Dispositivo y método para el análisis de fallo renal.

Método para el análisis del estado renal en una muestra de fluido corporal determinando la concentración de un analito

, caracterizado por que el estado renal es lesión renal aguda y el analito es miR-210 y que comprende añadir un microARN conocido como control a la muestra y analizar la concentración del microARN de control añadido por detección paralela con especificidad por el microARN de control.

Tipo: Patente Europea. Resumen de patente/invención. Número de Solicitud: E12152245.

Solicitante: MEDIZINISCHE HOCHSCHULE HANNOVER.

Nacionalidad solicitante: Alemania.

Dirección: CARL-NEUBERG-STRASSE 1 30625 HANNOVER ALEMANIA.

Inventor/es: THUM,THOMAS PROF. DR. DR, LORENZEN,JOHAN DR, KIELSTEIN,JAN PD DR.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/68 (en los que intervienen ácidos nucleicos)

PDF original: ES-2513015_T3.pdf

 

google+ twitter facebookPin it
Dispositivo y método para el análisis de fallo renal.
Dispositivo y método para el análisis de fallo renal.
Dispositivo y método para el análisis de fallo renal.

Fragmento de la descripción:

Dispositivo y método para el análisis de fallo renal

La presente invención se refiere a un método analítico, y a un kit de partes, que está adaptado al método analítico, para analizar la muestra de un paciente para determinar las posibilidades de un paciente de desarrollar lesión renal aguda (AKI), y para determinar las posibilidades de pacientes que padecen AKI para supervivencia a largo plazo, por ejemplo, durante 28 días a partir del diagnóstico de AKI. La invención proporciona un analito, y el uso del analito, que respecto a AKI es esencialmente independiente de una sepsis o shock diagnosticado. La concentración del analito de la invención, preferiblemente en combinación con la concentración de uno o ambos de dos analitos adicionales en una muestra de fluido corporal humano, por ejemplo, en suero sanguíneo obtenido de pacientes, especialmente de pacientes que padecen AKI, es un marcador de la propensión de desarrollar AKI, y de supervivencia, por ejemplo, de 28 días de supervivencia, incluyendo recuperación renal.

Estado de la técnica

Juan et al. en Urology 835-841 (2010) describen la identificación de microARN que son característicos de cáncer renal en comparación con microARN de riñón normal.

Mitchell et al., PNAS 10513-10518 (2008) describen microARN en circulación como marcadores para cáncer, especialmente de m¡R-141 como característico de cáncer de próstata.

Ali et al., J. Am. Soc. Nephrol. 1292-1298 (2007) describen el análisis de valores de creatinina relacionados con lesión renal aguda y fallo renal crónico en fase aguda.

Bagger et al., Pediatr. Nephrol. 1655-1658 (2007) describen niveles de creatinina en suero y producción de orina como medidas que reflejan la función renal.

El documento US 2010/0173288 A1 describe que generalmente las patologías pueden analizarse por medición de todos los microARN detectables en suero sanguíneo de un paciente, y describe un kit y biochip, respectivamente, que contienen esencialmente todos los microARN maduros conocidos para suero humano.

El documento WO 2010/145035 A1 se refiere a marcadores para enfermedades renales y menciona miR-210 como marcador para cáncer renal.

El documento US 2011/0003704 A1 describe el análisis de microvesículas para el diagnóstico de enfermedades y menciona una cantidad muy grande de microARN, sin correlacionar específicamente un microARN específico a fallo renal agudo.

Li et al., Nephrology 599 - 608 (2010) describen que se ha observado en relación a carcinoma renal que miR210 está regulado por hipoxia y puede tener implicaciones para patogénesis tumoral.

El documento EP 2474622 A1, que es relevante según el artículo 54 (3) EPC solamente, describe el análisis de niveles aumentados de miR-127, miR-126, miR-210 y miR-101 en comparación con valores de control, siendo el aumento indicativo de muestras de daño renal agudo obtenidas de pacientes después de trasplante de riñón y en pacientes después de cirugía cardiaca.

Objeto de la invención

Un objetivo de la invención es proporcionar un método analítico, y un kit de partes adecuado para realizar el método, cada uno adecuado para evaluar el riesgo de pacientes de desarrollar AKI, y adecuado para evaluar el riesgo de mortalidad, y las posibilidades de supervivencia a largo plazo y recuperación renal, respectivamente, en pacientes con AKI.

