Inventos patentados en España.

Inventos patentados en España.

Inventos patentados en España en los últimos 80 años. Clasificación Internacional de Patentes CIP 2013.

VECTORES DE EXPRESIÓN PARA ESTIMULAR UNA RESPUESTA INMUNE Y PROCEDIMIENTOS DE USO DE LOS MISMOS.

Patente Internacional (Tratado de Cooperación de Patentes). Resumen:

Un vector de expresión que comprende un promotor unido operativamente a una primera secuencia de nucleótidos que codifica una secuencia dirigida del complejo de histocompatibilidad mayor

(MHC) fusionado a una segunda secuencia de nucleótidos que codifica dos o más epitopos del péptido heterólogo, en el que los epitopos del péptido heterólogo comprenden dos epitopos del péptido VIH (HTL) restringido de clase II o un epitopo del péptido VIH (CTL) restringido de clase I y un epitopo del péptido (HTL) restringido de clase II, en el que al menos uno de dichos epitopos del péptido VIH (HTL) restringido de clase II se selecciona del grupo de péptidos provisto en la Tabla 5; y en el que además dicho epitopo del péptido VIH (CTL) restringido de clase I se selecciona del grupo de péptidos provisto en la Tabla 6.

Solicitante: EPIMMUNE, INC..

Nacionalidad solicitante: Estados Unidos de América.

Dirección: 5820 NANCY RIDGE DRIVE, SUITE 100 SAN DIEGO, CA 92121 ESTADOS UNIDOS DE AMERICA.

Inventor/es: SETTE, ALESSANDRO, CHESNUT, ROBERT W., FIKES,John,D, HERMANSON,Gary,G, ISHIOKA,Glenn Y, LIVINGSTON,Brian.

Fecha de Publicación de la Concesión: 2 de Enero de 2012.

Fecha Solicitud PCT: 13 de Mayo de 1999.

Clasificación PCT: C12N15/85 (....para células animales [5]).

Clasificación antigua: C12N15/00 (Técnicas de mutación o de ingeniería genética; ADN o ARN relacionado con la ingeniería genética, vectores, p. ej. plásmidos, o su aislamiento, su preparación o su purificación; Utilización de huéspedes para ello (mutantes o microorganismos modificados por ingeniería genética 1/00, 5/00, 7/00; nuevas plantas per se A 01 H; reproducción de plantas por técnicas de cultivo de tejidos A 01 H 4/00; nuevas razas animales per se A 01 K 67/00; utilización de preparaciones medicinales que contienen material genético que es introducido en células del cuerpo humano para tratar enfermedades genéticas, terapia génica A 61 K 48/00; péptidos en general C 07 K) [3,5,6]).

Países PCT: Austria, Bélgica, Suiza, Alemania, Dinamarca, España, Francia, Reino Unido, Grecia, Italia, Liechtensein, Luxemburgo, Países Bajos, Suecia, Mónaco, Portugal, Irlanda, Finlandia, Chipre.

Volver al resumen de la patente.

Descripción:

