa un algoritmo Clustal W (Thompson et al., 1994). Los resultados se muestran en la Figura 8.

También se calculó el porcentaje de identidad de secuencias entre las secuencias de polipéptidos alineadas usando Vector NTI versión 9.0 (02 de septiembre de 2003 ©1994-2003 InforMax, ahora con licencia para Invitrogen). Los resultados se muestran en la Figura 9.

Estos datos muestran que los solicitantes han identificado un grupo distinto de variantes de MdMyb10 de especies de Rosaceae. Las secuencias de Rosaceae comparten un grado significativo de conservación de secuencias, y cada secuencia de Rosaceae es más similar a otra secuencia de Rosaceae que a AtPAP1.

Ejemplo 4 Activación de promotores de pigmento por expresión de polinucleótidos de factor de transcripción de la invención en plantas

Ensayo de doble luciferasa

Se insertaron secuencias promotoras en el sitio de clonación de pGreen 0800-LUC (Hellens et al., 2005) y se modificaron para introducir un sitio NcoI en el extremo 3' de la secuencia, permitiendo que un promotor se clonara como fusión transcripcional con el gen de luciferasa de luciérnaga (LUC). Así, TF que se unen al promotor y aumentan la tasa de transcripción podrían identificarse por un aumento en la actividad de luminiscencia. Se aislaron CHS de Arabidopsis (TT4) (AT5G13930) y DFR de Arabidopsis (TT3) (AT5G42800) de ADN genómico. En la misma construcción, un gen de luciferasa de Renilla (REN) bajo el control de un promotor 35S proporcionó un cálculo estimado del grado de expresión transitoria. La actividad se expresa como una relación de actividad de LUC con respecto a REN de manera que cuando se produjera la interacción entre un TF (+/- bHLH) y un promotor, se observaría un aumento significativo en la actividad de LUC con respecto a REN.

Se cultivaron Nicotiana benthamiana bajo condiciones de invernadero, usando luz natural con extensión de la luz del día a 16 h, hasta que estuvieron disponibles al menos 6 hojas (de 2-3 cm de longitud) para la infiltración con Agrobacterium. Las plantas se mantuvieron en el invernadero durante la duración del experimento. Se cultivó cepa de Agrobacterium GV3101(MP90) sobre agar de Lennox (Invitrogen) complementado con antibióticos de selección y se incubó a 28 ºC. Se resuspendió un bucle de 10 µl de bacteria confluente en 10 ml de medio de infiltración (MgCl2 10 mM, acetosiringona 0,5 µM), a una DO600 de 0,2, y se incubó a temperatura ambiente sin agitación durante 2 h antes de la infiltración. Se realizaron infiltraciones según los métodos de Voinnet et al. (2003). Aproximadamente 150 µl de esta mezcla de Agrobacterium se infiltraron en seis puntos en una hoja joven de N. benthamiana y se ensayó la expresión transitoria 3 días después de la inoculación.

Se usaron las fusiones de promotor-LUC (CHS y DFR) en pGreenII 0800-LUC en transformación transitoria mezclando 100 µl de Agrobacterium transformado con el casete indicador con dos otras cepas de Agrobacterium (450 µl cada una) transformadas con casetes que contenían un gen de TF MYB fusionado con el promotor 35S y un gen de TF bHLH en tanto vectores binarios pART27 (Gleave, 1992) como pGreenII 62-SK (Hellens et al., 2000).

Se ensayaron luciferasa de luciérnaga y luciferasa de Renilla usando los reactivos de ensayo de doble luciferasa (Promega, Madison, EE.UU.). Tres días después de la inoculación, se quitaron discos de hojas de 2 cm (6 duplicados técnicos de cada planta) y se molieron en 500 µl de tampón de lisis pasivo (PLB). Se ensayaron diez µl de una dilución 1/100 de este extracto en bruto en 40 µl de tampón de ensayo de luciferasa, y se midió la quimioluminiscencia. Entonces se añadieron 40 µl de tampón Stop and Glow™ y se hizo una segunda medición de quimioluminiscencia. Se midieron unidades relativas de luminiscencia absoluta (URL) en un luminómetro Turner 20/20, con un retraso de 5 s y medición de 15 s.

Ensayo de doble luciferasa

Se ha demostrado que el sistema de doble luciferasa proporciona un método rápido de análisis transitorio de la expresión génica (Hellens et al., 2005). No requiere marcador de selección y los resultados pueden cuantificarse con un simple ensayo enzimático. En este estudio el sistema se usó para cuantificar la actividad de los genes biosintéticos de promotores de antocianina cuando se expusieron a TF que se unen putativamente a los promotores.

Los presentes inventores usaron N. benthamiana para el ensayo transitorio de doble luciferasa para probar la interacción de los TF candidatos de los presentes inventores con dos promotores de genes de la biosíntesis de antocianina de Arabidopsis, AtCHS (TT4, AT5g13930) y AtDFR (TT3, AT5g42800), que son conocidos por ser regulados por los TF MYB PAP1 y PAP2 de Arabidopsis (Tohge et al., 2005, Zimmermann et al., 2004). Se seleccionaron varios TF MYB de manzana para sondar la especificidad de MdMYB10: MdMYB9, MdMYB11, MdMYB8 y, de Arabidopsis, AtPAP1. Estos MYB se clasifican en clados que representan los subgrupos 10, 9, 11 y 7, respectivamente (Figura 2). Para interrogar la interacción entre TF MYB y bHLH se realizó co-transformación con reguladores putativos de la clase bHLH de manzana; MdbHLH3 y MdbHLH33 y de Arabidopsis el bHLH, TT8 (AtbHLH042; At4g09820).

Los resultados de los análisis transitorios basados en el promotor CHS mostraron que la actividad de MYB PAP1 de Arabidopsis fue la mayor en la co-transformación con un bHLH de manzana, pero inesperadamente no se afectó por la co-transformación con bHLH de TT8 de Arabidopsis. A diferencia, los resultados para MdMYB10 indican actividad que puede ser independiente de un bHLH con la mayor actividad observada con MYB solo (Figura 5). La co- transformación de MdMYB10 con bHLH de Arabidopsis pareció inhibir la actividad. MdMYB9 también mostró actividad potenciada en asociación con cualquier bHLH de manzana, de acuerdo con su similitud de secuencias para genes tipo TT2. No se observó actividad significativa para los restantes MYB y este grado de actividad representa supuestamente niveles basales.

Los resultados del ensayo de promotores DFR muestran un patrón diferente que indica un aumento significativo en la actividad cuando MdMYB10 (y AtPAP1) se co-transformó con un bHLH de manzana. En el caso de MdMYB10, la mayor actividad se observó cuando se infiltró con MdbHLH3. Esto contrastó con AtPAP1, en el que la actividad fue la mayor cuando se infiltró con el homólogo de Delila de manzana, MdbHLH33. Estos resultados reflejan el trabajo previo en un sistema transitorio de transfección de protoplastos en el que en una fusión de promotor DFR:Gus de Arabidopsis solo se activó por PAP1 en presencia de bHLH (Zimmermann et al., 2004), aunque debe observarse que los presentes inventores no vieron tan gran aumento en la actividad cuando AtPAP1 se infiltró con AtTT8.

MdMYB9 se realizó de un modo similar, pero reducido, mientras que la relación de LUC con respecto a REN para MdMYB11 y MdMYB8 fue baja bajo todas las condiciones.

Cuando se clonó MYB10 de cereza-ciruela genómico (PcfMYB10) en un vector plasmídico pGREEN y se ensayó como se ha descrito anteriormente, se produce la activación del promotor DFR. Se muestra la mayor actividad cuando PcfMYB10 se infiltra con MdbHLH3 y MdbHLH33 (Figura 10). Estos datos muestran que una secuencia de MYB10 de la sub-familia Amygdaloideae o Prunoideae también es eficaz en conducir la actividad del gen de antocianina en un mecanismo similar a MdMYB10 (de la sub-familia Malus de Rosaceae).

