2,026 Patentes de marzo de 2015 (pag. 54)

  1. 1697.-

    Disposición para fijar un conductor eléctrico en un borne metálico construido como una pieza tubular que tiene en su pared al menos un agujero de paso provisto de una rosca y destinado a recibir un tornillo de apriete que presenta en su estructura al menos un sitio de rotura nominal para limitar la fuerza que se ejerce sobre el tornillo de apriete por medio de una herramienta que ataca en el mismo y que produce un giro alrededor de su eje, en la que: - el tornillo de apriete presenta una parte de contacto cilíndrica atornillable en el agujero de paso del borne, la cual...

  2. 1698.-

    1. Pantallas correderas verticales para el control del viento de terrazas, caracterizado por el hecho de que son totalmente transparentes careciendo de marco en todo el perímetro, pudiendo deslizarse verticalmente e independientemente por el interior de unas guías , mediante accionamiento mecánico, la pantalla corredera y manual, la pantalla corredera . 2. Pantallas correderas verticales según la reivindicación 1 caracterizado por el hecho de que la pantalla vertical superior se acciona mediante un motor tubular ubicado en el registro en el que se...

  3. 1699.-

    1. Clip para el cabello, del tipo de clips formados por dos brazos (4 y 5) que se prolongan en orejas de manipulación , estando el conjunto atravesado por un eje de articulación e incluyendo un resorte que tiende a mantener los brazos cerrados, caracterizado porque en la superficie orientada hacia el exterior de dicho brazo , el configurado para disponerse más alejado del cráneo del usuario, se han dispuesto varias hileras de púas . 2. Clip para el cabello, según la reivindicación anterior, caracterizado porque dichas hileras de púas establecen...

  4. 1700.-

    Cuerpo moldeado de peso ligero de espuma metálica, compuesto por una matriz metálica en la que están incluidas partículas y que encierra un gran número de huecos esencialmente esféricos y/o esencialmente elipsoidales, caracterizado porque las espuma metálica del cuerpo moldeado, al observarla desde el punto de vista espacial, presenta una distribución monomodal de las extensiones longitudinales proporcionalmente máximas de los huecos en el intervalo de entre 1,0 y 30,0 mm.

  5. 1701.-

    Material no tejido plisable que incluye fibras más gruesas de soporte y estabilización de forma y fibras más finas que determinan el efecto de filtrado, caracterizado porque las fibras más finas están incorporadas en gran medida de forma homogénea en las fibras más gruesas en la dirección longitudinal de la superficie del materia no tejido y, en la dirección perpendicular a la superficie del material no tejido, existe un gradiente de densidad de distribución de las fibras más finas de modo que la concentración más alta de fibras más finas se produce...

  6. 1702.-

    Un anticuerpo anti CMV aislado o fragmento del mismo, en el que dicho anticuerpo o fragmento del mismo comprende: (a) una región VH que comprende (i) una región VH CDR1 que comprende la secuencia de aminoácidos de SSNGIH (SEC ID Nº: 57); (ii) una región VH CDR2 que comprende la secuencia de aminoácidos de VISSDANDKQYADSVKG (SEC ID Nº: 58); (iii) una región VH CDR3 que comprende la secuencia de aminoácidos de DGTCSGGNCYSGLIDY (SEC ID Nº: 59); y (b) una región VL que comprende (i) una región VL CDR1 que comprende la secuencia...

  7. 1703.-

    Método para el funcionamiento de un ascensor que incluye una cabina accionada por un motor y al menos un freno para detener la cabina , comprendiendo el método los pasos consistentes en: cerrar un freno (S3); aumentar un par del motor hasta que se mueve la cabina (S4); registrar un valor (Mb) indicativo del par motor con el que la cabina se mueve (S6); comparar el valor registrado con un valor de referencia (Mr); y determinar el grado en el que el valor registrado (Mb) es superior al valor de referencia (Mr).

  8. 1704.-

    Alicate pelacables con a. dos mangos , b. dos palancas plegables que se apoyan giratoriamente en una base , c. en donde en una de ambas palancas plegables hay colocado un par de cuchillas pelacables móviles una respecto a la otra y en la otra palanca plegable hay colocado un par de mordaza de apriete móviles una respecto de la otra o un par de otras cuchilla pelacables, y d. en donde una cuchilla pelacables o una mordaza de apriete de cada par está guiada pudiendo desplazarse en un agujero alargado de la correspondiente...

