Variantes del virus de la hepatitis B resistentes a ciertos análogos nucleósidos, pero sensibles a otros, y usos de las mismas.

Una variante aislada del VHB que comprende al menos la mutación de un nucleotido en el gen de la ADN polimerasa en la posición cod6nica 233 segun el esquema de numeracion independiente del genotipo para la polimerasa del HBV

, lo que da como resultado una sustitución de una isoleucina por valina, I233V.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2006/002351.

Solicitante: RHEINISCHE FRIEDRICH-WILHELMS-UNIVERSITAT BONN.

Inventor/es: KAISER, ROLF, VOGEL, MARTIN, SCHILDGEN,OLIVER, MATZ,BERTFRIED, ROCKSTROH,JUERGEN, DAEUMER,MARTIN, HELM,MARTIN, WEITNER,LUTWIN, SCHEWE,CARL KNUD, GERLICH,WOLFRAM.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > C12N7/00 (Virus, p. ej. bacteriófagos; Composiciones que los contienen; Su preparación o purificación (preparaciones de uso médico que contienen virus A61K 35/76; preparación de composiciones de uso médico que contienen antígenos o anticuerpos virales, p. ej. vacunas virales, A61K 39/00))
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/70 (en los que intervienen virus o bacteriófagos)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/01 (Preparación de mutantes sin introducción de material genético extraño; Procedimientos de cribado para ello)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/51 (Virus de la hepatitis)
  • SECCION C — QUIMICA; METALURGIA > QUIMICA ORGANICA > PEPTIDOS (péptidos que contienen β -anillos lactamas... > Péptidos con más de 20 aminoácidos; Gastrinas;... > C07K14/02 (Hepadnaviridae, p. ej. virus de la hepatitis B)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/36 (Hepadnaviridae)

PDF original: ES-2470318_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Variantes del virus de la hepatitis B resistentes a ciertos analogos nucleosidos, pero sensibles a otros, y usos de las

mismas.

La presente invenciOn versa sobre el campo de variantes del virus de la hepatitis B (VHB, tambien denotado como

virus VHB) que presentan una sensibilidad reducida a agentes particulares. Mas en particular, la presente invencion versa sobre el campo de la diagnosis de la susceptibilidad de una muestra del VHB a farmacos antivirales usados para tratar una infección del VHB y sobre un procedimiento y/o un ensayo para la detección rapida y fiable de mutaciones inducidas por farmacos en los genes del VHB que permiten la caracterizacion simultanea de una gama de codones implicados en la resistencia a los farmacos.

El VHB es un virus ADN de envoltura pequena con una longitud de aproximadamente 3200 pb perteneciente a la familia de los Hepadnaviridae. El virus se replica mediante un intermediario de ARN y utiliza la transcripcion inversa en su estrategia de replicacion (Summers, 1982) . El genoma del VHB es de naturaleza compleja, teniendo una estructura de ADN parcialmente bicatenaria con marcos de lectura abiertos (ORF) solapados que son (i) el ORF preC/C, que codifica el antigeno e secretado (HBeAg) y la proteina central de la nucleocapside (HBcAg) ,

respectivamente; (ii) el ORF P, que codifica la polimerasa viral/transcriptasa inversa; (iii) el ORF preS1/preS2/S, que codifica las proteinas de la envoltura viral, y el antigeno s grande, mediano y pequefio (HBsAg) , respectivamente; y

(iv) el ORF X, que codifica la proteina transactivadora transcripcional que codifica polimerasa de superficie, central y genes X.

Los virus de la hepatitis B muestran una gran variabilidad genetica en sus genomas, reconociendose en la

actualidad siete genotipos de VHB (A a G) (Stuyver y otros, 2001; Stuyver y otros, 2000) . El virus, que se propaga mediante contacto con sangre infectada, puede causar un estado de enfermedad debilitante y puede conducir a insuficiencia hepatica aguda. Aunque la mayoria de los adultos puede repeler la infeccion sin tratamiento, la infección de hepatitis B puede desarrollarse adquiriendo una forma cronica. En realidad, aproximadamente 400 millones de personas en el mundo entero estan infectadas de forma cronica con el VHB y se preve que aproximadamente del 15 al 40% de los portadores cranicos de VHB desarrollaran cirrosis y hepatopatia terminal. Sin tratamiento, el pronOstico de estos pacientes es malo; en consecuencia, el desarrollo de terapia antiviral efectiva para el VHB sigue siendo una meta importante. El objetivo principal de la terapia es controlar la replicacion del VHB e inducir la remision de la hepatopatia para detener la evoluciOn hacia la cirrosis y el cancer hepaticï. El tratamiento esta indicado para pacientes con inflamacion activa, niveles elevados de alanina aminotransferasa (ALT) debidos a la destruccion de celulas hepaticas, y niveles de ADN del VHB (niveles de replicacion viral) superiores a 100.000 copias/ml.

Los farmacos actuales autorizados para el tratamiento de la hepatitis B cranica son los interferones alfa y los analogos nucleosidos o combinaciones de los farmacos. Un analog () nucleosido es un nucleotido modificado quimicamente que actua como bloque funcional sustituto en el proceso de replicacion viral que inhibe la replicacion

del VHB.