Ejemplo 5 Activación de la biosíntesis de pigmento por expresión de factores de transcripción de la

invención en plantas

Ensayo de color

Se cultivaron Nicotiana tabacum var. Samsun en un invernadero a 22 ºC, usando luz natural con prolongación de la luz del día a 16 h, hasta que estuvieron disponibles al menos 3 hojas (de 10-15 cm de longitud) para la infiltración con Agrobacterium. Las plantas se mantuvieron en el invernadero durante la duración del experimento. Se incubaron cultivos de Agrobacterium en cuanto al ensayo de doble luciferasa y cepas separadas que contenían el gen de TF MYB y el gen de TF bHLH fusionado con el promotor 35S en el vector binario pART27 se mezclaron (500 µl cada una) y se infiltraron en la superficie inferior de la hoja en cuando al ensayo con N. benthamiana. Se realizaron seis infiltraciones separadas en hojas de N. tabacum (dos plantas por tratamiento) y se midieron los cambios en el color diariamente usando un cromámetro Minolta CR-300 (calibrado a luz D65) usando el sistema L*a*b* (CIE, 1986). Las infiltraciones que comprenden MdMYB10 junto con un bHLH de manzana produjeron pigmentación visible después de cuatro días. El nivel de pigmentación aumentó a lo largo del periodo experimental; se tomaron imágenes fotográficas y de microscopio digitales ocho días después de la infiltración. No se desarrolló pigmentación de antocianina cuando se usó N. benthamiana en ensayos paralelos (datos no mostrados).

HPLC

Se sacaron discos de hojas de N. tabacum alrededor de los sitios de infiltración, se liofilizaron y se molieron gruesamente antes de la resuspensión en 5 ml de metanol y 0,1 % de HCl, se extrajeron a temperatura ambiente durante 2 horas y se centrifugaron a 3500 rpm. Alícuotas de 1 ml se secaron hasta completitud en un concentrador Labconco Centrivap. Se resuspendieron muestras en 20 % de metanol (250 µl). Se caracterizaron antocianinas por HPLC sobre una columna de fenilo enlazado a éter de 250 x 4,6 mm, Synergi, tamaño de partícula 4m, Polar-RP, tamaño de poro 80Å (Phenomenex, Auckland, Nueva Zelanda). Ésta se ajustó a un HPLC analítico Shimadzu con un horno de columna, inyector térmico, desgasificador de disolvente a vacío y detector de matriz de diodos. Los disolventes fueron (A) acetonitrilo + 0,1 % de ácido fórmico y (B) acetonitrilo/agua/ácido fórmico, 5:92:3. La velocidad de flujo fue 1,5 ml/min y la temperatura de la columna 45 ºC. El contenido de disolvente A fue 0 % a tiempo 0 y aumentó linealmente en rampa hasta el 17 % a 17 min, 20 % a 20 min, 30 % a 26 min, 50 % a 28,5 min, 95 % entre 32-35 min y de nuevo al 0 % entre 36-42 min. La cuantificación de productos de reacción fue a 520 nm para antocianinas y 280 nm para otros fenólicos. Se registraron espectros de 240-600 nm en etapas de 4 nm. El volumen de inyección de muestra fue 40 µl.

Ensayo de color

Los presentes inventores han establecido un método simple para revelar la acumulación de pigmentos de antocianina en N. tabacum mediante infiltración de Agrobacterium. Se examinó visualmente la acumulación de pigmentación en hojas infiltradas de N. tabacum. La pigmentación fue evidente en puntos de infiltración ya cuatro días después de la infiltración para MdMYB10 cuando se co-infiltró con un bHLH de manzana (Figura 6A). El grado de pigmentación aumentó durante el periodo experimental (de hasta diez días). También se observó pigmentación pero a niveles reducidos en tratamientos que comprenden co-infiltración de AtPAP1 y un bHLH de manzana (MdbHLH3 o MdbHLH33), AtPAP1 y AtTT8, y, a un menor grado, con infiltración de MdMYB10 solo. No fue visible pigmentación en otras combinaciones. Los resultados demuestran la eficacia de este ensayo como un sistema indicador útil para estudiar la regulación del proceso de pigmentación.

El color que se cuantificó por medición con un cromámetro Minolta usando el sistema L*a*b* confirmó la transición visible de verde a rojo. Los datos se muestran como una relación de a*/b* (Figura 6B), en la que el cambio denegativo hacia positivo indica un desplazamiento de verde a rojo. Hubo variabilidad entre duplicados de untratamiento dado en cuanto al grado de pigmentación como es evidente en la profundidad de las barras de error(Figura 6B).

Para verificar la formación celular de compuestos de antocianina, se obtuvieron imágenes de microscopio de cáscaras epidérmicas 1 semana después de la inoculación (Figura 6C). Esto ilustra la transformación de células individuales con los genes candidatos y la activación de la acumulación de pigmentos de antocianina dentro de las vacuolas.

Datos de análisis de HPLC

Para confirmar la identidad de las antocianinas sintetizadas durante la expresión transitoria en tabaco de MYB seleccionados, se extrajeron muestras y las antocianinas solubles se analizaron por HPLC. Los resultados indican que cuando MdMYB10 y MdbHLH3 se co-expresan en exceso en hojas de tabaco, se observan dos picos principales, que representan cianidin-3-glucósido y cianidin-3-0-rutinósido (Figura 7). Estas identidades de compuesto se confirmaron por LC-EM (datos no mostrados). No se encontraron picos de antocianina observables en los extractos de hoja de tabaco transformados con control de vector vacío (datos no mostrados). Para comparar esto con compuestos que se producen naturalmente en manzana y tabaco, también se extrajeron antocianinas de los pétalos de tabaco y piel de la manzana (Pacific Rose, fruta madura) y los resultados confirmaron la predominancia de cianidin-3-galactósido en la piel de manzana (datos no mostrados), pero como se ha descrito previamente (Tsou et al. 2003). Se observó cianidin-3-glucósido y petunidin-3-galactósido en pétalo de tabaco (Figura 7). No se observa petunidin-3-galactósido en el perfil generado en una hoja de tabaco por la acción de MdMYB10 y MdbHLH3 (Figura 7).

Análisis de expresión de qPCR de factores de transcripción

El conocimiento de la abundancia, y patrón de acumulación, de transcritos de genes biosintéticos proporcionó información en cuanto al tejido más apropiado con el que realizar PCR degenerada para el aislamiento de un regulador transcripcional putativo. qPCR de los TF en esta misma serie de desarrollo revela aumentos en los niveles de transcritos relativos de MdMYB10 en los tejidos de fruta de Red Field en comparación con Pacific Rose. En tejido de corteza, los niveles de transcrito en Pacific Rose fueron apenas detectables, mientras que en el transcrito de Pacific Rose de piel fue evidente y los niveles del transcrito de MYB se correlacionan con las enzimas biosintéticas, particularmente en el momento de tiempo de enero y en relación con UFGT. Niveles de expresión de MdMYB10 en Red Field parecen seguir en gran parte el patrón de transcritos de las enzimas ensayadas, con niveles altamente elevados en todos los tejidos del fruto, particularmente en el momento de tiempo de noviembre y luego de nuevo en enero, febrero y marzo (Figura 4B). Los niveles de transcrito en hoja de Red Field fueron similarmente elevados en comparación con Pacific Rose. Los resultados fueron similares para RT-PCR (Figura 4A) y para confirmar adicionalmente la especificidad, se secuenciaron amplicones por qPCR y se analizaron y se encontró que codificaron MdMYB10.

No pareció que los niveles de transcrito de MdbHLH3 y MdbHLH33 siguieran el patrón mostrado para los genes biosintéticos, o para MdMYB10, con un nivel de expresión más coherente tanto a través de las series de desarrollo como en ambas variedades (Figura 4B). También se ensayaron los niveles de transcrito de los genes MdMYB8, MdMYB9 y MdMYB11, pero no mostraron un patrón correlativo con los niveles de transcrito de la enzima antocianina (datos no mostrados).

Ejemplo 6: La expresión en exceso de MdMyb10 en plantas transgénicas de manzana produce elevada producción de antocianina

Transformación de manzana

El vector binario pSAK277-MdMYB10 que contiene el ADNc de MdMYB10 conducido por el promotor 35S del virus del mosaico de la coliflor producido por técnicas convencionales se transfirió a la cepa GV3101 de Agrobacterium

tumefaciens por el método de liofilización muy conocido para aquellos expertos en la materia. Se generaron plantas transgénicas 'Royal Gala' de Malus domestica por transformación mediada por Agrobacterium de trozos de hoja, usando un método previamente informado (Yao et al., 1995). También se produjeron plantas de control transformadas con un vector vacío equivalente de la misma forma.