Descripción general de la invención

La invención consigue el objetivo mencionado anteriormente proporcionando un método de acuerdo con la reivindicación 1 para el análisis del estado de la función renal en una muestra de fluido corporal obtenida de un paciente que no se ha diagnosticado con lesión renal aguda (AKI, también mencionado como fallo renal agudo) o en una muestra de fluido corporal obtenida de un paciente que se ha diagnosticado con AKI, siendo dicho análisis adecuado para y estando adaptado para evaluar las posibilidades para supervivencia a largo plazo, por ejemplo, durante 28 días desde el diagnóstico de AKI, y/o para la recuperación renal en un paciente con AKI, comprendiendo dicho método para el análisis determinar la concentración del microARN-210 (miR-210) que comprende o consiste en la secuencia de ácido nucleico SEC ID N2 1: CUGUGCGUGUGACAGCGGCUGA, preferiblemente en combinación con determinar la concentración de uno o ambos de miR-320 que comprende o consiste en la secuencia de ácido nucleico SEC ID N2 2: AAAAGCUGGGUUGAGAGGGCGA y miR-16 que comprende o consiste

en la secuencia de ácido nucleico SEC ID N2 3: UAGCAGCACGUAAAUAUUGGCG en una muestra, preferiblemente en una muestra de suero obtenida del paciente, pudiendo diagnosticarse dicho paciente que padece AKI, por ejemplo, por análisis de los niveles de creatinina.

La invención se basa en el hallazgo de que la concentración del miR-210 analito, preferiblemente en combinación con uno o ambos de miR-320 y miR-16, está significativamente correlacionada con la propensión de un paciente a desarrollar inicialmente AKI, y con las posibilidades de supervivencia, por ejemplo, durante 28 días, y para recuperación renal de pacientes con AKI. En mayor detalle, se ha descubierto que una concentración en suero de miR-210 que está elevada en comparación con los niveles medios en suero es indicativa de una propensión de una persona a desarrollar AKI, y de una posibilidad reducida de supervivencia a largo plazo de pacientes con AKI, pero es generalmente indicativa de una mortalidad aumentada. El nivel medio en suero puede, por ejemplo, ser la concentración del microARN respectivo encontrado en personas sanas, especialmente de miR-210.

Las concentraciones de miR-320 que están disminuidas por debajo de las concentraciones medias en suero de personas sanas también son indicativas de una propensión aumentada a desarrollar inicialmente AKI, indicativas de una mortalidad aumentada, e indicativas de una probabilidad reducida de supervivencia a largo plazo en pacientes con AKI, y concentraciones de miR-16 disminuidas por debajo de una concentración media en personas sanas también son indicativas de una mortalidad aumentada.

En una primera realización, el método analítico para determinar la concentración de miR-210, opcionalmente en combinación con determinar la concentración de miR-320 y/o miR-16, permite la evaluación del riesgo de un paciente de desarrollar AKI, y/o de la propensión de un paciente a padecer o desarrollar AKI, ya que la concentración de los analitos de la invención es un indicador predictlvo para AKI, siendo dicho indicador independiente de otros indicadores conocidos para AKI, por ejemplo, a partir del diagnóstico de sepsis o shock, y esencialmente independiente del diagnóstico de los niveles de creatinina y/o de la producción de orina.

Generalmente, el método para el análisis puede realizarse detectando la concentración de los microARN que se usan como analito, es decir, miR-210, preferiblemente también miR-320 y/o miR-16 en una muestra de fluido corporal para determinar la concentración del miARN analito. La etapa de determinar la concentración del analito en una primera realización generalmente comprende la etapa de poner en contacto una muestra de fluido corporal con una secuencia de ácido nucleico que comprende o consiste en una sección que es complementaria inversa al microARN (m¡R) analito, y detectar la concentración o varios híbridos formados por la sección de ácido nucleico complementaria inversa con los componentes de la muestra. Para detectar la concentración o varios híbridos específicos de analito, se prefiere que la secuencia de ácido nucleico comprenda o consista en una sección de ácido nucleico que es complementaria inversa al miR analito, se inmovilice en un sustrato, por ejemplo, la secuencia de ácido nucleico puede... [Seguir leyendo]

 


Reivindicaciones:

1. Método para el análisis del estado renal en una muestra de fluido corporal determinando la concentración de un analito, caracterizado por que el estado renal es lesión renal aguda y el analito es miR-210 y que comprende añadir un microARN conocido como control a la muestra y analizar la concentración del microARN de control añadido por detección paralela con especificidad por el microARN de control.

2. Método de acuerdo con la reivindicación 1, caracterizado por la determinación adicional de la concentración de al menos uno de los analitos del grupo que contiene miR-16 y miR-320.

3. Método de acuerdo con una de las reivindicaciones anteriores, caracterizado por que el microARN de control es una concentración conocida de miR-210, miR-320 y/o de miR-16 y/o de un microARN de origen no humano.