  9. 1706.-

    Un cabezal de ajuste para un dispositivo de elevación y destinado a su conexión liberable con el extremo libre del dispositivo de elevación, en el que dicho cabezal de ajuste comprende mecanismos para el ajuste tridimensional del cabezal de ajuste independientemente de los medios de ajuste del dispositivo de elevación, en el que dichos mecanismos comprenden: • un mecanismo (10, 13 y 15) de inclinación que proporciona extensión e inclinación en un plano vertical por medio de un brazo extensible y medios de pistón...

  10. 1707.-

    Un dispositivo hidráulico de tipo reversible que comprende: un rodete , que a su vez comprende una pluralidad de elementos provistos de simetría axial, dispuestos en la periferia de dicho rodete , estando articulados dichos elementos en un punto que corresponde al extremo interior del eje de simetría/ de giro de dichos elementos , para poder girar sobre dicho eje de giro; un conducto de distribución adaptado para conducir un fluido, asociado con dicho rodete y que comprende un radio de flexión sustancialmente igual al radio de...

  11. 1709.-

    Caja eléctrica para aparellaje eléctrico que comprende una primera y una segunda envoltura cóncavas diseñadas para ensamblarse la una en la otra para definir un volumen cerrado, una proyección del borde de cada envoltura sobre un plano define una curva cerrada que tiene al menos dos ejes (X, Y) de simetría, caja caracterizada porque dichas envolturas están delimitadas respectivamente por un borde idéntico, comprendiendo cada borde de envoltura al menos un par (M1, M2) de medios macho de enganche y un par (F1, F2) de medios hembra...

  12. 1710.-

    Dispositivo de sujeción que presenta un cuerpo de base que tiene al menos una cámara de presión con al menos una respectiva abertura orientada en la dirección de acción y una primera membrana que cierra la al menos una abertura y que está unida con el cuerpo de base de una manera hermética a la presión, estando confinada en la cámara de presión una cantidad constante de fluido a presión , formando la primera membrana un primer segmento de pared lateral de la cámara de presión y presentando el dispositivo...

  13. 1711.-

    Monodosis de café útil en particular para máquinas de preparación y de distribución de bebidas a base de café del tipo que comprende por lo menos una cámara de extracción , y por lo menos un pistón de prensado de una cantidad determinada de café molido introducida en dicha cámara de extracción, comprendiendo dicha monodosis: - una cantidad determinada de café molido compactada en forma de un conglomerado de granos de café molido, que presenta una forma externa adaptada para rodar, y preferentemente una forma de...

  14. 1712.-

    Una composición que comprende una proteína aislada que comprende: (i) una secuencia de aminoácidos seleccionada del grupo consistente de las SEQ IDs 2918, 2916 y 2920; o (ii) una secuencia de aminoácidos que tiene un 90% o más de identidad de secuencia con una secuencia de aminoácidos seleccionada del grupo consistente de las SEQ IDs 2918, 2916 y 2920.

  15. 1713.-

    Un procedimiento de producción de un artículo decorativo, comprendiendo el citado artículo decorativo un cuerpo que tiene al menos una pletina de acoplamiento, y un miembro decorativo fabricado de un material de decoración que puede ser ablandado térmicamente y que tiene al menos una superficie que se puede acoplar a la pletina de acoplamiento del cuerpo, comprendiendo el citado procedimiento las etapas de: i) disponer el material de decoración ablandado en un molde y a continuación, moldear por compresión, estando configurado...

  16. 1714.-

    Una lámina multicapa para moldeo por infusión bajo vacío que comprende un apilamiento de capas que es permeable al aire y controlable de tal modo que en un primer estado la transmisión de una resina líquida es bloqueada a través del apilamiento de capas y que en un segundo estado la resina líquida puede penetrar al menos parcialmente a través del apilamiento de capas, en que el primer estado corresponde a una primera temperatura y el segundo estado corresponde a una segunda temperatura que es superior a la primera temperatura; incluyendo...

  17. 1715.-

    Un sistema para la retirada de etiquetas que se aplica en envases reutilizables (BT, LT), incluyendo dicho sistema: - medios para soportar un envase (BT, LT); - medios reversibles para la fijación del envase (BT, LT) en los medios de soporte ; - un cepillo motorizado con rodillo giratorio que se puede situar con su perfil de cepillado contra una de dicha etiqueta ; - medios para hacer girar los medios de soporte del envase (BT, LT), capaces de impartir una velocidad tangencial diferente en dichos medios...