Los resultados se muestran en la Figura 11.

Células de callo altamente pigmentadas se muestran en A(i). A(ii) muestra una planta 35S Mym10 altamente pigmentada (izquierda) y un planta de control de vector vacío para comparación (derecha).

El panel B muestra perfiles de antocianina (generados como se describe en el Ejemplo 5) de extractos de 35S- MdMyB10 y plantas de control. Los resultados muestran niveles de pigmentos de antocianina que son claramente detectables en las plantas 35S-MdMYB10, pero no en las plantas de control. Se extrajo tejido de manzana en metanol acidificado y se identificaron picos de diagramas de HPLC a 520 nm; cy-gal, cianiding-3-galactósido, con trazas menores de cy-glu, cianiding-3-glucósido y cy-pent, cianiding-3-pentósido.

No es intención limitar el alcance de la invención a los ejemplos anteriormente mencionados solo. Como se apreciará por un experto en la materia, son posibles muchas variaciones sin apartarse del alcance de la invención.

Referencias

Aharoni A, De Vos CH, Wein M, Sun Z, Greco R, Kroon A, Mol JN, O'Connell AP (2001) The strawberry FaMYB1 transcription factor suppresses anthocyanin and flavonol accumulation in transgenic tobacco. Plant J 28: 319-332 Borevitz JO, Xia Y, Blount J, Dixon RA, Lamb C (2000) Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 12: 2383-2394 Boss PK, Davies C, Robinson SP (1996). Expression of anthocyanin biosynthesis pathway genes in red and white grapes. Plant Mol Biol 32: 565-569 Boyer J, Liu R (2004) Apple phytochemicals and their health benefits. Nutrition Journal 3: 5 Brooks, RM, Olmo, H.P. (1972). Register of New Fruit and Nut Varieties. University of California Press, London.

Broun P (2005). Transcriptional control of flavonoid biosynthesis: a complex network of conserved regulators involved in multiple aspects of differentiation in Arabidopsis. Curr Opin Plant Biol 8: 272-279 Brouillard R (1988). Flavonoids and flower colour. In JB Harborne, ed, The Flavonoids: Advances in Research since 1980. Chapman & Hall, London, pp 525-538 Chang, S., Puryear, J. and Cairney, J. (1993). A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol. Rep. 11: 113-116.

CIE (1986) Colorimetry, 2nd edn. Publication CIE No. 15.2, Central Bureau of the Commission Internationale de L'Eclairage, Viena.

Davies KM, Schwinn KE (2003) Transcriptional regulation of secondary metabolism. Functional Plant Biology 30: 913-925 Davuluri GR, van Tuinen A, Fraser PD, Manfredonia A, Newman R, Burgess D, Brummell DA, King SR, Palys J, Uhlig J, Bramley PM, Pennings HMJ, Bowler C (2005) Fruit-specific RNAi-mediated suppression of DET1 enhances carotenoid and flavonoid content in tomatoes. Nature Biotechnology 23: 890-895 de Vetten N, Quattrocchio F, Mol J, Koes R (1997) The an11 locus controlling flower pigmentation in petunia encodes a novel WD-repeat protein conserved in yeast, plants, and animals. Genes Dev 11: 1422-1434 Dixon RA, Steele CL (1999) Flavonoids and isoflavonoids - a gold mine for metabolic engineering. Trends Plant Sci 4: 394-400 Dong YH, Mitra D, Kootstra A, Lister C, Lancaster J (1998) Postharvest stimulation of skin colour in royal gala apple. J Am Soc Hortic Sci 120: 95-100 Elomaa P, Uimari A, Mehto M, Albert V, Laitinen R, Teeri T (2003) Activation of anthocyanin biosynthesis in Gerbera hybrida (Asteraceae) suggests conserved protein-protein and protein-promoter interactions between the anciently diverged monocots and eudicots. Plant Physiology and Biochemistry 133: 1831-1842 Folta KM, Dhingra A, Howard L, Stewart PJ, Chandler CK. (2006) Characterization of LF9, an octoploid strawberry genotype selected for rapid regeneration and transformation. Planta. 2006 Apr 14; PMID: 16614818 Gleave A (1992) A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Molecular Biology 20: 1203-1207 Goff SA, Cone KC, Chandler VL (1992) Functional analysis of the transcriptional activator encoded by the maize B gene: evidence for a direct functional interaction between two classes of regulatory proteins. Genes Dev 6: 864-875 Gonzalez Padilla IM, Webb K, Scorza R. (2003) Early antibiotic selection and efficient rooting and acclimatization improve the production of transgenic plum plants (Prunus domestica L.).Plant Cell Rep.22(1):38- 45.

Goodrich J, Carpenter R, Coen ES (1992) A common gene regulates pigmentation pattern in diverse plant species. Cell 68: 955-964 Graham J, McNicol RJ, Kumar A. (1995) Agrobacterium-mediated transformation of soft fruit Rubus, Ribes, and Fragaria. Methods Mol Biol. 1995;44:129-33.

Grotewold E, Sainz MB, Tagliani L, Hernandez JM, Bowen B, Chandler VL (2000) Identification of the residues in the Myb domain of maize C1 that specify the interaction with the bHLH cofactor R. Proc Natl Acad Sci U S A 97: 13579-13584 Harborne JB, Grayer RJ (1994) Flavonoids and insects. In JB Harborne, ed, The Flavonoids: Advances in Research Since 1986. Chapman & Hall, London, p 589-618 Heim MA, Jakoby M, Werber M, Martin C, Bailey PC, Weisshaar B (2003) The basic helix-loop-helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. Molecular Biology and Evolution 20: 735-747 Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM (2000) pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol. Biol. 42: 819-832 Hellens RP, Allan AC, Friel EN, Bolitho K, Grafton K, Templeton MD, Karunairetnam S, Laing WA (2005) Transient plant expression vectors for functional genomics, quantification of promoter activity and RNA silencing. Plant Methods In press Hernandez JM, Heine GF, Irani NG, Feller A, Kim M-G, Matulnik T, Chandler VL, Grotewold E (2004) Different mechanisms participate in the R-dependent activity of the R2R3 MYB transcription factor C1. J. Biol. Chem. 279: 48205-48213 Holton TA, Cornish EC (1995) Genetics and biochemistry of anthocyanin biosynthesis. Plant Cell 7: 1071-1083 Honda C, Kotoda N, Wada M, Kondo S, Kobayashi S, Soejima J, Zhang Z, Tsuda T, Moriguchi T (2002) Anthocyanin biosynthetic genes are coordinately expressed during red coloration in apple skin. Plant Physiology and Biochemistry 40: 955-962 Li X, Gasic K, Cammue B, Broekaert W, Korban SS (2003) Transgenic rose lines harboring an antimicrobial protein gene, Ace-AMP1, demonstrate enhanced resistance to powdery mildew (Sphaerotheca pannosa).Planta. 218(2);226-32.

Jin H, Martin C (1999) Multifunctionality and diversity within the plant MYB-gene family. Plant Mol Biol 41: 577- 585 Kim S-H, Lee J-R, Hong S-T, Yoo Y-K, An G, Kim S-R (2003) Molecular cloning and analysis of anthocyanin biosynthesis genes preferentially expressed in apple skin. Plant Science 165: 403-413 Kobayashi S, Ishimaru M, Hiraoka K, Honda C (2002) Myb-related genes of the Kyoho grape (Vitis labruscana) regulate anthocyanin biosynthesis. Planta 215: 924-933 Kobayashi S, Goto-Yamamoto N, Hirochika H (2004) Retrotransposon-induced mutations in grape skin color. Science 304: 982 Koes RE, Quattrocchio F, Mol JNM (1994) The flavonoid biosynthetic pathway in plants: Function and evolution. BioEssays 16: 123-132 Koes R, Verweij W, Quattrocchio F (2005) Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends in Plant Science 10: 236-242 Kumar S, Tamura K, Jakobsen IB, M. N (2001) MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17: 1244-1245 Kubo H, Peeters AJM, Aarts MGM, Pereira A, Koornneef M (1999) Anthocyanless2, a homeobox gene affecting anthocyanin distribution and root development in Arabidopsis. Plant Cell 11: 1217-1226 Lancaster J (1992) Regulation of skin color in apples. Crit. Rev. Plant Sci. 10: 487-502 Lister CE, J. E. Lancaster (1996) Developmental changes in enzymes of flavonoid biosynthesis in the skins of red and green apple cultivars. J Sci Food Agric: 313-320 Matsuda N, Gao M, Isuzugawa K, Takashina T, Nishimura K. (2005) Development of an Agrobacterium- mediated transformation method for pear (Pyrus communis L.) with leaf-section and axillary shoot-meristem explants. Plant Cell Rep. 24(1):45-51.

