Producción de formatos de anticuerpos y aplicaciones inmunológicas de estos formatos.

Formatos de anticuerpo, caracterizados por que comprenden todos o parte de los dominios de VHH o de VHH humanizados

, fusionados a las regiones constantes de anticuerpos humanos, por que son de tipo Fab y comprenden, en asociación, dos dominios VHH diferentes, o dos dominios VH humanos sobre los cuales se insertan las CDRs de los VHH, estando uno de los dominios fusionado a la región constante Cκ o Cλ humana, el otro a la región CH1 de una inmunoglobulina, y por que son de tipo biespecífico / monovalente o biepitópico / monovalente.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/FR2005/003151.

Solicitante: CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE (CNRS).

Nacionalidad solicitante: Francia.

Dirección: 3, RUE MICHEL-ANGE 75794 PARIS CEDEX 16 FRANCIA.

Inventor/es: PELEGRIN,ANDRE, TEULON,ISABELLE, BATY,DANIEL, BEHAR,GHISLAINE, CHARTIER,MARTINE, TEILLAUD,JEAN-LUC.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Inmunoglobulinas, p. ej. anticuerpos mono o policlonales > C07K16/28 (contra receptores, antígenos celulares de superficie o determinantes celulares de superficie)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > C07K16/00 (Inmunoglobulinas, p. ej. anticuerpos mono o policlonales)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Inmunoglobulinas, p. ej. anticuerpos mono o policlonales > C07K16/30 (de células tumorales)

PDF original: ES-2544237_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

de ias figuras

Otras características y ventajas de la Invención se proporcionarán en los ejemplos que siguen, en los cuales se hace referencia a las figuras 1 a 13, que representan, respectivamente,

- las figuras 1 y 2, las secuencias de aminoácidos (SEC ID N° 73 a 76, 103 y 104) y de nucleótldos (SEC ID N° 81 a 84, 106 y 107) de 4 clones de VHH antl-CD16, y las secuencias de aminoácidos (SEC ID N° 77 a 80 y 105) y de nucleótldos (SEC ID N° 85 a 88 y 108) de 4 clones ant¡-CEA aislados según la Invención,

- las figuras 3 y 4, los resultados mediante FACS que muestran la especificidad de 8 VHH analizados, y de los anticuerpos blespecíficos correspondientes,

- la figura 5, los resultados mediante FACS que muestran la accesibilidad a células de los anticuerpos blespecíficos,

- la figura 6, los resultados de los ensayos de competición mediante ELISA entre 2 VHH antl-CD16 y los anticuerpo monoclonales ant¡-CD 16,

- la figura 7, los perfiles de las competiciones en células mediante FACS de 2 VHH antl-CD16 y de los anticuerpos monoclonales antl-CD 16,

- la figura 8, los resultados de la activación de CD16A por parte de 2 VHH antl-CD16, y por parte del anticuerpo blespecíflco antl-CEA 17 / ant¡-CD16 c21 de tipo F(ab')2,

- la figura 9, los resultados de la llsls celular por parte de las células NK activadas por los anticuerpos blespecíficos,

- las figuras 10A y 10B, los constructos de plásmldos según la invención,

- la figura 11, las secuencias de plásmldos de la Invención,

- las figuras 12A y 12B, los formatos de anticuerpos de tipo Fab, Fab', F(ab')2, (HCH2CH3)2 y mAb*,

- la figura 13, los geles de electroforesis de los fragmentos de anticuerpo de tipo Fab, Fab' y F(ab')2 en el transcurso de las diferentes etapas de su purificación.

Descripción detaiiada de ia invención

Ejempio 1:

inmunización de ¡amas, tituiación de ios sueros y purificación de ios iinfocitos B.

Se ha inmunizado una lama hembra con la región extracelular del receptor FcyRIIIB humano recombinante (CD16B) (descrito en la publicación: Teillaud C étal., 1993).REF

Se ha inmunizado una lama macho con la región extracelular del antígeno carcinoembrionario humano recombinante (CEA) (descrito en la publicación: Terskikh y al., 1993, y en la patente: Terskikh A y al., 1993).