Se ha demostrado que la terapia con interferon (IFN) es parcialmente efectiva unicamente en un grupo pequefio de portadores (Lok, 1994) y que tambien esta limitada debido a graves efectos secundarios. Este fracaso relativo del IFN-a para el tratamiento de la infeccion cronica del VHB ha Ilevado a la basqueda de agentes y regimenes terapeuticos adicionales. En particular, se ha demostrado que varios analogos nucleosidos inhiben la replicacion de los Hepadnavitidae por medio de la inhibicion de la ADN polimerasa/transcriptasa inversa de los Hepadnavitidae. Algunos de estos compuestos ya han sido retirados del uso clinico debido a su toxicidad (lobucavir) o su falta de eficacia (famciclovir) (De Clercq, 1999; Schinazi, 1997; Luscombe y otros, 1996) . En este momento, el analogï nucleOsido de nnas exitï para el tratamiento de la hepatitis B cronica es, sin duda, el enantiOmero (-) , medicamente autorizado, de la 3'-tiacitidina (3TC o lamivudina (LMV) ) (Jarvis y otros, 1999) . El farmaco tiene una potente actividad antiviral contra el virus, se tolera bien y tiene pocos efectos adversos. Sin embargo, la terapia a largo plazo con lamivudina se asocia frecuentemente con la apariciOn de resistencia viral. Una de las mutaciones comunes que confieren resistencia a la lamivudina y reducen la eficiencia de replicacion in vitro del virus es una sustituciOn de metionina por isoleucina o de metionina por valina en el codon 204 del ADN del VHB dependiente del ARN (Ling R. y otros, 1996; Bartholomew M. y otros, 1997; Tipples G.A. y otros, 1996) . Adernas de la alteraciOn de esta sustituciOn delos aminoacidos Met por Val o por Ile (rtM204V/I) en el motivo YMDD conservado, se han asociado con la resistencia a la lamivudina patrones genotipicos mutados en otros sitios del gen de la transcriptasa inversa. En particular, se ha documentado que la mutaciOn de leucina a metionina en el cod& 180 (rtL180M) en el dominio B de la polimerasa restaura parcialmente la aptitud para la replicaciOn, y que aumenta la resistencia a los farmacos in vitro. En pacientes coinfectados con VHBNIH, el desarrollo de la resistencia a la lamivudina es mas frecuente que

enlos pacientes monoinfectados con VHB, lo que hace indispensable la creación de una terapia alternativa a la aplicacion de lamivudina (Benhamou y otros, 2001; Benhamou y otros, 2003; Benhamou y otros, 2004; Dore G.J. y otros, 2004) .

Otro analogï nucleosido aplicable para el tratamiento de la hepatitis B cronica es el adefovir dipivoxil, profarmaco del adefovir (ADF) . Los estudios in vitro e in vivo han demostrado que este farmaco es capaz de inhibir cepas de

referenda del VHB, asi como las que muestran resistencias a la lamivudina. Por lo tanto, el ADF puede servir como terapia alternativa para el tratamiento de la infeccion crOnica del VHB en casos en los que se ha dado la resistencia a la lamivudina. Hasta el momenta, el ADF ha superado con exito los estudios clinicos de fase III (Westland CE y otros, 2003) . Ya se han descrito dos mutaciones que median la resistencia al ADF. Estas mutaciones estan situadas enel codOn 181 (dominio B) y en el codón 236 (dominio D) del gen de la transcriptasa inversa y dan como resultado

una sustitucion de aminoacidos de Ala a Val (rtA181V) y Asn a Thr (rtN236T) , respectivamente (Angus P. y otros, 2003; Yang H. y otros, 2003; WO 2003/087352; WO 2004/031224) . La frecuencia de la mutaciOn rtA181V es de aproximadamente el 2, 5%, con una relevancia clinica hasta ahora desconocida, mientras que 1, 7-2, 5% de los pacientes tratados con adefovir revelan la mutación de resistencia rtN236T.

Estudios publicados recientemente por Perrillo y otros (2004) , asi como por Peters y otros (2004) , demuestran que aproximadamente del 85% al 92% de los pacientes con resistencia a la lamivudina tendran una disminucion en su nivel de ADN del VHB igual o mayor que dos magnitudes logaritmicas mientras reciban ADF. Esto implica que un 815% de los pacientes no logran una reducción significativa en los niveles de ADN del VHB cuando se afiade ADF a la terapia. Por lo tanto, existe un precedente de un subgrupo de pacientes con VHB resistente a la lamivudina que no

lograran una respuesta virologica con terapia de ADF. La razor) de la falta de respuesta al ADF sigue estando poco clara.

Por lo anterior, parece que existe la necesidad de monitorizar la aparición o la presencia de variantes... [Seguir leyendo]

 


Reivindicaciones:

1. Una variante aislada del VHB que comprende al menos la mutación de un nucleotido en el gen de la ADN polimerasa en la posición codónica 233 segun el esquema de numeracion independiente del genotipo para la polimerasa del HBV, lo que da como resultado una sustitución de una isoleucina por valina, I233V.