Mol J, Grotewold E, Koes R (1998) How genes paint flowers and seeds. Trends in Plant Science 3: 212-217 Mol JJ, G; Schafer, E; Weiss, D (1996) Signal perception, transduction, and gene expression involved in anthocyanin biosynthesis. Critical Reviews in Plant Sciences.: 525-557 Mehrtens F, Kranz H, Bednarek P, Weisshaar B (2005) The Anabidopsis transcription factor MYB12 is a flavonol-specific regulator of phenylpropanoid biosynthesis. Plant Physiology 138: 1083-1096 Nesi N, Jond C, Debeaujon I, Caboche M, L L (2001) The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determainant for proanthocyanidin accumulation in developing seed. Plant Cell 13: 2099-2114 Noda K-i, Glover BJ, Linstead P, Martin C (1994) Flower colour intensity depends on specialized cell shape controlled by a Myb-related transcription factor. 369: 661-664 Oosumi T, Gruszewski HA, Blischak LA, Baxter AJ, Wadl PA, Shuman JL, Veilleux RE, Shulaev V. (2006) High- efficiency transformation of the diploid strawberry (Fragaria vesca) for functional genomics. Planta. ;223(6):1219-30.

Page R (1996) Comput. Applic. Biosci 12: 357-358 Piazza P, Procissi A, Jenkins GI, Tonelli C (2002) Members of the c1/p11 regulatory gene family mediate the response of maize aleurone and mesocotyl to different light qualities and cytokinins. Plant Physiol 128: 1077- 1086 Quattrocchio F, Wing JF, van der Woude K, Mol JN, Koes R (1998) Analysis of bHLH and MYB domain proteins: species-specific regulatory differences are caused by divergent evolution of target anthocyanin genes. Plant J 13: 475-488 Ramesh SA, Kaiser BN, Franks T, Collins G, Sedgley M. (2006) Improved methods in Agrobacterium-mediated transformation of almond using positive (mannose/pmi) or negative (kanamycin resistance) selection-based protocols. Plant Cell Rep. 25(8):821-8.

Ramsay NA, Glover BJ (2005) MYB-bHLH-WD40 protein complex and the evolution of cellular diversity. Trends in Plant Science 10: 63-70 Saito K, Yamazaki M (2002) Biochemistry and molecular biology of the late-stage of biosynthesis of anthocyanin: lessons from Perilla frutescens as a model plant. New Phytologist 155: 9-23 Schwinn KE, Davies KM (2004) Flavonoids. In KM Davies, ed, Plant pigments and their manipulation, Vol 14.

Blackwell, Oxford Song GQ, Sink KC. (2005) Transformation of Montmorency sour cherry (Prunus cerasus L.) and Gisela 6 (P. cerasus x P. canescens) cherry rootstock mediated by Agrobacterium tumefaciens. Plant Cell Rep. 2006 ;25(2): 117-23 Stracke R, Werber M, Weisshaar B (2001) The R2R3-MYB gene family in Arabidopsis thaliana. Current Opinion in Plant Biology 4: 447-456 J D Thompson, D G Higgins, and T J Gibson (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 11; 22(22): 4673-4680.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24: 4876-4882 Tohge T, Nishiyama Y, Hirai MY, Yano M, Nakajima J, Awazuhara M, Inoue E, Takahashi H, Goodenowe DB, Kitayama M, Noji M, Yamazaki M, Saito K (2005) Functional genomics by integrated analysis of metabolome, and transcriptome of Arabidopsis plants over-expressing an MYB transcription factor. Plant J 42: 218-235 Tsao R, Yang R, Young JC, Zhu H (2003) Polyphenolic profiles in eight apple cultivars using high-performance liquid chromatography (HPLC). J Agric Food Chem 51: 6347-6353 Voinnet O, Rivas S, Mestre P, Baulcombe D (2003) An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J 33: 949-956 Vom Endt D, Kijne JW, Memelink J (2002) Transcription factors controlling plant secondary metabolism: what regulates the regulators? Phytochemistry 61: 107-114 Walker AR, Davison PA, Bolognesi-Winfield AC, James CM, Srinivasan N, Blundell TL, Esch JJ, Marks MD, Gray JC (1999) The TRANSPARENT TESTA GLABRA1 locus, which regulates trichome differentiation and anthocyanin biosynthesis in Arabidopsis, encodes a WD40 repeat protein. Plant Cell 11: 1337-1350 Winkel-Shirley B (2001) Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol 126: 485-493 Yao, J-L., Cohen, D., Atkinson, R., Richardson, K. and Morris, B. (1995) Regeneration of transonic plants from the commercial apple cultivar Royal Gala. Plant Cell Reports, 14, 407-412 Zimmermann IM, Heim MA, Weisshaar B, Uhrig JF (2004) Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins. Plant J 40: 22-34 Tabla X: RESUMEN DE SECUENCIAS

SEC ID Nº

ESPECIE

REF

TIPO DE SECUENCIA

1 Malus domestica Md MYB10 Polipéptido 2 Malus domestica Md MYB9 Polipéptido 3 Malus domestica Md bHLH3 Polipéptido 4 Malus domestica Md bHLH33 Polipéptido Malus domestica Md MYB10 Polinucleótido (ADNc) 6 Malus domestica Md MYB9 Polinucleótido (ADNc) 7 Malus domestica Md bHLH3 Polinucleótido (ADNc) 8 Malus domestica Md bHLH33 Polinucleótido (ADNc) 9 Malus sylvestris Ms MYB10 Polipéptido Pyrus communis Pc MYB10 Polipéptido 11 Pyrus pyrifolia Ppy MYB10 Polipéptido 12 Pyrus bretschneideri Pb MYB10 Polipéptido 13 Cydonia oblonga Co MYB10 Polipéptido 14 Prunus salicina Ps MBY10 Polipéptido Prunus cerasifera Pcf MYB10 Polipéptido 16 Prunus persica Ppr MYB10 Polipéptido 17 Eriobotrya japonica Ej MYB10 Polipéptido 18 Prunus dulcis Pd MYB10 Polipéptido 19 Prunus avium Pav MYB10 Polipéptido Mespilus germanica Mg MYB10 Polipéptido 21 Prunus domestica Pdm MYB10 Polipéptido 22 Malus sylvestris Ms MYB10 Polinucleótido (ADNc) 23 Malus sylvestris Ms MYB10 Polinucleótido (ADNg) 24 Pyrus communis Pc MYB10 Polinucleótido (ADNc) Pyrus communis Pc MYB10 Polinucleótido (ADNc) 26 Pyrus communis Pc MYB10 Polinucleótido (ADNg) 27 Pyrus pyrifolia Ppy MYB10 Polinucleótido (ADNg) 28 Pyrus bretschneideri Pb MYB10 Polinucleótido (ADNc) 29 Pyrus bretschneideri PB MYB10 Polinucleótido (ADNg) Cydonia oblonga Co MYB10 Polinucleótido (ADNc) 31 Cydonia oblonga Co MYB10 Polinucleótido (ADNg) 32 Prunus salicina Ps MYB10 Polinucleótido (ADNc) 33 Prunus salicina Ps MYB10 Polinucleótido (ADNg) 34 Prunus cerasifera Pcf MYB10 Polinucleótido (ADNc) Prunus cerasifera Pcf MYB10 Polinucleótido (ADNg) 36 Prunus persica Ppr MYB10 Polinucleótido (ADNc) 37 Prunus persica Ppr MYB10 Polinucleótido (ADNg) 38 Eriobotrya japonica Ej MYB10 Polinucleótido (ADNc) 39 Eriobotrya japonica Ej MYB10 Polinucleótido (ADNg)