Vectores de expresión para estimular una respuesta inmune y procedimientos de uso de los mismos Declaración de derechos sobre invenciones realizadas bajo investigación y desarrollo con patrocinio federal La presente invención se realizó con el apoyo del gobierno en virtud de la Subvención NIH Núm. AI-42699-01, Subvención NIH Núm. AI38584-03, y Contrato NIH Núm. N01-AI-45241. El Gobierno tiene ciertos derechos en la presente invención. Campo de la invención La presente invención se refiere a vacunas de ácido nucleico que codifica múltiples epitopos CTL y HTL y secuencias dirigidas al MHC. Antecedentes de la invención Las vacunas son de importancia fundamental en la medicina moderna y han sido muy efectivas para combatir ciertas enfermedades humanas. Sin embargo, a pesar de la exitosa implementación de programas de vacunación que han limitado mucho o prácticamente eliminado varias enfermedades humanas debilitantes, existen numerosas enfermedades que afectan a millones en el mundo para las que no se han desarrollado vacunas efectivas. Los principales avances en el campo de la inmunología han llevado a una mayor comprensión de los mecanismos involucrados en la respuesta inmune y han provisto perspectivas para el desarrollo de nuevas estrategias de vacuna (Kuby, Immunology, 443-457 (3rd ed., 1997), que se incorporan en la presente memoria por referencia). Estas nuevas estrategias de vacuna han aprovechado el conocimiento obtenido con respecto a los mecanismos por los cuales el material extraño, denominado antígeno, es reconocido por el sistema inmune y eliminado del organismo. Una vacuna efectiva es una que estimula una respuesta inmune a un antígeno de interés. Las células especializadas del sistema inmunológico son responsables de la actividad protectora necesaria para combatir las enfermedades. Una respuesta inmune involucra dos grupos principales de células, linfocitos o leucocitos, y células que presentan antígeno. El fin de estas células de la respuesta inmune es reconocer el material extraño, tal como un organismo infeccioso o una célula cancerosa y eliminar este material extraño del organismo. Dos tipos principales de linfocitos median diferentes aspectos de la respuesta inmune. Las células B exhiben en su superficie celular proteínas especializadas, llamadas anticuerpos, que se unen específicamente al material extraño, llamado antígeno. Las células B efectoras producen formas solubles del anticuerpo, que circulan en todo el organismo y actúan para eliminar el antígeno del organismo. Esta rama del sistema inmunológico se conoce como la rama humoral. Las células B de memoria actúan para reconocer el antígeno en encuentros futuros al continuar expresando la forma del anticuerpo unida a membrana. Un segundo tipo principal de linfocitos es la célula T. Las células T también tienen en su superficie celular proteínas especializadas que reconocen el antígeno pero, en contraste con las células B, requieren que el antígeno se una a un complejo de proteína de membrana especializado, el complejo de histocompatibilidad mayor (MHC), en la superficie de una célula que presenta antígenos. Dos clases importantes de las células T, denominadas linfocitos T auxiliares ("HTL") y linfocitos T citotóxicos ("CTL"), a menudo se distinguen sobre la base de la presencia de la proteína CD4 o CD8, respectivamente, en la superficie celular. Esta rama del sistema inmunológico se conoce como rama mediada por células. La segunda clase importante de células de la respuesta inmune son células que actúan en la presentación del antígeno por procesamiento del antígeno para la unión a las moléculas de MHC expresadas en las células que presentan antígeno. El antígeno procesado que se une a las moléculas de MHC se transfiere a la superficie de la célula, en la que el complejo antígeno-MHC está disponible para unirse a las células T. Las moléculas de MHC se pueden dividir en moléculas de MHC de clase I y clase II y se reconocen por las dos clases de células T. Casi todas las células expresan las moléculas de MHC clase I, que actúan para presentar el antígeno a los linfocitos T citotóxicos. Los linfocitos T citotóxicos normalmente reconocen el antígeno unido a MHC clase I. Un subconjunto de células llamado células que presentan antígeno expresan moléculas de MHC clase II. Los linfocitos T auxiliares normalmente reconocen el antígeno unido a las moléculas de MHC clase II. Las células que presentan antígeno incluyen células dendríticas, macrófagos, células B, fibroblastos, células gliales, células pancreáticas beta, células epiteliales tímicas, células epiteliales tiroideas y células endoteliales vasculares. Estas células que presentan antígeno generalmente expresan las moléculas de MHC clase I y clase II. Asimismo, las células B actúan como células productoras de anticuerpo y que presentan antígeno. Una vez que un linfocito T auxiliar reconoce un complejo antígeno-MHC clase II en la superficie de una célula que presenta antígeno, el linfocito T auxiliar se activa y produce factores de crecimiento que activan una variedad de células involucradas en la respuesta inmune, que incluyen las células B y linfocitos T citotóxicos. Por ejemplo, bajo la influencia de los factores de crecimiento expresados por los linfocitos T auxiliares activados, se activa un linfocito T 2 E99924233 27-10-2011   citotóxico que reconoce un complejo de antígeno-MHC clase I. Los CTL controlan y eliminan células que exhiben el antígeno reconocido específicamente por los CTL, tales como células infectadas o células tumorales. En consecuencia, la activación de los linfocitos T auxiliares estimula la activación de las ramas mediada humoral y celular del sistema inmunológico. Un aspecto importante de la respuesta inmune, en particular relacionado con la eficacia de la vacuna, es la manera en que el antígeno se procesa de modo que pueda ser reconocido por las células especializadas del sistema inmunológico. Se utilizan distintas vías del procesamiento y presentación del antígeno. Una es una vía citosólica, que hace que el antígeno se una a las moléculas de MHC de clase I. Una vía alternativa es una vía del retículo endoplásmico, que bordea el citosol. Otra es una vía endocítica, que produce que el antígeno se una a las moléculas de MHC clase II. En consecuencia, la presentación en la superficie celular de un antígeno particular por una molécula de MHC clase II o clase I a un linfocito T auxiliar o un linfocito T citotóxico, respectivamente, es dependiente de la vía de procesamiento para este antígeno. La vía citosólica procesa antígenos endógenos que se expresan dentro de la célula. El antígeno es degradado por un complejo de proteasa especializado en el citosol de la célula, y los péptidos antigénicos resultantes se transportan en el retículo endosplásmico, una organela que procesa moléculas de la superficie celular. En el retículo endoplásmico, los péptidos antigénicos se unen a las moléculas de MHC de clase I, que posteriormente se transportan a la superficie celular para la presentación a los linfocitos T citotóxicos del sistema inmunológico. Los antígenos que existen fuera de la célula se procesan por la vía endocítica. Tales antígenos son tomados en la célula por endocitosis, que coloca los antígenos en vesículas especializadas llamadas endosomas y posteriormente en vesículas especializadas llamadas lisosomas, en las que el antígeno es degradado por las proteasas en péptidos antigénicos que se unen a las moléculas MHC clase II. El complejo de péptido antigénico-molécula de MHC clase II posteriormente se transporta a la superficie celular para la presentación a los linfocitos T auxiliares del sistema inmunológico. Se debe considerar una variedad de factores en el desarrollo de una vacuna efectiva. Por ejemplo, el grado de activación de la rama mediada humoral o celular del sistema inmunológico puede determinar la efectividad de una vacuna contra una enfermedad particular. Por otra parte, el desarrollo de la memoria inmunológica por la inducción de la formación de células de memoria puede ser importante para una vacuna efectiva contra una enfermedad particular (Kuby, supra). Por ejemplo, la protección de las enfermedades infecciosas causadas por patógenos con períodos de incubación cortos, tales como virus de la gripe, requiere altos niveles de anticuerpo neutralizante generados por la rama humoral debido a que los síntomas de la enfermedad ya están en proceso antes de que se active la memoria. En forma alternativa, la protección de las enfermedades infecciosas causadas por patógenos con períodos de incubación largos, tales como virus de polio, no requiere anticuerpos neutralizantes en el momento de la infección pero en cambio requiere células B de memoria que puedan generar los anticuerpos neutralizantes para combatir el patógeno antes de que pueda infectar los tejidos diana. En consecuencia, la efectividad de una vacuna para prevenir o mejorar los síntomas de una enfermedad particular depende del tipo de respuesta inmune generada por la vacuna. Muchas vacunas tradicionales han dependido de patógenos intactos tales como virus atenuados o inactivados o bacterias para inducir una respuesta inmune. Sin embargo, estas vacunas tradicionales tienen ventajas y desventajas, que incluyen la inversión de un patógeno atenuado a una forma virulenta. El problema de la inversión de una vacuna atenuada se ha tratado con el uso de moléculas del patógeno más que el patógeno completo. Por ejemplo, las estrategias de inmunización han comenzado a incorporar vacunas de vector recombinante y vacunas de péptidos sintéticos (Kuby, supra). Recientemente, también se han usado vacunas de ADN (Donnelly et al., Annu. Rev. Immunol. 15:617-648 (1997), que se incorporan en la presente memoria por referencia). El uso de las moléculas de un patógeno proporciona vacunas seguras que superan la potencial inversión a una forma virulenta de la vacuna. El direccionamiento de antígenos a las moléculas de MHC clase II para activar los linfocitos T auxiliares se ha descrito mediante secuencias dirigidas a los lisosomas, que dirigen los antígenos a los lisosomas, en los que el antígeno se digiere con la proteasa lisosómica en los péptidos antigénicos que se unen a las moléculas de MHC clase II (Patente U.S. Núm. 5.633.234; Thomson et al., J. Virol. 72: 2246-2252 (1998)). Sería ventajoso desarrollar vacunas que administran múltiples antígenos mientras que aprovechan la seguridad provista por la administración de epitopos individuales de un patógeno más que un organismo completo. En particular, sería ventajoso desarrollar vacunas que dirijan efectivamente antígenos a las moléculas de MHC clase II para la activación de los linfocitos T auxiliares. Varios estudios también indican el papel crítico de las células T citotóxicas en la producción y erradicación de las enfermedades infecciosas y cáncer por el sistema inmunológico (Byrne et al., J. Immunol. 51: 682 (1984); McMichael et al., N. Engl. J. Med. 45 309:13 (1983)). Las vacunas de proteína recombinante no inducen en forma confiable las respuestas de CTL, y por otra parte el uso de vacunas inmunogénicas que consisten en patógenos atenuados en los seres humanos está dificultado, en el caso de varias enfermedades importantes, por problemas de seguridad esenciales. En el caso de enfermedades tales como VIH, HBV, HCV, y malaria, parece conveniente no solo inducir una respuesta CTL vigorosa, sino también centrar la respuesta contra los epitopos altamente conservados a fin de 3 E99924233 27-10-2011   evitar el escape por mutación y superar la eficacia variable de la vacuna contra diferentes cepas del patógeno diana. La inducción de una respuesta amplia dirigida simultáneamente contra múltiples epitopos también parece ser crítica para el desarrollo de vacunas eficaces. La infección con VIH es quizás el mejor ejemplo en que un huésped infectado puede beneficiarse de una respuesta multiespecífica. La progresión rápida de la infección con VIH se ha informado en casos en que se induce una respuesta de CTL restringidamente centrada mientras que los que no progresan tienen a mostrar una especificidad más amplia de los CTLs (Goulder et al., Nat. Med. 3: 212 (1997); Borrow et al., Nat. Med. 3:205 (1997)). La naturaleza muy variable de los epitopos de CTL de VIH resultantes de un genoma de alta mutación y la selección por las respuestas de los CTL dirigidos contra solo un epitopo individual o pocos también respalda la necesidad de respuestas amplias de los CTL de epitopos (McMichael et al., Annu. Rev. Immunol. 15:271 (1997)). Una estrategia potencial para inducir respuestas multiespecíficas contra epitopos conservados es la inmunización con un plásmido minigén que codifica los epitopos de modo cadena de perlas. Se ha descrito la inducción de las respuestas de CTL, HTL, y células B en los ratones por los plásmidos de minigén por varios laboratorios que usan constructos que codifican tanto como 11 epitopos (An et al., J. Virol. 71: 2292 (1997); Thomson et al., J. Immunol. 157: 822 (1996); Whitton et al., J. Virol. 67: 348 (1993); Hanke et al., Vaccine 16:426 (1998); Vitiello et al., Eur. J. Immunol. 27:671-678 (1997)). Los minigenes se han administrado in vivo por la infección con adenovirus recombinante o vaccinia, o por la inyección de ADN purificado por medio de la vía intramuscular o intradérmica (Thomson et al., J. Immunol. 160:1717 (1998); Toes et al., Proc. Natl. Acad. Sci. USA 94:14660 (1997)). El desarrollo exitoso de las vacunas de ADN de minigén para uso humano requerirá tratar ciertas cuestiones fundamentales que se relacionan con la afinidad de MHC por el epitopo, optimización de los constructos para la máxima inmunogenicidad in vivo, y desarrollo de ensayos para analizar in vivo la potencia de los constructos de minigén multi-epitopo. Con respecto a la afinidad de unión de MHC de los epitopos, en la actualidad no se conoce si se pueden incluir epitopos de baja y alta afinidad dentro de un constructo de minigén único, y que los intervalos de afinidad por el péptido son permisibles para la inducción de los CTL in vivo. Esto es esencialmente importante porque los epitopos dominantes varían en su afinidad y porque sería importante poder administrar mezclas de subepitopes dominantes y subdominantes que se caracterizan por afinidades de unión alta y baja a MHC. Con respecto a la optimización del constructo de minigén para la máxima inmunogenicidad in vivo, existen datos conflictivos respecto de si la posición exacta de los epitopos en un constructo dado o la presencia de regiones flanqueantes, epitopos de las células T auxiliares, y las secuencias señal podrían ser críticas para la inducción de los CTL (Del Val et t al., Cell 66:1145 (1991); Bergmann et al., J. Virol. 68:5306 (1994); Thomson et al., Proc. Natl. Acad. Sci. USA 92:5845 (1995); Shirai et al., J. Infect. Dis. 173:24 (1996); Rahemtulla et al., Nature 353:180 (1991); Jennings et al., Cell. Immunol. 133:234 (1991); Anderson et al., J. Exp. Med. 174:489 (1991); Uger et al., J. Immunol. 158:685 (1997)). Finalmente, con respecto al desarrollo de ensayos que permitan analizar los candidato de vacuna humana, cabe indicar que, hasta la fecha, todos los datos inmunogenicidad in vivo de los plásmidos de minigén multepitope se han realizado con epitopos restringidos de MHC de clase I murinos. Sería ventajoso poder analizar la inmunogenicidad in vivo de los minigenes que contienen los epitopos de CTL humano en un sistema modelo animal conveniente. El documento WO 97/35021 desvela vaccinia recombinante que comprende un promotor unido operativamente a las secuencias que codifican un péptido oligo-epitopo del antígeno específico de próstata (PSA), una señal de tráfico ER y un epitopo auxiliar T universal. Thomson et al., 1998, J. Virol. 72(3), 2246-2252 desvelan una vaccinia recombinante que comprende un promotor unido operativamente a las secuencias que codifican múltiples epitopos CTL restringidos de clase II del virus de Epstein-Barr y virus de la gripe y señales de tráfico endosómico/lisosómico derivadas de LAMP-1 y la proteína II. An et al. J. Virol., 1997, 71(3), 2292-2302, desvelan una vacuna minigén multivalente que contiene epitopos de las células B, epitopos de CTL y epitopos de TH) de varios microbios. El documento WO 95/07707 desvela los péptidos de unión a pan DR tal como el péptido AlaLysPheValAlaAlaTrpThrLeuLysAlaAlaAla y sus usos terapéuticos. El documento WO 95/22317 desvela los constructos de minigén que incluyen uno o más epitopos CTL y uno o más epitopos TH. En consecuencia, existe una necesidad de desarrollar procedimientos para administrar efectivamente una variedad de antígenos HTL (linfocito T auxiliar) y CTL (linfocito T citotóxico) para estimular una respuesta inmune. La presente invención satisface esta necesidad y también proporciona ventajas relacionadas. Sumario de la invención La invención en consecuencia se refiere a un vector de expresión definido en las reivindicaciones. La presente invención posibilita un procedimiento de inducir una respuesta inmune in vivo que comprende 4 E99924233 27-10-2011   administrar a un sujeto mamífero un vector de expresión de la invención. La presente invención también posibilita un procedimiento de inducir una respuesta inmune in vivo que comprende administrar a un sujeto mamífero un vector de expresión de la invención. La invención también posibilita un procedimiento de ensayar la inmunogenicidad humana de un epitopo del péptido de células T in vivo a un mamífero no humano, que comprende la etapa de administrar al mamífero no humano un vector de expresión de la invención. En una realización, los epitopos del péptido heterólogo comprenden dos o más epitopos del péptido HTL heterólogo. En otra realización, los epitopos del péptido heterólogo comprenden un epitopo del péptido CTL y un epitopo del péptido HTL universal. En otra realización, los epitopos del péptido heterólogo también comprenden uno a dos o más epitopos del péptido CTL heterólogo. En otra realización, el vector de expresión comprende los epitopos del péptido HTL y CTL. En una realización, uno de los epitopos del péptido HTL es un epitopo HTL universal. En otra realización, el epitopo HTL universal es un epitopo pan DR. En otra realización, el epitopo pan DR tiene la secuencia AlaLysPheValAlaAlaTrpThrLeuLysAlaAlaAla (SEQ ID NO:38). En una realización, la secuencia dirigida a MHC comprende una región de un polipéptido seleccionado del grupo que consiste en la proteína II, LAMP-I, HLS-DM, HLA-DO, H2-DO, proteína de la matriz de la gripe, antígeno de superficie de hepatitis B, antígeno del núcleo de hepatitis B, partícula Ty, proteína Ig-, proteína Ig-ß, y secuencia señal de la cadena kappa de Ig. En una realización, el vector de expresión también comprende una segunda secuencia promotora unida operativamente a una tercera secuencia de nucleótidos que codifica uno o más epitopos del péptido de HTL o CTL heterólogos. En otra realización, el epitopo del péptido CTL comprende un motivo estructural para un supertipo HLA, por el cual el epitopo del péptido CTL se une a dos o más miembros del supertipo con una afinidad mayor de 500 nM. En otra realización, los epitopos del péptido CTL tienen motivos estructurales que proporcionan la afinidad de unión para más de un supertipo de alelo de HLA. Breve descripción de los dibujos La Figura 1 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS: 1 y 2, respectivamente) del constructo IiPADRE que codifica una fusión del gen Ii murino con una secuencia del epitopo pan DR sustituida con la secuencia CLIP de la proteína Ii. La Figura 2 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS: 3 y 4, respectivamente) del constructo 180T que codifica una fusión del dominio citoplasmático, el dominio de transmembrana y parte del dominio luminal de la proteína Ii fusionada a los múltiples epitopos de MHC de clase II. La Figura 3 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS: 5 y 6, respectivamente) del constructo IiThfull que codifica una fusión del dominio citoplasmático, dominio de transmembrana y una porción del dominio luminal de la proteína Ii fusionado a múltiples epitopos auxiliares T y residuos de aminoácidos 101 a 215 de la proteína II, que codifica la región de trimerización de la proteína Ii. La Figura 4 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS: 7 y 8, respectivamente) del constructo KappaLAMPTh que codifica una fusión de la secuencia señal kappa de la inmunoglobulina murina fusionada a los múltiples epitopos auxiliares T y los dominios de transmembrana y citoplasmáticos de LAMP-1. La Figura 5 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS: 9 y 10, respectivamente) del constructo H2M-Th que codifica una fusión de la secuencia señal de H2-M fusionada a los múltiples epitopos de MHC de clase II y los dominios de transmembrana y citoplasmáticos H2-M. La Figura 6 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS: 11 y 12, respectivamente) del constructo H2O-Th que codifica una fusión de la secuencia señal de H2-DO fusionada a los múltiples epitopos de MHC de clase II y los dominios de transmembrana y citoplasmáticos de H2-DO. La Figura 7 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS:13 y 14, respectivamente) del constructo de PADRE-matriz de gripe que codifica una fusión de una secuencia del epitopo pan DR fusionada al extremo amino-terminal de la proteína de la matriz de la gripe. La Figura 8 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS:15 y 16, respectivamente) del constructo PADRE-HBV-s que codifica una fusión de una secuencia del epitopo pan DR fusionada al extremo aminoterminal del antígeno de superficie del virus de hepatitis B. La Figura 9 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS: 17 y 18, respectivamente) del constructo de Ig-alfaTh que codifica una fusión de la secuencia señal de la proteína de Ig- fusionada a los múltiples epitopos de MHC de clase II y los dominios de transmembrana y citoplasmáticos de la proteína de Ig-. E99924233 27-10-2011   La Figura 10 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS: 19 y 20, respectivamente) del constructo de Ig- betaTh que codifica una fusión de la secuencia señal de la proteína de Ig-ß fusionada a los múltiples epitopos de MHC de clase II y los dominios de transmembrana y citoplasmáticos de la proteína de Ig-ß. La Figura 11 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS:21 y 22, respectivamente) del constructo de SigTh que codifica una fusión de la secuencia señal de la inmunoglobulina kappa fusionada a los múltiples epitopos de MHC de clase II. La Figura 12 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS: 23 y 24, respectivamente) de HLA-DR humano, la proteína (II) de cadena no variante. La Figura 13 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS:25 y 26, respectivamente) de glicoproteína 1 de membrana lisosómica humana (LAMP-1). La Figura 14 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS: 27 y 28, respectivamente) de HLA-DMB humano. La Figura 15 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS: 29 y 30, respectivamente) de HLA-DO beta humana. La Figura 16 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS:31 y 32, respectivamente) de Ig- de MB-1 humana. La Figura 17 muestra las secuencias de nucleótidos y aminoácidos (SEQ ID NOS:33 y 34, respectivamente) de proteína de Ig-ß humana. La Figura 18 muestra un diagrama esquemático que ilustra el procedimiento de generación de algunos de los constructos que codifican una secuencia dirigida a MHC clase II fusionada a los múltiples epitopos de MHC de clase II. La Figura 19 muestra la secuencia de nucleótidos del vector pEP2 (SEQ ID NO:35). La Figura 20 muestra la secuencia de nucleótidos del vector pMIN.0 (SEQ ID NO:36). La Figura 21 muestra la secuencia de nucleótidos del vector pMIN.1 (SEQ ID NO:37). Figura 22. Respuesta de CTL representativas en los ratones HLA-A2.1/K b -H-2 bxs inmunizados con pMIN.1 DNA. Se cultivaron los esplenocitos de animales activados en matraces por triplicados y se estimularon dos veces in vitro con cada epitopo del péptido. Se analizó la citotoxicidad de cada cultivo en un ensayo de liberación de 51 Cr contra las células diana Jurkat-A2,1/K b en presencia (símbolos llenos, línea entera) o ausencia (símbolos abiertos, líneas de puntos) del péptido. Cada símbolo representa la respuesta de un solo cultivo. Figura 23. Presentación de epitopos virales a los CTL específicos por células tumorales Jurkat-A2,1/K b transfectadas con minigén de ADN. Se usaron dos constructos para la transfección, pMIN.1 y pMin.2-GFP. Las células diana transfectadas con pMin.2-GFP se separaron por FACS y la población usada en este experimento contenía 60% de células fluorescentes. Se midió la estimulación CTL por la cuantificación de la cantidad de liberación de IFN- (A, B) o por lisis de las células diana marcadas con 51 Cr (C, D, barras rayadas). Los CTL se estimularon con células transfectadas (A, C) o con células Jurkat-A2,1/K b originales en presencia de 1 µg/ml de péptido (B, D). Los niveles de liberación de IFN- y la citotoxicidad para las diferentes líneas CTL en ausencia del epitopo variaron de 72-126 pg/ml y 2-6% respectivamente. Figura 24. Síntesis de constructos de minigén modificados para tratar variables críticas para la inmunogenicidad in vivo. Las siguientes modificaciones se incorporaron en el constructo pMin. 1 prototipo; A, supresión del epitopo PADRE HTL; B, incorporación del epitopo HBV Pol 551 nativo que contiene una alanina en posición 9; C, supresión de la secuencia señal kappa de Ig; y D, cambio de la posición de los epitopos HBV Env 335 y HBV Pol 455. Figura 25. Examen de las variables que pueden influir en la inmunogenicidad de pMin. 1. La actividad inductora de CTL in vivo de pMin. 1 se compara con los constructos modificados. Para facilitar la comparación, se compara la respuesta CTL inducida por cada uno de los constructos de minigén de ADN modificados (barras sombreadas) por separado en cada uno de los cuatros paneles con la respuesta inducida por el constructo prototipo pMIN.1 (barras llenas). Se muestra la respuesta media geométrica de los cultivos positivos para CTL de dos a cinco experimentos independientes. Los números mostrados con cada barra indican el número de cultivos positivos/número total analizado para el epitopo particular. La relación de cultivos positivos/analizados totales para los grupos de pMin. 1 se muestra en el panel A y es el mismo para los restantes paneles de la figura (ver Ejemplo V, Materiales y Procedimientos, en cultivos de CTL in vitro, para la definición de un cultivo CTL positivo). Las respuestas a Theradigm se obtuvieron por la inmunización de los animales con el lipopéptido y el análisis de los cultivos de esplenocitos con el péptido 18-27 del núcleo HBV. 6 E99924233 27-10-2011   Definiciones Un epitopo del péptido "HTL" o un "epitopo de MHC II" es un epitopo restringido de MHC clase II, es decir, uno que se une con una molécula de MHC clase II. Un epitopo del péptido "CTL" o un "epitopo de MHC I es un epitopo restringido de MHC clase I, es decir, uno que se une con una molécula de MHC clase I. Una "secuencia dirigida a MHC" se refiere a una secuencia peptídica que se dirige a un polipéptido, por ejemplo, que comprende un epitopo del péptido, para una vía citosólica (por ejemplo, una vía de procesamiento del antígeno de MHC clase I), en la vía del retículo endoplásmico, o una vía endocítica (por ejemplo, una vía de procesamiento del antígeno de MHC clase II). El término "heterólogo" cuando se usa con referencia a porciones de un ácido nucleico indica que el ácido nucleico comprende dos o más subsecuencias que no se hallan en la misma relación entre sí en la naturaleza. Por ejemplo, el ácido nucleico normalmente se produce en forma recombinante, que tiene dos o más secuencias de genes no relacionados dispuestos para obtener un nuevo ácido nucleico funcional, por ejemplo, un promotor de una fuente y una región codificadora de otra fuente. De modo similar, un proteína heteróloga indica que la proteína comprende dos o más subsecuencias que no se hallan en la misma relación entre sí en la naturaleza, por ejemplo, un polipéptido de fusión que comprende subsecuencias de diferentes polipéptidos, epitopos del péptido del mismo polipéptido que no están naturalmente en una posición adyacente, o repeticiones de un epitopo del péptido único. Como se usa en la presente memoria, la frase "epitopo de MHC clase II universal" o un "epitopo HTL universal" se refiere a un epitopo del péptido de MHC clase II que se une a los productos génicos de múltiples alelos de MHC clase II. Por ejemplo, los alelos DR, DP y DQ son alelos de MHC II humanos. En general, un único conjunto de péptidos se une a un producto génico particular de un alelo de MHC clase II. En contraste, un epitopo de MHC clase II universal es capaz de unirse a los productos génicos de múltiples alelos de MHC clase II. Un epitopo de MHC clase II universal se une a 2 o más alelos de MHC clase II, generalmente 3 o más alelos de MHC clase II, y particularmente 5 o más alelos de MHC clase II. En consecuencia, la presencia de un epitopo de MHC clase II universal en un vector de expresión es ventajosa ya que funciona para aumentar la cantidad de moléculas alélicas de MHC clase II que se pueden unir al péptido y, en consecuencia, el número de linfocitos T auxiliares que se activan. Los epitopos de MHC de clase II universales son bien conocidos en la técnica e incluyen, por ejemplo, epitopos tales como los "epitopos panDR" también denominado como "PADRE" (Alexanderet al., Immunity 1:751-761 1: (1994); WO 95/07707, USSN 60/036,713, USSN 60/037,432, PCT/US98/01373, 09/009,953, y USSN 60/087,192 cada uno de los cuales incorpora en la presente memoria por referencia). Un "péptido de unión al pan DR" o un "PADRE" péptido de la invención es un péptido capaz de unirse al menos a aproximadamente 7 diferentes moléculas de DR, preferentemente 7 de las 12 moléculas de DR más comunes, con máxima preferencia 9 de las 12 moléculas de DR más comunes (DR1, 2w2b, 2w2a, 3, 4w4, 4w14, 5, 7, 52a, 52b, 52c, y 53), o de modo alternativo, 50% de un panel de las moléculas de DR representativos de mayor de o igual a 75% de la población humana, preferentemente mayor de o igual a 80% de la población humana. Los epitopos pan DR pueden unirse a una cantidad de alelos