2. Una variante aislada del VHB segun la reivindicacion 1 en la que dicha variante presenta una sensibilidad disminuida a un analogï nucleOsido, salvo tenofovir.

3. Una variante aislada del VHB segun la reivindicaciOn 2 en la que dicha variante presenta una sensibilidad disminuida al analogï nucleOsido adefovir y/o a la lamivudina.

4. Una variante aislada del VHB segun una cualquiera de las reivindicaciones 1 a 3 que comprende una o mas mutaciones adicionales de nucleotidos en el gen de la ADN polimerasa escogidos del grupo constituido de un nucleótido en el cod& 173, en el codón 204 y en el cod& 219 en la que dicha mutación adicional de nucleotidos en posiciOn codonica 173 del gen de la polimerasa da como resultado la sustituciOn del aminoacido valina por cualquier aminoacido distinto de la valina; en la posición cock:mica 204 del gen de la polimerasa da como resultado la sustitución del aminoacido metionina por cualquier aminoacido distinto de la metionina; y en la posicion codónica

219 del gen de la polimerasa da como resultado la sustitución del aminoacido serina por cualquier aminoacido distinto de la serina.

5. Una variante aislada del VHB segOn la reivindicacion 4 en la que dicha mutacion adicional de nucleotidos en el cod& 204 da como resultado la sustitución del aminoacido metionina por isoleucina; en el codón 173 da como resultado la sustitución del aminoacido valina por leucina; y en el cod& 219 da como resultado la sustitucion del

aminoacido serina por alanina.

6. Un acidï polinucleico aislado del VHB obtenido de una variante del VHB segOn se describe en cualquiera de las

reivindicaciones 1 a 5 que comprende una mutación de nucleotidos que da como resultado una sustitucion del aminoacido en la posición codonica 233 de isoleucina a valina, I233V, o un fragmento de dicho acidï polinucleico del VHB que comprenda dicha mutacion de nucleotidos.

7. Un acidï polinucleico aislado del VHB segun la reivindicacion 6 que comprende una mutación adicional de nucleotidos que afecta a la posición cock:mica 204 del gen de la ADN polimerasa en la variante del VHB y da como resultado la sustitución del aminoacido metionina por cualquier aminoacido distinto de la metionina, o un fragmento de dicho acidï polinucleico del VHB que comprenda las mutaciones de nucleotidos.

8. Un acido polinucleico aislado del VHB segun la reivindicaciOn 7 que comprende una mutación de nucleOtidos que

da como resultado la sustituciOn rtI233V en el dominio D del gen de la ADN polimerasa en la variante del VHB, y una mutación de nucleotidos que da como resultado la sustitución rtM2041 en el dominio C del gen de la ADN polimerasa en la variante del VHB, o un fragmento de dicho acido polinucleico del VHB que comprenda las mutaciones de nucleotidos.

9. Un acido polinucleico aislado del VHB segun una cualquiera de las reivindicaciones 6 a 8 que comprende un

acido polinucleico escogido del grupo que consiste en las ID SEC 1, ID SEC 2, ID SEC 3, ID SEC 4, ID SEC 5, ID SEC 6, ID SEC 7, ID SEC 8, ID SEC 9 e ID SEC 10.

10. Un producto de expresión del VHB proveniente de un acidï polinucleico aislado del VHB o cualquier fragmento del mismo segiin se describe en una cualquiera de las reivindicaciones 6 a 9.

11. Un producto de expresion del VHB segun la reivindicacion 10 que comprende un acidï poliaminico escogido del

grupo que consiste en las ID SEC 11, ID SEC 12, ID SEC 13, ID SEC 14, ID SEC 15, ID SEC 16, ID SEC 17, ID SEC 18, ID SEC 19 e ID SEC 20.

12. Una composición que comprende una variante aislada del VHB segun se describe en una cualquiera de las reivindicaciones 1 a 5.

13. Una composición que comprende un acidï polinucleico aislado del VHB o cualquier fragmento del mismo segOn sedescribe en una cualquiera de las reivindicaciones 6 a 9.

14. Una composición que comprende un producto de expresiOn del VHB segun se describe en las reivindicaciones

u 11.

15. El uso de una variante aislada del VHB sew:HI se describe en una cualquiera de las reivindicaciones 1 a 5 o un acidï polinucleico aislado del VHB segun se describe en una cualquiera de las reivindicaciones 6 a 9 o un producto

de expresión del VHB segOn se describe en las reivindicaciones 10 u 11 o una composicion segun se describe en las reivindicaciones 12 o 13, en un procedimiento para la selecciOn de al

menos un farmaco contra el VHB sin

resistencia cruzada.

16. El uso de una variante aislada del VHB segiin se describe en una cualquiera de las reivindicaciones 1 a 5 o un acido polinucleico aislado del VHB segon se describe en una cualquiera de las reivindicaciones 6 a 9 o un producto de expresión del VHB segun se describe en las reivindicaciones 10 u 11 o una composiciOn segun se describe en las reivindicaciones 12 o 13, en un procedimiento para la detecciOn de una variante del VHB.