SEC ID Nº

ESPECIE

REF

TIPO DE SECUENCIA

Prunus dulcis Pd MYB10 Polinucleótido (ADNc) 41 Prunus dulcis Pd MYB10 Polinucleótido (ADN) 42 Prunus avium Pav MYB10 Polinucleótido (ADNc) 43 Prunus avium Pav MYB10 Polinucleótido (ADNg) 44 Mespilus germanica Mg MYB10 Polinucleótido (ADNc) Mespilus germanica Mg MYB10 Polinucleótido (ADNg) 46 Prunus domestica Pdm MYB10 Polinucleótido (ADN) 47 Prunus domestica Pdm MYB10 Polinucleótido (ADNg) 48 Artificial/Cebador RE73 Polinucleótido 49 Artificial/Cebador RE77R Polinucleótido Artificial/Cebador RE78R Polinucleótido 51 Artificial/Cebador RE79R Polinucleótido 52 Artificial/Cebador RE95F Polinucleótido 53 Artificial/Cebador RE96R Polinucleótido 54 Artificial/Cebador RE108F Polinucleótido Artificial/Cebador RE109R Polinucleótido 56 Artificial/Cebador RE120F Polinucleótido 57 Artificial/Cebador RE121R Polinucleótido 58 Artificial/Cebador KL Ms1F Polinucleótido 59 Artificial/Cebador KL Ms2R Polinucleótido Artificial/Cebador KL Md PAP1F Polinucleótido 61 Artificial/Cebador KL MdPAP1R Polinucleótido 62 Artificial/Cebador KL PcfF Polinucleótido 63 Artificial/Cebador KL PcfR Polinucleótido 64 Artificial/Cebador KL Pcf2F Polinucleótido Artificial/Cebador KL Pcf3R Polinucleótido 66 Artificial/Cebador KL Pcf4R Polinucleótido 67 Artificial/Cebador KL Ppr1F Polinucleótido 68 Artificial/Cebador KL Ppr2R Polinucleótido 69 Artificial/Cebador KL Ppr3F Polinucleótido Artificial/Cebador KL Ppr4R Polinucleótido 71 Artificial/Cebador KL Fv1F Polinucleótido 72 Artificial/Cebador KL Fv2R Polinucleótido 73 Artificial/Cebador KL Fv6R Polinucleótido 74 Artificial/Cebador KL Fv7F Polinucleótido 75 Artificial/Cebador KL Rh1F Polinucleótido 76 Artificial/Cebador KL Rh2R Polinucleótido 77 Artificial/Cebador KL Rh3F Polinucleótido 78 Artificial/Cebador KL Rh4R Polinucleótido 79 Artificial/Cebador KL Rosa deg 1F (cebador degenerado Polinucleótido con una degeneración de 64 veces) 80 Artificial/Cebador KL Rosa deg 2R (cebador degenerado Polinucleótido con una degeneración de 16 veces) 81 Artificial/Cebador CN944824 MdCHS directo Polinucleótido 82 Artificial/Cebador CN944824 MdCHS inverso Polinucleótido 83 Artificial/Cebador CN946541 MdCHI directo Polinucleótido 84 Artificial/Cebador CN 946541 MdCHI inverso Polinucleótido 85 Artificial/Cebador CN491664 MdF3H directo Polinucleótido 86 Artificial/Cebador CN491664 MdF3H inverso Polinucleótido 87 Artificial/Cebador AY227729 MdDFR directo Polinucleótido 88 Artificial/Cebador AY227729 MdDFR inverso Polinucleótido 89 Artificial/Cebador AF117269MdLDOX directo Polinucleótido 90 Artificial/Cebador AF117269MdLDOX inverso Polinucleótido 91 Artificial/Cebador AF117267MdUFGT directo Polinucleótido 92 Artificial/Cebador AF117267MdUFGT inverso Polinucleótido 93 Artificial/Cebador MdMYB10 directo Polinucleótido 94 Artificial/Cebador MdMYB10 inverso Polinucleótido 95 Artificial/Cebador MdbHLH33 directo Polinucleótido 96 Artificial/Cebador MdbHLH33 inverso Polinucleótido 97 Artificial/Cebador CN934367 MdbHLH3 directo Polinucleótido 98 Artificial/Cebador CN934367 MdbHLH3 inverso Polinucleótido 99 Artificial/Cebador CN938023 MdActin directo Polinucleótido

SEC ID Nº

ESPECIE

REF

TIPO DE SECUENCIA

100 Artificial/Cebador CN938023 MdActin inverso Polinucleótido 101 Artificial Consenso Polipéptido 102 Malus domestica MdMYB10 Polinucleótido (ADNg) LISTADO DE SECUENCIAS <110> THE HORTICULTURE AND FOOD RESEARCH INSTITUTE OF NEW ZEALAND LIMITED ESPLEY, Richard HELLENS, Roger ALLAN, Andrew <120> COMPOSICIONES Y MÉTODOS PARA MODULAR LA PRODUCCIÓN DE PIGMENTOS EN PLANTAS <130> HCF 517065 <150> 542110 <151> 30-08-2005 <160> 102 <170> PatentIn versión 3.3 <210> 1 <211> 243 <212> PRT <213> Malus domestica

<400> 1 <210> 2 <211> 290 <212> PRT <213> Malus domestica

<400> 2 <210> 6 <211> 870 <212> ADN <213> Malus domestica

<400> 6 <210> 7 <211> 2130 <212> ADN <213> Malus domestica

<400> 7 <210> 8 <211> 2457 <212> ADN <213> Malus domestica

<220> <221> misc_feature <222> (1326)..(1326) <223> n es a, c, g o t <400> 8 <210> 9 <211> 243 <212> PRT <213> Malus sylvestris

<400> 9 <210> 10 <211> 244 <212> PRT <213> Pyrus communis

<400> 10 <210> 11 <211> 244 <212> PRT <213> Pyrus pyrifolia

<400> 11 <210> 12 <211> 244 <212> PRT <213> Pyrus bretschneideri

<400> 12 <210> 13 <211> 245 <212> PRT <213> Cydonia oblonga

<400> 13 <210> 14 <211> 243 <212> PRT <213> Prunus salicina

<400> 14 <210> 15 <211> 243 <212> PRT <213> Prunus cerasifera

<400> 15 <210> 16 <211> 243 <212> PRT <213> Prunus persica

<400> 16 <210> 17 <211> 246 <212> PRT <213> Eriobotrya japonica

<400> 17 <210> 18 <211> 225 <212> PRT <213> Prunus dulcis

<400> 18 <210> 19 <211> 244 <212> PRT <213> Prunus avium

<400> 19 <210> 20 <211> 247 <212> PRT <213> Mespilus germanica

<400> 20 <210> 21 <211> 237 <212> PRT <213> Prunus domestica

<400> 21 <210> 22 <211> 729 <212> ADN <213> Malus sylvestris

<400> 22 <210> 23 <211> 4088 <212> ADN <213> Malus sylvestris

<400> 23 <210> 24 <211> 735 <212> ADN <213> Pyrus communis

<400> 24 <210> 25 <211> 1595 <212> ADN <213> Pyrus communis

<400> 25 <210> 26 <211> 732 <212> ADN <213> Pyrus communis

<400> 26

ES 2 553 180 T3   <210> 27 <211> 1591 <212> ADN <213> Pyrus pyrifolia

<400> 27

ES 2 553 180 T3   <210> 28 <211> 732 <212> ADN <213> Pyrus bretschneideri

<400> 28 <210> 29 <211> 1596 <212> ADN <213> Pyrus bretschneideri

<400> 29

ES 2 553 180 T3   <210> 30 <211> 735 <212> ADN <213> Cydonia oblonga

<400> 30

ES 2 553 180 T3   <210> 31 <211> 2488 <212> ADN <213> Cydonia oblonga

<400> 31

ES 2 553 180 T3   <210> 32 <211> 729 <212> ADN <213> Prunus salicina

<400> 32 <210> 33 <211> 1890 <212> ADN <213> Prunus salicina

<400> 33

ES 2 553 180 T3   <210> 34 <211> 729 <212> ADN <213> Prunus cerasifera

<400> 34

ES 2 553 180 T3   <210> 35 <211> 1970 <212> ADN <213> Prunus cerasifera

<400> 35

ES 2 553 180 T3   <210> 36 <211> 729 <212> ADN <213> Prunus persica

<400> 36 <210> 37 <211> 1920 <212> ADN <213> Prunus persica

ES 2 553 180 T3   <400> 37 <210> 38 <211> 738 <212> ADN <213> Eriobotrya japonica