DR y son fuertemente inmunogénicos para la células T. Por ejemplo, se halló que los epitopos pan DR son más efectivos para inducir una respuesta inmune que los epitopos naturales MHC de clase II (Alexander, supra). Un ejemplo de un epitopo PADRE es el péptido AlaLysPheValA-laAlaTrpThrLeuLysAlaAlaAla (SEQ ID NO:38). Con respecto a una secuencia de aminoácidos particular, un "epitopo" es un conjunto de residuos de aminoácidos que se involucra en el reconocimiento por una inmunoglobulina particular, o en el contexto de las células T, los residuos necesarios para el reconocimiento por las proteínas del receptor celular T y/o receptores del complejo de histocompatibilidad mayor (MHC). En un contexto del sistema inmunológico, in vivo o in vitro, un epitopo tiene las características colectivas de una molécula, tal como estructura del péptido primaria, secundaria y terciaria, y carga, que en conjunto forma un sitio reconocido por una inmunoglobulina, receptor celular T o molécula de HLA. A lo largo de esta descripción epitopo y péptido con frecuencia se usan en forma indistinta. Se aprecia, sin embargo, que las moléculas de proteína o péptido aisladas o purificadas más grandes que y que comprenden un epitopo de la invención están dentro de los límites de la invención. Como se usa en la presente memoria, "alta afinidad" con respecto a las moléculas de HLA de clase I se define como la unión de una IC50 (o KD) de menos de 50 nM. "Afinidad intermedia" es la unión con una IC50 (o KD) de entre aproximadamente 50 y aproximadamente 500 nM. "Alta afinidad" con respecto a la unión de moléculas de HLA clase II se define como la unión con una KD de menos de 100 nM. "Afinidad intermedia" es la unión con una KD de entre aproximadamente 100 y aproximadamente 1000 nM. Los ensayos para determinar la unión se describen en detalle, por ejemplo, en publicaciones PCT WO 94/20127 y WO 94/03205. En forma alternativa, la unión se expresa con respecto a un péptido de referencia. Como un ensayo particular es más, o menos sensible, las IC50m de los péptidos analizados pueden cambiar. Sin embargo, la unión relativa del péptido de referencia no cambiará significativamente. Por ejemplo, en un ensayo que corre en condiciones de modo que la IC50 del péptido de referencia aumenta 10 veces, los valores de IC50 de los péptidos de ensayo cambiarán aproximadamente 10 veces. En consecuencia, para evitar ambigüedades, la evaluación de si un péptido es bueno, intermedio, débil o negativo para la unión se basa 7 E99924233 27-10-2011   generalmente en su IC50, con respecto a la IC50 de un péptido estándar. A lo largo de esta descripción, los resultados se expresan en términos de "IC50". La IC50 es la concentración del péptido en un ensayo de unión en la que se observa el 50% de inhibición de la unión de un péptido de referencia. Dadas las condiciones en que se corren los ensayos (es decir, concentraciones de proteínas de HLA y péptido marcado limitantes), estos valores se aproximan a los valores de KD. Cabe mencionar que los valores de IC50 pueden cambiare, a menudo drásticamente, si las condiciones del ensayo varían y dependen de los reactivos particulares usados (por ejemplo, preparación de HLA, etc.). Por ejemplo, las concentraciones excesivas de las moléculas de HLA aumentarán la IC50 medida aparente de un ligando dado. Los términos "idéntico" o por ciento de identidad en el contexto de dos o más secuencias peptídicas, se refieren a dos o más secuencias o subsecuencias que son iguales o tienen un porcentaje de residuos de aminoácidos especificado que son iguales, cuando se comparan y alinean para la correspondencia máxima respecto de una ventana de comparación, medida por medio de algoritmos de comparación de secuencia por medio de parámetros del programa predeterminados o por alineamiento manual e inspección visual. Las frases "aislado" o "biológicamente puro" se refieren al material que está sustancial o esencialmente libre de los componentes que acompañan normalmente tal como se halla en la naturaleza. En consecuencia, los péptidos aislados de acuerdo con la invención preferentemente no contienen materiales normalmente asociados con los péptidos en su ambiente in situ. "Complejo de histocompatibilidad mayor" o "MHC" es un agrupamiento de genes que cumple un papel en el control de las interacciones celulares responsables de las respuestas inmunes fisiológicas. En los seres humanos, el complejo MHC también se conoce como el complejo HLA. Para una descripción detallada de los complejos MHC y HLA, ver Paul, Fundamental Immunology (3rd ed. 1993). "Antígeno leucocitario humano" o "HLA" es una proteína del complejo de histocompatibilidad mayor (MHC) de clase I o clase II humano (ver, por ejemplo, Stites, et al., Immunology, (8th ed., 1994). Un "supertipo o familia de HLA", como se usa en la presente memoria, describe conjuntos de las moléculas de HLA agrupados sobre la base de las especificidades de unión del péptido compartido. Las moléculas de HLA de clase I que comparten alguna afinidad de unión similar por los péptidos que portan ciertos motivos de aminoácido se agrupan en los supertipos HLA. Los términos superfamilia de HLA, familia del supertipo HLA, familia de HLA, y moléculas del supertipo tipo xx de HLA (en el que xx indica un tipo de HLA particular), son sinónimos. El término "motivo" se refiere al patrón de residuos en un péptido de longitud definida, usualmente un péptido de aproximadamente 8 a aproximadamente 13 aminoácidos para un motivo de HLA de clase I y de aproximadamente 6 a aproximadamente 25 aminoácidos para un motivo HLA de clase II, que es reconocido por una molécula de HLA particular. Los motivos peptídicos son normalmente diferentes para cada proteína codificada por cada alelo de HLA humano y difiere en el patrón de los residuos de anclaje primarios y secundarios. Un "supermotivo es una especificidad de unión al péptido compartida por las moléculas de HLA codificadas por dos o más alelos HLA. En consecuencia, un supermotivo preferentemente se reconoce con afinidad alta o intermedia (como se define en la presente memoria) con dos o más antígenos HLA. "Unión de reacción cruzada" indica que un péptido está unido con más de una molécula de HLA; un sinónimo es unión degenerada. El término "péptido" se usa en forma indistinta con "oligopéptido" en la presente memoria para designar una serie de residuos, normalmente L-aminoácidos, conectados entre sí, normalmente por enlaces peptídicos entre los grupos - amino y carboxilo adyacentes de los aminoácidos. Los oligopéptidos inductores de CTL preferidos de la invención son 13 residuos o menos de longitud y usualmente consisten en entre aproximadamente 8 y aproximadamente 11 residuos, preferentemente 9 o 10 residuos. Los oligopéptidos inductores de HTL son menos de aproximadamente 50 residuos de longitud y consisten en entre aproximadamente 6 y aproximadamente 30 residuos, más usualmente entre aproximadamente 12 y 25, y a menudo entre aproximadamente 15 y 20 residuos. Un "péptido inmunogénico" o "epitopo del péptido" es un péptido que comprende un motivo o supermotivo específico de alelo de modo que el péptido se unirá a una molécula de HLA e inducirá una respuesta de CTL y/o HTL. En consecuencia, los péptidos inmunogénicos de la invención son capaces de unirse a una molécula de HLA apropiada y a partir de este momento inducen una respuesta de células T citotóxicas, o una respuesta de células T auxiliares, al antígeno del cual deriva el péptido inmunogénico. Una "respuesta inmune protectora" se refiere a una respuesta CTL y/o HTL a un antígeno derivado de un agente infeccioso o un antígeno tumoral, que impide o al menos detiene parcialmente los síntomas o progresión de la enfermedad. La respuesta inmune también puede incluir una respuesta de anticuerpo que ha sido facilitada por la estimulación de las células T auxiliares. El término "residuo se refiere a un aminoácido o mimético de aminoácido incorporado en un oligopéptido por un 8 E99924233 27-10-2011   enlace amida o mimético de enlace amida. "Péptido sintético" se refiere a un péptido que no es natural, sino que es fabricado por el hombre por medio de procedimientos tales como síntesis química o tecnología de ADN recombinante. La nomenclatura usada para describir los compuestos de péptido sigue la práctica convencional en la que el grupo amino se presenta a la izquierda (el extremo N-terminal) y el grupo carboxilo a la derecha (el extremo C-terminal) de cada residuo de aminoácido. Cuando las posiciones del residuo de aminoácido se refieren a un epitopo del péptido se numeran en una dirección amino a carboxilo, con la posición uno que está en la posición más cercana al extremo amino terminal del epitopo, o el péptido o proteína de la cual puede ser parte. En las fórmulas que representan las formas de realización específicas seleccionadas de la presente invención, los grupos amino- y carboxilo-terminal, si bien no se muestran específicamente, están en la forma que se asume pueden estar en los valores de pH fisiológico, a menos que se especifique lo contrario. En las fórmulas estructurales de aminoácidos, cada residuo se representa generalmente por denominaciones estándares de tres letras o letra única. La forma L de un residuo de aminoácido está representada por una letra única mayúscula o una primera letra mayúscula de un símbolo de tres letras, y la forma D para los aminoácidos que tienen formas D está representada por una letra única minúscula o un símbolo de tres letras minúscula. La glicina no tiene átomo de carbono asimétrico y se denomina simplemente como "Gly" o G. Como se usa en la presente memoria, el término "vector de expresión" se refiere a una molécula de ácido nucleico capaz de expresar un antígeno de interés tal como un epitopo de MHC clase I o clase II en una célula diana apropiada. Un vector de expresión puede ser, por ejemplo, un plásmido o virus, que incluye virus de ADN o ARN. El vector de expresión contiene tal elemento promotor para expresar un antígeno de interés en la célula o tejido apropiado a fin de estimular una respuesta inmune deseada. Descripción detallada de la invención Los linfocitos T citotóxicos (CTL) y linfocitos T auxiliares (HTLs) son críticos para la inmunidad contra los patógenos infecciosos; tales como virus, bacterias, y protozoos; células tumorales; enfermedades autoinmunes y similares. La presente invención proporciona minigenes que codifican epitopos del péptido que inducen una respuesta de CTL y/o HTL. Los minigenes de la invención también incluyen una secuencia dirigida a MHC. Se puede analizar una variedad de minigenes que codifican diferentes epitopos para determinar la inmunogenicidad por medio de un HLA de ratón transgénico. Los epitopos normalmente son una combinación de al menos dos o más epitopos de HTL, o un epitopo de CTL más un epitopo HTL universal, y opcionalmente incluyen epitopos HTL y/o CTL adicionales. Se pueden incluir dos, tres, cuatro, cinco, seis, siete, ocho, nueve, diez, veinte, treinta, cuarenta o aproximadamente cincuenta epitopos diferentes, sean HTL y/o CTL, en el minigén, junto con la secuencia dirigida a MHC. Los epitopos pueden tener diferente restricción de HLA. Los epitopos para analizar incluyen los derivados de virus tales como VIH, HBV, HCV, HSV, CMV, HPV, y HTLV; antígenos de cáncer tales como p53, Her2/Neu, MAGE, PSA, virus del papiloma humano, y CEA; parásitos tales como Trypanosoma, Plasmodium, Leishmania, Giardia, Entamoeba; enfermedades autoinmunes tales como artritis reumatoide, miastenia gravis, y lupus eritematoso; hongos tales como Aspergillus y Candida; y bacterias tales como Escherichia coli, estafilococos, Chlamydia, micobacterias, estreptococos, y Pseudomonas. Los epitopos que serán codificados por el minigén se seleccionan y analizan por medio de los procedimientos descritos en las solicitudes de PCT publicadas WO 93/07421, WO 94/02353, WO 95/01000, WO 97/04451, y WO 97/05348. Epitopos de HTL y CTL Los vectores de expresión de la invención codifican uno o más epitopos de MHC clase II y/o clase I y una secuencia dirigida a MHC. Los epitopos de MHC clase II o clase I múltiples presentes en un vector de expresión pueden derivar del mismo antígeno, o los epitopos de MHC pueden derivar de antígenos diferentes. Por ejemplo, un vector de expresión puede contener uno o más epitopos de MHC que pueden derivar de dos antígenos diferentes del mismo virus o de dos antígenos diferentes de diferentes virus. Por otra parte, se puede usar cualquier epitopo de MHC en los vectores de expresión de la invención. Por ejemplo, se puede usar cualquier epitopo de MHC único o una combinación de los epitopos de MHC mostrados en las Tablas 1 a 8 en los vectores de expresión de la invención. Otros epitopos del péptido pueden ser seleccionados por los expertos en la técnica, por ejemplo, por el uso de una computadora para seleccionar epitopos que contienen motivos o supermotivos específicos del alelo HLA. Los vectores de expresión de la invención también pueden codifican uno o más epitopos de MHC de clase II universales, por ejemplo, PADRE. Los epitopos de MHC de clase II universales se pueden combinar ventajosamente con otros epitopos de MHC de clase I y clase II para aumentar el número de células que se activan en respuesta a un antígeno dado y proporcionan una cobertura de población más amplia de alelos reactivos a MHC. En consecuencia, los vectores de expresión de la invención pueden codificar epitopos de MHC específicos para un antígeno, epitopos de MHC de clase II universales, o una combinación de epitopos de MHC específicos y al menos un epitopo de MHC clase II universal. Los epitopos de MHC de clase I en general son de aproximadamente 5 a 15 aminoácidos de longitud, en particular aproximadamente 8 a 11 aminoácidos de longitud. Los epitopos de MHC de clase II en general son de 9 E99924233 27-10-2011   aproximadamente 10 a 25 aminoácidos de longitud, en particular aproximadamente 13 a 21 aminoácidos de longitud. Un epitopo de MHC de clase I o II se puede derivar de cualquier antígeno de interés deseado. El antígeno de interés puede ser un antígeno viral, receptor de superficie, antígeno tumoral, oncogén, enzima, o cualquier patógeno, célula o molécula para la que se desea una respuesta inmune. Los epitopos se pueden seleccionar sobre la base de su capacidad de unir uno o múltiples alelos de HLA, y también se pueden seleccionar por medio de la técnica "análoga" que se describe a continuación. Secuencias dirigidas Los vectores de expresión de la invención codifican uno o más epitopos de MHC unidos operativamente a una secuencia dirigida a MHC. El uso de una secuencia dirigida a MHC aumenta la respuesta inmune a un antígeno, con respecto a la administración del antígeno solo, por la dirección del epitopo del péptido al sitio de ensamblaje de la molécula de MHC y transporte a la superficie celular, de este modo se proporciona un número aumentado de complejos de molécula de MHC-epitopo del péptido disponible para la unión y activación de las células T. Las secuencias dirigidas a MHC clase I se usan en la presente invención, por ejemplo, las secuencias que se dirigen al péptido del epitopo de MHC clase I a una vía citosólica o a al retículo endoplásmico (ver, por ejemplo, Rammensee et al., Immunogenetics 41:178-228 (1995)). Por ejemplo, la vía citosólica procesa los antígenos endógenos que se expresan dentro de la célula. Sin estar ligado a teoría particular alguna, se considera que las proteínas citosólicas son degradadas al menos parcialmente por una actividad de endopeptidasa de un proteasoma y a continuación se transportan al retículo endoplásmico por la molécula TAP (transportador asociado con procesamiento). En el retículo endoplásmico, el antígeno se une a las moléculas de MHC clase I. Las secuencias señal del retículo endoplásmico saltean la vía de procesamiento citosólica y dirigen directamente los antígenos endógenos al retículo endoplásmico, en el que se produce la degradación proteolítica en los fragmentos del péptido. Tales secuencias dirigidas a MHC clase I son bien conocidas en la técnica, e incluyen por ejemplo, secuencias señal tales como las de Ig kappa, activador del plasminógeno tisular o insulina. Un péptido señal preferido es la secuencia de la cadena kappa de la Ig humana. Las secuencias señal del retículo endoplásmico también se pueden usar para dirigir los epitopos de MHC de clase II al retículo endoplásmico, el sitio del ensamblaje de la molécula de MHC clase I. Las secuencias dirigidas a MHC clase II también se usan en la invención, por ejemplo, los que dirigen un péptido a la vía endocítica. Estas secuencias de direccionamiento normalmente se dirigen a los antígenos extracelulares para ingresar en la vía endocítica, lo que produce que el antígeno se transfiera al compartimiento lisosómico en el que el antígeno se escinde proteolíticamente en péptidos antigénicos para la unirse a las moléculas de MHC clase II. Como en el procesamiento normal del antígeno exógeno, una secuencia que dirige un epitopo de MHC clase II a los endosomas de la vía endocítica y/o posteriormente a los lisosomas, en los que el epitopo de MHC clase II se puede unir a una molécula de MHC clase II, es una secuencia dirigida a MHC clase II. Por ejemplo, el grupo de las secuencias dirigidas a MHC clase II útiles en la invención son secuencias dirigidas a los lisosomas, que localizan los polipéptidos en los lisosomas. Debido a que las moléculas de MHC clase II normalmente se unen a los péptidos antigénicos derivados del procesamiento proteolítico de los antígenos sometidos a endocitosis en los lisosomas, una secuencia dirigida a los lisosomas pueden actuar como una secuencia dirigida a MHC clase II. Las secuencias dirigidas a los lisosomas son bien conocidas en la técnica e incluyen secuencias halladas en las proteínas lisosómicas LAMP-1 y LAMP-2 descritas por August et al. (Patente U.S. Núm. 5.633.234, expedida el 27 de mayo de 1997). Otras proteínas lisosómicas que contienen secuencias dirigidas a los lisosomas incluyen HLA-DM. HLA-DM es una proteína endosómica/lisosómica que actúa en la facilitación de la unión de los péptidos antigénicos a las moléculas de MHC clase II. Debido a que se ubica en el lisosoma, HLA-DM tiene una secuencia dirigida a los lisosomas que puede actuar como una secuencia dirigida a la molécula de MHC clase II (Copier et al., J. Immunol. 157:1017-1027 (1996). La proteína lisosómica residente HLA-DO también puede funcionar como una secuencia dirigida a los lisosomas. En contraste a las proteínas lisosómicas residentes anteriormente descritas LAMP-1 y HLA-DM, que codifican los motivos que contienen Tyr específicos que dirigen las proteínas a los lisosomas, HLA-DO se dirige a los lisosomas por la asociación con HLA-DM (Liljedahl et al., EMBO50 J. 15:4817-4824 (1996)). En consecuencia, se pueden usar las secuencias de HLA-DO que causan la asociación con HLA-DM y, por consiguiente, la translocación de HLA-DO a los lisosomas como secuencias dirigidas a MHC clase II. De modo similar, el homólogo murino de HLA-DO, H2-DO, se puede usar para derivar una secuencia dirigida a MHC clase II. Un epitopo de MHC clase II se puede fusionar a HLA-DO o H2-DO y se dirige a los lisosomas. En otro ejemplo, los dominios citoplasmáticos de las subunidades Ig- e Ig-ß del receptor de las células B median la internalización del antígeno y aumentan la eficiencia de la presentación del antígeno (Bonnerot et al., Immunity 3:335-347I (1995)). En consecuencia, los dominios citoplasmáticos de las proteínas de Ig- e Ig-ß pueden actuar como secuencias dirigidas a MHC clase II que dirigen un epitopo de MHC clase II a la vía endocítica para el procesamiento y unión a las moléculas de MHC clase II. Otro ejemplo de una secuencia dirigida a MHC clase II que dirige los epitopos de MHC de clase II a la vía endocítica E99924233 27-10-2011   es una secuencia que dirige los polipéptidos secretados, en la que el polipéptido puede entrar en la vía endosómica. Estas secuencias dirigidas a MHC clase II que dirigen los polipéptidos por secretar imitan la vía normal por la que se procesan los antígenos extracelulares, exógenos en los péptidos que se unen a las moléculas de MHC clase II. Cualquier secuencia señal que actúa para dirigir un polipéptido a través del retículo endoplásmico y por último se secreta, puede actuar como una secuencia dirigida a MHC clase II a condición que el polipéptido secretado pueda entrar a la vía endosómica/lisósomica y se escinda en los péptidos que pueden unirse a las moléculas de MHC clase II. Un ejemplo de tal fusión se muestra en la Figura 11, en la que la secuencia señal de inmunoglobulina kappa se fusiona a los múltiples epitopos de MHC de clase II. En otro ejemplo, la proteína Ii se une a las moléculas de MHC clase II en el retículo endoplásmico, en el que actúa para evitar que los péptidos presentes en el retículo endoplásmico se unan a las moléculas de MHC clase II. En consecuencia, la fusión de un epitopo de MHC clase II a la proteína Ii dirige el epitopo de MHC clase II al retículo endoplásmico y una molécula de MHC clase II. Por ejemplo, la secuencia CLIP de la proteína Ii se puede eliminar y reemplazar con una secuencia del epitopo MHC de clase II de modo que el epitopo de MHC clase II se dirige al retículo endoplásmico, en el que el epitopo se une a una molécula de MHC clase II. En algunos casos, los antígenos mismos pueden servir como secuencias dirigidas a MHC clase II o I y se pueden fusionar a un epitopo de MHC clase II universal para estimular una respuesta inmune. Si bien los antígenos virales citoplásmicos generalmente se procesan y presentan como complejos con moléculas de MHC de clase I, las proteínas citoplasmáticas de vida larga tales como la proteína de la matriz de la gripe pueden entrar en la vía de procesamiento de la molécula de MHC clase II (Gueguen & Long, Proc. Natl. Acad. Sci. USA 93:14692-14697 (1996)). Por ende, las proteínas citoplasmáticas de vida larga pueden actuar como una secuencia dirigida a MHC clase II. Por ejemplo, un vector de expresión que codifica la proteína de la matriz de la gripe fusionada a un epitopo de MHC clase II universal se puede usar ventajosamente para dirigir el antígeno de influenza y el epitopo de MHC clase II universal a la vía de MHC clase II para estimular una respuesta inmune para la influenza. Otros ejemplos de antígenos que funcionan como secuencias dirigidas a MHC clase II incluyen los polipéptidos que forman espontáneamente partículas. Los polipéptidos se secretan de la célula que los produce y forman espontáneamente partículas, que son captadas en una célula que presenta antígeno por endocitosis tal como endocitosis mediada por receptor o es absorbida por fagocitosis. Las partículas se escinden proteolíticamente en péptidos antigénicos después de ingresar en la vía endosómica/ lisosómica. Tal polipéptido que forma espontáneamente partículas es antígeno de superficie de HBV (HBV-S) (Diminsky et al., Vaccine 15:637-647 (1997); Le Borgne et al., Virology 240:304-315 (1998)), cada uno de los cuales incorpora en la presente memoria por referencia. Otro polipéptido que forma espontáneamente partículas es el antígeno del núcleo de HBV (Kuhröber et al., International Immunol. 9:1203-1212 (1997)). Otro polipéptido más que forma espontáneamente partículas es la proteína Ty de levadura (Weber et al., Vaccine 13:831-834 (1995)), que se incorpora en la presente memoria, por ejemplo, por un vector de expresión que contiene el antígeno HBV-S fusionado a un epitopo de MHC clase II universal se puede usar ventajosamente para dirigir el antígeno HBV-S y el epitopo de MHC clase II universal a la vía de MHC clase II para estimular una respuesta inmune al HBV. Afinidad de unión de los epitopos del péptido por las moléculas de HLA El gran grado de polimorfismo de HLA es un factor importante a tomar en cuenta en la estrategia basada en epitopos para el desarrollo de vacunas. Para tratar este factor, preferentemente se utiliza la selección del epitopo que abarca la identificación de péptidos capaces de unirse con afinidad alta o intermedia a múltiples moléculas de HLA, con máxima preferencia estos epitopos se unen con afinidad alta o intermedia a dos o más moléculas de HLA específicas del alelo. Los péptidos inductores de CTL de interés para las composiciones de vacunas preferentemente incluyen los que tienen una afinidad de unión para las moléculas de HLA de clase I de menos de 500 nM. Los péptidos inductores de HTL preferentemente incluyen los que tienen una afinidad de unión para las moléculas de HLA de clase II de menos de 1000 nM. Por ejemplo, la unión de péptido se evalúa por el análisis de la capacidad de un péptido candidato de unirse a una molécula de HLA purificada in vitro. Los péptidos que exhiben afinidad alta o intermedia por lo tanto se consideran para el análisis posterior. Los péptidos seleccionados se prueban en otros miembros de la familia del supertipo. En formas de realización preferidas, los péptidos que exhiben la unión de reactividad cruzada posteriormente se usan en las vacunas o en análisis de detección celular. La afinidad de unión a HLA mayor normalmente se correlaciona con mayor inmunogenicidad. La mayor inmunogenicidad se puede manifestar en varias maneras diferentes. La inmunogenicidad corresponde a si se induce alguna respuesta inmune, y al vigor de cualquier respuesta particular, así también como la medida de la población en que se induce una respuesta. Por ejemplo, un péptido podría inducir una respuesta inmune en un conjunto diverso de la populación, aun en el caso en que no se produce una respuesta vigorosa. De acuerdo con estos principios, se ha hallado que cerca de 90% de los péptidos de unión alta son inmunogénicos, en contraste con aproximadamente 50% de los péptidos que se unen con afinidad intermedia. Además, los péptidos de afinidad de unión más alta producen respuestas inmunogénicas más vigorosas. Como resultado, se requieren menos péptidos para inducir un efecto biológico similar si se usa un péptido de unión de afinidad alta. En consecuencia, en formas de 11 E99924233 27-10-2011   realización preferidas de la invención, los epitopos de unión alta particularmente útiles. La relación entre la afinidad de unión por las moléculas de HLA de clase I y la inmunogenicidad de los epitopos del péptido diferenciados sobre los antígenos unidos se ha determinado por primera vez en la técnica por los presentes inventores. Se analizó la correlación entre la afinidad de unión y la inmunogenicidad en dos abordajes experimentales diferentes (Sette et al., J. Immunol. 153:5586-5592 (1994)). En el primer abordaje, la inmunogenicidad de los potenciales epitopos que varían en afinidad de unión HLA en un intervalo de 10.000 veces se analizó en ratón transgénico HLA-A*0201. En el segundo abordaje, se evaluó la antigenicidad de aproximadamente 100 epitopos potenciales diferentes derivados de del virus de hepatitis B (HBV), todos los cuales portan los motivos de unión A*0201 por el uso de PBL (linfocitos de sangre periférica) de pacientes con hepatitis aguda. De acuerdo con estos abordajes, se determinó que un umbral de afinidad de aproximadamente 500 nM (preferentemente 50 nM o menos) determina la capacidad de un epitopo del péptido para inducir una respuesta de CTL. Estos datos son válidos para las mediciones de afinidad de unión de clase I para los péptidos procesados naturalmente y para los epitopos de las células T sintetizadas. Estos datos también indican el papel importante de la selección determinante en la configuración de las respuestas de las células T (ver, por ejemplo, Schaeffer et al. Proc. Natl. Acad. Sci. USA 86: 4649-4653, 1989). También se ha delineado un umbral de afinidad asociado con la inmunogenicidad en el contexto de las moléculas de DR de HLA clase II (ver, por ejemplo, Southwood et al. J. Immunology 160:3363-3373 (1998), y USSN 60/087192, presentado el 5/29/98). A fin de definir un umbral biológicamente significativo de la afinidad de unión de DR, se compiló una base de datos de las afinidades de unión de 32 epitopos restringidos de DR por su elemento de restricción (es decir, la molécula de HLA que se une al motivo). En aproximadamente la mitad de los casos (15 de 32 epitopos), la restricción de DR se asoció con afinidades de unión altas, es decir afinidades de unión de menos de 100 nM. En la otra mitad de los casos (16 de 32), la restricción de DR se asoció con afinidad intermedia (afinidades de unión en el intervalo de 100-1000 nM). En solo uno de los 32 casos la restricción de DR se asoció con una IC50 de 1000 nM o mayor. En consecuencia, se puede definir a 1000 nM como un umbral de afinidad asociado con inmunogenicidad en el contexto de las moléculas de DR. Motivos y supermotivos de unión al epitopo del péptido En los últimos años se ha acumulado evidencia para demostrar que una gran fracción de las moléculas de HLA clase I y clase II se pueden clasificar en relativamente pocos supertipos, cada uno caracterizado por repertorios de unión de péptidos con gran superposición y estructuras de consenso de los principales sitios de unión del péptido. Para los análisis del sitio de las moléculas de HLA, se analizaron los residuos que comprenden los sitios B y F de las moléculas de HLA de clase I que se describieron en los estudios cristalográficos (Guo et al., Nature 360:364 (1992); Saper et al., J. Mol. Biol. 219: 277 (1991); Madden et al., Cell 75: 693 (1993); Parham et al., Immunol. Rev. 143: 141 (1995)). En estos análisis, se consideró que los residuos 9, 45, 63, 66, 67, 70, y 99 constituyen el sitio B; y se estimó que el sitio B determina la especificidad para el residuo del aminoácido en la segunda posición de los ligandos del péptido. De modo similar, se consideró que los residuos 77, 80, 81, y 116 determinan la especificidad del sitio F; se estimó que el sitio F determina la especificidad para el residuo C-terminal de un ligando del péptido unido por la molécula de HLA clase I. A través del estudio de los análogos del antígeno sustituidos con aminoácido único y la secuenciación de los péptidos procesados naturalmente, unidos en forma endógena, se han identificado residuos críticos necesarios para la unión específica de alelo de las moléculas de HLA. La presencia de estos residuos se correlaciona con la afinidad de unión para las moléculas de HLA. La identificación de motivos y/o supermotivos que se correlacionan con la unión de afinidad alta e intermedia es un tema importante con respecto a la identificación de los epitopos inmunogénicos del péptido para la inclusión en una vacuna. Kast et al. (J. Immunol. 