17.El uso de tenofovir para la fabricacion de una composición farmaceutica para curar a un sujeto infectado con una variante aislada del VHB segim se describe en una cualquiera de las reivindicaciones 1 a 5, VHB que es resistente a la lamivudina y/o al adefovir.

18. Un procedimiento para detectar la presencia de una variante del VHB segun se describe en una cualquiera de las reivindicaciones 1 a 5 en una muestra biologica, comprendiendo dicho procedimiento la etapa de deteccion de la

presencia de la mutación que da como resultado una sustitución de aminoacido en la posicion codonica 233 de isoleucina a valina en un acido polinucleico o un fragmento del mismo sew:Jr' se describe en una cualquiera de las reivindicaciones 6 a 9.

19. Un procedimiento segun la reivindicacion 18 que comprende:

a. obtener un acido polinucleico del VHB diana a partir de dicha muestra biolOgica, sospechandose que dicho acido

polinucleico del VHB diana comprende un cod& 233 codificador de valina del dominio de la transcriptasa inversa del VHB, y consistiendo opcionalmente uno o mas de los codones escogidos del grupo consistente en un codon 173 codificador de leucina, un codex, 204 codificador de isoleucina o un codón 204 codificador de valina o un codOn 204 codificador de serina, un codOn 219 codificador de alanina, un codon 180 codificador de metionina, un codón 181 codificador de valina, un codOn 217 codificador de arginina y un codon 236 codificador de treonina del dominio de la

transcriptasa inversa del VHB de un virus VHB;

b. obtener la secuencia de acidos nucleicos del acido polinucleico del VHB diana de (a) ;

c. inferir, a partir de la secuencia de acidos nucleicos obtenida en (b) , la presencia de dicho codón 233 codificador de

valina del dominio de la transcriptasa inversa del VHB, y opcionalmente uno o mas codones escogidos del grupo mencionado en (a) y, a partir de ello, la presencia de dicho virus VHB en dicha muestra biologica y/o dicha resistencia a un farmaco antiviral de un virus VHB presente en dicha muestra biologica.

20. Un procedimiento segtin la reivindicaciOn 19 que comprende:

a. obtener un acido polinucleico del VHB diana presente en dicha muestra biolOgica y/u obtener la secuencia de nucleotidos del mismo;

b.cuando sea apropiado, desnaturalizar parcial o completannente, o modificar enzimaticamente los acidos polinucleicos obtenidos en la etapa (a) ;

c. cuando sea apropiado, renaturalizar los acidos polinucleicos desnaturalizados obtenidos en la etapa (b) , preferentemente en presencia de al menos un oligonucleótido que tiene secuencias de nucleOtidos complementarias sustancialmente homologas capaces de discriminar, en funciOn de la hibridacion, en un acido polinucleico del VHB o un fragmento del mismo, entre un codon 233 codificador de valina en el dominio de la transcriptasa inversa del VHB y un codón 233 que codifica una isoleucina en el dominio de la transcriptasa inversa del VHB, y, si hace falta, incluir

la etapa de modificaciOn enzimatica, incluyendo la extensiOn, de dicho oligonucleOtido;

d. cuando sea apropiado, detectar los acidos polinucleicos del VHB parcial o completamente desnaturalizados obtenidos en la etapa (b) , y/o de los hibridos formados en la etapa (c) , y/o de las modificaciones enzimaticas obtenidas en las etapas (b) y/o (c) ;

e. inferir, a partir de uno o mas de los datos de los grupos siguientes: los acidos polinucleicos parcial o completamente desnaturalizados, los hibridos, las modificaciones enzimaticas, todos detectados en la etapa (d) , y de la secuencia de nucleOtidos obtenida en (a) , la presencia de dicho VHB en dicha muestra biologica y/o dicha resistencia a un farmaco antiviral de un VHB presente en dicha muestra biologica.

21. El procedimiento de deteccion de la presencia de una variante del VHB sew:in la reivindicacion 18 que comprende:

a. obtener un acido polinucleico del VHB diana a partir de dicha muestra biologica, sospechandose que dicho acido polinucleico del VHB diana comprende un codón 233 codificador de valina del dominio de la transcriptasa inversa del

VHB, y opcionalmente con uno o mas de los codones escogidos del grupo consistente en un cod& 173 codificador de leucina, un codón 204 codificador de isoleucina o un codón 204 codificador de valina o un codon 204 codificador de serina, un cod& 219 codificador de alanina, un cod& 180 codificador de metionina, un codOn 181 codificador de valina, un cod& 217 codificador de arginina y un codon 236 codificador de treonina del dominio de la transcriptasa inversa del VHB de un VHB;