<400> 38

ES 2 553 180 T3   <210> 39 <211> 1570 <212> ADN <213> Eriobotrya japonica

<400> 39

ES 2 553 180 T3   <210> 40 <211> 678 <212> ADN <213> Prunus dulcis

<400> 40 <210> 41 <211> 1806 <212> ADN <213> Prunus dulcis

<400> 41

ES 2 553 180 T3   <210> 42 <211> 735 <212> ADN <213> Prunus avium

<400> 42

ES 2 553 180 T3   <210> 43 <211> 2262 <212> ADN <213> Prunus avium

<400> 43

ES 2 553 180 T3   <210> 44 <211> 744 <212> ADN <213> Mespilus germanica

<400> 44

ES 2 553 180 T3   <210> 45 <211> 2287 <212> ADN <213> Mespilus germanica

<400> 45

ES 2 553 180 T3   <210> 46 <211> 714 <212> ADN <213> Prunus domestica

<400> 46 <210> 47 <211> 1916 <212> ADN <213> Prunus domestica

<220> <221> misc_feature <222> (849)..(849) <223> n es a, c, g o t <220> <221> misc_feature <222> (857)..(857) <223> n es a, c, g o t <220>

ES 2 553 180 T3   <221> misc_feature <222> (867)..(867) <223> n es a, c, g o t <220> <221> misc_feature <222> (1151)..(1151) <223> n es a, c, g o t <220> <221> misc_feature <222> (1160)..(1160) <223> n es a, c, g o t <400> 47

ES 2 553 180 T3   <210> 48 <211> 38 <212> ADN <213> Cebador/Artificial <400> 48 aaaagttgca gacttagatg gttgaattat ttgaagcc 38 <210> 49 <211> 27 <212> ADN <213> Cebador/Artificial <400> 49 gagaatcgat ccgcaatcga gtgttcc 27 <210> 50 <211> 31 <212> ADN <213> Cebador/Artificial <400> 50 accacctgtt tcccaaaagc ctgtgaagtc t 31 <210> 51 <211> 33 <212> ADN <213> Cebador/Artificial <400> 51 cacaagctag atggtaccac agaagtgaga atc 33 <210> 52 <211> 22 <212> ADN <213> Cebador/Artificial <400> 52 taagagatgg agggatataa cg 53 <210> 53 <211> 26 <212> ADN <213> Cebador/Artificial <400> 53 ctagctattc ttcttttgaa tgattc 26 <210> 54 <211> 24 <212> ADN

ES 2 553 180 T3   <213> Cebador/Artificial <400> 54 gatcgattct cgcatgaaaa cggt 24 <210> 55 <211> 23 <212> ADN <213> Cebador/Artificial <400> 55 gacgacgttt gtggtggcgt act 23 <210> 56 <211> 23 <212> ADN <213> Cebador/Artificial <400> 56 tgcctggact cgagaggaag aca 23 <210> 57 <211> 23 <212> ADN <213> Cebador/Artificial <400> 57 cctgtttccc aaaagcctgt gaa 23 <210> 58 <211> 22 <212> ADN <213> Cebador/Artificial <400> 58 cttataatta gacttcacag gc 22 <210> 59 <211> 20 <212> ADN <213> Cebador/Artificial <400> 59 caccgttttc atgcgagaat <210> 60 <211> 37 <212> ADN <213> Cebador/Artificial <400> 60 gcagataaga gatggaggga tataacgaaa acctgag 37 <210> 61 <211> 35 <212> ADN <213> Cebador/Artificial <400> 61 tacacaagct agatggtacc acagaagtga gaatc <210> 62 <211> 25 <212> ADN <213> Cebador/Artificial

ES 2 553 180 T3   <400> 62 gactttatgg aagatgaagt agatc <210> 63 <211> 25 <212> ADN <213> Cebador/Artificial <400> 63 aagcgatagt atattattga tgaac <210> 64 <211> 20 <212> ADN <213> Cebador/Artificial <400> 64 cttgggtgtg agaaaaggag <210> 65 <211> 20 <212> ADN <213> Cebador/Artificial <400> 65 cacgctaaaa gagaaatcac <210> 66 <211> 20 <212> ADN <213> Cebador/Artificial <400> 66 gcttgtgaag cctaattatt <210> 67 <211> 20 <212> ADN <213> Cebador/Artificial <400> 67 gaaagataaa ccccaagaaa <210> 68 <211> 20 <212> ADN <213> Cebador/Artificial <400> 68 tttgaactct tgatgaagct <210> 69 <211> 22 <212> ADN <213> Cebador/Artificial <400> 69 ctgcgaattt gtattgtatg tc 22 <210> 70 <211> 20 <212> ADN <213> Cebador/Artificial <400> 70 ttcccaccaa tcatttccat

ES 2 553 180 T3   <210> 71 <211> 22 <212> ADN <213> Cebador/Artificial <400> 71 aagagaggag agtttgcaga gg 22 <210> 72 <211> 22 <212> ADN <213> Cebador/Artificial <400> 72 tagttcttca catcattggc ag 22 <210> 73 <211> 25 <212> ADN <213> Cebador/Artificial <400> 73 aatatgcacc aggaagtctt aaaga <210> 74 <211> 25 <212> ADN <213> Cebador/Artificial <400> 74 aaatctgctt aattttcatg gaggg <210> 75 <211> 28 <212> ADN <213> Cebador/Artificial <400> 75 tcagagagag agagatgggt ggtattcc 28 <210> 76 <211> 26 <212> ADN <213> Cebador/Artificial <400> 76 cttcctcttg ttcaaagctc cctctc 26 <210> 77 <211> 25 <212> ADN <213> Cebador/Artificial <400> 77 agaactattg gaattgtcac ttgag <210> 78 <211> 25 <212> ADN <213> Cebador/Artificial <400> 78 agaataaaat cactttcata accac <210> 79

ES 2 553 180 T3   <211> 30 <212> ADN <213> Cebador/Artificial <220> <221> misc_feature <222> (21)..(21) <223> n es a, c, g o t <400> 79 agacttccrg gaagracwgc naatgmtgtg <210> 80 <211> 24 <212> ADN <213> Cebador/Artificial <220> <221> misc_feature <222> (22)..(22) <223> n es a, c, g o t <400> 80 ccartaattt ttcacakcat tngc 24 <210> 81 <211> 25 <212> ADN <213> Cebador/Artificial <400> 81 ggagacaact ggagaaggac tggaa <210> 82 <211> 23 <212> ADN <213> Cebador/Artificial <400> 82 cgacattgat actggtgtct tca 23 <210> 83 <211> 20 <212> ADN <213> Cebador/Artificial <400> 83 gggataacct cgcggccaaa <210> 84 <211> 22 <212> ADN <213> Cebador/Artificial <400> 84 gcatccatgc cggaagctac aa 22 <210> 85 <211> 23 <212> ADN <213> Cebador/Artificial <400> 85 tggaagcttg tgaggactgg ggt 23 <210> 86

ES 2 553 180 T3   <211> 23 <212> ADN <213> Cebador/Artificial <400> 86 ctcctccgat ggcaaatcaa aga 23 <210> 87 <211> 21 <212> ADN <213> Cebador/Artificial <400> 87 gatagggttt gagttcaagt a 21 <210> 88 <211> 24 <212> ADN <213> Cebador/Artificial <400> 88 tctcctcagc agcctcagtt ttct 24 <210> 89 <211> 21 <212> ADN <213> Cebador/Artificial <400> 89 ccaagtgaag cgggttgtgc t 21 <210> 90 <211> 23 <212> ADN <213> Cebador/Artificial <400> 90 caaagcaggc ggacaggagt agc 23 <210> 91 <211> 22 <212> ADN <213> Cebador/Artificial <400> 91 ccaccgccct tccaaacact ct 22 <210> 92 <211> 23 <212> ADN <213> Cebador/Artificial <400> 92 cacccttatg ttacgcggca tgt 23 <210> 93 <211> 23 <212> ADN <213> Cebador/Artificial <400> 93 tgcctggact cgagaggaag aca 23 <210> 94 <211> 23 <212> ADN