152:3904-3912 (1994)) han demostrado que los péptidos portadores del motivo representan el 90% de los epitopos que se unen a moléculas de HLA de clase I específicas del alelo. En este estudio se evaluaron todos los péptidos posibles de 9 aminoácidos de longitud y superposición en ocho aminoácidos (240 péptidos), que cubren la secuencia completa de las proteínas E6 y E7 del virus de papiloma humano tipo 16, por la unión a cinco moléculas de HLA específicas del alelo que se expresan con alta frecuencia entre los diferentes grupos étnicos. Este conjunto sin sesgo de péptidos permitió una evaluación del valor predictivo de los motivos de HLA clase I. A partir del conjunto de 240 péptidos, se identificaron 22 péptidos que se unen a las moléculas de HLA específicas del alelo con afinidad alta o intermedia. De estos 22 péptidos, 20, (es decir, 91%), eran portadores del motivo. En consecuencia, este estudio demuestra el valor de los motivos para la identificación de los epitopos del péptido para la inclusión en una vacuna: la aplicación de las técnicas de identificación basadas en el motivo elimina la selección del 90% de los potenciales epitopos en una secuencia de la proteína del antígeno diana. Los péptidos de la presente invención también pueden incluir epitopos que se unen a moléculas DR de MHC clase II. Existe una diferencia significativa entre las moléculas de HLA clase I y clase II. Esta diferencia corresponde al hecho de que, si bien existe una restricción de tamaño estricta y de la posición del motivo con respecto al sitio de unión para los péptidos que se unen a las moléculas de clase I, existe un mayor grado de heterogeneidad tanto en el tamaño como la posición del marco de unión del motivo, con respecto a los extremos N y C terminales, para los ligandos del péptido de clase II. 12 E99924233 27-10-2011   Esta heterogeneidad aumentada de los ligandos del péptido de HLA clase II se debe a la estructura del surco de unión de la molécula de HLA clase II que, a diferencia de su contraparte de clase I, está abierta en ambos extremos. El análisis cristalográfico de los complejos de HLA clase II DRB*0101-péptido mostró que los residuos que ocupan la posición 1 y posición 6 de los péptidos complejados con DRB*0101 comprometen dos sitios complementarios en las moléculas DRBa*0101, con la posición P1 que corresponde al residuo de anclaje más crítico y el sitio hidrófobo más profundo (ver, por ejemplo, Madden, Ann. Rev. Immunol. 13:587 (1995)). Otros estudios también han señalado a la posición P6 como un residuo de anclaje crucial para la unión a otras diversas moléculas de DR. En consecuencia, los péptidos de la presente invención se identifican con cualquiera de varios motivos de aminoácidos específicos para HLA clase I o II (ver, por ejemplo, Tablas I-III de USSN 09/226,775, y 09/239,043). Si la presencia del motivo corresponde a la capacidad de unir a varios antígenos de HLA específicos del alelo se denomina como un supermotivo. Las moléculas de HLA específicas del alelo que se unen a los péptidos que poseen un supermotivo de aminoácido particular se denominan colectivamente como un "supertipo" de HLA. Análogos del péptido estimulador de la respuesta inmune En general, las respuestas de CTL y HTL no se dirigen contra todos los epitopos posibles. Más bien, ellos están restringidos a unos pocos determinantes "inmunodominantes" (Zinkemagel et al., Adv. Immunol. 27: 5159 (1979); Bennink et al., J. Exp. Med. 168:1935-1939 (1988); Rawle et al., J. Immunol. 146: 3977-3984 (1991)). Se ha reconocido que la inmunodominancia (Benacerraf et al., Science 175: 273-279 (1972)) se podría explicar por la capacidad de un epitopo dado de unirse selectivamente a una proteína de HLA particular (teoría de selección determinante) (Vitiello et al., J. Immunol. 131:1635 (1983)); Rosenthal et al., Nature 267: 156-158 (1977)), o son reconocidos selectivamente por la especificidad del TCR existente (receptor celular T) (teoría del repertorio) (Klein, Immunology, The Science of Self on self Discrimination, pp. 270-310 (1982)). Se ha demostrado que factores adicionales, en mayor parte ligados a los eventos de procesamiento, también pueden cumplir un papel clave en el establecimiento, más allá de la inmunogenicidad estricta, de cuál de los diversos determinantes potenciales se presentará como inmunodominante (Sercarz et al., Annu. Rev. Immunol. 11:729-766 (1993)). El concepto de dominancia y subdominancia es relevante para la inmunoterapia de las enfermedades infecciosas y cáncer. Por ejemplo, en el curso de la enfermedad viral crónica, puede ser importante el reclutamiento de epitopos subdominantes para la eliminación exitosa de la infección, especialmente si las especificidades de CTL o HTL dominantes se han inactivado por tolerancia funcional, supresión, mutación de virus y otros mecanismos (Franco et al., Curr. Opin. Immunol. 7:524-53120 (1995)). En el caso del cáncer y los antígenos tumorales, los CTL que reconocen al menos algunos de los péptidos de unión de afinidad más alta se podrían inactivar funcionalmente. Los péptidos de afinidad de unión más baja se reconocen con preferencia en estos momentos y en consecuencia se pueden preferir en las vacunas anti-cáncer terapéuticas o profilácticas. En particular, se ha observado que un número significativo de epitopos derivados de antígenos asociados con tumores no virales conocidos (TAA) se unen a HLA clase I con afinidad intermedia (IC50 en el intervalo de 50-500 nM). Por ejemplo, se ha hallado que 8 de 15 péptidos TAA conocidos reconocidos por los linfocitos infiltrantes de tumor (TIL) o CTL se unen en el intervalo de 50-500 nM. (Estos datos están en contraste con las estimaciones de que 90% de los antígenos virales conocidos se unieron con moléculas de HLA de clase I con IC50 de 50 nM o menos, mientras que solo aproximadamente 10% se unieron en un intervalo de 50-500 nM (Sette et al., J. Immunol., 153:558-5592 (1994)). En el establecimiento del cáncer este fenómeno se debe probablemente a la eliminación, o inhibición funcional de los CTL que reconocen varios de los péptidos de unión más alta, presumiblemente debido a los eventos de tolerización de las células B. Sin pretender estar ligado por la teoría, se considera que ya que las células T para los epitopos dominantes se pueden haber suprimido clonalmente, la selección de los epitopos subdominantes puede permitir el reclutamiento de las células T existentes, que a continuación conducirá a una respuesta terapéutica o profiláctica. Sin embargo, la unión de las moléculas de HLA a los epitopos subdominantes a menudo es menos vigorosa que la de los dominantes. Por consiguiente, se necesita poder modular la afinidad de unión de los epitopos inmunogénicos particulares para una o más moléculas de HLA, y de este modo modular la respuesta inmune inducida por el péptido, por ejemplo para preparar péptidos análogos que inducen una respuesta más vigorosa. Esta capacidad puede aumentar mucho la utilidad de las vacunas basadas en péptido y los agentes terapéuticos. En consecuencia, si bien los péptidos con reactividad cruzada adecuada entre todos los alelos de una superfamilia se identifican por los procedimientos de detección descritos anteriormente, la reactividad cruzada no siempre es tan completa como sea posible y en ciertos casos pueden ser útiles los procedimientos para aumentar la reactividad cruzada de los péptidos; más aún, tales procedimientos también se pueden usar para modificar otras propiedades de los péptidos tales como afinidad de unión o estabilidad del péptido. Habiendo establecido las reglas generales que rigen la reactividad cruzada de los péptidos para los alelos de HLA dentro de un motivo o supermotivo dado, se puede realizar la modificación (es decir, equivalente) de la estructura de los péptidos de interés particular a fin de obtener una capacidad de unión a HLA más amplia (o modificada de otro modo). Más específicamente, los péptidos que exhiben los patrones de reactividad cruzada más amplia, se pueden producir de acuerdo con las enseñanzas de la presente. Los presentes conceptos relacionados con la generación de análogos se exponen con mayor detalle en el documento USSN 09/226.775 en trámite. 13 E99924233 27-10-2011   En breves palabras, la estrategia empleada utiliza los motivos o supermotivos que correlacionan con la unión a ciertas moléculas de HLA clase I y II. Los motivos o supermotivos se definen por tener anclajes primarios, y en muchos casos anclajes secundarios (ver Tablas I-III del documento USSN 09/226,775). Los péptidos análogos se pueden crear por la sustitución de residuos de aminoácidos en el anclaje primario, anclaje secundario, o en las posiciones de los anclajes primario y secundario. En general, los análogos se obtienen para los péptidos que ya portan un motivo o supermotivo. Los residuos del anclaje secundario preferidos de los supermotivos y motivos que se han definido para los péptidos de unión de HLA clase I y clase II se muestran en la Tablas II y III, respectivamente, del documento USSN 09/226.775. Para numerosos motivos o supermotivos de acuerdo con la invención, se definen los residuos que son perjudiciales para la unión a las moléculas de HLA específicas del alelo o miembros de los supertipos de HLA que se unen al respectivo motivo o supermotivo (ver Tablas II y III del documento USSN 09/226.775). Por consiguiente, la eliminación de tales residuos que son perjudiciales para la unión se puede realizar de acuerdo con los procedimientos descritos en esta. Por ejemplo, en el caso del supertipo A3, cuando todos los péptidos que tienen tales residuos perjudiciales se eliminan de la población de péptidos analizados, la incidencia de reactividad cruzada aumenta de 22% a 37% (I., Sidney et al., Hu. Immunol. 45:79 (1996)). En consecuencia, una estrategia para aumentar la reactividad cruzada de los péptidos dentro de un supermotivo dado es simplemente suprimir uno o más de los residuos perjudiciales presentes dentro de un péptido y sustituir un residuo "neutro" pequeño tal como Ala (que puede no influir en el reconocimiento de las células T del péptido). Se espera una probabilidad aumentada de reactividad cruzada si, junto con la eliminación de residuos perjudiciales dentro de péptido, se insertan residuos "preferidos" asociados con unión de alta afinidad a una molécula de HLA específica del alelo o a múltiples moléculas de HLA dentro de una superfamilia. Para asegurar que un péptido análogo, cuando se usa como una vacuna, induce realmente una respuesta de CTL en el epitopo nativo in vivo (o, en el caso de los epitopos de clase II, una falla para inducir las células T auxiliares que reacciona en forma cruzada con los péptidos tipo salvaje), el péptido análogo se puede usar para inmunizar las células T in vitro de individuos del alelo de HLA apropiado. A partir de este momento, se evalúa la capacidad de las células inmunizadas de inducir la lisis de las células sensibilizadas con el péptido de tipo salvaje. En los sistemas de clase I y clase II será conveniente usar como dianas, las células que han sido infectadas o transfectadas con los genes apropiados para establecer si el antígeno producido en forma endógena también es reconocido por las células T relevantes. Otra realización de la invención es crear análogos de los péptidos de unión débil, para asegurar de este modo las cantidades adecuadas de ligadores celulares con reactividad cruzada. Los péptidos clase I que exhiben afinidades de unión de 500-50000 nM, y portan un residuo de anclaje primario aceptable pero subóptimo en una o ambas posiciones se pueden "fijar" por la sustitución de los residuos de anclaje preferidos de acuerdo con el supertipo respectivo. Los péptidos análogos posteriormente se pueden analizar para determinar la actividad de unión cruzada. Otra realización para generar análogos de péptidos efectivos involucra la sustitución de residuos que presentan un impacto adverso sobre la estabilidad o solubilidad del péptido en, por ejemplo, un ambiente líquido. Esta sustitución puede ocurrir en cualquier posición del epitopo del péptido. Por ejemplo, una cisteína (C) se puede sustituir a favor de ácido gamma-amino butírico. Debido a su naturaleza química, la cisteína tiene propensión a formar puentes disulfuro y alterar suficientemente el péptido en forma estructural de modo que se reduce la capacidad de unión. La sustitución con ácido gamma-amino butírico de C no solo alivia este problema, sino que mejora realmente la capacidad de unión y unión cruzada en ciertos casos (Sette et al, In: Persistent Viral Infections (Ahmed & Chen, eds., 1998)). La substitución de cisteína con ácido gamma-amino butírico puede ocurrir en cualquier residuo de un epitopo del péptido, es decir, en posiciones de anclaje o no anclaje. Vectores de expresión y construcción de un minigén Los vectores de expresión de la invención contienen al menos un elemento promotor que es capaz de expresar una unidad de transcripción que codifica el antígeno de interés, por ejemplo, un epitopo de MHC clase I o un epitopo de MHC clase II y una secuencia dirigida a MHC en las células apropiadas de un organismo de modo que el antígeno se expresa y dirige a la molécula de MHC apropiada. Por ejemplo, si el vector de expresión se administra a un mamífero tal como un ser humano, un elemento promotor que funciona en una célula humano se incorpora en el vector de expresión. Un ejemplo de un vector de expresión útil para la expresar los epitopos de MHC de clase II fusionados a las secuencias dirigidas a los epitopos de MHC clase II y MHC de clase I descriptos en la presente memoria es el vector de pEP2 descrito en el Ejemplo IV. Esta invención depende de las técnicas de rutina en el campo de la genética recombinante. Los textos básicos que divulgan los procedimientos de uso generales en esta invención incluyen Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed. 1989); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); y Current Protocols in Molecular Biology (Ausubel et al., eds., 1994); Oligonucleotide Synthesis: A Practical Approach (Gait, ed., 1984); Kuijpers, Nucleic acids Research 18(17):5197 (1994); Dueholm, J. Org. Chem. 59:5767-5773 (1994); Methods in Molecular Biology, volumen 20 (Agrawal, ed.); y Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology-- Hybridization with Nucleic Acids Probes, por ejemplo, Parte I, capítulo 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" (1993)). 14 E99924233 27-10-2011   Los minigenes están compuestos de dos o varios epitopos diferentes (ver, por ejemplo, Tablas 1-8). El ácido nucleico que codifica los epitopos se ensambla en un minigén de acuerdo con técnicas estándares. En general, las secuencias de ácidos nucleicos que codifican los epitopos del minigén se aíslan mediante técnicas de amplificación con cebadores de oligonucleótido o se sintetizan químicamente. También se pueden usar técnicas de clonación recombinante cuando sea apropiado. Se seleccionan secuencias de oligonucleótidos que amplificar (cuando se usa PCR para ensamblar el minigén) o codificar (cuando se usan oligonucleótidos sintéticos para ensamblar el minigén) los epitopos deseados. Las técnicas de amplificación que usan cebadores se usan normalmente para amplificar y aislar secuencias que codifican los epitopos de elección de ADN o ARN (ver patentes U.S. 4.683,195 y 4.683.202; PCR Protocols: A Guide to Methods ands y Applications (Innis et al., eds, 1990)). Se pueden usar procedimientos tales como la reacción en cadena de polimerasa (PCR) y reacción en cadena de ligasa (LCR) para amplificar las secuencias de ácidos nucleicos del epitopo directamente del ARNm, del ADNc, de las bibliotecas genómicas o bibliotecas de ADNc. Los sitios de endonucleasa de restricción se pueden incorporar en los cebadores. Los minigenes amplificados por la reacción de PCR se pueden purificar a partir de los geles de agarosa y se clonan en un vector apropiado. Los oligonucleótidos sintéticos también se pueden usar para construir minigenes. Este procedimiento se realiza mediante una serie de oligonucleótidos superpuestos, que representan tanto las cadenas sentido como no sentido del gen. Estos fragmentos de ADN a continuación se aparean, ligan y clonan. Los oligonucleótidos que no están disponibles en el comercio se pueden sintetizar químicamente de acuerdo con el procedimiento de triéster de fosforamidita en fase sólida descrito primero por Beaucage & Caruthers, Tetrahedron13EP 1 078 092 B1Letts. 22:1859-1862 (1981), por medio de un sintetizador automatizado, como se describe en Van Devanter et. al., Nucleic Acids Res. 12:6159-6168 (1984). La purificación de los oligonucleótidos se realiza por electroforesis en gel de acrilamida nativo o por HPLC de intercambio aniónico como se describe en Pearson & Reanier, J. Chrom. 255:137- 149 (1983). Los epitopos del minigén normalmente se subclonan en un vector de expresión que contiene un promotor fuerte para dirigir la transcripción, así como otras secuencias regulatorias tales como potenciadores y sitios de poliadenilación. Los promotores adecuados son bien conocidos en la técnica y se describen, por ejemplo, en Sambrook et al. y Ausubel et al. Los sistemas de expresión eucarióticos para las células de mamífero son bien conocidos en la técnica y están disponibles en el comercio. Tales elementos promotores incluyen por ejemplo, citomegalovirus (CMV), virus de sarcoma Rous LTR y SV40. El vector de expresión normalmente contiene una unidad de transcripción o casete de expresión que contiene todos los elementos adicionales necesarios para la expresión del minigén en las células huésped. El casete de expresión atípico contiene de este modo un promotor unido operativamente al minigén y señales requeridas la poliadenilación eficiente del transcripto. Los elementos adicionales del casete pueden incluir potenciadores e intrones con sitios dadores y aceptores de empalme funcionales. Además de una secuencia promotora, el casete de expresión también puede contener una región de terminación de la transcripción corriente abajo del gen estructural para proporcionar la terminación eficiente. La región de terminación se puede obtener del mismo gen que la secuencia promotora o se puede obtener de genes diferentes. El vector de expresión particular usado para transportar la información genética en la célula no es particularmente crítica. Se puede usar cualquiera de los vectores convencionales usados para la expresión en células eucarióticas. Los vectores de expresión que contienen elementos regulatorios de los virus eucarióticos se usan normalmente en vectores de expresión eucarióticos, por ejemplo, vectores SV40, vectores del virus de papiloma, y vectores derivados del virus de Epstein Bar. Otros ejemplos de vectores eucarióticos incluyen pMSG, pAV009/A+, pMT010/A+, pMAMneo-5, baculovirus pDSVE, y cualquier otro vector que permite la expresión de las proteínas bajo la dirección del promotor temprano de SV40, promotor tardío de SV40, promotor de metalotioneína, promotor del virus del tumor mamario murino, promotor del virus de sarcoma Rous, promotor de polihedrina, u otros promotores que se muestran como efectivos para la expresión en células eucarióticas. En una realización, se usa el vector pEP2 en la presente invención. Otros elementos que normalmente se incluyen en los vectores de expresión también incluyen un replicón que actúa en E. coli, un gen que codifica la resistencia a antibióticos para permitir la selección de las bacterias que albergan los plásmidos recombinantes, y sitios de restricción únicos en regiones no esenciales del plásmido para permitir la inserción de las secuencias eucarióticas. El gen de resistencia antibiótica particular elegido no es crítico, cualquiera de los diversos genes conocidos en la técnica son adecuados. Las secuencias procarióticas se eligen preferentemente de modo que no interfieran en la replicación del ADN en las células eucarióticas, si fuera necesario. Administración in vivo La invención también permite procedimientos para estimular una respuesta inmune por la administración de un vector de expresión de la invención a un individuo. La administración de un vector de expresión de la invención para estimular una respuesta inmune es ventajosa porque los vectores de expresión de la invención dirigen los epitopos de MHC a las moléculas de MHC, de este modo aumenta la cantidad de CTL y HTL activados por los antígenos E99924233 27-10-2011   codificados por el vector de expresión. En forma inicial, los vectores de expresión de la invención se identifican en ratón para determinar los vectores de expresión que tienen actividad óptima para estimular una respuesta inmune deseada. En consecuencia los estudios iniciales se llevan a cabo, cuando sea posible, con genes de ratón de las secuencias dirigidas a MHC. Los procedimientos de determinar la actividad de los vectores de expresión de la invención son bien conocidos en la técnica e incluyen, por ejemplo, la absorción de 3 H-timidina para medir las activación de las células T y la liberación de 51 Cr para medir la actividad de CTL como se describe a continuación en los Ejemplos II y III. Los experimentos similares a los descriptos del Ejemplo IV se realizan para determinar los vectores de expresión que tienen actividad en la estimulación de una respuesta inmune. Los vectores de expresión que tienen actividad se analizan adicionalmente en seres humanos. Para evitar las potenciales respuestas inmunológicas adversas en las secuencias de ratón codificadas, los vectores de expresión que tienen actividad se modifican de modo que las secuencias dirigidas a MHC de clase II se derivan de los genes humanos. Por ejemplo, la sustitución de las regiones análogas de los homólogos humanos de los genes que contienen varias secuencias dirigidas a MHC de clase II se sustituyen en los vectores de expresión de la invención. Los ejemplos de tales homólogos humanos de los genes que contienen secuencias dirigidas a MHC clase II se muestran en las Figuras 12 a 17. Los vectores de expresión que contienen secuencias dirigidas a MHC clase II humanas, tales como las que se describen en el siguiente Ejemplo I, se analizan para determinar la actividad en la estimulación de una respuesta inmune en los seres humanos. La invención también proporciona composiciones farmacéuticas que comprenden un portador farmacéuticamente aceptable y un vector de expresión de la invención. Los portadores farmacéuticamente aceptables son bien conocidos en la técnica e incluyen soluciones acuosas o no acuosas, suspensiones y emulsiones, que incluyen solución salina regulada fisiológicamente, alcohol/soluciones acuosas u otros solventes o vehículos tales como glicoles, glicerol, aceites tales como aceite de oliva o ésteres orgánicos inyectables. Un portador farmacéuticamente aceptable puede contener compuestos fisiológicamente aceptables que actúan, por ejemplo, para estabilizar el vector de expresión o aumentar la absorción del vector de expresión. Tales compuestos fisiológicamente aceptables incluyen, por ejemplo, carbohidratos, tales como glucosa, sacarosa o dextranos, antioxidantes tales como ácido ascórbico o glutatión, agentes quelantes, polipéptidos de bajo peso molecular, agentes antimicrobianos, gases inertes u otros estabilizantes o excipientes. Los vectores de expresión se pueden complejar adicionalmente con otros componentes tales como péptidos, polipéptidos y carbohidratos. Los vectores de expresión también se pueden complejar con partículas o perlas que se pueden administrar a un individuo, por ejemplo, por medio de una pistola de vacunación. Los expertos en la técnica pueden saber que la elección de un portador farmacéuticamente aceptable, que incluye un compuesto fisiológicamente aceptable, depende, por ejemplo, de la vía administración del vector de expresión. La invención además posibilita procedimientos de administración de una composición farmacéutica que comprende un vector de expresión de la invención para estimular una respuesta inmune. Los vectores de expresión se administran por procedimientos bien conocidos en la técnica como se describen por Donnelly et al. (Ann. Rev. Immunol. 15: 617-648 (1997)); Felgner et al. (Patente U.S. Núm. 5.580.859, expedida el 3 de diciembre de 1996); Felgner (Patente U.S. Núm. 5.703.055, expedida el 30 de diciembre de 1997); y Carson et al. (Patente U.S. Núm. 5.679.647, expedida el 21 de octubre de 1997), cada una de las cuales se incorpora en la presente memoria por referencia. En una realización, el minigén se administra como ácido nucleico desnudo. Una composición farmacéutica que comprende un vector de expresión de la invención se puede administrar para estimular una respuesta inmune en un sujeto por varias vías que incluyen, por ejemplo, oral, intravaginal, rectal, o parenteral, tales como intravenosa, intramuscular, subcutánea, intraorbital, intracapsular, intraperitoneal, intracisternal o por absorción pasiva o facilitada a través de la piel por medio de, por ejemplo, un parche cutáneo o iontoforesis transdérmica, respectivamente. Además, la composición se puede administrar por inyección, intubación o por vía tópica, esta última puede ser pasiva, por ejemplo, por aplicación directa de un ungüento o polvo, o activa, por ejemplo, mediante un spray nasal o inhalante. Un vector de expresión también se puede administrar como un spray tópico, en tal caso un componente de la composición es un propelente apropiado. La composición farmacéutica también se puede incorporar, si se desea, en liposomas, microesferas u otra matrices poliméricas (Felgner et al., Patente U.S. Núm. 5.703.055; Gregoriadis, Liposome Technology, Vols. I to III (2nd ed. 1993)). Los liposomas, por ejemplo, que consisten en fosfolípidos u otros lípidos, son portadores no tóxicos, fisiológicamente aceptables y metabolizables que son relativamente simples de preparar y administrar. Los vectores de expresión de la invención se pueden administrar en los espacios intersticiales de los tejidos de un organismo animal (Felgner et al., Patentes U.S. Núm. 5.580.859 y 5.703.055). La administración de los vectores de expresión de la invención al músculo es un procedimiento de administración particularmente efectivo, que incluye inyecciones intradérmicas y subcutáneas y la administración transdérmica. La administración transdérmica, tal como por iontoforesis, también es un procedimiento efectivo para administrar vectores de expresión de la invención al músculo. También se puede emplear la administración epidérmica de los vectores de expresión de la invención. La administración epidérmica involucra la irritación mecánica o química de la capa más externa de la epidermis para estimular una respuesta inmune al irritante (Carson et al., Patente U.S. Núm. 5.679.647). Otros procedimientos efectivos de administrar un vector de expresión de la invención para estimular una respuesta 16 E99924233 27-10-2011   inmune incluye la administración en mucosa (Carson et al., Patente U.S. Núm. 5.679.647). Para la administración en la mucosa, el procedimiento de administración más efectivo incluye la administración intranasal de un aerosol apropiado que contiene el vector de expresión y una composición farmacéutica. Los supositorios y preparaciones tópicas también son efectivos para la administración de los vectores de expresión en los tejidos de la mucosa genital, vaginal y sitios oculares. En forma adicional, los vectores de expresión se pueden complejar con partículas y administrar con una pistola de vacunación. La dosis que se administra es dependiente del procedimiento de administración y en general estará entre aproximadamente 0,1 µg a aproximadamente 200 µg. Por ejemplo, la dosis puede ser de aproximadamente 0,05 µg/kg a aproximadamente 50 mg/kg, en particular aproximadamente 0,005-5 mg/kg. Una dosis efectiva se puede determinar, por ejemplo, por la medición de la respuesta inmune después de la administración de un vector de expresión. Por ejemplo, la producción de anticuerpos específicos para los epitopos de MHC de clase II o epitopos de MHC de clase I codificados por el vector de expresión se puede medir por procedimientos bien conocidos en la técnica, que incluyen ELISA u otros ensayos inmunológicos. Además, la activación de las células T auxiliares o una respuesta de CTL se puede medir por procedimientos bien conocidos en la técnica que incluyen, por ejemplo, al captación de 3 H-timidina para medir la activación de las células T y la liberación de 51 Cr para medir la actividad de CTL (ver los siguientes Ejemplos II y III). Las composiciones farmacéuticas que comprenden un vector de expresión de la invención se pueden administrar a los mamíferos, en particular seres humanos, para fines profilácticos o terapéuticos. Los ejemplos de enfermedades que se pueden tratar o prevenir por medio de los vectores de expresión de la invención incluyen la infección con VIH así como el síndrome de inmunodeficiencia adquirida (SIDA). En aplicaciones terapéuticas, los vectores de expresión de la invención se administran a un individuo que ya padece de cáncer, enfermedad autoinmune o está infectado con un virus. Los que están en fase de incubación o fase aguda de la enfermedad se pueden tratar con vectores de expresión de la invención, que incluyen los que expresan todos los epitopos de MHC clase II universal, por separado o en conjunto con otros tratamientos, según sea apropiado. En aplicaciones terapéuticas y profilácticas, las composiciones farmacéuticas que comprenden los vectores de expresión de la invención se administran a un paciente en una cantidad suficiente para inducir una respuesta inmune efectiva para un antígeno y para mejorar los signos o síntomas de una enfermedad. La cantidad del vector de expresión para administrar que es suficiente para mejorar los signos o síntomas de una enfermedad se denomina dosis terapéuticamente efectiva. La cantidad del vector de expresión suficiente para obtener una dosis terapéuticamente efectiva dependerá de la composición farmacéutica que comprende un vector de expresión de la invención, la manera de administración, el estado