b. poner en contacto el acidï polinucleico del VHB diana de (a) con un oligonucleotido que tenga secuencias de nucleotidos complementarias sustancialmente homOlogas capaces de discriminar, en función de la hibridacion, entre un codón 233 que codifica una isoleucina y un codOn 233 que codifica una alanina o una valina, y opcionalmente tambien capaz de discriminar, en uno o mas codones escogidos del grupo, entre un codon 173 que codifica una valina y un codon 173 que codifica una leucina, entre un codón 204 que codifica una metionina y un codón 204 que codifica un aminoacido escogido del grupo que consiste en isoleucina, valina y serina, entre un codón 219 que codifica una serina y un codón 219 que codifica una alanina, entre un cod& 180 que codifica una leucina y un cod 180 que codifica una metionina, entre un codOn 181 que codifica una alanina y un coat.) 181 que codifica una valina, entre un codón 217 que codifica una leucina y un codón 217 que codifica una arginina y entre un codón 236 que

codifica una asparagina y un cod& 236 que codifica una treonina;

c. inferir, a partir de la seal discriminatoria obtenida en (b) , la presencia de dicho cod& 233 codificador de valina de la transcriptasa inversa del VHB, opcionalmente junto con dicho codón 173 codificador de leucina o dicho codon 219 codificador de alanina o dicho codón 180 codificador de metionina, o dicho cod& 181 codificador de valina o dicho

codOn 204 codificador de isoleucina o dicho codón 204 codificador de valina o dicho codón 204 codificador de serina, o dicho codon 217 codificador de arginina o dicho codón 236 codificador de treonina del dominio de la transcriptasa inversa del VHB de un VHB; y, a partir de ello, la presencia de dicho VHB en dicha muestra biologica y/o dicha resistencia a un farmaco antiviral de un virus VHB presente en dicha muestra biologica.

22. Un kit de diagnóstico para detectar la presencia de una variante del VHB en una muestra biologica y/o para detectar resistencia a un farmaco antiviral de un VHB presente en una muestra biologica, comprendiendo dicho kit un medio para detectar la presencia de la mutacion resultante en una sustitucion en la posiciOn codonica 233 del aminoacido isoleucina por valina en un acido polinucleico segun se describe en una cualquiera de las reivindicaciones 6 a 9.

23. Un kitde diagnOstico segun la reivindicacion 22 que comprende:

a. un medio para inferir —a partir de la secuencia de acidos nucleicos de un acido polinucleico diana que se sospecha que comprende un codon 233 codificador de valina del dominio de la transcriptasa inversa del VHB, opcionalmente junto con uno o mas de los codones escogidos del grupo consistente en un codón 173 codificador de leucina, un cod& 204 que codifica un aminoacido escogido del grupo que consiste en isoleucina, valina y serina, un codOn 219 codificador de alanina, un codOn 180 codificador de metionina, un cod& 181 codificador de valina, un coder' 217 codificador de arginina y un codon 236 codificador de treonina del dominio de la transcriptasa inversa del VHB— la presencia de dicho cod& 233 codificador de valina del dominio de la transcriptasa inversa del VHB, opcionalmente junto con uno o mas codones del grupo que consiste en dicho codón 173 codificador de leucina, dicho codón 204 codificador de isoleucina o dicho codón 204 codificador de valina o dicho codón 204 codificador de

serina, dicho cod& 219 codificador de alanina, dicho codon 180 codificador de metionina, dicho codOn 181 codificador de valina, un codon 217 codificador de arginina y un codón 236 codificador de treonina del dominio de la transcriptasa inversa del VHB; y, a partir de ello, la presencia en dicha muestra biologica de dicho virus VHB y, opcionalmente,

b. un medio para obtener la secuencia de acidos nucleicos del acidï polinucleico diana.

24. Un kit de diagnostico segun cualquiera de las reivindicaciones 22 y 23 que comprende un oligonucleotido capaz de discriminar entre un cod& 233 que codifica una valina y un codOn 233 que codifica una isoleucina.

25. Un procedimiento para buscar farmacos activos contra un VHB que comprende un acidï polinucleico segun cualquiera de las reivindicaciones 6 a 9 que comprende:

a. medir la replicacion de dicho VHB en ausencia de dicho farmaco;

b. medir la replicacion de dicho VHB en presencia de dicho farmaco;

c.inferir de (a) y (b) el efecto inhibitorio de dicho farmaco sobre la replicacion de dicho VHB.

26. Un oligonucleotido que tiene secuencias de nucleotidos complementarias sustancialmente hornologas capaces de discriminar, en función de la hibridación, en un acidï polinucleico del VHB o un fragmento del mismo, segun se ha descrito en cualquiera de las reivindicaciones 6 a 9, entre un codón 233 que codifica una valina y un codón 233

que codifica una isoleucina.