ES 2 553 180 T3   <213> Cebador/Artificial <400> 94 cctgtttccc aaaagcctgt gaa 23 <210> 95 <211> 23 <212> ADN <213> Cebador/Artificial <400> 95 atgtttttgc gacggagaga gca 23 <210> 96 <211> 28 <212> ADN <213> Cebador/Artificial <400> 96 taggcgagtg aacaccatac attaaagg 28 <210> 97 <211> 22 <212> ADN <213> Cebador/Artificial <400> 97 agggttccag aagaccacgc ct 22 <210> 98 <211> 22 <212> ADN <213> Cebador/Artificial <400> 98 ttggatgtgg agtgctcgga ga 22 <210> 99 <211> 25 <212> ADN <213> Cebador/Artificial <400> 99 tgaccgaatg agcaaggaaa ttact <210> 100 <211> 24 <212> ADN <213> Cebador/Artificial <400> 100 tactcagctt tggcaatcca catc 24 <210> 101 <211> 249 <212> PRT <213> Artificial <220> <223> Artificial <220> <221> MISC_FEATURE <222> (6)..(6) <223> V, L O E

ES 2 553 180 T3   <220> <221> MISC_FEATURE <222> (7)..(7) <223> N O G <220> <221> MISC_FEATURE <222> (8)..(8) <223> L O V <220> <221> MISC_FEATURE <222> (9)..(9) <223> R O S <220> <221> MISC_FEATURE <222> (10)..(10) <223> V O K <220> <221> MISC_FEATURE <222> (11)..(11) <223> G, R, K O M <220> <221> MISC_FEATURE <222> (12)..(12) <223> R O ESTÁ AUSENTE <220> <221> MISC_FEATURE <222> (13)..(13) <223> K O ESTÁ AUSENTE <220> <221> MISC_FEATURE <222> (14)..(14) <223> G O ESTÁ AUSENTE <220> <221> MISC_FEATURE <222> (19)..(19) <223> E, K O Q <220> <221> MISC_FEATURE <222> (22)..(22) <223> D O N <220> <221> MISC_FEATURE <222> (28)..(28) <223> I O V <220> <221> MISC_FEATURE <222> (29)..(29) <223> E O G <220> <221> MISC_FEATURE <222> (30)..(30) <223> I, H O N <220>

ES 2 553 180 T3   <221> MISC_FEATURE <222> (30)..(30) <223> I, N O K <220> <221> MISC_FEATURE <222> (31)..(31) <223> H, L O Q <220> <221> MISC_FEATURE <222> (37)..(37) <223> H O N <220> <221> MISC_FEATURE <222> (40)..(40) <223> P O S <220> <221> MISC_FEATURE <222> (41)..(41) <223> Y O N <220> <221> MISC_FEATURE <222> (43)..(43) <223> A O T <220> <221> MISC_FEATURE <222> (46)..(46) <223> N, S O K <220> <221> MISC_FEATURE <222> (50)..(50) <223> K O R <220> <221> MISC_FEATURE <222> (54)..(54) <223> L O Q <220> <221> MISC_FEATURE <222> (57)..(57) <223> L, M O V <220> <221> MISC_FEATURE <222> (60)..(60) <223> L O V <220> <221> MISC_FEATURE <222> (63)..(63) <223> N O S <220> <221> MISC_FEATURE <222> (68)..(68) <223> D O E <220> <221> MISC_FEATURE

ES 2 553 180 T3   <222> (70)..(70) <223> K, A, M O T <220> <221> MISC_FEATURE <222> (78)..(78) <223> I O L <220> <221> MISC_FEATURE <222> (82)..(82) <223> K O R <220> <221> MISC_FEATURE <222> (93)..(93) <223> R, G O Q <220> <221> MISC_FEATURE <222> (96)..(96) <223> P O Q <220> <221> MISC_FEATURE <222> (102)..(102) <223> D O A <220> <221> MISC_FEATURE <222> (107)..(107) <223> W O C <220> <221> MISC_FEATURE <222> (108)..(108) <223> N O Y <220> <221> MISC_FEATURE <222> (112)..(112) <223> R O G <220> <221> MISC_FEATURE <222> (113)..(113) <223> I, T, M O K <220> <221> MISC_FEATURE <222> (114)..(114) <223> D O N <220> <221> MISC_FEATURE <222> (115)..(115) <223> S O Y <220> <221> MISC_FEATURE <222> (116)..(116) <223> R, C O S <220> <221> MlSC_FEATURE <222> (117)..(117)

ES 2 553 180 T3   <223> M O L <220> <221> MISC_FEATURE <222> (118)..(118) <223> K O ESTÁ AUSENTE <220> <221> MISC_FEATURE <222> (119)..(119) <223> K O T <220> <221> MISC_FEATURE <222> (120)..(120) <223> V, M, L O S <220> <221> MISC_FEATURE <222> (121)..(121) <223> K O Q <220> <221> MISC_FEATURE <222> (122)..(122) <223> D O N <220> <221> MISC_FEATURE <222> (124)..(124) <223> S O R <220> <221> MISC_FEATURE <222> (127)..(127) <223> T O M <220> <221> MISC_FEATURE <222> (128)..(128) <223> I O R <220> <221> MISC_FEATURE <222> (129)..(129) <223> K O E <220> <221> MISC_FEATURE <222> (131)..(131) <223> I O N <220> <221> MISC_FEATURE <222> (132)..(132) <223> V O I <220> <221> MISC_FEATURE <222> (133)..(133) <223> I O R <220> <221> MISC_FEATURE <222> (134)..(134) <223> R O ESTÁ AUSENTE

ES 2 553 180 T3   <220> <221> MISC_FEATURE <222> (138)..(138) <223> R O Q <220> <221> MISC_FEATURE <222> (139)..(139) <223> K, S O R <220> <221> MISC_FEATURE <222> (141)..(141) <223> I, T O N <220> <221> MISC_FEATURE <222> (142)..(142) <223> K O R <220> <221> MISC_FEATURE <222> (145)..(145) <223> N O Y <220> <221> MISC_FEATURE <222> (146)..(146) <223> C O Y <220> <221> MISC_FEATURE <222> (149)..(149) <223> S o F <220> <221> MISC_FEATURE <222> (151)..(151) <223> E o G <220> <221> MISC_FEATURE <222> (155)..(155) <223> D o E <220> <221> MISC_FEATURE <222> (157)..(157) <223> l o T <220> <221> MISC_FEATURE <222> (159)..(159) <223> S, L o T <220> <221> MISC_FEATURE <222> (160)..(160) <223> A, E o V <220> <221> MISC_FEATURE <222> (161)..(161) <223> E o está ausente <220>

ES 2 553 180 T3   <221> MISC_FEATURE <222> (162)..(162) <223> D O N <220> <221> MISC_FEATURE <222> (163)..(163) <223> F, L O S <220> <221> MISC_FEATURE <222> (164)..(164) <223> S O ESTÁ AUSENTE <220> <221> MISC_FEATURE <222> (165)..(165) <223> T O ESTÁ AUSENTE <220> <221> MISC_FEATURE <222> (166)..(166) <223> P O T <220> <221> MISC_FEATURE <222> (167)..(167) <223> S O P <220> <221> MISC_FEATURE <222> (168)..(168) <223> Q O ESTÁ AUSENTE <220> <221> MISC_FEATURE <222> (169)..(169) <223> T, I O S <220> <221> MISC_FEATURE <222> (170)..(170) <223> S O ESTÁ AUSENTE <220> <221> MISC_FEATURE <222> (171)..(171) <223> S, T, P O L <220> <221> MISC_FEATURE <222> (172)..(172) <223> S O T <220> <221> MISC_FEATURE <222> (173)..(173) <223> T O K <220> <221> MISC_FEATURE <222> (174)..(174) <223> K O R <220> <221> MISC_FEATURE

ES 2 553 180 T3   <222> (175)..(175) <223> N, I O R <220> <221> MISC_FEATURE <222> (176)..(176) <223> G O ESTÁ AUSENTE <220> <221> MISC_FEATURE <222> (177)..(177) <223> N O S <220> <221> MISC_FEATURE <222> (179)..(179) <223> W O R <220> <221> MISC_FEATURE <222> (183)..(183) <223> F O L <220> <221> MISC_FEATURE <222> (184)..(184) <223> L O F <220> <221> MISC_FEATURE <222> (185)..(185) <223> D, E O K <220> <221> MISC_FEATURE <222> (186)..(186) <223> D O G <220> <221> MISC_FEATURE <222> (187)..(187) <223> K O E <220> <221> MISC_FEATURE <222> (188)..(188) <223> E, D O K <220> <221> MISC_FEATURE <222> (189)..(189) <223> D, A, G O V <220> <221> MISC_FEATURE <222> (190)..(190) <223> T, A, F O V <220> <221> MISC_FEATURE <222> (191)..(191) <223> F O T <220> <221> MISC_FEATURE <222> (193)..(193)