Los animales se han inmunizado cada mes con 500 pg de cada uno de los ¡nmunógenos. Se han recogido cien mi de sangre 15 días después de cada inmunización. Para cada una de las muestras recogidas se ha realizado una titulación de los sueros y de los anticuerpos purificados (lgG1, 2 y 3) para detectar la presencia de anticuerpos contra los diferentes ¡nmunógenos. A continuación se han purificado los Iinfocitos B en un gradiente de Ficoll (histopaque-1077, Sigma-Aldrich), después se han lavado 2 veces con PBS.

Construcción de ios bancos de VHH: purificación de ios ARN totaies, transcripción inversa, PCR1, PCR 2 y cionación en ei fagémido pHenl.

Construcción de los bancos de VHH:

Pur;7fcac/ón de /os ARN fofa/es.

Los ARN totales de los Iinfocitos B se extraen según un método que utiliza isotiocianato de guanidlo (Chomczynski y Sacchi, 1987) REF. Después de unas extracciones con fenol / cloroformo en medio ácido, los ARN totales son precipitados con etanol. La calidad de los ARN y su cuantificación son evaluadas en gel de agarosa al 1 %. A continuación se convierten en ADNc mediante una transcripción inversa.

7ranscdpc/ón inversa y PCR.

Secuencias SEC ID N° 1 a 9 de los oligonucleótidos utilizados: 3' CH2FORTA4

SEC ID N° 1: CGCCATCAAGGTACCAGTTGA 3' CH2-2 SEC ID N° 2: GGTACGTGCTGTTGAACTGTTCC 3' RC-lgG2 SEC ID N° 3: GGAGCTGGGGTCTTCGCTGTGGTGCG 3' RC-lgG3 5 SEC ID N° 4: TGGTTGTGGTTTTGGTGTCTTGGGTT 5' VH1-Sf¡

SEC ID N° 5:

CATGCCATGACTCGCGGCCGAGCCGGCCATGGCCCAGGTGCAGCTGGTGCAGT

CTGG

5' VH2-Sfi

10 SEC ID N° 6:

CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCCAGGTCACCTTGAAGGAGT

CTGG

5' VH3-Sfi

15 SEC ID N° 7:

CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGT

CTGG

5' VH4-Sf¡

20 SEC ID N° 8:

CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGCAGGAGT

CGGG

3' VHH-Not

25 SEC ID N° 9: CACGATTCTGCGGCCGCTGAGGAGAC(AG)GTGACCTGGGTCC

Se hibridan cinco pg de ARN total con 1 pmol del oligonucleótido 3' CH2FORTA4 (Arbabi Ghahroudi et al., 1997) REF o CH2-2 específico del dominio CH2 de las IgG simple de cadena pesada de lama retrotranscritas con 150 U de superscript II (BRL) durante 30 min a 50 °C. También pueden utilizarse los oligonucleótidos específicos de las 30 regiones bisagra de las IgG 2 y 3, 3' RC-lgG2 y 3' RC-lgG3. Las hebras de ADNc simples se purifican con esferas (BioMag^ Carboxll Termlnator, Polyscience Inc) y se eluyen con 17 pl de Tris-acetato 10 mM a pH 7,8.

Condiciones de /a PCRt

35 Se amplifican cuatro pl de ADNc mediante una PCR con 0,5 U de polimerasa Dynazyme Extend DNA (Finnzymes), 10 pmol del mismo cebador 3' CH2FORTA4 o CH2-2 y 10 pmol de los 4 cebadores 5VH1-4 Sfi específicos del dominio VH de las IgG humanas, en un volumen de 50 pl (a 94 °C, 3 min; a 94 °C, 1 min; a 60 °C, 1 min; a 72 °C, 1 min; 37 ciclos, después a 72 °C, 10 min).