y gravedad de la enfermedad tratada, el peso y estado general de salud del paciente y el criterio del médico que los prescribe. Si bien la precedente invención se ha descrito con algún detalle a modo de ilustración y ejemplo a los fines de claridad de comprensión, será fácilmente evidente para los expertos en la técnica a luz de las enseñanzas de esta invención que se pueden realizar ciertos cambios y modificaciones sin apartarse del espíritu o alcance de las reivindicaciones anexas. Ejemplos El siguiente ejemplo se proporciona solo a modo de ilustración y no a manera de limitación. Los expertos en la técnica reconocerán fácilmente una variedad de parámetros no críticos que se pueden cambiar o modificar para producir resultados esencialmente similares. Ejemplo I: Construcción de los vectores de expresión que contienen los epitopos de MHC de Clase II Este ejemplo muestra la construcción de vectores de expresión que contienen epitopos de MHC de clase II que se pueden usar para dirigir antígenos a las moléculas de MHC clase II. Los vectores de expresión que comprenden constructos de ADN se prepararon por medio de oligonucleótidos superpuestos, reacción en cadena de polimerasa (PCR) y técnicas de biología molecular estándar (Dieffenbach & Dveksler, PCR Primer: A Laboratory Manual (1995); Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed., 1989), cada una de los cuales incorpora en la presente memoria por referencia). Para generar Ii de tipo salvaje de longitud completa, la cadena no variante de longitud completa se amplificó, clonó y secuenció y se usó en la construcción de los tres constructos de la cadena no variante. Excepto cuando sea indicado, la fuente de ADNc para todos los constructos listados a continuación fue ADNC de bazo de ratón Marathon-Ready de machos Balb/c (Clontech; Palo Alto CA). Los pares de cebadores fueron el oligonucleótido GCTAGCGCCGCCACCATGGATGACCAACGCGACCTC (SEQ ID NO: 40), que se designa murIi-F y contiene un sitio Nhel seguido por la secuencia de Kozak de consenso y el extremo 5 del ADNc Ii; y el oligonucleótido GGTACCTCACAGGGTGACTTGACCCAG (SEQ ID NO: 41), que se denomina murIi-R y contiene un sitio KpnI y el extremo 3 de la secuencia codificadora Ii. Para la reacción de PCR, se combinaron 5 µl de ADNc de bazo y 250 nM de cada cebador en una reacción de 100 17 E99924233 27-10-2011   µl con 0,25 mM de cada dNTP y 2,5 unidades de Pfu polimerasa en buffer de Pfu polimerasa que contiene 10 mM de KCl, 10 mM de (NH4)2SO4, 20 mM de Tris-cloruro, pH 8,75, 2 mM de MgSO4, 0,1% de TRITON X-100 y 100 µg/ml de albúmina sérica bovina (BSA). Se usó una máquina de PCR Perkin/Elmer 9600 (Perkin Elmer; Foster City CA) y las condiciones de ciclado fueron: 130 ciclos de 95°C d urante 5 minutos, seguido por 30 ciclos de 95°C dur ante 15 segundos, 52°C durante 30 segundos, y 72°C durante 1 minuto. La reacción de PCR se corrió en un gel de agarosa 1%, y se cortó el producto de 670 pares de bases, se purificó por centrifugación a través de un filtro Millipore Ultrafree-MC (Millipore; Bedford MA) y se clonó en pCR-Blunt de Invitrogen (San Diego, CA). Los clones individuales se identificaron por secuenciación y se usó un clon correcto (denominado bli#3) como molde para los constructos auxiliares. Se prepararon los constructos de ADN que contienen las secuencias del epitopo pan DR y las secuencias dirigidas a MHC II derivadas de la proteína Ii. La proteína murina Ii se ha descrito previamente (Zhu & Jones, Nucleic Acids Res. 17:447-448 (1989)), que se incorpora en la presente memoria por referencia. En breves palabras, el IiPADRE contiene la secuencia Ii de longitud completa con PADRE que reemplaza precisamente la región CLIP. El constructo de ADN codifica los aminoácidos 1 a 87 de la cadena no variante, seguido por 13 aminoácido de la secuencia PADRE (SEQ ID NO:38) y el resto de la secuencia de ADN de la cadena no variante (aminoácidos 101-215). El constructo se amplificó en 2 mitades superpuestas que se unieron para producir el constructo final. Los dos cebadores usados para amplificar la mitad 5 fueron murIi-F y el oligonucleótido CAGGGTCCAGGCAGCCACGAACTTGGCCACAGGTTTGGCAGA (SEQ ID NO:42), que se denomina IiPADRE-R. El cebador IiPADRE-R incluye los nucleótidos 303-262 de IiPADRE. La mitad 3 se amplificó con el cebador GGCTGCCTGGACCCTGAAGGCTGCCGCTATGTCCATGGATAAC (SEQ ID NO:43), que se denomina IiPADRE-F e incluye los nucleótidos 288-330 de IiPADRE; y murIi-R. Las condiciones de PCR fueron las mismas que se describieron anteriormente, y las dos mitades se aislaron por electroforesis en gen de agarosa como se describió anteriormente. Se combinaron diez microlitros de cada producto de PCR en 100 µl de una reacción de PCR con una temperatura de apareamiento de 50°C durante cinco ciclos para gene rar un molde de longitud completa. Se añadieron los cebadores murIi-F y murIi-R y se llevaron a cabo más ciclos. El producto IiPADRE de longitud completa se aisló, clonó, y secuenció como se describió anteriormente. Este constructo contiene el gen Ii murino con una secuencia del epitopo pan DR sustituido con la secuencia CLIP de Ii (Figura 1). Se construyó un constructo de ADN, denominado I80T, que contiene el dominio citoplasmático, el dominio de transmembrana y parte del dominio luminal de Ii fusionado a una cadena de múltiples epitopos de MHC de clase II (Figura 2). En breves palabras, la cadena de múltiples epitopos de MHC de clase II se construyó con tres oligonucleótidos superpuestos (oligos). Cada oligo superpuesto a su vecino por 15 nucleótidos y el epitopo final de la cadena MHC clase II se ensambló por la extensión de los oligonucleótidos superpuestos entres conjuntos de reacciones por medio de PCR. Los tres oligonucleótidos fueron: oligo 1, nucleótidos 241-310, oligo 2, nucleótidos 364-295, y oligo 3, nucleótidos 350-42, Para la primera reacción de PCR, 5 µg de oligos 1 y 2 se combinaron en 100 µl de una reacción que contiene Pfu polimerasa. Se usó una máquina de PCR Perkin/Elmer 9600 y la temperatura de apareamiento usada fue 45°C. El producto de PCR se purificó en gel, y en una segunda reacción que contiene el producto de PCR se aparearon los oligos 1 y 2 con el oligo 3 y extendieron durante 10 ciclos antes de la purificación en gel del producto de longitud completa que se usará como un "mega-cebador". El constructo 180T se obtuvo por la amplificación bIi#3 con murIi-F y el mega-cebador. Las condiciones de ciclado fueron: 1 ciclo de 95°C durante 5 minutos, seguido por 5 ciclos de 95°C durante 15 segundos, 37°C dura nte 30 segundos, y 72°C durante 1 minuto. Se añadió cebador Help-epR y se realizaron 25 ciclos adicionales con la 18 E99924233 27-10-2011   temperatura de apareamiento elevada a 47°C. El ceba dor Help-epR GGTACCTCAAGCGGCAGCCTTCAGGGTCCAGGCA (SEQ ID NO:47) corresponde a los nucleótidos 438-405. El producto de I80T longitud completa se aisló, clonó, y secuenció como anteriormente. El constructo 180T (Figura 2) codifica los residuos de aminoácidos 1 a 80 de Ii, que contiene el dominio citoplásmico, el dominio de transmembrana y parte del dominio luminal, fusionados a una cadena de múltiples epitopos de MHC de clase II que corresponden a: residuos de aminoácidos 323-339 de ovoalbúmina (IleSerGlnAlaValHisAlaAlaHisAlaGluIleAsnGluAlaGlyArg; SEQ ID NO:48); residuos de aminoácidos 128 a 141 del antígeno del núcleo de HBV (aminoácidos ThrProProAlaTyrArgProProAsnAlaProIleLeu; SEQ ID NO: 49); residuos de aminoácidos 182 a 196 de HBV env (aminoácidos PhePheLeuLeuThrArgIleLeuThr-35 IleProGlnSerLeuAsp; SEQ ID NO:50); y la secuencia de pan DR denominada SEQ ID NO:38. Se generó un constructo de ADN que contiene el dominio citoplasmático, dominio de transmembrana y una porción del dominio luminal de Ii fusionados a la cadena del epitopo de MHC clase II que se muestra en la Figura 2 y los residuos de aminoácidos 101 a 215 de Ii que codifican la región de trimerización de Ii (Figura 3). Este constructo, denominado IiThfull, codifica los primeros 80 aminoácidos de la cadena no variante seguidos por la cadena del epitopo de MHC clase II (que reemplaza los CLIP) y el resto de la cadena no variante (aminoácidos 101-21 S). En breves palabras, el constructo se generó como dos mitades superpuestas que se aparearon y extendieron por PCR para producir el producto final. El extremo 5 de IiThfull se obtuvo por la amplificación I80T con murIi-F (SEQ ID NO:40) y Th-Pad-R. El cebador Th- Pad-R AGCGGCAGCCTTCAGGGTC (SEQ ID NO:51) corresponde a los nucleótidos 429-411. La mitad 3 se obtuvo por la amplificación de bIi#3 con IiPADRE-F y murIi-R (SEQ ID NO: 41). El cebador IiPADRE-F GGCTGCCTGGACCCTGAAGGCTGCCGCTATGTCCATGGATAAC (SEQ ID NO:52) corresponde a los nucleótidos 402-444. Cada producto de PCR se purificó en gel y se mezcló, a continuación se desnaturalizó, apareó y extendió por cinco ciclos de PCR. Se añadieron los cebadores murIi-F (SEQ ID NO: 40) y murIi-R (SEQ ID NO:41) y se realizaron otros 25 ciclos. El producto de longitud completa se purificó en gel, clonó y secuenció. Todos los constructos restantes que se describen a continuación se obtuvieron esencialmente de acuerdo con el esquema mostrado en la Figura 18. En breves palabras, los pares de cebadores 1F más 1R, designados a continuación para cada constructo específico, se usaron para amplificar la secuencia señal específica y contenían una cola de 15 pares de bases superpuestos idénticas al extremo 5 de la cadena del epitopo de MHC clase II. El par cebador Th-ova-F, ATCAGCCAGGCTGTGCACGC (SEQ ID NO:53), más Th-Pad-R (SEQ ID NO:51) se usaron para amplificar la cadena del epitopo de MHC clase II. Una superposición de 15 pares de bases y la cola de transmembrana y citoplásmica específica que contienen las señales de direccionamiento se amplificaron con los pares de cebadores 2F más 2R. Los tres trozos de cada ADNc se amplificaron mediante las siguientes condiciones: 1 ciclo de 95°C duran te 5 minutes, seguido por 30 ciclos de 95°C durante 15 s egundos, 52°C durante 30 segundos, y 72°C durante 1 minuto. Cada uno de los fragmentos se purificó en gel de agarosa, y la secuencia señal y los fragmentos de la cadena de MHC clase II se combinaron y unieron por cinco ciclos en una segunda PCR. Después de cinco ciclos, se añadieron los cebadores 1F y Th-Pad-R durante 25 ciclos adicionales y el producto de PCR se purificó en gel. Esta secuencia señal más el fragmento de la cadena del epitopo de MHC clase II se combinó con el fragmento de la cola de transmembrana más citoplásmica para la PCR final. Después de cinco ciclos, se añadieron los cebadores 1F más 2R durante 25 ciclos adicionales y el producto se purificó en gel, clonó y secuenció. Se generó un constructo de ADN que contiene la secuencia señal kappa de la inmunoglobulina murina fusionada a la cadena del epitopo auxiliar T mostrado en la Figura 2 y los dominios de transmembrana y citoplasmáticos de LAMP-1 (Figura 4) (Granger et al., J. Biol. Chem. 265: 12036-12043 (1990)), que se incorpora por referencia (LAPP- 1 de ratón, Núm. de acceso GenBank M32015). Este constructo, denominado kappaLAMP-Th, contiene la secuencia señal kappa de la inmunoglobulina de ratón de consenso y se amplificó de un plásmido que contiene inmunoglobulina kappa de longitud completa representada en la figura 18. El cebador 1F usado fue el oligonucleótido denominado KappaSig-F, GCTAGCGCCGCCACCATGGGAATGCAG (SEQ ID NO:54). El cebador 1R usado fue el oligonucleótido denominado Kappa-Th-R, CACAGCCTGGCTGATTCCTCTGGACCC (SEQ ID NO:55). El cebador 2F usado fue el oligonucleótido denominado PAD/LAMP-F, CTGAAGGCTGCCGCTAACAACAT- GTTGATCCCC (SEQ ID NO:56). El cebador 2R usado fue el oligonucleótido denominado LAMP-CYTOR, GGTAC- 15 CCTAGATGGTCTGATAGCC (SEQ ID NO:57). Se generó un constructo de ADN que contiene la secuencia señal de H2-M fusionada la cadena del epitopo de MHC clase II que se muestra en la Figura 2 y los dominios de transmembrana y citoplasmáticos de H2-M (Figura 5). El gen H2-M de ratón se ha descrito previamente, Peleraux et al., Immunogenetics 43:204-214 (1996)), y se incorpora en la presente memoria por referencia. Este constructo se denominó H2M-Th y se construyó como se ilustra en la Figura 18. El cebador 1F usado fue el oligonucleótido denominado H2-Mb-"1F, GCC GCT AGC GCC GCC ACC ATG GCT GCA CTC TGG (SEQ ID NO:58). El cebador 1R usado fue el oligonucleótido denominado H2- Mb-1R, CAC 19 E99924233 27-10-2011   AGC CTG GCT GAT CCC CAT ACA GTG CAG (SEQ ID NO:59). El cebador 2F usado fue el oligonucleótido denominado H2-Mb-2F, CTG AAG GCT GCC GCT AAG GTC TCT GTG TCT (SEQ ID NO:60). El cebador 2R usado fue el oligonucleótido denominado H2-Mb-2R, GCG GGT ACC CTA ATG CCG TCC TTC (SEQ ID NO:61). Se generó el constructo de ADN que contiene la secuencia señal de H2-DO fusionada a la cadena del epitopo de MHC clase II que se muestra en la Figura 2 y los dominios de transmembrana y citoplasmáticos de H2-DO (Figura 6). El gen H2-DO de ratón se ha descrito previamente (Larhammar et al., J. Biol. Chem. 260: 14111-14119 (1985)), el cual se incorpora en la presente memoria por referencia (Acceso GenBank Núm. M19423). Este constructo, denominado H2O-Th, se construyó como se ilustra en la Figura 18. El cebador 1F usado fue el oligonucleótido denominado H2-Ob-1F, GCG GCT AGC GCC GCC ACC ATG30 GGC GCT GGG AGG (SEQ ID N0:62). El cebador 1R usado fue el oligonucleótido denominado H2- Ob-1R, TGC ACA GCC TGG CTG ATG GAA TCC AGC CTC (SEQ ID NO:63). El cebador 2F usado fue el oligonucleótido denominado H2-Ob-2F, CTG AAG GCT GCC GCT ATA CTG AGT GGA GCT (SEQ ID NO:64). El cebador 2R usado fue el oligonucleótido denominado H2-Ob-2R, GCC GGT ACC TCA TGT GAC ATG TCC CG (SEQ ID NO:65). Se genera el constructo de ADN que contiene una secuencia del epitopo pan DR (SEQ ID NO:38) fusionada al extremo amino-terminal de la proteína de la matriz de la gripe (Figura 7). Este constructo, denominado PADREmatriz de gripe, contiene el epitopo de MHC clase II PADRE universal fijado al extremo amino terminal de la secuencia codificadora de la matriz de la gripe. El constructo se obtiene por medio de un cebador largo en el cebador del extremo 5. El cebador del extremo 5 es el oligonucleótidoGCTAGCGCCGCCACCATGGCCAAGTTCGTGGCTGCCTGGACCCTGAAGGCTGCCGCGCTATGA GTCTTCTAACGAGGTCGA (SEQ ID NO: 66). cebador del extremo 3 es el oligonucleótido TTCACTTGAATCGCTGCATCTGCACCCCCA40 (SEQ ID NO:67). El virus de la gripe del America Type Tissue Collection (ATCC) se usa como una fuente para región codificadora de la matriz (Perdue et al. Science 279: 393-396 (1998)), que se incorpora en la presente memoria por referencia (Acceso GenBank Núm. AF036358). Se generó un constructo de ADN que contiene una secuencia del epitopo pan DR (SEQ ID NO: 38) fusionada al extremo amino terminal del antígeno de HBVS (Figura 8). Este constructo se denomina PADRE-HBV-s y se generó por el apareamiento de dos oligonucleótidos superpuestos para añadir PADRE en el extremo amino terminal del antígeno de superficie de la hepatitis B (Michel et al., Proc. Natl. Acad. Sci. USA 81:7708-7712 (1984); Michel et al., Proc. Natl. Acad. Sci. USA 92:5307-5311 (1995)), cada uno de los cuales incorpora en la presente memoria por referencia. Un oligonucleótido fue GCTAGCGCCGCCACCATGGCCAAGTTCG GGCTGCCTGGACCCTGAAGGCTGCCGCTC (SEQ ID NO:68). NO: El segundo oligonucleótido fue CTCGAGAGCGGCAGCCTTCAGGGTCCAGGCAGCCACGAACTTGGCCATGGTGGCGGCG (SEQ ID NO: 69). Cuando se aparearon, los oligos tienen extremos cohesivos NheI y Xhol. Los oligos se calentaron a 100°C y se enfriaron lentamente a temperatura ambiente para aparearse. Un ligamiento de tres partes unió PADRE con un fragmento de XhoI-KpnI que contiene el antígeno HBV-s en los sitios NheI más KpnI del vector de expresión. Se generó un constructo de ADN que contiene la secuencia señal de Ig- fusionada a la cadena del epitopo de MHC clase II que se muestra en la Figura 2 y los dominios de transmembrana y citoplasmáticos de Ig- (Figura 9). El gen de Ig- de ratón se ha descrito previamente (Kashiwamura et al., J. Immunol. 145:337-343 (1990)), que se incorpora en la presente memoria por referencia (Acceso GenBank Núm. M31773). Este constructo, denominado Ig-alfaTh, se construyó como se ilustra en la Figura 18. El cebador 1F usado fue el oligonucleótido denominado Ig alfa-1F, GCG GCT AGC GCC GCC ACC ATG CCA GGG GGT CTA (SEQ ID NO: 70). El cebador 1R usado fue el oligonucleótido denominado Igalfa-1R, GCA CAG CCT GGC TGA TGG CCT GGC ATC CGG (SEQ ID NO:71). El cebador 2F usado fue el oligonucleótido denominado Igalfa-2F, CTG AAG GCT GCC GCT GGG ATC ATC TTG CTG (SEQ ID NO:72). El cebador 2R usado fue el oligonucleótido denominado Igalfa-2R, GCG GGT ACC TCA TGG CTT TTC CAG CTG (SEQ ID NO:73). Se generó un constructo de ADN que contiene la secuencia señal de Ig-ß fusionada a la cadena de MHC clase II que se muestra en la Figura 2 y los dominios de transmembrana y citoplasmáticos de Ig-ß (Figura 10). La secuencia de Ig-ß es el gen B29 de ratón y se ha descrito previamente (Hermanson et al., Proc. Natl. Acad. Sci. USA 85: 6890- 6894 (1988)), el que se incorpora en la presente memoria por referencia (Acceso GenBank Núm. J03857). Este constructo, denominado Ig-betaTh, se construyó como se ilustra en la Figura 18. El cebador 1F usado fue el oligonucleótido denominado B29-1F (33 mer) GCG GCT AGC GCC GCC ACC ATG GCC ACA CTG GTG (SEQ ID NO: 74). El cebador 1R usado fue el oligonucleótido denominado B29-1R (30 mer) CAC AGC CTG GCT GAT CGG CTC ACC TGA GAA (SEQ ID NO:75). El cebador 2F usado fue el oligonucleótido denominado B292F (30 mer) CTG AAG GCT GCC GCT ATT ATC TTG ATC CAG (SEQ ID NO: 76). El cebador 2R usado fue el oligonucleótido denominado B29-2R (27 mer), GCC GGT ACC TCA TTC CTG GCC TGG ATG (SEQ ID NO:77). Se generó un constructo de ADN que contiene la secuencia señal de la secuencia señal de la inmunoglobulina kappa fusionada a la cadena del epitopo de MHC clase II que se muestra en la Figura 2 (Figura 11). Este constructo se denomina SigTh y se generó por medio del constructo kappaLAMP-Th (que se muestra en la Figura 4) y la amplificación con el par cebador KappaSig-F (SEQ ID NO:54) más Help-epR (SEQ ID NO:47) para crear SigTh. SigTh contiene la secuencia señal de la inmunoglobulina kappa fusionada a la Cadena del epitopo T auxiliar y terminó con un codón de detención de la traducción. E99924233 27-10-2011   Los constructos que codifican secuencias humanas que corresponden a los constructos descriptos anteriormente que tienen las secuencias de ratón se preparan por la sustitución de las secuencias humanas con las secuencias de ratón. En breves palabras, para el constructo IiPADRE, que corresponde a la Figura 1, los residuos de aminoácidos 1-80 de la secuencia del gen HLA-DR II humano (Figura 12) (Acceso GenBank Núm. X00497 M14765) se sustituye con las secuencias de ratón II, que se fusionan a PADRE, seguido por los residuos de aminoácidos 114-223 de la cadena no variante HLA-DR. Para el constructo 180T, que corresponde a la Figura 2, los residuos de aminoácidos 1- 80 de la secuencia humana de II son seguidos por una cadena del epitopo de MHC clase II. Para el constructo IiThfull, que corresponde a la Figura 3, los residuos de aminoácidos 1-80 de la secuencia humana de II, que se fusionan a una cadena del epitopo de MHC clase II, son seguidos por los residuos de aminoácidos 114-223 de la cadena no variante humana. Para el constructo LAMP-Th, similar al de la Figura 4, la secuencia señal codificada por los residuos de los aminoácidos 1-19 (nucleótidos 11-67) de LAMP-1 humana (Figura 13) (Acceso GenBank Núm. J04182), que están fusionados a la cadena del epitopo de MHC clase II, son seguidos por la región de transmembrana (nucleótidos 1163-1213) y cola citoplásmica (nucleótidos 1214-1258) codificadas por los residuos de aminoácidos 380-416 de LAMP-1 humano. Para el constructo HLA-DM-Th, que corresponde a la Figura 5, la secuencia señal codificada por los residuos de aminoácidos 1-17 (nucleótidos 1-51) de HLA-DMB humana (Figura 14) (Acceso GenBank Núm. U15085), que están fusionados a la cadena del epitopo de MHC clase II, son seguido por la región de transmembrana (nucleótidos 646- 720) y cola citoplásmica (nucleótidos 721-792) codificadas por los residuos de aminoácidos 216-263 de HLA-DMB humano. Para el constructo HLA-DO-Th, que corresponde a la Figura 6, la secuencia señal codificada por los residuos de aminoácidos 1-21 (nucleótidos 1-63) de HLA-DO humano (Figura 15) (Acceso GenBank Núm. L29472 J02736 N00052), que se fusiona a la cadena del epitopo de MHC clase II, es seguido por la región de transmembrana (nucleótidos 685-735) y cola citoplásmica (nucleótidos 736-819) codificadas por los residuos de aminoácidos 223- 273 de HLA-DO humano. Para el constructo Ig-alfa, que corresponde a la Figura 9, la secuencia señal codificada por los residuos de aminoácidos 1-29 (nucleótidos 1-87) de Ig- MB-1 humana (Figura 16) (Acceso GenBank Núm. U05259), que se fusiona a la cadena del epitopo de MHC clase II, es seguida por la región de transmembrana (nucleótidos 424-498) y cola citoplásmica (nucleótidos 499-6781 codificadas por los residuos de aminoácidos 142-226 de Ig- MB-1 humana. Para el constructo Ig-betaTh, que corresponde a la Figura 10, la secuencia señal codificada por los residuos de aminoácidos 1-28 (nucleótidos 17-100) de Ig-ß B29 humana (Figura 17) (Acceso GenBank Núm. M80461), que se fusiona a la la cadena del epitopo de MAC clase II, es seguida por la región transmembrana (nucleótidos 500-547) y cola citoplásmica (nucleótidos 548-703) codificada por los residuos de aminoácidos 156-229 de human Ig-ß. El constructo SigTh que se muestra en la Figura 11 se puede usar en ratón y ser humano. De modo alternativo, una secuencia señal derivada de un gen humano apropiado que contiene una secuencia señal se puede sustituir con la secuencia kappa de inmunoglobulina de ratón en el kappa secuencia en el constructo SigTh. El constructo de PADRE-matriz de gripe que se muestra en la Figura 7 y el constructo PADRE-HBVs que se muestra en la Figura 8 se pueden usar en ratón y ser humano. Algunos de los constructos de ADN descritos anteriormente se clonaron en el vector pEP2 (Figura 19; SEQ ID N0:35). El vector pEP2 se construyó para contener promotores de CMV duales. El vector pEP2 usó el esqueleto de pADNc3,1 (-)Myc-His A de Invitrogen y pIRES1hyg de Clontech. Se realizaron cambios en ambos vectores antes de mover la unidad de transcripción CMV55 de pIRES1hyg en el vector pADNc modificado. El vector pADNc3,1(-)Myc-HisA (http://www.invitrogen.com) se modificó. En breves palabras, se eliminó el fragmento PvuII (nucleótidos 1342-3508). Se cortó un fragmento BspHI que contiene el gen de resistencia a la ampicilina (nucleótidos 4404-5412). El gen de resistencia a la ampicilina se reemplazó con el gen de resistencia a kanamicina de pUC4K (GenBank1925 acceso #X06404). pUC4K se amplificó con el conjunto cebador: TCTGATGTTACATTGCACAAG (SEQ ID NO:78) (nucleótidos 1621-1601) y GCGCACTCATGATGCTCTGCCAGTGTTACAACC (SEQ ID NO:79) (nucleótidos 682-702 más la adición de un sitio de restricción BspHI en el extremo 5). El producto de PCR se digirió con BspHI y se ligó en el vector digerido con BspHI. Se suprimió la región entre el sitio PmeI del nucleótido 905 y el sitio EcoRV del nucleótido 947. El vector se digirió posteriormente con PmeI (cortes en nucleótido 1076) y ApaI (cortes en el nucleótido 1004), se cargó Klenow en los extremos cohesivos y se ligó. El sitio KpnI del nucleótido 994 se suprimió por digestión con KpnI y se cargó en los extremos con ADN polimerasa Klenow, y se ligó. La secuencia del intrón A de CMV (Acceso GenBank M21295, nucleótidos 635-1461) se añadió por la amplificación del AAN CMV con el conjunto cebador: GCGTCTAGAGTAAGTAC CGCCTATAGACTC (SEQ ID NO: 80) (nucleótidos 635-655 más un sitio XbaI en el extremo 5) y CCGGCTAGCCTGCAGAAAAGACCCATGGAA (SEQ ID NO:81) (nucleótidos 1461-1441 más un sitio NheI en el extremo 3. El producto de PCR se digirió con XbaI y NheI y se ligó en el sitio NheI del vector (nucleótido 895 del vector de pADNc original) de modo que el sitio Nhe esté en el extremo 3 del intrón. 21 E99924233 27-10-2011 Para modificar el vector pIRES1hyg (Acceso GenBank U89672, Clontech), se suprimió el sitio KpnI (nucleótido 911) por corte y cargado con Klenow. El plásmido se cortó con NotI (nucleótido 1254) y XbaI (nucleótido 3196) y se insertó un oligo poliligador en el sitio. El poliligador se formó por el apareamiento de los dos siguientes oligos: y CTAGCGGTACCGGCATTAGTCTATGGCCCGACTCTAGATTTTTTCCTTGC (SEQ ID NO:83). El plásmido resultante se cortó con HincII y el fragmento entre los sitios HincII 234 y 3538 se aisló y se ligó en el vector de pADNc modificado. Este fragmento contiene un promotor de CMV, intrón, poliligador, y señal de poliadenilación. El fragmento pIREShyg y el fragmento de pADNc se combinaron para formar pEP2.El vector pADNc3,1 (-)Myc-His A se digirió parcialmente con PvuII para aislar un fragmento lineal con el corte corriente debajo de la señal de poliadenilación de pADNc (el otro sitio PvuII es el intrón de CMV). El fragmento HincII del vector pIRES1hyg modificado se ligó en el vector cortado PvuII. La señal de poliadenilación del pADNc derivado de la unidad de transcripción se eliminó por digestión con EcoRI (pADNc nucleótido 955) y Xhol (pIRES1hyg nucleótido 3472) y reemplazó con una secuencia de poliadenilación sintética. La señal de poliadenilación sintética se describió en Levitt et al., Genes and Development 3:1019-1025 (1989)). Dos oligos se aparearon para producir un fragmento que contenía un poliligador y señal de poliadenilación con extremos cohesivos EcoRI y XhoI. Los oligos fueron: y   El vector resultante se denomina pEP2 y contiene dos unidades de transcripción separadas. Ambas unidades de transcripción usan el mismo promotor de CMV pero cada uno contiene diferentes intrón, poliligador, y secuencias de poliadenilación. El vector pEP2 contiene dos unidades de transcripción. La primera unidad de transcripción contiene el promotor de CMV inicialmente a partir de pADNc (nucleótidos 210-862 en la Figura 19), secuencia del intrón A CMV (nucleótidos 900-1728 en la Figura 19), sitio de clonación del poliligador (nucleótidos 1740-1760 en la Figura 19) y señal de poliadenilación sintética (nucleótidos 1764-1769 en la Figura 19). La segunda unidad de transcripción, que inicialmente se derivó de pIRES1hyg, contiene el promotor de CMV (nucleótidos 3165-2493 en la Figura 19), secuencia del intrón (nucleótidos 2464-2173 en la Figura 19), sitio de clonación del poliligador (nucleótidos 2126- 2095 en la Figura 19) y señal de poliadenilación de la hormoma de crecimiento bovino (nucleótidos 1979-1974 en la Figura 19). El gen de resistencia a kanamicina está codificada en los nucleótidos 4965-4061 (Figura 19). Los constructos de ADN descriptos anteriormente se digirieron con NheI y KpnI y se clonaron en los sitios XbaI y KpnI de pEP2 (la segunda unidad de transcripción). También se construyeron vectores adicionales. Para analizar el efecto de la co-expresión de los epitopos de MHC de clase I con los epitopos de MHC de clase II, se generó un inserto, denominado AOS, que contiene nueve epitopos de MHC de clase I. El inserto de AOS se construyó inicialmente en el vector pMIN.0 (Figura 20; SEQ ID NO:36). En breves palabras, inserto de AOS contiene nueve epitopos de MHC de clase I, seis restringidos de HLA-A2 y tres restringidos de HLA-A11, y el epitopo de MHC clase II universal PADRE. El vector pMIN.0 contiene epitopos de HBV, VIH y un epitopo de ovoalbúmina de ratón. Los epitopos de MHC de clase I aparecen en pMIN.0 en el siguiente orden: secuencia señal kappa de Ig de ratón de consenso (pMIN. 0 residuos de aminoácidos 1-20, nucleótidos 16-81) MQVQIQSLFLLLLWVPGSRG (SEQ ID NO:86) codificada por los nucleótidos ATG CAG GTG CAG ATC CAG AGC CTG TTT CTG CTC CTC CTG TGG GTG CCC GGG TCC AGA GGA (SEQ ID NO:87); 22 E99924233 27-10-2011   HBV pol 149-159 (A11 restringido) (pMIN.0 residuos de aminoácidos 21-31, nucleótidos 82-114) HTLWKAGILYK (SEQ ID NO: 88) codificada por los nucleótidos CAC ACC CTG TGG AAG GCC GGAATC CTG TAT AAG (SEQ ID NO:89); epitopo de PADRE-MHC clase II universal (pMIN.0 residuos de aminoácidos 32-45, nucleótidos 115-153) AKFVAAW TLKAAA (SEQ ID NO:38) codificada por los nucleótidos GCC AAG TTC GTG GCT GCC TGG ACC CTG AAG GCT GCC GCT (SEQ ID NO:90); núcleo de HBV 18-27 (A2 restringido) (pMIN.0 residuos de aminoácidos 46-55, nucleótidos 154-183) FLPSDFFPSV (SEQ ID NO:91) codificada por los nucleótidos TTC CTG CCT AGC GAT TTC TTT CCT AGC GTG (SEQ ID NO:92); VIH env 120-128 (A2 restringido) (pMIN.0 residuos de aminoácidos 56-64, nucleótidos 184-210) KLTPLCVTL (SEQ ID NO:93) codificada por los nucleótidos AAG CTG ACC CCA CTG TGC GTG ACC CTG (SEQ ID NO:94); HBV pol 551-559 (A2 restringido) (pMIN.0 residuos de aminoácidos 65-73, nucleótidos 211-237) YMDDVVLGA (SEQ ID NO:95) codificada por los nucleótidos TAT ATG GAT GAC GTG GTG CTG GGA GCC (SEQ ID NO:96); ovoalbúmina de ratón 257-264 (K b restringido) (pMIN. 0 residuos de aminoácidos 74-81, nucleótidos 238-261) SIINFEKL (SEQ ID NO:97) codificada por los nucleótidos AGC ATC ATC AAC TTC GAG AAG CTG (SEQ ID NO:98); HBV pol 455-463 (A2 restringido) (pMIN.0 residuos de aminoácidos 82-90, nucleótidos 262-288) GLSRYVARL (SEQ ID NO:99) codificada por los nucleótidos GGA CTG TCC AGA TAC GTG GCT AGG CTG (SEQ ID NO:100); VIH pol 476-84 (A2 restringido) (pMIN.0 residuos de aminoácidos 91-99, nucleótidos 289-315) ILKEPVHGV (SEQ ID NO:25 101) codificada por los nucleótidos ATC CTG AAG GAG CCT GTG CAC GGC GTG (SEQ ID NO: 102); núcleo de HBV 141-151 (A11 restringido) (pMIN.0 residuos de aminoácidos 100-110, nucleótidos 316-348) STLPETTVVRR (SEQ ID NO: 103) codificada por los nucleótidos TCC ACC CTG CCA GAG ACC ACC GTG GTG AGG AGA (SEQ ID NO:104); VIH env 49-58 (A11 restringido) (pMIN.0 residuos de aminoácidos 111-120, nucleótidos 349-378) TVYYGVPVWK (SEQ30 ID NO:105) codificada por los nucleótidos ACC GTG TAC TAT GGA GTG CCT GTG TGG AAG (SEQ ID NO:106); y HBV env 335-343 (A2 restringido) (pMIN.0 residuos de aminoácidos 121-129, nucleótidos 378-405) WLSLLVPFV (SEQ ID NO:107) codificada por los nucleótidos TGG CTG AGC CTG CTG GTG CCC TTT GTG (SEQ ID NO:108). El vector pMIN.0 contiene un sitio de restricción KpnI (pMIN.0 nucleótidos 406-411) y un sitio de restricción NheI (pMIN.0 nucleótidos 1-6). El vector pMIN.0 contiene una secuencia de Kozak de