  18. 1716.-

    Un procedimiento de fabricación de un objeto polimérico espumado multicapa a partir de una lámina de material termoplástico monolítico sólido, teniendo la lámina de material termoplástico un primer nivel de cristalinidad global, comprendiendo el procedimiento: absorber una cantidad eficaz de un gas plastificante en la lámina de material termoplástico para dar una lámina de material termoplástico plastificado de forma reversible, impregnándose la lámina de material termoplástico plastificado con el gas plastificante...

  19. 1717.-

    Casquillo que tiene un eje longitudinal A previsto para montarse en un contenedor de un dispositivo de inyección , proporcionándose dicho contenedor en su extremo próximo con al menos un resalte exterior , comprendiendo dicho casquillo al menos un cuerpo exterior , estando dicho casquillo provisto de al menos una prolongación interior radial prevista para evitar el movimiento proximal de dicho resalte exterior con respecto a dicho casquillo una vez dicho casquillo está montado en dicho contenedor...

  20. 1718.-

    Un método ex-vivo para determinar si un paciente responderá terapéuticamente a un método de tratamiento que comprende la administración de una composición inmunogénica, en donde el método de determinación comprende la etapa de medir los niveles de sICAM-1 en dicha muestra de sangre obtenida de dicho paciente antes de la administración de dicha composición inmunogénica, en donde los bajos niveles de sICAM-1 indican que el paciente desarrollará una respuesta profiláctica o terapéutica hacia la composición inmunogénica,...

  21. 1719.-

    La máquina dispone de un cuerpo único que integra unos batidores en correspondencia con unos recipientes que contienenla pasta, una centrifugadora dotada de unos alojamientos destinados a albergar de forma individualizada y en disposiciónradial cada uno de los recipientes que contienen la pasta yabatida, medios de bombeo o presionado que ejercen una presión sobre el líquido obtenido tras la centrifugación, y unfiltro situado a continuación de los medios de bombeo para la obtención definitiva...

  22. 1720.-

    Un sistema para tratar excrementos fecales , que comprende: un dispositivo de recogida de excrementos ; un dispositivo de transporte de excrementos que tiene un extremo proximal configurado para conectarse al dispositivo de recogida de excrementos, que comprende: una zona rectal situada en una zona extrema distal del dispositivo de transporte de excrementos, configurada para su disposición en el recto de un paciente para que comience el transporte de material fecal desde el paciente hasta el...

  23. 1721.-

    Un compuesto de fórmula (I):**Fórmula** en la que Z es Het2, opcionalmente sustituido en un átomo de carbono de anillo con uno o más sustituyentes seleccionados entre el grupo que consiste en halo, ciano, alquilo (C1-C4), halo-alquilo (C1-C4), alcoxi (C1-C4), halo-alcoxi (C1-C4), cicloalquilo (C3-C8), cicloalquil (C3-C8)-alquilo (C1-C4), alquil (C1-C4)-S-, amino, alquilamino (C1-C4), di-alquilamino (C1-C4), amino-alquilo (C1-C4), alquilamino (C1-C4)-alquilo (C1-C4) y di[alquil (C1-C4)]amino-alquilo...

  24. 1722.-

    Un procedimiento para estimular la producción de una citocina proinflamatoria seleccionada entre TNF-alfa e IL-12 que comprende: poner en contacto una célula que expresa TLR8 in vitro con un oligonucleótido de ARN (ORN) que comprende: N-U-R1-R2, en el que N es un ribonucleótido y N no incluye un U, U es uracilo o un derivado del mismo, y R es un ribonucleótido en el que al menos uno de R1 y R2 es adenosina (A) o citosina (C) o derivados de los mismos y en el que R no es U a no ser que N-U-R1-R2 incluya al menos dos A, en el que el ORN es seleccionado de: GCCACCGAGCCGAAUAUACC SEC ID Nº: 11; AUAUAUAUAUAUAUAUAUAU SEC ID Nº: 12; UUAUUAUUAUUAUUAUUAUU SEC ID Nº: 13; AAUAAUAAUAAUAAUAAUAA SEC ID Nº: 16; AAAUAAAUAAAUAAAUAAAU SEC ID Nº:...