40 Se amplifican tres fragmentos de ADN: un fragmento de aproximadamente 900 pb que codifica para los dominios VH-CH1-CH2 de las lgG1; y 2 fragmentos de aproximadamente 600 bp que codifican para los dominios VHH-CH2 de las lgG2 y 3.

Condiciones de ia PCP2.

Los fragmentos de 600 pb se purifican en gel de agarosa al 1 % (kit « Qiaquick gel extraction », Qiagen), después se amplifican mediante una PCR con 1 U de Deep Vent (Biolabs) y 10 pmol de los 4 cebadores 5VH1-4 Sfi específicos del dominio VH de las IgG humanas y 10 pmol del cebador 3' VHH-Notl.

(a 94 °C, 3 min; a 94 °C, 45 s; a 65 °C, 45 s; a 72 °C, 45 s; 15 ciclos, después, a 94 °C, 45 s; a 60 °C, 45 s; a 72 °C, 50 45 s; otros 15 ciclos, después a 72 °C, 10 min).

Los fragmentos de aproximadamente 400 pb que codifican para los VHH se purifican en gel de agarosa al 1 % (kit « Qiaquick gel extraction », Qiagen), se reensamblan y se precipitan en etanol. A continuación se cortan con las enzimas de restricción Ncol y Notl, o Bgll y Notl (Biolabs) para ser clonados en el fagémido pHenl (Hoogenboom et

al., 1991) REF en los sitios Ncol y Notl o Sfll y Notl.

Preparac/ón de/ vector;

Se digieren veinte pg de fagémido pHenl en un volumen de 300 pl con 50 U de Sfil en presencia de BSA, a 50 °C, 16 h; o con 50 U de Ncol en presencia de BSA, a 37 °C, 16 h. El fagémido linealizado se purifica en gel de agarosa al 0,7 % (kit « Qiaquick gel extraction », Qiagen). El ADN eluido se corta a continuación mediante 50 U de Notl a 37 °C en un volumen de 200 pl, 16 h. La enzima es destruida con calor 15 min a 65 °C y el ADN se extrae con fenol / cloroformo y se precipita en etanol. El pHenl cortado se controla en gel de agarosa al 0,7 %, se cuantifica y se ajusta a 200 ng/pl.

Preparac/ón de /os /ragvwenfos de AD/V de /os VPP.

Se cortan cinco pg de fragmentos VHH en un volumen de 300 pl con 50 U de Bgll y Notl en presencia de BSA, a 37 °C, 16 h; o con 50 U de Ncol y Notl en presencia de BSA, a 37 °C, 16 h. Las enzimas son desnaturalizadas a 65 °C, 15 min; después se extraen los ADN con fenol / cloroformo y se precipitan en etanol en presencia de 10 pg de glucógeno (Roche). Los fragmentos VHH cortados mediante Ncol y Notl se purifican en gel de agarosa al 1 %, después se controlan en gel de agarosa al 2 %, se cuantlflcan y se ajustan a 100 ng/pl.

L/gac/ón.

Se ligan ciento cincuenta ng de pHenl digeridos con Sfll... [Seguir leyendo]

 


Reivindicaciones:

1. Formatos de anticuerpo, caracterizados por que comprenden todos o parte de los dominios de VHH o de VHH humanizados, fusionados a las regiones constantes de anticuerpos humanos, por que son de tipo Fab y comprenden, en asociación, dos dominios VFIFI diferentes, o dos dominios VFI humanos sobre los cuales se insertan las CDRs de los VFIFI, estando uno de los dominios fusionado a la reglón constante Cx o CX humana, el otro a la reglón CFI1 de una ¡nmunoglobullna, y por que son de tipo biespecíflco / monovalente o blepltóplco / monovalente.