4, ckorl

Paciente 1 Lmv I TDF I ADF I TDF

7 6 5 4

—J

3

1 0

%0 0if, bp0cpAOcb0 'Si cp0 0cp0

el/ NsemanaNebNtP43 S*15P Paciente 2

LMV I ADF I 'TDF 8 7

- g 5 4 3 2 1

NC) (t3 05' 99cPeN'S.:2949.A.4) ï, R404) ï, 430) semana

Paciente 3

LMV IADF1 TDF 9 8 7

- g 6

I

CO .4

1 0

k 4:5 pyi to bo qs) , 0 sts) op 00 NO (, ) 0 to (oo cp 410semana FIGURA 1 cp o■ et,

29

Paciente 1

vLs s s ssscr it As ssc WPF W vcc pcvL *PQ• IDSEC 11 1 -GCGTTTTATC ATCTTCCTCT TCATCCTGCT GCTATGCCTC ATCTTCTTGT TOG'PTCTTCT GGACTATCAA GGTATOTTGC CCGTGTCTCC TCTAATTCCA IDSEC 1 CGCAAAATAG TAGAAGGAGA AGTAGOACGA CGATACGGAG TAGAAGAACA ACCAAGAAGA CCTGATAGTT CCATACAACG GGCACACAGG AGARTAAGGT IDSEC 2

VPN LR T IDSEC 11 101 GOATCTCCGA CCACCAGTAC GGGACCATGC AGAACCTGCA CGACTATTGC TCAAGOAACC TCTATGTATC CCTCCTGTTG CTOTACCAAA CCTTCOGACG IDSEC 1

• DLR PPVR DMA EP A RLLL REP LCI PP VA

ID SEC 2

CCTAGAGGCT OGTOGTCATO CCCFGOTACG TCTTOGACGT GCTGATAACG AGTTCCITGO AGATACATAG GGAGGACRAC ORCATGGIVT GGAROCCFCC

/ AP VPP SI I LGFR KIP NOV G L S P F L LAQP TsAz• ID SEC 11 201 GAAATTGCAC CT3TATTCCC ATCCATCATC CTGGGCTTTC GGAAAATTCC TATGGGAGTG GGCCTCAGCC COTT'FCTCCT GGCTCAGTTT ACTAGTGCC.A IDSEC 1

CTTTAACGTG GACATAAGGG TAGGTAGTAG GACCCOMAG CCTTTTAAGG ATACCCTC.AC CO3GAGTCGG GCAAAGAGGA CCGAGTCAAA TGATCACGOT

IDSEC 2

MOD V VLG AK S VQ/IL E AL• IDSEC 11 301 'TTTOTTCAGT GGTTCGTAGG GCTTTCCCCC ACTGITTGGC TTTCAGTTAT ATGGATGATG TGGTATTGGG GGCCAAGTCT GTACAGCATC TTGAGGCCCT IDSEC 1

•CSV VRRAF PR CL A P S Y

AAACAAGTCA CCAAGCATCC CGAAAGGGGG TGACAAACCG AAAGTCAATA TACCTACTAC ACCATAACCC CCGG'ITCAGA CATGTCGTAG AACTCCGGGA IDSEC 2

T K IDSEC 11 401 T'FTTACCGCT GTTACCAATT TTCTITTGTC TTTGGGTGTA CATTTAAACC CTAACAAAAC AAAAA IDSEC 1

' PTA VTNF LLB LGV ELNP NK

IDSEC 2

AAAATGGCGA CAATOGTTAA. AAGAAAACAG AAACCCACAT GTAAATTTGG emrrarrrrc TTTTT

FIGURA 2a

Paciente 2 bADF

A F Y ELF L HP A AMP HLL VGSS GLS ATV ARLS S N S • ID SEC 12

1 CGGCGTTTTA TCATCTTCCT CTTCATCCTG CTGCTATGCC TCATCTTCTT GTTGGTTCTT CTGGACTATC AAGOTATOTTGCCCOFFTGT CCTCTAATTC ID SEC 3

GCCGCAAAAT AGTAGAAGGA GAAGTAGGAC GACGATACGG AGTAGAAGAA CAACCAAGAA GACCTGATAG TTCCATACAA CGGOCAAACA GGAGATTAAG ID SEC 4

• R/F NHQH GTM QNL HDYC SRN LYV SLLL LYQ TPG ID SEC 12

101 CAGGATCFFC AACCACCAGC ACOGGACCAT'OCAGAACCTG CACGACTATT GCTCAAGGAA CCTCTATGTA TCCCTCCTGT TGCTOTACCA AACCTTCGGA • ID SEC 3 GTCCTAGAAG TTGGTGOTCO TGCCCTGGTA COTCTTGGAC GTGCTGATAACGAGTTCCTTGGAGATACAT AGGGAGGACA ACGACATGGT TTGGAAGCCT

ID SEC 4

L AQ FT S A• ID SEC 12 201 CGGAAATTGC ACCTGTATTC CCATCCCATC ATCCTGGGCT TTCGGAAAAT

AXLE LYS HPI ILGF RKI PMG VGLS PPL

TCCTATOGGA GTGGOCCTCA GCCCGTTTCT CCTGGCTCAG ITTACTAGTG IDSEC 3 IDSEC 4

GGTAGGGTAG TAGGACCCGA AAGCCTTTTA AGGATACCCT CACCCGGAGT CGGGCAAAGA GGACCGAGTC AAATGATCAC

GCCTTTAACG TGGACATAAG

• ICS VVR RAPP 'JCL APS YIDD VVL OAK S V Q B LES ID SEC 12

301 CCATTIGTTC AGTOMCGT AGGGCFITCCCCCACTGTTTaaarrrmar TATATTGATG ATGTGGTATT GGGGGCCAAG TCTOFACAGC ATCTTGAGTC ID SEC 3 GGTAAACAA/3 TCACCAAGCA TCCCGAAAGGGGGTGACAAACCGAAAGTCA ATATAACTAC TACACCATAA CCCCCGGTTC AGACATGTCG TAGAACTCAG