consenso (nucleótidos 7-18) (GCCGCCACCATG; SEQ ID NO: 109) y secuencia señal de la cadena liviana de Ig kappa murina seguido por una cadena de 10 epitopos de MHC de clase I y un epitopo de MHC clase II universal. La secuencia de pMIN.0 codifica un marco de lectura abierto fusionado a la marca del epitopo del anticuerpo Myc e His codificado por el vector pADNc 3,1 Myc-His. El vector pMIN.0 se construyó con ocho oligonucleótidos: Oligo Min1 Oligo Min2 Oligo Min3 23 E99924233 27-10-2011   Oligo Min4 Oligo Min5 Oligo Min6 Oligo Min7 Oligo Min8 Los cebadores adicionales fueron cebador flanqueante 5, GCG CAA GAA GCT TGC TAG CG (SEQ ID NO: 118) y cebador flanqueante 3, GCT CTA GAT CAG GTA CCC CAC (SEQ ID NO:119). La construcción del minigén original pMIN.0 se llevó a cabo por medio de ocho oligos superpuestos que promedian aproximadamente 70 nucleótidos de longitud, que se sintetizaron y purificaron por Operon Technologies Inc. Cada oligo está superpuesto a su vecino en 15 nucleótidos, el minigén multi-epitopo final se ensambló por la extensión de los oligos superpuestos en tres conjuntos de reacciones mediante PCR (Ho et al., Gene 77:51-59 (1989). Para la primera reacción de PCR, 5 µg de cada uno de los dos oligos se aparearon y extendieron: 1+2, 3+4, 5+6, y 7+8 se combinaron en reacciones de 100 µl que contienen 0,25 mM de cada dNTP y 2,5 unidades de Pfu polimerasa en buffer de Pfu polimerasa que contiene 10 mM de KCl, 10 mM de (NH4)2SO4, 20 mM de Tris-cloruro, pH 8,75, 2 mM de MgSO4, 0,1% de TRITON X-100 y 100 mg/ml de BSA. Se usó una máquina de PCR Perkin/ Elmer 9600 y la temperatura de apareamiento usada fue 5°C por debaj o de la Tm calculada más baja de cada par cebador. Los productos diméricos de longitud completa se purificaron en gel y se mezclaron dos reacciones que contienen el producto de 1-2 y 3-4, y el producto de 5-6 y 7-8, se aparearon y extendieron durante 10 ciclos. La mitad de las dos reacciones se mezclaron posteriormente y se realizaron 5 ciclos de apareamiento y extensión antes de añadir los cebadores flanqueantes para amplificar el producto de longitud completa durante 25 ciclos adicionales. El producto de longitud completa se purificó en gel y se clonó en pCR-romo (Invitrogen) y los clones individuales se identificaron por secuenciación. El inserto Min se aisló como un fragmento Nhe-KpnI y se clonó en los mismos sitios de pADNc3,1 (-)/Myc-His A (Invitrogen) para la expresión. La proteína de Min contiene las marcas del epitopo de anticuerpo Myc e His en su extremo carboxilo terminal. Para todas las reacciones de PCR descriptas, se realizó un total de 30 ciclos por medio de Pfu polimerasa y las siguientes condiciones: 95°C durante 15 segundos, t emperatura de apareamiento for 30 segundos, 72°C du rante un minuto. La temperatura de apareamiento usada fue 5°C por debajo de la Tm calculada más baja de cada par de cebadores. Se realizaron tres cambios en pMIN.0 para producir pMIN.1 (Figura 21; SEQ ID NO: 37, también mencionado como pMIN-AOS). Se eliminó el epitopo ova de ratón, el residuo de anclaje de la alanina de posición 9 (#547) de HBV pol 551-560 se convirtió en una valina que aumentó 40 veces la afinidad de unión in vitro y se introdujo un codón de detención de la traducción en el extremo de la secuencia codificadora multi-epitopo. Los cambios se realizaron por la 24 E99924233 27-10-2011   amplificación de dos fragmentos superpuestos y la combinación de ellos para producir el producto de longitud completa. La primera reacción usó el cebador T7 del vector 5 pADNc y el cebador MinovaR (nucleótidos247-218) TGGACAGTCCCACTCCCAGCACCACGTCAT (SEQ ID NO: 120). La mitad 3 se amplificó con los cebadores: MinovaF (nucleótidos 228-257) GCTGGGAGTGGGACTGTCCAGGTACGTGGC (SEQ ID NO:121) y Min-StopR (nucleótidos 390-361) GGTACCTCACACAAAGGGCACCAGCAGGC (SEQ ID NO:122) Los dos fragmentos se purificaron en gel, mezclaron, desnaturalizaron, aparearon y cargaron con cinco ciclos de PCR. El fragmento de longitud completa se amplificó con los cebadores flanqueantes T7 y Min-Stop durante 25 ciclos más. El producto se purificó en gel, se digirió con NheI y KpnI y se clonó en pADNc3,1 para la secuenciación y expresión. El inserto de pMIN.1 se aisló como un fragmento NheI-KpnI y se clonó en pEP2 para obtener pEP2-AOS. Ejemplo II: Ensayo para la activación de células T auxiliares Este ejemplo muestra procedimientos para ensayar la actividad de las células T auxiliares. Un procedimiento para ensayar la actividad de las células T auxiliares usa células de bazos de un organismo inmunizado. En breves palabras, un sedimento de células de bazo se suspende con 2-3 ml de buffer de lisis de eritrocitos que contiene 8,3 g/litro de cloruro de amonio en 0,001 M de Tris-HCl, pH 7,5. Las células se incuban en buffer de lisis durante 3-5 min a temperatura ambiente con agitación en vórtex ocasional. Se añade un volumen en exceso de 50 ml de medio R10 a las células, y las células sedimentan. Las células se resuspenden y sedimentan una o dos veces más en medio R2 o medio R10. El pellet celular se suspende en medio R10 y se cuenta. Si la suspensión celular se agrega, se elimina los agregados por filtración o se deja que los agregados decanten por gravedad. La concentración celular se lleva a 107/ml, y se añaden 100 µl de células de bazo a placas de parte inferior plana de 96 pocillos. Se preparan diluciones del péptido apropiado, tal como epitopo pan DR (SEQ ID NO:145), en medio R1030 a razón de 100, 10, 1, 0,1 y 0,01 µg/ml, y se añaden 100 µl de péptido a los pocillos duplicados o triplicados de las células de bazo. La concentración de péptido final es 50, 5, 0,5, 0,05 y 0,005 µg/ml. Los pocillos control reciben 100 µl de medio R10. Las placas se incuban durante 3 días a 37°C. Despué s de 3 días, se añaden 20 µl de 50 µCi/ml 3 H-timidina por pocillo. Las células se incuban durante 18-24 horas y posteriormente se recolectan en filtros de fibra de vidrio. La incorporación de 3 H-timidina en el ADN de las células proliferantes se mide en un contador beta. Un segundo ensayo para determinar actividad de las células T auxiliares usa células mononucleares de sangre periférica (PBMC) que se estimulan in vitro como se describió en Alexander et al., supra y Sette (WO 95/07,707), adaptado de Manca et al., J. Immunol, 146:1964-1971 (1991), que se incorpora en la presente memoria por referencia. En breves palabras, los PBMC se recolectan de dadores sanos y se purifican sobre Ficoll-Plaque (Pharmacia Biotech; Piscataway, NJ). Los PBMC se siembran en una placa de cultivo de tejido de 24 pocillos a razón de 4 x 10 6 células/ml. Los péptidos se añaden a una concentración final de 10 µg/ml. Los cultivos se incuban a 37°C en 5% de CO 2. En el día 4, se añade interleuquina-2 recombinante (IL-2) a una concentración final de 10 ng/ml. Los cultivos se alimentan cada 3 días por la aspiración de 1 ml de medio y el reemplazo con medio fresco que contiene IL-2. Se realizan dos estimulaciones adicionales de las células T con antígeno en aproximadamente los días 14 y 28. Las células T (3 x 10 5 /pocillo) se estimulan con péptido (10 µg/ml) por medio de células PBMC autólogas (2 x 10 6 células irradiadas/pocillo) (irradiadas con 7500 rads) como las células que presentan antígeno en un total de tres pocillos de una placa de cultivo de tejido de 24 pocillos. Además, en el día 14 y 28, se determinan las respuestas de las células T proliferativas en las siguientes condiciones: 2 x 10 4 células T/pocillo; 1 x 10 5 PBMC irradiados/pocillo como las células que presentan antígeno; concentración de péptido que varía entre 0,01 y 10 µg/ml de concentración final. La proliferación de las células T se mide 3 días después por la adición de 3 H-timidina (1 µCi/pocillo) 18 horas antes de recolectar las células. Las células se recolectan en filtros de vidrio y se mide la incorporación de 3 H-timidina en el contador de placa beta. Estos resultados demuestran procedimientos para ensayar la actividad de las células T auxiliares por la medición de la incorporación de 3 H-timidina. Ejemplo III: Ensayo para la respuesta de linfocitos T citotóxicos Este ejemplo muestra un procedimiento ensayar la actividad de los linfocitos T citotóxicos (CTL). Una respuesta de CTL se mide esencialmente como se describió previamente (Vitiello et al., Eur. J. Immunol. 27:671-678 (1997), que se incorpora en la presente memoria por referencia). En breves palabras, después de aproximadamente 10-35 días posteriores a la inmunización con ADN, los esplenocitos de un animal se aíslan y cocultivan a 37°C con blastos singeneicos de LPS revestidos con péptido, irradiados (3000 rad) (1 x 10 6 a 1,5 x 10 6 células/ml) en 10 ml de R10 en matraces T25. Los blastos LP se obtienen por la activación de esplenocitos (1 x 10 6 a 1,5 x 10 6 células/ml) con 25 µg/ml de lipopolisacáridos (LPS) (Sigma cat. no. L-2387; St. Louis, MO) y 7 µg/ml de dextran sulfato (Pharmacia Biotech) en medio R10 en matraces T75 durante 3 días a 37°C. Los linfoblastos posteriormente se resuspe nden a una concentración de 2,5 x 10 7 a 3,0 x 10 7 /ml, se irradian (3000 rad), y se revisten con los péptidos apropiados (100 E99924233 27-10-2011   µg/ml) durante 1 h a 37°C. Las células se lavan una vez, se resuspenden en el medio R10 a la concentración deseada y se añaden a la preparación de células receptivas. Los cultivos se ensayan para determinar actividad citolítica en el día 7 en un ensayo de liberación de 51 Cr. En el ensayo de liberación de 51 Cr, las células diana se marcan durante 90 min a 37°C con 150 µl de 51 cromato de sodio ( 51 Cr) (New England Nuclear; Wilmington DE), se lavan tres veces y se resuspenden en la concentración apropiada en medio R10. En el ensayo, 10 4 células diana se incuban en presencia de diferentes concentraciones de células efectoras en un volumen final de 200 µl en placas de parte inferior en U de 96 pocillos en presencia o ausencia de 10 µg/ml péptido. Los sobrenadantes se extraen después de 6 h a 37°C, y se determina el po r ciento de lisis específica por la fórmula: por ciento de lisis específica = 100 x10 (liberación experimental liberación espontánea), (liberación máxima - liberación espontánea). Para facilitar la comparación de respuestas de diferentes experimentos, los datos de por ciento de liberación se transforman a las 30 unidades líticas por 10 6 células (LU30/10 6 ), con 1 LU30 definido como el número de células efectoras requeridas para inducir 30% de lisis de 10 4 células diana en un ensayo de 6 horas. Los valores LU representan el LU30/10 6 obtenido en presencia de péptido menos LU30/10 6 en ausencia del péptido. Estos resultados demostraron procedimientos para ensayar la actividad de CTL por la medición de la liberación de 51 Cr de las células. Ejemplo IV: Proliferación de células T en ratones inmunizados con los vectores de expresión que codifican los epitopos de MHC Clase II y secuencias dirigidas a MHC Clase II Este ejemplo demuestra que los vectores de expresión que codifican epitopos de MHC de clase II y secuencias dirigidas a MHC Clase II son efectivos para activar las células T. Los constructos usados en el ensayo de proliferación de células T se describen en el Ejemplo I y se clonaron en el vector pEP2, un vector de expresión conducido por CMV. Los péptidos usados para la estimulación in vitro de las células T son: Ova 323-339, ISQAVHAAHAEINEAGR (SEQ ID NO: 123); HBVcore128, TPPAYRPPNAPILF (SEQ ID NO: 124); HBVenv182, FFLLTRILTIPQSLD (SEQ ID NO: 125); y PADRE, AKFVAAWTLKAAA (SEQ ID NO:38). El ensayo de proliferación de células T se realizó esencialmente como se describió en el Ejemplo II. En breves palabras, ratones B6D2 F1 de 12 a 16 semanas (2 ratones por constructo) se inyectaron con 100 µg del vector de expresión indicado (50 µg por pata) en el músculo tibial anterior. Después de once días, los bazos se recolectaron de los ratones y se separaron en una suspensión celular única por homogenización en Dounce. Se contaron los esplenocitos y un millón de esplenocitos se incubaron en una placa de 96 pocillos. Cada muestra se realizó por triplicado. Se añadieron diez µg/ml del péptido correspondiente codificado por los vectores de expresión respectivos a cada pocillo. Un pocillo contenía esplenocitos sin péptido añadido para control negativo. Las células se cultivaron a 37°C, 5% de CO 2 durante tres días. Después de tres días, se añadió un µCi de 3 H-timidina a cada pocillo. Después de 18 horas a 37°C, las células se recolectaron en filtros de vidrio y se midió la incorporación de 3 H en un contador de placa LKB R. Los resultados del ensayo de proliferación de células T se muestran en la Tabla 9. La proliferación de las células T específicas de antígeno se presenta como el índice de estimulación (SI); este se define como la relación de incorporación de 3 H- timidina promedio en presencia de antígeno dividido por la incorporación de 3 H-timidina en ausencia de antígeno. El inmunógeno "PADRE + IFA" es un control positivo en el que se inyectó el péptido PADRE en adyuvante de Freund incompleto en los ratones y se comparó con la respuesta observada con la inyección de los constructos del epitopo de MHC clase II que contienen una secuencia PADRE. Como se muestra en la Tabla 9, la mayor parte de los vectores de expresión analizados fueron efectivos para activar la proliferación de las células T40 en respuesta a la adición del péptido PADRE. La actividad de varios vectores de expresión fue comparable con la que se observa con la inmunización con el péptido PADRE en adyuvante de Freund incompleto. Los vectores de expresión que contienen los epitopos de MHC clase I y clase II, pEP2-AOS y pADNc-AOS, también fueron efectivos para activar la proliferación de las células T en respuesta a la adición del péptido PADRE. Estos resultados muestran que los vectores de expresión que codifican epitopos de MHC de clase II fusionados a una secuencia dirigida a MHC de clase II son efectivos para activar la proliferación de las células T y son útiles para estimular una respuesta inmune. Ejemplo V: Ensayo in vivo mediante ratones transgénicos A. Materiales y procedimientos Los péptidos se sintetizaron de acuerdo con los procedimientos de síntesis de fase sólida F-moc estándares que se ha descrito previamente (Ruppert et al., Cell 74:929 (1993); Sette et al., Mol. Immunol. 31:813 (1994)). La pureza del péptido se determinó por HPLC analítica de fase inversa y la pureza fue habitualmente >95%. La síntesis y purificación de la vacuna Theradigm- lipopéptido de HBV se describe en (Vitiello et al., J. Clin. Invest. 95:341 (1995)). Ratones Los ratones transgénicos HLA-A2.1 usados en este estudio fueron de la generación F1 derivados por cruzamiento 26 E99924233 27-10-2011   de ratones transgénicos que expresan un gen quimérico que consiste en los dominios 1, 2 de HLA-A2.1 y el dominio 3 de H-2K b con ratones SJL/J (Jackson Laboratory, Bar Harbor, ME). Esta cepa se mencionará de aquí en adelante como HLA-A2.1/K b -H-2 bxs . La cepa HLA-A2.1/K b transgénica original se generó con un ancestro C57BL/6 por medio del transgén y procedimientos descritos en (Vitiello et al., J. Exp. Med. 173:1007 (1991)). Los ratones transgénicos HLA-A11/K b usados en el presente estudio fueron idénticos a los que se describen en (Alexander et al., J. Immunol. 159:4753 (1997)). Líneas celulares, purificación de MHC y ensayos de unión del péptido Las células diana para los ensayos de citotoxicidad específica del péptido fueron células Jurkat transfectadas con el gen quimérico HLA-A2.1/K b (Vitiello et al., J. Exp. Med. 173:1007 (1991)) y las células tumorales 221 transfectadas con HLA-A11/K b (Alexander et al., J. Immunol. 159:4753 (1997)). Para medir la presentación de epitopos procesados en forma endógena, las células Jurkat-A2,1/k b se transfectaron con los minigenes pMin.1 o pMin.2-GFP y posteriormente se analizaron en un ensayo de citotoxicidad contra las líneas CTL específicas del epitopo. Para la transfección, las células Jurkat-A2.1/K b se resuspendieron a razón de 10 7 células/ml y se añadieron 30 µg de ADN a 600 µl de suspensión celular. Después de la electroporación las células se incubaron en una cubeta de 0,4 cm a 0,25 kV, 960 µFd, en hielo durante 10 min y posteriormente se cultivaron durante 2 d en medio de cultivo RPMI. Las células se cultivaron posteriormente en medio que contiene 200 U/ml de higromicina B (Calbiochem, SanDiego CA) para seleccionar los transfectantes estables. Se usó FACS para enriquecer la fracción de células que expresan la proteína fluorescente verde (GFP) de 15% a 60% (datos no mostrados). Los procedimientos para medir la unión cuantitativa de los péptidos a las moléculas de HLA-A2.1 y A11 se describen en Ruppert et al., Cell 74:929 (1993); Sette et al., Mol. Immunol. 31:813 (1994); Alexander et al., J. Immunol. 159: 4753 (1997). Todas las líneas celulares tumorales y los CTL esplénicos de los ratones activados se cultivaron en medio de cultivo (CM) que consistió en medio RPMI 1640 con Hepes (Life Technologies, Grand Island, NY) suplementado con 10% de FBS, 4 mM de L-glutamina, 5 X 10 -5 M de 2-ME, 0,5 mM de piruvato de sodio, 100 µg/ml de estreptomicina y 100 U/ml de penicilina. Construcción de plásmidos de ADN multi-epitopo del minigén Se construyeron pMIN.0 y pMIN.1 (es decir, pMIN-AOS) como se describió anteriormente y en USSN 60/085,751. pMIN.1-No PADRE y pMin. 1-Anclaje. pMIN.1 se amplificó por medio de dos fragmentos superpuestos que posteriormente se combinaron para producir el producto de longitud completa. La primera reacción usó el cebador T7 del vector 5 pADNc y el cebador ATCGCTAGGCAGGAACTTATACAGGATTCC (SEQ ID NO:126) para pMIN.1- No PADRE o TGGACAGTCCGGCTCCCAGCACCACGT (SEQ ID NO:127) para pMIN.1-Anclaje. La mitad 3 se amplificó con los cebadores TTCCTGCCTAGCGATTTC (SEQ ID NO:128) (No PADRE) o GCTGGGAGCCGGACTGTCCAGGTACGT (SEQ ID NO:129) (Anclaje) y Min-StopR. Los dos fragmentos generados de la amplificación de los extremos 5 y 3 se purificaron por gel, mezclaron, desnaturalizaron, aparearon y cargaron con cinco ciclos de PCR. El fragmento de longitud completa se amplificó adicionalmente con los cebadores flanqueantes T7 y Min-StopR durante 25 ciclos más. pMIN.1-No Sig. La secuencia señal de Ig se suprimió de pMin.1 por la amplificación con el cebador GCTAGCGCCGCCACCATGCACACCCTGTGGAAGGC CGGAATC (SEQ ID NO: 130) y los cebadores pADNc rev (Invitrogen). El producto se clonó en pCR-romo y se secuenció. pMIN.1-Switch. Tres fragmentos superpuestos se amplificaron de pMIN.1, se combinaron y extendieron. El fragmento 5' se amplificó con el cebador T7 del vector y el cebador primer GGGCACCAGCAGGCTCAGCCACACTCCCAGCACACGTC (SEQ ID NO: 131). El segundo fragmento superpuesto se amplificó con los cebadores AGCCTGCTGGTGCCCTTTGTGATCCTGAAGGAGCCTGTGC (SEQ ID ID NO:132) y AGAGCCACGTACCTGGACAGTCCCTTCCACACA GCACTCCAT (SEQ ID NO:133). El cebador TGTCCAGGTACGTGGCTAGGCTGTGAGGTACC (SEQ ID NO: 134) y el cebador del vector pADNc rev (Invitrogen) se usaron para amplificar el tercer fragmento (3). Los fragmentos 1, 2, y 3 se amplificaron y se purificaron por gel. Los fragmentos 2 y 3 se mezclaron, aparearon, amplificaron y se purificaron por gel. El fragmento 1 se combinó con el producto de 2 y 3, y se extendió, purificó en gen y se clonó en pADNc3.1 para la expresión. pMin.2-GFP. La secuencia señal se suprimió de pMIN.0 por amplificación PCR con Min.O-No Sig-5 más los cebadores pADNc rev (Invitrogen) GCTAGCGCCGCCACCATGCACACCCTGTGGAAGGCCGGAATC (SEQ ID NO: 135). El producto se clonó en pCR-romo y se secuenció. El inserto que contiene el marco de lectura abierto del constructo de secuencia señal-multi-epitopo suprimido se cortó con NheI más HindIII y se ligó en los mismos sitios de pEGFPN1 (Clontech). Este constructo fusiona la región codificadora del constructo de la señal suprimida de pMIN.0 en el extremo N-terminal de la proteína fluorescente verde (GFP). Inmunización de ratones 27 E99924233 27-10-2011   Para la inmunización con ADN, los ratones se pretrataron por la inyección de 50 µl de 10 µM de cardiotoxina (Sigma Chem. Co., #C9759) en forma bilateral en el músculo tibial anterior. Cuatro o cinco días después, se inyectaron 100 µg de ADN diluidos en PBS en el mismo músculo. Se descongeló Theradigm-lipopéptido HBV (10 mg/ml en DMSO) que estaba conservado a - 20°C, durante 10 min a 45°C antes de diluir a 1:10 (v/v) con PBS a temperatu ra ambiente. Inmediatamente después de la adición de PBS, la suspensión de lipopéptido se agitó en vórtex vigorosamente y se inyectaron 100 µl s.c. en la base de la cola (100 µg/ratón). Se analizó la inmunogenicidad de los epitopos individuales de CTL por la mezcla de cada epitopo de CTL (50 µg/ratón) con el péptido del núcleo de HBV 128-140 (TPPAYRPPNAPIL (SEQ ID NO: 124), 140 µg/ratón) que sirvió para inducir las células I-A b -restringido-Th. El cóctel de péptido posteriormente se emulsionó en adyuvante de Freund incompleto (Sigma Chem. Co.) y se inyectaron 100 µl de emulsión de péptido s.c. en la cola. Cultivos de CTL y ensayos de citotoxicidad in vitro Once a 14 días después de la inmunización, los animales se sacrificaron y se preparó una suspensión celular única de esplenocitos. Los esplenocitos de los animales activados con ADNc se estimularon in vitro con cada uno de los epitopos del péptido representados en el minigén. Los esplenocitos (2,5-3,0 X 10 7 /matraz) se cultivaron en matraces rectos de 25 cm 2 en presencia de 10 µg/m de péptido y 10 7 células de bazo irradiadas que han sido activadas durante 3 días con LPS (25 µg/ml) y dextran sulfato (7 µg/ml). Los cultivos triplicados se estimularon con cada epitopo. Cinco días después, los cultivos se alimentaron con CM fresco. Después de 10 días de cultivo in vitro, 2-4 X 10 6 de CTL de cada matraz se reestimularon con 10 7 de esplenocitos activados con LPS/dextran sulfato tratados con 100 µg/ml de péptido durante 60-75 min a 37°C, post eriormente se irradiaron 3500 rad. Los CTL se reestimularon en placas de 6 pocillos en 8 ml de CM libre de citoquina. Dieciocho horas después, los cultivos recibieron citoquinas contenidas en sobrenadante de esplenocitos activados con A (10-15% de concentración final, v/v) y se alimentaron o expandieron en el tercer día con CM que contiene 10-15% de precipitado de citoquina. Cinco días después de la reestimulación, se midió la actividad de CTL de cada cultivo por la incubación de cantidades variadas de CTL con 10 4 células diana marcadas con 51 Cr en presencia o ausencia de péptido. Para disminuir la citotoxicidad no específica de las células NK, también se añadieron células YAC-1 (ATCC) con una relación celular de YAC-1: diana marcadas con 51 Cr de 20:1. Se midió la actividad CTL contra el epitopo Pol 551 de HBV por la estimulación de los esplenocitos activados con ADN in vitro con el péptido que contiene A nativo y se analiza para determinar actividad citotóxica contra el mismo péptido. Para comparar más fácilmente las respuestas, las curvas de datos de relación de E:T estándar versus % de citotoxicidad se convirtieron en LU por 10 6 células efectoras con una LU definida como la actividad lítica requerida para obtener 30% de lisis de células diana en una relación E:T 100: 1. La actividad de CTL específica (LU) se calculó por la sustracción del valor de LU obtenido en ausencia de péptido del valor de LU obtenido con el péptido. Un cultivo dado se calificó como negativo para la inducción CTL si se cumplieron los siguientes criterios: 1) LU >2; 2) LU(+ péptido) - LU(- péptido) > 3; y 3) a >10% de diferencia en el % de citotoxicidad analizado con y sin péptido en las dos relaciones E:T más altas (en el comienzo las relaciones E:T eran habitualmente entre25-50:1). Se generaron líneas CTL de esplenocitos activados con pMIN.1 a través de estimulaciones semanales repetida de los CTLs con esplenocitos activados LPS/DxS tratados con péptido por medio de las condiciones de cultivos de 6 pocillos descriptas anteriormente con la excepción de que los CTL se expandieron en CM que contiene citoquinas según sea necesario durante el período de estimulación de siete días. Ensayo de citoquinas Para medir la producción de IFN- en respuesta a las células diana transfectadas con minigén, se cultivaron 4 X 10 4 CTLs con un número equivalente de células Jurkat-A2.1/K b transfectadas con minigén en placas de 96 pocillos de fondo plano. Después de una noche de incubación a 37°C, se recolectó el sobrenadante del cultivo de ca da pocillo y analizó en cuanto a concentración de IFN- utilizando un ELISA en sandwich. Se revistieron pocillos de microtitulación Immulon II (Dynatech, Boston, MA) durante una noche a 4°C con 0,2 µg de anticuerpo de captura IFN- anti-ratón, R4-6A2 (Pharmingen). Después de lavar los pocillos con PBS/Tween-20 0,1% y bloquear con BSA 1%, los pocillos revestidos con anticuerpo se incubaron con muestras de sobrenadante del cultivo durante 2 horas a temperatura ambiente. Se añadió un anticuerpo secundario anti-IFN-, XMG1.2 (Pharmingen) a los pocillos y se dejó incubar durante 2 horas a temperatura ambiente. Los pocillos fueron desarrollados a continuación mediante incubaciones con Avidina-DH y finalmente con peroxidasa de rábano H biotinilada (kit Vectastain ABC, Vector Labs, Burlingame, CA) y sustrato TMB peroxidasa (Kirkegaard and Perry Labs, Gaithersberg, MD). La cantidad de citoquinas presente en cada muestra se calculó utilizando un estándar de rIFN-y (Pharmingen). b. Resultados Selección de epitopos y diseño del constructo del minigén En la primera serie de experimentos, la cuestión era si podía inducirse una respuesta equilibrada y multiespecífica de CTL por constructos simples de ADNc de minigén que codifican varios epitopos restringidos de HLA de clase I 28 E99924233 27-10-2011   dominantes. En consecuencia, se seleccionaron nueve epitopos de CTL sobre la base de su importancia en la inmunidad por CTL durante la infección por HBV y HIV en seres humanos, su conservación de secuencia entre subtipos virales, y su afinidad de unión a MHC de clase I (Tabla 10). De estos nueve epitopos, seis están restringidos de HLA-A2.1 y tres mostraron restricción de HLA-A11. Un epitopo, HBV Pol 551, fue estudiado en dos formas alternativas: la secuencia de tipo salvaje o un análogo (HBV Pol 551-V) diseñado para una mayor afinidad de unión. Como se indica en la Tabla 10, varios laboratorios independientes han informado que estos epitopos son parte de la respuesta dominante de CTL durante la infección por HBV o HIV. Todos los epitopos considerados mostraron conservación superior al 75% en la secuencia primaria de aminoácidos entre los diferentes subtipos de HBV y clados de HIV. La afinidad de unión a MHC de los péptidos también fue considerada en la selección de los epitopos. Estos experimentos se dirigieron a la viabilidad de la inmunización con epitopos que poseen una amplia gama de afinidades y, como se muestra en la Tabla 10, los seis epitopos restringidos de HLA de HBV y los seis de HIV cubrieron un amplio espectro de afinidades de unión a MHC que abarcan más de dos órdenes de magnitud, con concentraciones de IC50% que van de 3 nM a 200 nM. La inmunogenicidad de los seis epitopos de CLT restringidos de A2.1 y los tres restringidos de A11 en ratones transgénicos fue verificada por la co-inmunización con un péptido de células T auxiliares en una formulación de IFA. Todos los epitopos indujeron respuestas de CTL significativas en el intervalo de 5 a 73 LU (Tabla 10). Como se mencionó anteriormente, para mejorar la unión a MHC y la inmunogenicidad de HBV Pol 551, el residuo A C-terminal de este epitopo fue sustituido por V resultando en un notable incremento de 40 veces en la afinidad de unión a HLA- A2.1 (Tabla 10). Aunque la secuencia parental fue débilmente o no inmunogénica en ratones transgénicos HLA, el análogo HBV Pol 551-V indujo niveles significativos de actividad de CTL cuando se administró en IFA (Tabla 10). Sobre la base de estos resultados, el análogo V del epitopo HBV Pol 551 fue seleccionado para el constructo del minigén inicial. En todos los experimentos descritos en esta memoria descriptiva, las respuestas de CTL se midieron con células diana revestidas con el epitopo HBV Pol 551 nativo, independientemente de si se utilizó el epitopo análogo V o nativo para la inmunización. Por último, como estudios anteriores indicaron que la inducción de células T auxiliares mejoraba significativamente la magnitud y duración de las respuestas de CTL (Vitiello et al, J. Clin. Invest. 95:341 (1995); Livingston et al, J. Immunol. 159:1383 (1997)), el epitopo universal de células Th PADRE también se incorporó en el minigén. PADRE ha demostrado previamente tener una alta afinidad de unión a MHC en una amplia gama de haplotipos de MHC de clase II de ratones y seres humanos (Alexander et al., Immunity 1:751 (1994)). En particular, se ha demostrado previamente que PADRE es altamente inmunogénico en ratones H-2 b que se utilizan en el presente estudio (Alexander et al., Immunoty 1:751 (1994)). pMin.1, el constructo de minigén de ADNc prototipo que codifica nueve epitopos de CTL y PADRE, fue sintetizado y subclonado en el vector pcDNA3.1. La posición de cada uno de los nueve epitopos en el minigén fue optimizada para evitar la unión de epitopos de MHC de clase I de ratón H-2 b y HLA-A2.1. La secuencia señal de Ig de ratón también se incluyó en el extremo 5 del constructo para facilitar el procesamiento de los epitopos de CTL en el retículo endoplásmico (RE) según lo informado por otros (Anderson et al., J. Exp. Med. 174:489 (1991)). Para evitar aún más la estructura conformacional en el producto del gen polipéptido traducido que pueda afectar el procesamiento de los epitopos de CTL, se introdujo un codón de detención ATG en el extremo 3 del constructo del minigén corriente arriba de la región de codificación para los epitopos c-myc y poli-hys en el vector pcDNA3.1. Inmunogenicidad de pMin.1 en ratones transgénicos Para evaluar la capacidad del constructo del minigén pMin.1 de inducir CTL in vivo, ratones transgénicos HLA- A2.1/K b -H-2 bxs fueron inmunizados intramuscularmente con 100 µg de ADNc desnudo. Como una forma de comparar el nivel de CTLs inducidos por la inmunización con ADNc, se inmunizó también a un grupo control de animales con Theradigm-HBV, un lipopéptido palmitoliado que consiste del epitopo de CTL de HBV Núcleo 18 relacionado con el epitopo de células Th de toxina del tétanos 830-843. Se estimularon esplenocitos de animales inmunizados dos veces con cada uno de los epitopos péptidos codificado en el minigén, a continuación, se analizaron en cuanto a actividad citotóxica específica del péptido en un ensayo de liberación de 51 Cr. Un panel representativo de respuestas de CTL de esplenocitos estimulados con pMin.1, mostrado en la Figura 22, indica claramente que se generaron niveles significativos de inducción de CTL por la inmunización con el minigén. La mayoría de los cultivos estimulados con los diferentes epitopos superó el 50% de lisis específica de las células diana en una relación E:T de 1:1. Los resultados de cuatro experimentos independientes, compilados en la Tabla 11, indican que el constructo de pMin.1 es de hecho altamente inmunogénico en ratones transgénicos HLA-A2.1/K b -H-2 bxs , lo que induce una amplia respuesta de CTL dirigida contra cada uno de sus seis epitopos restringidos de A2 0.1. Para comparar de forma más conveniente los niveles de inducción de CTL entre los diferentes epitopos, los valores de citotoxicidad % para cada cultivo de esplenocitos se convirtieron en LU y se determinó el LU medio de actividad de CTL en cultivos positivos para cada epitopo (véase el Ejemplo V, materiales y procedimientos, para criterios positivos). Los datos, expresados de esta manera en la Tabla 11, confirman la amplitud de la inducción de 29 E99924233 27-10-2011   CTL provocada por la inmunización con pMin.1 ya que se observaron respuestas de CTL extremadamente altas, que oscilan entre 50 a 700 flu, contra los seis epitopos restringidos de A2.1. Más importante aún, las respuestas de varios cientos de LU observados en cinco de los seis epitopos se acercaron o superaron la del lipopéptido Theradigm-HBV, una formulación de vacuna conocida por su alta potencia de inducción de CTL (Vitiello et al., J. Clin. Invest. 