ES 2 553 180 T3   <223> R, K O T <220> <221> MISC_FEATURE <222> (194)..(194) <223> A, D O T <220> <221> MISC_FEATURE <222> (195)..(195) <223> A O T <220> <221> MISC_FEATURE <222> (196)..(196) <223> C, G O Y <220> <221> MISC_FEATURE <222> (197)..(197) <223> P, S O Y <220> <221> MISC_FEATURE <222> (198)..(198) <223> G O S <220> <221> MISC_FEATURE <222> (199)..(199) <223> L, I O F <220> <221> MISC_FEATURE <222> (200)..(200) <223> E, G O A <220> <221> MISC_FEATURE <222> (202)..(202) <223> E O D <220> <221> MISC_FEATURE <222> (205)..(205) <223> L O E <220> <221> MISC_FEATURE <222> (206)..(206) <223> F O L <220> <221> MISC_FEATURE <222> (207)..(207) <223> T O A <220> <221> MISC_FEATURE <222> (208)..(208) <223> S O T <220> <221> MISC_FEATURE <222> (211)..(211) <223> V, F O A

ES 2 553 180 T3   <220> <221> MISC_FEATURE <222> (213)..(213) <223> D O E <220> <221> MISC_FEATURE <222> (214)..(214) <223> R, D O M <220> <221> MISC_FEATURE <222> (215)..(215) <223> M, L O Q <220> <221> MISC_FEATURE <222> (216)..(216) <223> P, S O Q <220> <221> MISC_FEATURE <222> (217)..(217) <223> Q, A, P O S <220> <221> MISC_FEATURE <222> (218)..(218) <223> S, R O A <220> <221> MISC_FEATURE <222> (219)..(219) <223> T, K O R <220> <221> MISC_FEATURE <222> (220)..(220) <223> R O S <220> <221> MISC_FEATURE <222> (221)..(221) <223> S, T, Q, C O K <220> <221> MISC_FEATURE <222> (222)..(222) <223> C O T <220> <221> MISC_FEATURE <222> (223)..(223) <223> A, I, V O T <220> <221> MISC_FEATURE <222> (224)..(224) <223> N O S <220> <221> MISC_FEATURE <222> (225)..(225) <223> F O V

ES 2 553 180 T3   <220> <221> MISC_FEATURE <222> (226)..(226) <223> P, S O T <220> <221> MISC_FEATURE <222> (228)..(228) <223> E O ESTÁ AUSENTE <220> <221> MISC_FEATURE <222> (230)..(230) <223> L, Q, H O P <220> <221> MISC_FEATURE <222> (231)..(231) <223> S, G O I <220> <221> MISC_FEATURE <222> (232)..(232) <223> R, K O T <220> <221> MISC_FEATURE <222> (233)..(233) <223> G O S <220> <221> MISC_FEATURE <222> (234)..(234) <223> E, D O N <220> <221> MISC_FEATURE <222> (235)..(235) <223> F O L <220> <221> MISC_FEATURE <222> (237)..(237) <223> F O V <220> <221> MISC_FEATURE <222> (238)..(238) <223> S O N <220> <221> MISC_FEATURE <222> (239)..(239) <223> V, M O T <220> <221> MISC_FEATURE <222> (240)..(240) <223> D O E <220> <221> MISC_FEATURE <222> (241)..(241) <223> L O P <220>

ES 2 553 180 T3   <221> MISC_FEATURE <222> (247)..(247) <223> E O K <220> <221> MISC_FEATURE <222> (248)..(248) <223> E O N <220> <221> MISC_FEATURE <222> (249)..(249) <223> S O ESTÁ AUSENTE <400> 101

ES 2 553 180 T3   <210> 102 <211> 4078 <212> ADN <213> Malus domestica

<400> 102

ES 2 553 180 T3  

ES 2 553 180 T3  

REIVINDICACIONES

1. Un polinucleótido aislado que comprende una secuencia que codifica un polipéptido con al menos el 90 % de identidad con las secuencias de aminoácidos de SEC ID Nº: 1, en el que el % de identidad se calcula con respecto a la longitud completa de la secuencia de aminoácidos, y en el que el polipéptido es un factor de transcripción capaz de al menos uno de: i) regular por incremento la producción de antocianina en una planta; y ii) regular por incremento un promotor de un gen en la vía biosintética de antocianina.

2. El polinucleótido aislado de la reivindicación 1, en el que el polipéptido tiene la secuencia de aminoácidos de SEC ID Nº: 1.

3. El polinucleótido aislado de la reivindicación 1, en el que la secuencia tiene al menos el 70 % de identidad con la secuencia de una cualquiera de SEC ID Nº: 5 y 102.

4. El polinucleótido aislado de la reivindicación 1, en el que la secuencia tiene al menos el 70 % de identidad con la secuencia codificante de una cualquiera de SEC ID Nº: 5 y 102.

5. El polinucleótido aislado de la reivindicación 1, en el que la secuencia tiene al menos el 70 % de identidad con la secuencia de SEC ID Nº: 5.

6. El polinucleótido aislado de la reivindicación 1, en el que la secuencia tiene al menos el 70 % de identidad con la secuencia codificante de SEC ID Nº: 5.

7. El polinucleótido aislado de la reivindicación 1, en el que la secuencia tiene la secuencia de SEC ID Nº: 5.

8. El polinucleótido aislado de la reivindicación 1, en el que la secuencia tiene la secuencia codificante de SEC ID Nº: 5.

9. El polinucleótido aislado de la reivindicación 1, en el que el polipéptido tiene al menos el 90 % de identidad con la secuencia de aminoácidos de SEC ID Nº: 1, y en el que la variante de polipéptido comprende la secuencia de SEC ID Nº: 101 10. El polinucleótido de la reivindicación 1, en el que el gen en la vía biosintética de antocianina codifica dihidroflavonol 4-reductasa (DFR).

11. El polinucleótido de la reivindicación 10, en el que el gen en la vía biosintética de antocianina codifica chalcona sintasa (CHS).

12. Una construcción genética que comprende un polinucleótido de una cualquiera de las reivindicaciones 1 a 11.

13. Una célula huésped, célula de planta o planta genéticamente modificada para expresar el polinucleótido de una cualquiera de las reivindicaciones 1 a 11.

14. Un polipéptido aislado que comprende una secuencia con al menos el 90 % de identidad con una secuencia de aminoácidos SEC ID Nº: 1, en el que el % de identidad se calcula con respecto a la longitud completa de la secuencia de aminoácidos, y en el que el polipéptido es un factor de transcripción que puede regular por incremento la producción de antocianina en una planta.

15. El polipéptido aislado de la reivindicación 14, en el que la secuencia, comprendida por el polipéptido, tiene al menos el 90 % de identidad de secuencias con la secuencia de aminoácidos de SEC ID Nº: 1.

16. El polipéptido aislado de la reivindicación 14, en el que la secuencia, comprendida por el polipéptido, tiene la secuencia de SEC ID Nº: 1.

17. Un anticuerpo producido contra y específico para un polipéptido que consiste en SEC ID Nº: 1.

18. El uso del polipéptido de una cualquiera de las reivindicaciones 14 a 16 para producir un anticuerpo.

19. Un método para producir anticuerpos, comprendiendo el método la etapa de uso del polipéptido de una cualquiera de las reivindicaciones 14 a 16 para producir los anticuerpos.

20. Un método para producir una célula de planta o planta con producción de antocianina alterada, comprendiendo el método la etapa de transformación de una célula de planta o planta con un polinucleótido de una cualquiera de las reivindicaciones 1 a 11.

ES 2 553 180 T3   21. Una planta producida por el método de la reivindicación 20, en el que la planta se transforma con un polinucleótido de una cualquiera de las reivindicaciones 1 a 11.

22. Un método para seleccionar una planta alterada en la producción de antocianina, comprendiendo el método probar una planta para expresión alterada de un polinucleótido de una cualquiera de las reivindicaciones 1 a 11.

ES 2 553 180 T3