ID SEC 4

- L P ? A V T N PLL S L 0 V H L N P 24K TX R NGY S L PIP MG Y ID SEC 12 401 OCTITTTTACC GCTOTTACCA ATTTTCTTTT GTCTTTGGGT GTACATTTAA ACCCTAACAA AACAAAAAGA TGOGOTTACT CTTTAAATTT CATGGGCTAT

ID SEC 3 GGAAAAATGG CGACAATGGT TAAAAGAAAA CAGAAACCCA CATGTAAATT TGGGATTGTT TTOTTTTTCT ACCCCAATGA GAAATTTAAA GTAOCCGATA

ID SEC 4

ID SEC 12 501 OTTATTOGAT GTTATGGGTC CTTGCCACAA GATCACATTA TTCAGAAAAT CAAAGAA ID SEC 3 CAATAACCTACAATACCCAGGAACGGTGTTCTAGTGTAATAAGTCTTITAGTTTCTT

VIGC YGS LPQ DM/ 1 QKI KE

ID SEC 4

FIGURA 2b

Paciente 2 pADF

RYVARLS S N S -ID SEC 13 CGGCOTTTTA TCATCTTCCT CTTCATCCTO CTGCTATGCC TCATCTTCTT GTTGGTTCTT CTGGACTATC AAGGTATGTT OCCCGTTTGT CCTCTAATTC ID SEC 5 OCCGCAAAAT AGTAGAAGGA GAAGTAGGAC GACOATACOG AGTAGAAGAA CAACCAAGAA GACCTGATAG TTCCATACAA COGOCAAACA GGAGATTAAG

AFY HLP LHPAAMP HLL VOSS G L S

ID SEC 6

ID SEC 13

LYV SLLL LYQ TFG CCTCTATOTA TCCCTCCTOT TGCTGTACCA AACCTTCGGA ID SEC 5

• RIF NHQH GTM QNL HDYC SRN

101 CAGGATCTTC AACCACCAGC ACOGGACCAT GCAGAACCTG CACGACTATT GCTCAAGGAA OTCCTAGAAG TTOOTOGTCG TOCCCTWTA

03TCITGGAC GTGCTGATAA CGAGTTCCTT GGAGATACATAGGGAGGACAACGACATGGT TTGGAAGCCT ID SEC 6

LAQ FTSA• ID SEC 13 201 CGGAAATPGC ACCTOTATTC CCATCCCATC ATCCTGOGCT TTCGGAAAAT TCCTATGGGA ID SEC 5

RKLH LYS HPI IL GF RK I PMG VGLS PFL

GTGGGCCTCA GCCCOTTTCT CCTGOCTCAG TTTACTAGTO GCCTTTAACG TWACATAAG GOTAGGOTAG TAGGACCCOA AAGCCTRITTA AGGATACCCT CACCCGGAGT CGOOCAAAGA GGACCGAGTC AAATOATCAC ID SEC 6

• ICS VV-R RAFP, HCL AFS YMDD VVL OAK SWLES' ID SEC 13 301 CCATTTGTTC AGTOOTTCOT AGGGCTTTCC CCCACPOTTT GGCTTTCAGT TATATGGATO ATGTGOTATT GGOGGCCAAG TCTGTACAGC ATCPTGAGTC ID SEC 5

GOTAAACAAG TCACCAAGCA TCCCGAAAGG GGGTGACAAA CCGAAAGTCA. ATATACCTAC TACACCATAA CCCCCGOTTC AGACATGTCG TAGAACTCAG ID SEC 6

LFT AVTN FLL SLO VHLN PNK TKR WGYS VHF HOT ID SEC 13 401 CCTFTTTACC GCNOTTACCA ATTTTCTTTT GTCTTTGGGT OTACATTTAA ACCCTAACAA AACAAAAAGA TGOGOTTACT CPTTAMITT CATOGGCTAT ID SEC 5 WAAAAATGG CGACAATGOT TAAAAGAAAA CAGAAACCCA CATOTAAATT TOGGATTGTT TTGWIITCT ACCCCAATGA GAAWITFAAA GTACCCGATA ID SEC 6