95:341 (1995), Livingston et al, J. Immunol 159:1383 (1997)). El epitopo de HBV Env 335 fue el único epitopo que muestra una respuesta de LU media más baja en comparación con el lipopéptido (Tabla 11, 44 vs 349 LU). Procesamiento de epitopos de minigén bv células transfectadas La disminución de la respuesta de CTL observada contra HBV Env 335 fue algo inesperado ya que este epitopo tenía buena afinidad de unión a A2.1 (IC50%, 5 nM) y también fue inmunogénico cuando se administró en IFA. La respuesta baja puede deberse, al menos en parte, al procesamiento ineficiente de este epitopo del polipéptido minigén por las células presentadoras de antígenos después de la inmunización con ADNc in vivo. Para responder a esta posibilidad, se transfectaron células tumorales Jurkat-A2. 1.K b con ADNc de pMin.1 y la presentación del epitopo de HBV Env 335 por células transfectadas se comparó con epitopos restringidos de A2.1 más inmunogénicos utilizando líneas de CTL específicas. La presentación de epitopos se estudió también utilizando células tumorales transfectadas con una constructo de ADNc control, pMin.2-GFP, que codifica un minigén multiepitopo similar fusionado con GFP que permite la detección de la expresión del minigén en células transfectadas por FACS. La presentación de epitopos de las células Jurkat transfectadas se analizó utilizando líneas de CTL específicas, empleándose para la lectura la citotoxicidad o la producción de IFN-. Se encontró que los niveles de respuesta de CTL se correlacionaban directamente con la inmunogenicidad in vivo de los epitopos. Los epitopos altamente inmunogénicos in vivo, como HBV Núcleo 18, HIV Pol 476, y HBV Pol 455, fueron presentados de manera eficiente a las líneas de CTL por células transfectadas con pMin.1 o pMin.2-GFP según se midió por la producción de IFN- (Figura 23A,> 100 pg/ml para cada epitopo) o actividad citotóxica (Figura 23C, lisis específica >30%). En contraste con estos niveles elevados de actividad in vitro, la estimulación de la línea de CTL específica para HBV Env 335 contra ambas poblaciones de células transfectadas resultó en menos de 12 pg/ml de IFN- y 3% de lisis específica. Aunque la línea de CTL específica para HBV Env 335 no reconoció el epitopo procesado naturalmente de manera eficiente, esta línea mostró una respuesta equivalente a las células diana cargadas con péptido en comparación con líneas de CTL específicas para los otros epitopos (Figura 23B, D). En conjunto, estos resultados sugieren un procesamiento y/o presentación defectuosos asociados con el epitopo HBV Env 335 que pueden contribuir a su inmunogenicidad disminuida in vivo. Efecto del epitopo de células T auxiliares PADRE en la inmunogenicidad del minigén Después de haber obtenido una respuesta de CTL amplia y equilibrada en ratones transgénicos inmunizados con un ADNc de minigén que codifica múltiples epitopos restringidos de HLA-A2.1, se examinaron otras variables posibles que podrían influir en la inmunogenicidad del constructo prototipo. Este tipo de análisis podría llevar a la optimización racional y rápida de constructos futuras. Más específicamente, se sintetizó una constructo de ADNc basado en el prototipo pMin.1 en la que el epitopo PADRE fue eliminado para examinar la contribución de las células T auxiliares en la inmunogenicidad del minigén (Figura 24A). Los resultados de los análisis de inmunogenicidad indicaron que la eliminación del epitopo de células Th PADRE resultó en una reducción significativa en la frecuencia de precursores de CTL específicos contra cuatro de los epitopos del minigén (HBV Núcleo 18, HIV Env 120, HBV Pol 455, y HBV Env 335) como lo indica el 17 a 50% de cultivos positivos para CTL observado contra estos epitopos en comparación con la frecuencia de 90 a 100% en animales inmunizados con el constructo de pMin.1 prototipo (Figura 25). Por otra parte, en dos de los epitopos, HBV Núcleo 18 y HIV Env 120, la magnitud de la respuesta en los cultivos positivos inducidos por pMin.1-No PADRE fue de 20 a 30 veces menor que la del constructo de pMin.1 (Figura 25A). Efecto de la modulación de la afinidad de unión a MHC en la inmunogenicidad del epitopo A continuación, se sintetizó una constructo en el que el residuo de anclaje en V HBV Pol 551 fue sustituido por alanina, el residuo nativo, para tratar el efecto de la disminución de la unión a MHC en la inmunogenicidad del epitopo (Figura 24B). A diferencia de la eliminación del epitopo de células Th, la disminución de la capacidad de unión a MHC del epitopo HBV Pol 551 en 40 veces a través de la modificación del residuo de anclaje no pareció afectar la inmunogenicidad del epitopo (Figura 25B). La respuesta de CTL contra el epitopo HBV Pol 551, así como a los otros epitopos, medida por LU o frecuencia de cultivos positivos para CTL, fue muy similar entre las constructos que contenían el residuo A nativo o V mejorado en el sitio de anclaje de unión a MHC . Este hallazgo refuerza la noción de que los minigenes de epitopos mínimos pueden proporcionar de manera eficiente epitopos de muy diferentes afinidades de unión a MHC. Además, este hallazgo es particularmente relevante para mejorar la inmunogenicidad del epitopo a través de diferentes procedimientos de administración, especialmente a la luz del hecho de que el epitopo HBV Pol 551 de tipo salvaje fue esencialmente no inmunogénico cuando se administró en una emulsión de IFA menos potente. E99924233 27-10-2011   Efecto de la secuencia señal en la inmunogenicidad del constructo del minigén Se eliminó la secuencia señal del constructo de pmin.1, lo que impide el procesamiento del polipéptido del minigén en el ER (Figura 24C). Cuando se examinó la inmunogenicidad del constructo de pMin.1-No Sig, se encontró una disminución global de la respuesta contra cuatro epitopos de CTL. Dos de estos epitopos, HIV Env 120 y HBV Env 335, mostraron una disminución en la frecuencia de cultivos positivos para CTL en comparación con pMin.1 mientras que el resto de los epitopos, HBV Pol 455 y HIV Pol 476, mostraron una disminución de 16 veces (de 424 a 27 LU) y 3 veces (709 a 236 LU) en la magnitud de la respuesta media de CTL, respectivamente (Figura 25C). Estos hallazgos sugieren que permitir el procesamiento en el ER de algunos de los epitopos codificados en el constructo prototipo de pMin.1 puede mejorar la inmunogenicidad, en comparación con las constructos que permiten solamente el procesamiento citoplasmático del mismo panel de epitopos. Efecto del reordenamiento del epitopo y creación de nuevos epitopos de unión En el constructo final examinado, se analizó la inmunogenicidad del epitopo HBV Env 335 para determinar si puede estar influida por su posición en el terminal 3 del constructo del minigén (Figura 24D). Por lo tanto, la posición del epitopo Env en el constructo de ADNc se cambió con un epitopo más inmunogénico, HBV Pol 455, situado en el centro del minigén. Cabe señalar que esta modificación también creó dos epitopos potencialmente nuevos. Como se muestra en la Figura 25D, la transposición de las dos epitopos pareció afectar la inmunogenicidad de no sólo los epitopos transpuestos, sino también más en general la de otros epitopos. El cambio de los epitopos resultó en la obliteración de la inducción de CTL contra el HBV Env 335 (sin cultivos positivos detectados de cada seis). La respuesta de CTL inducida por el epitopo HBV Pol 455 terminal también se redujo, pero sólo ligeramente (424 vs 78 LU media). Además de los epitopos cambiados, la inducción de CTL contra otros epitopos en el constructo de pMin.1-Switch también se redujo notablemente en comparación con el constructo prototipo. Por ejemplo, no se observó una respuesta de CTL contra el epitopo HIV Env 120 y esta disminuyó significativamente contra los epitopos HBV Núcleo 18 (4 de 6 cultivos positivos, disminución en LU media de 306 a 52) y HBV Pol 476 (disminución en LU media de 709 a 20) (Figura 25D). Como se mencionó anteriormente, debe señalarse que el cambio de los dos epitopos había creado nuevos epitopos de unión. De hecho, en el constructo pMin.1-Switc, se crearon dos nuevos epitopos de CTL potenciales a partir de secuencias de epitopos de HBV Env 335 - HIV Pol 476 (LLVPFVIL (SEQ ID NO: 135), restringida a H-2K b ) y HBV Env 335-HBV Pol 551 (VLGVWLSLLV (SEQ ID NO: 136), restringida a HLA-A2.1). Aunque estos epitopos de unión no han sido examinados para determinar si son o no inmunogénicos en efecto, esto puede explicar la baja inmunogenicidad de los epitopos HBV Env 335 y HIV Pol 476. Estos hallazgos sugieren que evitar los epitopos de unión puede ser importante en el diseño de minigenes multi-epitopo así como la capacidad para confirmar su inmunogenicidad in vivo en un sistema de ensayo biológico como ratones transgénicos HLA. Inducción de CTLs contra epitopos de A11 codificados en pMin.1 Para examinar aún más la flexibilidad del enfoque de la vacuna de minigén para inducir una respuesta de CTL amplia no sólo contra múltiples epitopos sino también contra epitopos restringidos de diferentes alelos de HLA, se inmunizaron ratones transgénicos HLA-A11/K b para determinar si los tres epitopos A11 en el constructo pMin.1 eran inmunogénicos para CTLs, como fue el caso de los epitopos restringidos de A2.1 en el mismo constructo. Como se resume en la Tabla 12, se observó la inducción significativa de CTL en la mayoría de los cultivos contra los tres epitopos restringidos de HLA-A11 y el nivel de inmunidad por CTL inducida para los tres epitopos, en el intervalo de 40 a 260 LU, superó al de los péptidos suministrados en IFA (Tabla 10). De este modo, nueve epitopos de CTL con restricciones variables de HLA incorporadas en una constructo de minigén prototipo demostraron inducción de CTL significativa in vivo, lo que confirma que los plásmidos de ADN de minigén pueden servir como medio de administración de múltiples epitopos, de diversas restricciones de HLA y afinidades de unión a MHC, al sistema inmunológico de una forma inmunogénica y que pueden utilizarse cepas adecuadas de ratones transgénicos para medir la inmunogenicidad del constructo de ADN in vivo. Las CTLs fueron inducidas también contra tres epitopos A11 en ratones transgénicos A11/K b . Estas respuestas sugieren que la administración de múltiples epitopos de CTL que confiere una amplia cobertura a la población puede ser posible en los seres humanos y que los animales transgénicos de haplotipos apropiados pueden ser herramientas útiles en la optimización de la inmunogenicidad in vivo de ADN del minigén. Además, puede utilizarse animales como los monos que tienen moléculas de HLA conservadas con reactividad cruzada con epitopos de CTL y HTL reconocidos por moléculas de MHC humano para determinar la inmunogenicidad humana de epitopos de HTL y CTL (Bertoni et al, J. Immunol. 161:4447-4455 (1998)). Este estudio representa la primera descripción de la utilización de ratones transgénicos HLA para cuantificar la inmunogenicidad in vivo de vacunas de ADN, mediante el examen de la respuesta a epitopos restringidos de antígenos de HLA humanos. Se requieren estudios in vivo para abordar las variables fundamentales para el desarrollo de vacunas, que no son evaluadas fácilmente mediante ensayos in vitro, como la vía de administración, formulación de la vacuna, biodistribución en tejidos, y la participación de órganos linfoides primarios y secundarios. Debido a su simplicidad y flexibilidad, los ratones transgénicos HLA representan una alternativa atractiva, al menos para los estudios iniciales de desarrollo de vacunas, en comparación con estudios más complicados y costosos en 31 E99924233 27-10-2011   especies animales superiores, como primates no humanos. Los estudios de presentación in vitro descritos anteriormente apoyan también el uso de ratones transgénicos HLA para la detección de constructos de ADN que contengan epitopos humanos en la medida en que se observe una correlación directa entre la inmunogenicidad in vivo y la presentación in vitro. Por último, se observaron respuesta de CTL fuertes contra seis epitopos virales restringidos de A 2.1 y en tres epitopos restringidos de A11 codificados en el constructo pMin.1 prototipo. Para cinco de los epitopos restringidos de A 2.1, la magnitud de la respuesta de CTL se aproximó a la observada con el lipopéptido, Theradigm-HBV, que anteriormente ha demostrado inducir una fuerte respuesta de CTL en seres humanos (Vitiello et al, J. Clin Invest. 95:341 (1995); Livingston et al, J. Immunol 159:1383 (1997)). Tabla 1 Epitopes de HTL derivados de HBV Péptido Secuencia Fuente SEQ ID NO: 1298.06 KQAFTFSPTYKAFLC HBV POL 661 F107.03 LQSLTNLLSSNLSWL HBV POL 412 1280.06 AGFPLLTRILTIPQS HBV ENV 180 1280.09 GTSFVYVPSALNPAD HBV POL 774 CF-08 VSFGVWIRTPPAYRPPNAPI HBV NUC 120 27.0280 GVWIRTPPAYRPPNA HBV NUC 123 1186.25 SFGVWIRTPPAYRPP HBV NUC 121 27.0281 RHYLHTLWKAGILYK HBV POL 145 F107.04 PFLLAQFTSAICSVV HBV POL 523 1186.15 LVPFVQWFVGLSPTV HBV ENV 339 1280.15 LHLYSHPIILGFRKI HBV POL 501 1298.04 KQCFRKLPVNRPIDW HBV POL 615 1298.07 AANWILRGTSFVYVP HBV POL 764 857.02 PHHTALRQAILCWGELMTLA HBV NÚCLEO 50 35.0100 LCQVFADATPTGWGL HBV POL 683 35.0096 ESRLVVDFSQFSRGN HBV POL 387 35.0093 VGPLTVNEKRRLKLI HBV POL 96 1186.18 NLSWLSLDVSAAFYH HBV POL 422 Tabla 2 Epitopes de CTL derivados de HBV Supertipo Péptido Secuencia Fuente SEQ ID NO: A2 924.07 FLPSDFFPSV HBV núcleo 18-27 1013.0102 WLSLLVPFV HBVadr-ENV (S Ag 335-343) 777.03 FLLTRILTI HBV ENV ayw 183 927.15 ALMPLYACI HBV ayw pol 642 32 E99924233 27-10-2011   (continuación) Epitopes de CTL derivados de HBV Supertipo Péptido Secuencia Fuente SEQ ID NO: 1168.02 GLSRYVARL HBV POL 455 927.11 FLLSLGIHL HBV pol 562 A3 1147.16 HTLWKAGILYK HBV POL 149 1083.01 1090.11 STLPETTVVRR HBV núcleo 141 SAICSVVRR HBV pol 531 1090.10 QAFTFSPTYK HBV pol 665 1069.16 NVSIPWTHK HBV pol 47 1069.20 1142.05 LVVDFSQFSR HBV pol 388 1069.15 KVGNFTGLY TLWKAGILYK 33 HBV adr POL 629 HBV pol 150 B7 1145.04 IPIPSSWAF HBV ENV 313 988.05 LPSDFFPSV HBV núcleo 19-27 A2 1147.04 TPARVTGGVF HBV POL 354 1069.06 LLVPFVQWFV HBV env 338-347 1147.13 FLLAQFTSAI HBV POL 513 1147.14 VLLDYQGMLPV HBV ENV 259 1132.01 LVPFVQWFV HBV ENV 339 1069.05 LLAQFTSAI HBV pol 504-512 927.42 NLSWLSLDV HBV pol 411 927.41 LLSSNLSWL HBV pol 992 927.46 KLHLYSHPI HBV pol 489 1069.071 FLLAQFTSA HBV pol 503 1142.07 GLLGWSPQA HBV ENV 62 927.47 HLYSHPHL HBV ayw pol 1076 1069.13 PLLPIFFCL HBV env 377-385 1013.1402 VLQAGFFLL HBVadr-ENV 177 1090.14 YMDDVVLGA HBV pol 538-546 A3 26.0539 RLVVDFSQFSR HBV pol 376 26.0535 GVWIRTPPAYR HBV X nuc fus 299 A3 26.0153 SSAGPCALR HBV X 64 E99924233 27-10-2011   (continuación) Epitopes de CTL derivados de HBV Supertipo Péptido Secuencia Fuente SEQ ID NO: 1.0993 KVFVLGGCR HBV adr "X" 1548 26.0149 CALRFTSAR HBV X 69 26.0023 VSFGVWIR HBV x nuc fus 296 26.0545 TLPETTVVRRR HBV x nuc fus 318 20.0131 SVVRRAFPH HBV POL 524 1.0219 FVLGGCRHK HBV adr "X" 1550 26.0008 FFFSPTYK HBV pol 656 20.0130 AFTESPTYK HBV POL 655 B7 1147.05 FPHCLAFSYM HBV POL 530 1147.08 YPALMPLYA HBV POL 640 1147.06 LPVCAFSSA HBV X 58 1147.02 HPAAMPHLL HBV POL 429 26.0570 YPALMPLYACI HBV pol 640 19.0014 YPALMPLY HBV POL 640 1145.08 FPHCLAFSY HBV POL 541 Otros 1090.02 A YRPPNAPI HBV NUC 131 1.0519 DLLDTASALY HBV Adr NÚCLEO 419 13.0129 EYLVSFGVWI HBV NUC 117 20.0254 FAAPRTQCGY HBV POL 631 2.0060 GYPALMPLY HBV ALL 1224 1069.04 HTLWKAGILY HBV pol 149 1069.08 ILLLCLIFLL HBV env 249-258 1.0166 KVGNFTGLY HBV adr POL 629 1069.23 KYTSFPWLL HBV POL 745 1069.01 LLDTASALY HBV núcleo 59 2.0239 LSLDVSAAFY HBV ALL 1000 2.0181 LYSHPHLGF HBV POL 492 1039.01 MMWYWGPSLY HBV 360 2.0126 MSTTDLEAY IIBV adr 1521 1069.03 PLDKGIKPYY HBV pol 124 1090.09 PTTGRTSLY HBV pol 808 34 E99924233 27-10-2011   (continuación) Epitopes de CTL derivados de HBV Supertipo Péptido Secuencia Fuente SEQ ID NO: 20.0138 PWTHKVGNF HBV POL 51 20.0135 RWMCLRRFI HBV ENV 236 20.0269 RWMCLRRFH HBV ENV 236 20.0139 SFCGSPYSW HBV POL 167 Otros 1069.02 SLDVSAAFY HBV pol 427 20.0136 SWLSLLVPF HBV ENV 334 20.0271 SWPKFAVPNL HBV POL 392 20.0137 SWWTSLNFL HBV ENV 197 2.0173 SYQHFRKLLL HBV POL 4 13.0073 WFIHSCLTF HBV NUC 102 1.0774 WLWGMDIDPY HBV adw NÚCLEO 416 1039.06 WMMWYWGPSLY HBV env 359 924.14 FLPSDFFPSI HBv 18-27 I10 var. 1090.77 YMDDVVLGV HBV pol 538-546 sub 941.01 FLPSDYFPSV HBC18-27 análogo 1083.02 STLPETYVVRR HBV core141-151 análogo 1145.05 FPIPSSWAF HBV ENV 313 análogo 1145.11 FPHCLAFSL HBV POL 541 análogo 1145.24 FPHCLAFAL HBV POL 541 análogo 1145.06 IPITSSWAF HBV ENV 313 análogo 1145.23 IPIPMSWAF HBV ENV 313 análogo 1145.07 IPILSSWAF HBV ENV 313 análogo 1145.09 FPVCLAFSY HBV POL 541 análogo 1145.10 FPHCLAFAY HBV POL 541 análogo Tabla 3 Epitopes de HTL derivados de HCV Péptido Secuencia Fuente SEQ ID NO: AAYAAQGYKVLVLNPSVAATLGFGAY HCV NS3 1242-1267 P98.03 AAYAAQGYKVLVLNPSVAAT HCV NS3 1242 P98.04 GYKVLVLNPSVAATLGFGAY HCV NS3 1248 E99924233 27-10-2011   (continuación) Epitopes de HTL derivados de HCV Péptido Secuencia Fuente SEQ ID NO: P98.05 GYKVLVLNPSVAAT HCV NS3 1248 1283.21 GYKVLVLNPSVAATL HCV NS3 1253 1283.20 AQGYKVLVLNPSVAA HCV NS3 1251 GEGAVQWMNRLIAFASRGNHVS HCV NS4 1914-1935 F134.08 GEGAVQWMNRLIAFASRGNHV HCV NS4 1914 1283.44 MNRLIAFASRGNHVS HCV NS4 1921 1283.16 SKGWRLLAPITAYAQ HCV NS3 1025 1283.55 GSSYGFQYSPGQRVE HCV NS5 2641 F134.05 NFISGIQYLAGLSTLPGNPA HCV NS4 1772 1283.61 ASCLRKLGVPPLRVW HCV NS5 2939 1283.25 GRHLIFCHSKKKCDE HCV NS3 1393 35.0107 TVDFSLDPTFTIETT HCV 1466 35.0106 VVVVATDALMTGYTG HCV 1437 Tabla 4 Epitopes de CTL derivados de HCV Supertipo Péptido Secuencia Fuente SEQ ID NO: A2 1090.18 FLLLADARV HCV NS1/E2 728 1073.05 LLFNILGGWV HCV NS4 1812 1013.02 YLVAYQATV HCV NS3 1590 1013.1002 DLMGYIPLV HCV Núcleo 132 1090.22 RLIVFPDLGV HCV NS5 2611 24.0075 VLVGGVLAA HCV NS4 1666 24.0073 WMNRLIAFA IICV NS4 1920 1174.08 HMWNFISGI HCV NS4 1769 1073.06 ILAGYGAGV I ICV NS4 1851 24.0071 LLFLLLADA HCV NS1/E2 726 1073.07 YLLPRRGPRL HCV Núcleo 35 1.0119 YLVTRHADV HCV NS3 1136 A3 1.0952 KTSERSQPR HCV Núcleo 51 1073.10 GVAGALVAFK HCV NS4 1863 36 E99924233 27-10-2011   (continuación) Epitopes de CTL derivados de HCV Supertipo Péptido Secuencia Fuente SEQ ID NO: 1.0123 LIFCHSKKK HCV NS3 1391 1.0955 QLFTFSPRR HCV E1 290 1073.11 RLGVRATRK HCV Núcleo 43 1073.13 RMYVGGVEHR HCV NS1/E2 635 24.0090 VAGALVAFK HCV NS4 1864 F104.01 VGIYLLPNR HCV NS5 3036 B7 1145.12 LPGCSFSIF HCV Núcleo 168 29.0035 IPFYGKAI HCV 1378 Otros 1069.62 CTCGSSDLY HCV NS3 1128 24.0092 FWAKHMWNF HCV NS4 1765 13.0019 LSAFSLHSY HCV NS5 2922 A3 24.0086 LGFGAYMSK HCV NS3 1267 1174.21 RVCEKMALY HCV NS5 2621 1174.16 WMNSTGFTK HCV NS1/E2 557 1073.04 TLHGPTPLLY HCV NS3 1622 B7 16.0012 FPYLVAYQA HCV NS3 1588 15.0047 YPCTVNFH HCV NS1/E2 623 Otros 24.0093 EVDGVRLHRY HCV NS5 2129 3.0417 LTCGFADLMGY HCV 126 1073.01 NIVDVQYLY HCV E1 700 1.0509 GLSAFSLHSY HCV NS5 2921 1073.17 MYVGDLCGSVF HCV E1 275 1073.18 MYVGGVEHRL HCV NS1/E2 633 13.075 QYLAGLSTL HCV NS4 1778 1145.13 FPGCSFSIF HCV Núcleo 168 1145.25 LPGCMFSIF HCV Núcleo 168 1292.24 LPGCSFSH HCV Núcleo 169 1145.14 LPVCSFSIF HCV Núcleo 168 1145.15 LPGCSFSYF HCV Núcleo 168 37 E99924233 27-10-2011   Tabla 5 Epitopes de HTL derivados de VIH Péptido Secuencia Fuente SEQ ID NO: GEIYKRWHLGLNKIVRMYSPTSILD HIV1 GAG 294-319 KRWHLGLNKIVRMYSPTSILD HIV gag 298-319 27.0313 KRWHLGLNKIVRMY HIV1 GAG 298 27.0311 GEIYKRWHLGLNKI HIV1 GAG 294 27.0354 WEFVNTPPLVKLWYQ HIV1 POL 596 27.0377 QKQITKIQNFRVYYR HIV1 POL 956 EKVYLAWVPAHKGIGG HIV1 POL 711-726 1280.03 KVYLAWVPAHKGIGG HIV POL 712 27.0361 EKVYLAWVPAHKGIG HIV1 POL 711 PIVQNIQGQMVHQAISPRTLNA HIV1 gag 165-186 27.0304 QGQMVHQAISPRTLN HIV1 GAG 171 27.0297 QHLLQLTVWGIKQLQ HIV1 ENV 729 27.0344 SPAIFQSSMTKILEP HIV1 POL 335 F091.15 IKQFINMWQEVGKAMY HIV1 ENV 566 27.0341 FRKYTAFTIPSINNE HIV1 POL 303 27.0364 HSNWRAMASDFNLPP IHIV1 POL 758 27.0373 KTAVQMAVFIHNFKR HIV1 POL 915 DRVHPVHAGPIAPGQMREPRGS AFSPEVIPMFSALSEGATPQDLNTML 38 HIV GAG 245 HIV gag 195-216 AFSPEVIPMFSALSEGATPQDL HIV gag 195-216 200.06 SALSEGATPQDLNTML HIV gag 205 27.0307 SPEVIPMFSALSEGA HIV gag 197 27.0310 LQEQIGWMTNNPPIPVGEIYKR QEQGWMTNNPPIPV HIV gag 275 HIV gag 276 35.0135 YRKILRQRKIDRLID HIV VPU 31 35.0131 WAGIKQEFGIPYNPQ HIV POL 874 35.0127 EVNIVTDSQYALGH HIV POL 674 35.0125 AETFYVDGAANRETK HIV POL 619 35.0133 GAVVIQDNSDIKVVP HIV POL 989 E99924233 27-10-2011   Tabla 6 Epitopes de HTL derivados de VIH Supertipo Péptido Secuencia Fuente SEQ ID NO: A2 25.0148 MASDFNLPPV HIV1 POL 70 1069.32 VLAEAMSQV HIV gag 397 1211.04 KLTPLCVTL HIV ENV 134 25.0062 KLVGKLNWA HIV1 POL 87 25.0039 LTFGWCFKL HIV1 NEF 62 941.031 ILKEPVHGV HIV1 pol 476-484 25.0035 MTNNPPIPV HIV1 GAG 34 25.0057 RILQQLLFI HIV1 VPR 72 A3 1.0944 AVFIHNFKR HIV POL 1434 1.1056 KIQNFRVYYR HIV POL 1474 1069.49 QMAVFIHNFK HIV pol 1432 966.0102 AIFQSSMTK HIV pol 337 1150.14 MAVFIHNFK HIV pol 909 940.03 QVPLRPMTYK HIV nef 73-82 25.0175 TTLFCASDAK HIV1 ENV 81 1069.43 TVYYGVPVWK HIV env 49 25.0209 VTIKIGGQLK HIV1 POL 65 B7 1146.01 FPVRPQVPL HIV nef 84-92 29.0060 IPIHYCAPA HIV env 293 15.0073 FPISPIETV HIV POL 171 29.0056 CPKVSFEPI HIV env 285 29.0107 IPYNPQSQGVV HIV pol 883 A2 25.0151 CTLNFPISPI HIV1 POL 96 25.0143 LTPGWCFKLV HIV1 NEF 62 25.0043 YTAFTIPSI HIV1 POL 83 25.0055 AHRILQQL HIV1 VPR 76 25.0049 ALVEICTEM HIV1 POL 52 25.0032 LLQLTVWGI HIV1 ENV 61 25.0050 LVGPTPVNI HIV1 POL 100 25.0047 KAACWWAGI HIV1 POL 65 25.0162 KMIGGIGFI HIV1 POL 96 39 E99924233 27-10-2011   (continuación) Epitopes de HTL derivados de VIH Supertipo Péptido Secuencia Fuente SEQ ID NO: 25.0052 RAMASDFNL HIV1 POL 78 1211.09 SLLNATDIAV HIV ENV 814 A2 25.0041 TLNFPSISPI HIV1 POL 96 A3 1.0046 IVIWGKTPK HIV POL 1075 25.0064 MVHQAISPR HIV1 GAG 45 1.0062 YLAWVPAHK HIV POL 1227 1.0942 MTKILEPFR HIV POL 859 25.0184 QMVHQAISPR HIV1 GAG 45 1069.48 AVFHINFKRK HIV pol 1434 1069.44 KLAGRWPVK HIV pol 1358 1069.42 KVYLAWVPAHK HIV pol 1225 1.0024 NTPVFAIKK HIV pol 752 25.0062 RIVELLGRR HIV1 ENV 53 25.0095 TIKIGGQLK HIV1 POL 65 25.0078 TLFCASDAK HIV1 ENV 82 25.0104 VMIVWQVDR HIV1 VIF 83 1069.47 VTVYYGVPVWK HIV env 48 B7 15.0268 YPLASLRSLF HIV GAG 507 1292.13 HPVHAGPIA HIV GAG 248 19.0044 VPLQLPPL HIV con. REV 71 Otros 1.0431 EVNIVTDSQY HIV POL 1187 1.0014 FRDYVDRFY HIV GAG 298 25.0113 IWGCSGKLI HIV1 ENV 69 25.0127 IYETYGDTW HIV1 VPR 92 1069.60 IYQEPFKNL HIV pol 1036 2.0129 IYQYMDDLY HIV pol 359 25.0128 PYNEWTLEL HIV1 VPR 56 25.0123 PYNTPVFAI HIV1 POL 74 1069.57 RYLKDQQLL HIV env 2778 1069.58 RYLRDQQLL HIV env 2778 1069.59 TYQIYQEPF HIV pol 1033 E99924233 27-10-2011   (continuación) Epitopes de HTL derivados de VIH Supertipo Péptido Secuencia Fuente SEQ ID NO: 1069.27 VIYQYMDDLY HIV pol 358 1069.26 VTVLDVGDAY HIV pol 265 25.0115 VWKEATTTL HIV1 ENV 47 25.0218 VWKEATTTLF HIV1 ENV 47 25.0219 YMQATWIPEW HIV1 POL 96 A2 1211.4 SLLNATAIAV HIV MN gp160 814(a) A3 F105,21 AIFQRSMTR HIV pol 337(a) F105.17 AIFQSSMTR HIV pol 337(a) F105.02 GIFQSSMTK HIV pol 337(a) . F105.03 AAFQSSMTK HIV pol 337(a) F105.04 AIAQSSMTK HIV pol 337(a) F105.05 AIFASSMTK HIV pol 337 (a) F105.06 AIFQASMTK HIV pol 337(a) F105.07 AIFQSAMTK HIV pol 337(a) F105.08 AIFQSSATK HIV pol 337(a) F105.09 AIFQSSMAK HIV pol 337(a) F105.11 FIFQSSMTK HIV pol 337(a) F105.12 SIFQSSMTK HIV pol 337(a) F105.16 AIFQCSMTK HIV pol 337(a) B7 1145.03 FPVRPQFPL HIV nef 84-92 análogo 1181.03 FPVRPQVPI HIV nef 84-92(a) 1292.14 HPVHAGPII HIV GAG 248 1292.09 FPISPIET1 HIV POL 179 1145.02 FPVTPQVPI. HIV nef 84-92 análogo 1145.22 FPVRMQVPL HIV nef 84-92 análogo 1181.04 FPVRPQVPM HIV nef 84-92(a) 1181.01 FPVRPQVPA HIV nef 84-92(a) 1181.02 FPVRPQVPV HIV nef 84-92(a) 1181.05 FPVRPQVPF HIV nef 84-92(a) 1181.06 FPVRPQVPW HIV nef 84-92(a) 41 E99924233 27-10-2011   Tabla 7 Epitopes de HTL derivados de P. falciparam Péptido Secuencia Fuente SEQ ID NO: F125.04 RHNWVNHA VPLAMKLI Pf SSP2 61 1188.34 HNWVNHAVPLAMKLI Pf SSP2 62 1188.16 KSKYKLATSVLAGLL Pf EXP1 71 LVNLLIFHINGKIIKNSE PfLSA1 13 F125.02 LVNLLIFHINGKIIKNS Pf LSA 113 27.0402 LLIFHINGKIIKNSE Pf LSA1 16 1188.32 GLAYKFVVPGAATPY Pf SSP2 512 27.0392 SSVFNVVNSSIGLIM Pf CSP 410 27.0417 VKNVIGPFMKAVCVE Pf SSP2 223 27.0388 MRKLAILSVSSFLFV Pf CSP 2 27.0387 1188.38 MNYYGKQENNWYSLKK KYKIAGGIAGGLALL 42 Pf CSP 53 Pf SSP2 494 1188.13 AGLLGNVSTVLLGGV Pf EXP1 82 27.0408 QTNFKSLLRNLGVSE Pf LSA 1 94 35.0171 PDSIQDSLKESRKLN Pf SSP2 165 35.0172 KCNLYADSAWENVKN Pf SSP2 211 Tabla 8 Epitopes de CTL derivados de P. falciparum Supertipo Péptido Secuencia Fuente SEQ ID NO: A2 1167.21 FLIFFDLFLV PfSSP2 14 1167.08 GLIMVLSFL PfCSP 425 1167.12 VLAGLLGNV Pf EXP1 80 1167.13 KILSVFFLA PfEXP1 2 1167.10 GLLGNVSTV Pf EXP1 83 1167.18 ILSVSSFLFV PfCSP 7 1167.19 VLLGGVGLVL Pf EXP1 91 A3 1167.36 LACAGLAYK PfSSP2 511 1167.32 QTNFKSLLR Pf LSAI 94 1167.43 VTCGNGIQVR PfCSP 375 1167.24 ALFFIIFNK Pf EXP1 10 E99924233 27-10-2011   (continuación) Epitopes de CTL derivados de P. falciparum Supertipo Péptido Secuencia Fuente SEQ ID NO: 1167.28 GVSENIFLK Pf LSA1 105 1167.47 HVLSHNSYEK Pf LSA1 59 1167.51 LLACAGLAYK Pf SSP2 510 1167.46 FILVNLLIFH Pf LSA1 11 B7 1101.03 MPLETQLAI Pf SHEBA 77 1167.61 TPYAGEPAPF PfSSP2539 A2 1167.14 FLIFFDLFL Pf SSP2 14 1167.16 FMKAVCVEV Pf SSP2 230 1167.15 LIFFDLFLV PfSSP2 15 1167.17 LLMDCSGSI Pf SSP2 51 1167.09 VLLGGVGLV Pf EXP1 91 B7 19.0051 LPYGRTNL Pf SSP2 126 Otros 16.0245 FQDEENIGIY Pf LSA1 1794 16.0040 FVEALFQEY Pf CSP 15 1167.54 FYFILVNLL Pf LSA1 9 1167.53 KYKLATSVL Pf EXP1 73 1167.56 KYLVIVFLI Pf SSP2 8 15.0184 LPSENERGY Pf LSA1 1663 16.0130 PSDGKCNLY Pf SSP2 207 16.0077 PSENERGYY Pf LSA1 1664 1167.57 PYAGEPAPF Pf SSP2 528 1167.55 YYIPHQSSL Pf LSA1 1671 Tabla 9. Activación de proliferación de células T por los vectores de expresión que codifican epitopes de MHC Clase II fusionados a secuencias dirigidas a MHC Clase II Inmunógeno PADRE 43 Péptido estimulante 1 OVA 323 NÚCLEO 128 péptido - CFA 2 3,0 (1.1) 2,7 (1.2) 3,2 (1,4) pEP2.(PAOS).(-) - - - pEP2.(AOS).(-) 5,6(1.8) - - pEP2.(PAOS).(sigTh) 5,0 (2.9) - 2,6(1,5) pEP2.(PAOS).(IgTh) 5,6 (2.1) - 3,0 (1,6) E99924233 27-10-2011   Inmunógeno PADRE (continuación) 44 Péptido estimulante 1 OVA 323 NÚCLEO 128 pEP2.(PAOS).(LampTh) 3,8 (1.7) - 3 pEP2.(PAOS).(IiTh) 5,2(2.0) 3,2 (1.5) 3,7 (1,5) pEP2.(PAOS).(H2M) 3,3 (1,3) 2,8 1 Media geométrico de cultivos con SI 2 2 . Respuesta proliferativa medida en el ganglio linfático Epitope Secuencia Tabla 10 Epitopes CTL en ADNc del minigen Inmunogenicidad in Vivo (IFA) MHC restringido Afinidad de unión de MHC [IC30% (nM)] No. CTLcultivos positivos Respuesta CTL (media geomx/÷SD) b HBV Núcleo 18 FLPSDFFPSV A2.1 3 6/6 73,0 (1,1) HBV Env 335 WLSLLVPFV A2.1 5 4/6 5,3 (1,6) HBV Pol 455 GLSRYVARL A2.1 76 ND c ND HIV Env 120 KLTPLCVTL A2.1 102 2/5 6,4 (1,3) HIV Pol 476 ILKEPVHGV A2.1 192 2/5 15,2 (2,9) HBV Pol 551-A YMDDVVLGA A2.1 200 0/6 - HBV Pol 551-V YMDDVVLGV A2.1 5 6/6 8,2 (2,3) HIV Env 49 TVYYGVPVWK A11 4 28 / 33 13,4 (3,1) HBV Núcleo 141 STLPETTVVRR A11 4 6/6 12.1 (2.6) HBV Pol 149 HTLWKAGILYK A11 14 6/6 13,1 (1,2) a Péptido analizado en ratones transgénicos HLA-A2.1/K b H-2 bxs por co-inmunización con un péptido de células T auxiliares T en IFA. b Media geométrica de la respuesta CTL de cultivos positivos. c ND, no realizado. E99924233 27-10-2011 LU   Tabla 11 Síntesis de inmunogenicidad del constructo de ADN de pMin.1 en ratones transgénicos HLA A2.1/K b Epitope Respuesta CTL a No. cultivos positivos/Total b Media Geom de respuesta de los cultivos positivos [x/÷SD] HBV Núcleo 18 9 / 9 455,5 [2,2] HIV Env 120 12 / 12 211,9 [3,7] HBV Pol 551-V 9 / 9 126,1 [2,8] HBV Pol 455 12 / 12 738,6 [1,3] HIV Pol 476 11 / 11 716,7 [1,5] HBV Env 335 12 / 12 43,7 [1,8] HBV Núcleo 18 (Theradigm)c 10 / 10 349,3 [1.8] a Los ratones se inmunizaron con ADN de pMin.1 o Theradigm-lipopéptido de HBV y la actividad CTL en cultivos de esplenocitos se determinó después de la estimulación in vitro con epitopes de péptidos individuales. Se muestran los resultados de 4 experimentos independientes b Ver Ejemplo V, Materiales y procedimientos para la definición de un cultivo positivo para CTL. c Respuesta de ratones inmunizados con Theradigm-lipopéptido HBV que contiene el epitope del núcleo 18 de HBV. Epitope Tabla 12 Síntesis de inmunogenicidad en ratones transgénicos HLA A2.1/K b Respuesta CTL a LU No. cultivos positivos/Total b Media Geom de respuesta de los cultivos positivos [x/÷SD] HBV Núcleo 141 5/9 128,1 [1,6] HBV Pol 149 6/9 267,1 [2,2] HIV Env 43 9/9 40,1 [2,9] a Los ratones se inmunizaron con ADN de pMin.1 la actividad CTL en cultivos de esplenocitos se determinó se determinó después de la estimulación in vitro con epitopes de péptidos individuales restringidos A11. Se muestra media geométrica de la respuesta CTL de tres experimentos independientes. b La definición de un cultivo positivo CTL se describe en el Ejemplo V, Materiales y procedimientos. LU E99924233 27-10-2011  