  25. 1723.-

    Un aparato de desnitrificación de un gas de combustión del tipo vertical descendente, el cual procesa un gas de escape emitido a partir de una cámara de combustión, y convertido en vertical descendente, el cual aparato comprende: una pluralidad de bloques catalizadores , incorporando cada uno de ellos una unidad catalizadora ; en donde una primera placa deflectora de acumulación de cenizas y una segunda placa deflectora de acumulación de cenizas están dispuestas en un hueco entre los bloques catalizadores adyacentes entre sí y pueden deslizarse dentro del hueco, y la parte superior de la primera placa deflectora de acumulación de cenizas tiene una estructura angular, caracterizado porque la parte inferior de la primera placa...

  26. 1724.-

    Procedimiento para el examen por ultrasonido no destructivo, donde se emite al menos un impulso ultrasónico mediante al menos un emisor de ultrasonidos a una pieza de ensayo y se refleja el impulso ultrasónico en las superficies de separación de la pieza de trabajo; el ultrasonido reflejado es recibido mediante al menos un receptor de ultrasonidos y las señales correspondientes se valoran y, de este modo, el ultrasonido penetra en un cuerpo de acoplamiento dispuesto entre la pieza de trabajo y el emisor o receptor, donde el procedimiento comprende al menos un paso para determinar la velocidad del sonido en el cuerpo de acoplamiento mediante un sistema de transductores con transductores controlados selectivamente, en el que respectivamente...

  27. 1725.-

    Dispositivo de taponado para un recipiente , comprendiendo este dispositivo de taponado un tapón de forma circular previsto para obturar el cuello del recipiente y una cubierta de material sintético apta para recubrir a la vez el cuello y el tapón en su lugar en este cuello, comprendiendo la cubierta un anillo , apto para rodear el tapón y el cuello en configuración montada y provisto de medios de cierre sobre el cuello, así como una tapa , mientras que el anillo y la tapa están realizados en una sola pieza monobloque y unidos por unos puentes divisibles repartidos sobre una circunferencia del anillo caracterizado porque - el anillo tiene un diámetro interno mínimo (d251) estrictamente superior al diámetro máximo (D21)...

  28. 1726.-

    Método implementado por ordenador y programa de ordenador para recuperación de imágenes por contenido. El método comprende seleccionar y segmentar una imagen consultada; extraer características mediante el cálculo de al menos dos descriptores de características incluyendo color y textura; y determinar la similitud de la imagen consultada con una pluralidad de imágenes incluidas en una base de datos que contiene imágenes, dicha pluralidad de imágenes incluyendo también características extraídas calculadas por dichos al menos dos descriptores. Los citados descriptores de características de color y textura calculados se combinan en diferentes espacios de color, los cuales comprenden unas medidas estadísticas...

  29. 1727.-

    Procedimiento para el pesaje de al menos un objeto que puede ser desplazado o se desplaza con respecto a una pluralidad de células de pesaje a lo largo de una dirección de transporte (T), donde a) la pluralidad de células de pesaje están constituidas cada una de ellas independientemente y se disponen sustancialmente una al lado de la otra en posición transversal a la dirección de transporte (T), b) cada célula de pesaje va acoplada mecánicamente, en cada caso, a un dispositivo de transporte , donde el respectivo dispositivo de transporte se forma de tal manera que se pueda desplazar al menos una parte de un objeto en la dirección de transporte (T), c) cada célula de pesaje respectiva genera...

  30. 1728.-

    Una mesa de trabajo equipada para una máquina de corte ; comprendiendo la mesa de trabajo equipada : - una superficie superior (SS) que soporta al menos un panel; y - al menos un dispositivo de cierre , (200A), (200B), (200C), (200D) de una ranura de corte (FT); comprendiendo dicho al menos un dispositivo de cierre , (200A), (200B), (200C), (200D) de la ranura de corte (FT) un miembro de cierre de dicha ranura de corte (FT) y medios de accionamiento de dicho miembro de cierre ; estando dicho miembro de cierre ortogonal con respecto a la propia ranura de corte (FT) y siendo capaz de situarse en una posición terminal retraída (PRT), en la que dicha ranura de corte (FT) en correspondencia...

<< · 27 · 40 · 47 · 50 · 52 · < · 54 · > · 56 · 59 · >>