2. Formatos de anticuerpo según la reivindicación 1, caracterizados por que la ¡nmunoglobulina es una IgG correspondiente a una ¡soforma lgG1, lgG2, lgG3 o lgG4 humana, o una IgA humana correspondiente a una ¡soforma lgA1 o lgA2.

3. Formatos según una cualquiera de las reivindicaciones 1 a 2, caracterizados por que comprenden los fragmentos ant¡-CD16 o ant¡-CEA que responden a una secuencia de aminoácidos elegida de entre el grupo que comprende, respectivamente, las secuencias SEC ID N° 73, SEC ID N° 74, SEC ID N° 75, SEC ID N° 76, SEC ID N° 103 y SEC ID N° 104 o SEC ID N° 77, SEC ID N° 78, SEC ID N° 79, SEC ID N° 80 y SEC ID N° 105.

4. Anticuerpos quimerizados o humanizados, multiespecíficos y/o multivalentes productos a partir de los formatos de anticuerpos según una cualquiera de las reivindicaciones 1 a 3, para su utilización en inmunoterapia o en ¡nmunodiagnóstico /n v/vo, con la exclusión de la inmunización de seres humanos.

5. Procedimiento de producción de anticuerpos quimerizados o humanizados, multiespecíficos y/o multivalentes para la inmunoterapia o el ¡nmunodiagnóstico, caracterizado por que comprende la utilización de formatos de anticuerpos según una cualquiera de las reivindicaciones 1 a 3, con la exclusión de la inmunización de seres humanos, comprendiendo dicho formatos VFIFI de camélidos, particularmente de lamas, anti-CEA y anti-CD16, y siendo dichos dominios variables de VFIFI anti-CEA y anti-CD16 ventajosamente productos según un protocolo que comprende:

- la inmunización de camélidos, particularmente de lamas con, como inmunógeno, un CEA o un CD 16,

- la purificación de los linfocitos B recuperados a partir de la sangre,

- la construcción de banco de VHH, y

- el aislamiento de los VHH a partir del banco.

6. Procedimiento según la reivindicación 5, caracterizado porque la construcción del banco comprende:

- la extracción de los ARN totales de los linfocitos B,

- la transcripción inversa de los ARN para la obtención de los ADNc correspondientes,

- la amplificación mediante una PCR de los genes que codifican para las regiones variables de los anticuerpos simples de cadena pesada anti-CD 16 y anti-CEA,

- la ligación de los fragmentos de ADN de los VHH obtenidos mediante la ruptura con enzimas de los ADN amplificados con un fagémido.

7. Procedimiento según una cualquiera de las reivindicaciones 5 o 6, caracterizado por que los VHH son aislados a partir de los bancos mediante la técnica de pñage d/sp/ay y purificados.

8. Procedimiento según una cualquiera de las reivindicaciones 5 a 7, caracterizado por que los genes de los VHH seleccionados son introducidos en vectores de expresión, particularmente en plásmidos, para la producción de los formatos según una cualquiera de las reivindicaciones 1 a 3.

9. Vectores de expresión, particularmente plásmidos, de los formatos de anticuerpos según una cualquiera de las reivindicaciones 1 a 3, caracterizados por que contienen entre dos sitios únicos de enzimas de restricción, los promotores, las secuencias de señalización, las secuencias nucleotídicas capaces de codificar para dichos fragmentos de anticuerpo.

10. Plásmidos pCxCH1y1-TAG de secuencia SEC ID N° 98 y SEC ID N° 112 y pCxCH1y1 de secuencia SEC ID N° 100 y SEC ID N° 114, que permiten la producción de los anticuerpos de tipo Fab según la reivindicación 1.

11. Composiciones farmacéuticas, caracterizadas por que contienen al menos un formato de anticuerpo según una cualquiera de las reivindicaciones 1 o 2.

12. Método de ¡nmunodiagnóstico /n v/fro, caracterizado por que comprende la utilización de los formatos de anticuerpos según una cualquiera de las reivindicaciones 1 o 2.