Reivindicaciones:

1. Un vector de expresión que comprende un promotor unido operativamente a una primera secuencia de nucleótidos que codifica una secuencia dirigida del complejo de histocompatibilidad mayor (MHC) fusionado a una segunda secuencia de nucleótidos que codifica dos o más epitopos del péptido heterólogo, en el que los epitopos del péptido heterólogo comprenden dos epitopos del péptido VIH (HTL) restringido de clase II o un epitopo del péptido VIH (CTL) restringido de clase I y un epitopo del péptido (HTL) restringido de clase II, en el que al menos uno de dichos epitopos del péptido VIH (HTL) restringido de clase II se selecciona del grupo de péptidos provisto en la Tabla 5; y en el que además dicho epitopo del péptido VIH (CTL) restringido de clase I se selecciona del grupo de péptidos provisto en la Tabla 6 2. El vector de expresión de la reivindicación 1, en el que los epitopos del péptido heterólogo comprenden dos o más epitopos del péptido VIH (HTL) restringido de clase II heterólogo. 3. El vector de expresión de la reivindicación 1, en el que los epitopos del péptido heterólogo comprenden un epitopo del péptido VIH (CTL) restringido de clase I y un epitopo del péptido (HTL) restringido de clase II. 4. El vector de expresión de la reivindicación 2, en el que los epitopos del péptido heterólogo además comprenden uno o más epitopos del péptido VIH (CTL) restringido de clase I. 5. El vector de expresión de la reivindicación 3, en el que los epitopos del péptido heterólogo además comprenden dos o más epitopos del péptido VIH (CTL) restringido de clase I. 6. El vector de expresión de la reivindicación 3, en el que los epitopos del péptido heterólogo además comprenden dos o más epitopos del péptido VIH (HTL) restringido de clase II. 7. El vector de expresión de la reivindicación 2, en el que los epitopos del péptido heterólogo además comprenden un epitopo del péptido VIH (HTL) restringido de clase II universal. 8. El vector de expresión de la reivindicación 3 o 7, en el que el epitopo del péptido VIH (HTL) restringido de clase II universal es un epitopo pan DR. 9. El vector de expresión de la reivindicación 8, en el que el epitopo pan DR tiene la secuencia AlaLysPheValAlaAlaTrpThrLeu-LysAlaAlaAla (SEQ ID NO:38). 10. El vector de expresión de la reivindicación 1, en el que la secuencia dirigida a MHC comprende una región de un polipéptido seleccionado del grupo que consiste en la proteína II, LAMP-I, HLS-DM, HLA-DO, H2-DO, proteína de la matriz de la gripe, antígeno de superficie de hepatitis B, antígeno del núcleo de hepatitis B, partícula Ty, proteína Ig, proteína Ig-ß, y secuencia señal de la cadena kappa de Ig. 11. El vector de expresión de la reivindicación 1, en el que el vector de expresión también comprende un segundo promotor unido operativamente a una tercera secuencia de nucleótidos que codifica uno o más epitopos del péptido (HTL) restringido heterólogo de clase II o epitopos del péptido (CTL) restringido de clase I. 12. El vector de expresión de la reivindicación 1, en el que el vector comprende pMin.1 o pEP2, enunciados en las SEQ ID NOs: 38 y 35, respectivamente. 13. El vector de expresión de la reivindicación 3 o 4, en el que el epitopo del péptido (CTL) restringido de clase I comprende un motivo estructural para un supertipo HLA, por el cual el epitopo del péptido (CTL) restringido de clase I se une a dos o más miembros del supertipo con una afinidad mayor que 500 nM. 14. El vector de expresión de la reivindicación 4 o 5, en el que los epitopos del péptido (CTL) restringido de clase I tienen motivos estructurales que proporcionan afinidad de unión para más de un supertipo de alelo de HLA. 15. El vector de expresión de cualquiera de las reivindicaciones 1-14 para su uso en un procedimiento de inducir una respuesta inmune en un sujeto mamífero. 16. Un vector de expresión que comprende un promotor unido operativamente a una primera secuencia de nucleótidos que codifica una secuencia dirigida al complejo de histocompatibilidad mayor (MHC) fusionada a una segunda secuencia de nucleótidos que codifica un epitopo del péptido de VIH (HTL) restringido de clase II heterólogo humano, en el que dicho epitopo del péptido de VIH (HTL) restringido de clase II del péptido de VIH se selecciona del grupo que consiste en: AETFYVDGAANRETK, EKVYLAWVPAHKGIG, EVNIVTDSQYALGII, FRKYTAFTIPSINNE, 46 E99924233 27-10-2011   GAVVIQDNSDIKVVP, GEIYKRWIILGLNKI, HSNWRAMASDFNLPP, IKQFINMWQEVGKAMY, KRWIILGLNKIVRMY, KTAVQMAVFIHNFKR, KVYLAWVPAHKGIGG, QGQMVHQAISPRTLN, QHLLQLTVWGIKQLQ, QKQITKIQNFRVYYR, SPAIFQSSMTKILEP, WAGIKQEFGIPYNPQ, WEFVNTPPLVKLWYQ, y YRKILRQRKIDRLID para su uso en un procedimiento de inducir una respuesta inmune in vivo que comprende administrar dicho vector de expresión a un sujeto mamífero. 17. El vector de expresión de la reivindicación 16, en el que la segunda secuencia de nucleótidos además comprende dos o más epitopos del péptido VIH (HTL) restringido de clase II heterólogo. 18. El vector de expresión de la reivindicación 16, en el que la segunda secuencia de nucleótidos también comprende uno o más epitopos del péptido VIH (CTL) restringido de clase I heterólogo. 19. El vector de expresión de la reivindicación 16, en el que la segunda secuencia de nucleótidos también comprende un epitopo del péptido (HTL) restringido universal de clase II. 20. El vector de expresión de la reivindicación 19, en el que el epitopo del péptido VIH (HTL) restringido de clase II universal es un epitopo pan DR. 21. El vector de expresión de la reivindicación 20, en el que el epitopo pan DR tiene la secuencia AlaLysPheValAlaAlaTrpThrLeu-LysAlaAlaAla (SEQ ID NO:38). 22. El vector de expresión de la reivindicación 16, en el que la secuencia dirigida a MHC comprende una región de un polipéptido seleccionada del grupo que consiste en la proteína II, LAMP-I, HLS-DM, HLA-DO, H2-DO, proteína de la matriz de la gripe, antígeno de superficie de hepatitis B, antígeno del núcleo de hepatitis B, partícula Ty, proteína Ig-, proteína Ig-ß, y secuencia señal de la cadena kappa de Ig. 23. El vector de expresión de la reivindicación 16, en el que el vector de expresión también comprende una segunda secuencia promotora unida operativamente a una tercera secuencia de nucleótidos que codifica uno o más epitopos del péptido (HTL) restringido heterólogo de clase II o (CTL) restringido de clase I. 24. El vector de expresión de la reivindicación 18, en el que el epitopo del péptido (CTL) restringido de clase I comprende un motivo estructural para un supertipo HLA, por el cual el epitopo del péptido se une a dos o más miembros del supertipo con una afinidad mayor que 500 nM. 25. El vector de expresión de la reivindicación 18, en el que los epitopos del péptido (CTL) restringido de clase I tienen motivos estructurales que proporcionan afinidad de unión para más de un supertipo de alelo de HLA. 47 E99924233 27-10-2011   48 E99924233 27-10-2011   49 E99924233 27-10-2011   E99924233 27-10-2011   51 E99924233 27-10-2011   52 E99924233 27-10-2011   FIG 5 53 E99924233 27-10-2011   FIG 6 54 E99924233 27-10-2011   FIG 7 E99924233 27-10-2011   FIG 7 continuación 56 E99924233 27-10-2011   FIG 8 57 E99924233 27-10-2011   FIG 8 Continuación 58 E99924233 27-10-2011   FIG. 9 59 E99924233 27-10-2011   FIG 10 E99924233 27-10-2011   FIG 11 61 E99924233 27-10-2011   FIG 12 62   FIG 12 Continuación 63   FIG 13 64   FIG 13 Continuación   FIG 13 Continuación 66   FIG 14 67   FIG 14 Continuación 68   FIG 15 69   FIG 15 Continuación   FIG 16 71   FIG 16 Continuación 72   FIG 17 73   FIG 17 Continuación 74   FIG 18   FIG 19 76   FIG 19 Continuación 77   FIG 19 Continuación 78   FIG 19 Continuación 79   FIG 19 Continuación   FIG 19 Continuación 81   FIG 19 Continuación 82   FIG 19 Continuación 83   FIG 20 84   FIG 21   FIGURA 22 86   FIGURA 23 87   FIGURA 24 88   FIGURA 25 89




Acerca de · Contacto · Patentados.com desde 2007 hasta 2014 // Última actualización: 25/10/2014.