4. Método de acuerdo con una de las reivindicaciones anteriores, caracterizado por que la etapa de determinación de la concentración del analito comprende la etapa de poner en contacto la muestra de fluido corporal con una secuencia de ácido nucleico que comprende una sección que es complementaria inversa al analito y detectar la concentración de híbridos de ácido nucleico formados de la secuencia de ácido nucleico que comprende la sección de ácido nucleico complementaria inversa.

5. Método de acuerdo con una de las reivindicaciones anteriores, caracterizado por que la secuencia de ácido nucleico que contiene la sección de ácido nucleico que es complementaria inversa al analito se inmoviliza en un sustrato de vehículo.

6. Método de acuerdo con una de las reivindicaciones anteriores, caracterizado por que la secuencia de ácido nucleico que contiene la sección de ácido nucleico que es complementaria inversa al analito se marca por medio de un cromóforo detectable o se marca por medio de una combinación de un cromóforo detectable y un inactivador separado del cromóforo.

7. Método de acuerdo con una de las reivindicaciones anteriores, caracterizado por que la etapa de determinación de la concentración del analito comprende una reacción de transcripción inversa usando un oligonucleótido como cebador que es específico para el analito y una reacción de PCR usando dos oligonucleótidos como cebadores que son específicos para el analito.

8. Método de acuerdo con la reivindicación 6, caracterizado por que el producto de amplificación de la reacción de PCR se detecta específicamente por hibridación con un oligonucleótido marcado que contiene la secuencia de ácido nucleico del analito o que contiene una secuencia de nucleótidos que es complementaria inversa al analito.

9. Método de acuerdo con una de las reivindicaciones anteriores, caracterizado por que el método comprende la etapa de

- añadir a la muestra un miARN de control conocido a una concentración conocida,

- aislar al ARN total de la muestra,

- realizar RT-PCR sobre el ARN con pares de cebadores específicos añadidos para cada uno del analito y para el miARN de control, respectivamente,

- calcular la concentración original de analito mediante la curva patrón, que contiene la correlación predeterminada de la concentración detectada de productos de amplificación del analito a la concentración original de miARN,

- calcular la concentración original de miARN de control mediante una curva patrón predeterminada que contiene la correlación predeterminada de la concentración detectada de productos de amplificación del miARN de control a la concentración original de miARN de control, y

- formar el cociente de la concentración original calculada de analito y la concentración calculada de miARN de control.

10. Método de acuerdo con una de las reivindicaciones anteriores, caracterizado por que el método comprende la etapa de

- aislar el ARN total de la muestra,

- realizar RT-PCR sobre el ARN con pares de cebadores específicos añadidos para cada uno del analito y para un ARN constitutivo, respectivamente,

- calcular la concentración original de analito mediante la curva patrón, que contiene la correlación predeterminada de la concentración detectada de productos de amplificación del analito a la concentración original de miARN analito,

- calcular la concentración original de ARN constitutivo mediante una curva patrón predeterminada que contiene la correlación predeterminada de la concentración detectada de productos de amplificación del ARN constitutivo a la concentración original de ARN constitutivo, y

- formar el cociente de la concentración original calculada de analito y la concentración calculada de ARN

constitutivo.

11. Método de acuerdo con una de las reivindicaciones anteriores, caracterizado por que la muestra se origina de un paciente que no se ha diagnosticado con lesión renal aguda.

12. Método de acuerdo con una de las reivindicaciones 1 a 10, caracterizado por que la muestra se origina de un paciente que se ha diagnosticado con lesión renal aguda.

13. Método de acuerdo con una de las reivindicaciones anteriores, caracterizado por la comparación de la 10 concentración detectada del analito con la concentración del analito en personas sanas.

14. Uso de un dispositivo como sustancia indicadora que es específica para lesión renal aguda en un método de acuerdo con una de las reivindicaciones anteriores, conteniendo el dispositivo una secuencia de ácido nucleico que contiene la secuencia de miR-210 y/o una sección de ácido nucleico que es complementaria inversa a miR-210.

15. Uso de acuerdo con la reivindicación 14 como sustancia indicadora que es específica para el estado renal, caracterizado por que el dispositivo contiene adicionalmente una secuencia de ácido nucleico que contiene una sección que es idéntica a miR-16 y/o a miR-210, y/o una sección de nucleótidos que es complementaria inversa a miR-16 y/o complementaria inversa a miR-210.

16. Uso de acuerdo con una de las reivindicaciones 14 a 15, caracterizado por que la secuencia de ácido nucleico se inmoviliza en un sustrato de vehículo.