-

ID SEC 13 501 OTTATTGOAT GTTATOGGTC CTTGCCACAA GAPCACATTA TPCAGAAAAT CAAAGAA

VIGC YGS LPQ DHII QKI KE

ID SEC 5 ID SEC 6

CAATAACCTA CAATACCCAG GAACGOTOTT CTAGTGTAAT AAGTCTTTTA GTTTCTT

FIGURA 2c

Paciente 3 bADF

I Y S L XPA

3. ATATATTCTC TTCNNCCTGC TATATAAGAG AAGNEGGACO

• H.QH GT PI

101 ACCACCAGCA CGOGACCATO TGGTGGTCGT GCCCTOOTAC

AMP HLL V G S S TGCTATGCCT CATCTWITG TTGGTTCTTC ACGATACGGA GTAGAAGAAC AACCAAGAAG

QNL H DY C SRN CAGAACCTGC ACGACTATTG CTCAAGGAAC GTCTTGGACG TGCTGATAAC GAGTTCCTTO

O L S R Y V A ALS TGGACTATCA AGGTATGTTG CCCUTTGTC ACCTGATAGT TCCATACAAC GOGCAAACAG

L Y V S LLL L YQ CTCTATOTAT CCCTTCTGTT GerGTACCAA GAGATACATA GGGAAGACAA CGACATGGTT

S N B RIFE* CTCTAATTCC AGGATCrrCA GAGATTAAGG TCCTAGAAGT

T F C ft K LH

ACCMCGGAC GGAAATTGCA TGGAAGCCTG CCTTTAACGT

•L Y S HP II LGP R X I PMGL GLS PFL LAQF TSA

201 CCTGTATTCC CATCCCATCA TCCTGGGCTT TCOGAAAATT CCTATGGGACTOGGCCTCAOCCCGTTTCVCCTGGCTCAGTTTACTAGTGC GGACATAAGG GTAGGGTAGT AGGACCCGAA AGCCTTTTAA GGATACCCEGACCCGGAGTCGGGCAAAGAGGACCGAGTCAAATGATCACG

V VR R A F P 301 GTGGTTCGTA GGGCTIVCCC CACCAAGCAT CCCGAAAGGG

• V T N FIJL 401 CTOTTACCAA TITTcrrriv

GAcamvarr AAAAGAAAAC

HCL APSE IDD CCACTOTTTG GCTTTCAGTT ATATTGATGA GGTGACAAAC CGAAAGTCAA TATAACTACT

S L GV HLN PNK TCTTTGGGTG TACATTTAAA CCCTAACAAA AGAAACCCAC ATGTAAATTT GGGATTGTTT

✓ VL OA K SVQ 11 LE S TGTGOTATTO GOGGCCAAGT CTGTACAGCA TCTTGAGTCC ACACCATAAC CCCCGOTTCA GACATGTCGT AGAACTCAGG

T X XW G X X XX ACAAAAGNAT GOGGGTANNN NNENNENT TOTTIVCNTA CCCCCATIEIN IONNNNNNA

FIGURA 2d

'Cs CATTTGTTCA GTAAACAAGT

L F T A •

crrrrrAcco

GAAAAATGGC

ID SEC 14 ID SEC 7 ID SEC 8

ID SEC 14 ID SEC 7 ID SEC 8

ID SEC 14 ID SEC 7 ID SEC 8

ID SEC 14 ID SEC 7 ID SEC 8

ID SEC 14 ID SEC 7 ID SEC 8

Paciente 3 pADF

I Y S L X P A A M P B L L V GS S GL S R Y V A R L S S R C RIFN• ID SEC 15

1 ATATATTCTC TTCHNCCTOC TOCTATGCCT CAT CTTCTTG TTGGTTCTTC TGGACTATCA AGGTATGTTG CCCGTTTGTC CFCTAATTCC AGGATCFFCA ID SEC 9

TATATAAGAG AAGNNGGACG ACGATACGGA GTAGAAGAAC AACCAAGAAG ACCTGATAGT TCCATACAAC GGGCAAACAG GAGATTAAGG TCCTAGAAGT ID SEC 10

• HQH GTM QNLH DYC SRN L Y V S LLL L YQ TF OR K L H ID SEC 15

101 ACCACCAGCA COGGACCATO CAGAACCFGC ACGACTATTG CFCAAGGAAC CFCTATGTAT CCCFFCTGTT OCTOTACCAA ACCTTCGGAC GGAAATTGCA ID SEC 9

TGOTGGTCGT OCCCTGOTAC OFCTTGOACG TGCTGATAAC GAGTTCCTTG GAGATACATA GGGAAGACAA CGACATGG'FF TGGAAGCCTG CCTTTAACGT ID SEC 10

• L Y S HP II LOP RK I PMG V GL S PF L L AQF TS A ICS ID SEC 15

201 CCTGTATTCC CATCCCATCA TCCTGGGCTT. TCGGAAAATT CCTATGGGAG TGGGCCTCAG CCCGTTTCTC CTOGCTCAGT TTACTAGTGC CATTTOFFCA ID SEC 9

GGACATAAGG OTAGGOTAGT AGGACCCGAA AGCCTTTTAA GGATACCCTC AC CCGGAGTC GGGCAAAGAG GACCGAGTCA AATGATCACG GTAAACAAGT ID SEC 10

V V R R A F P H C L A F S Y I DD V V L CARS V Q H IS L F T A • ID SEC 15

301 GTGG'FFCGTA GGOCTTTCCC CCACTOT1P3 GCTTTCAGTT ATATTGATGA TGTGGTATTG GGOOCCAAGT CTGTACAGCA TCTTGAGTCC CTTTTTACCG ID SEC 9

CACCAAGCAT CCCGAAAGGG GGTGACAAAC CGAAAGTCAA TATAACTACT ACACCATAAC CCCCGOTTCA ïAmmar= AGAACTCAGG GAAAAATGGC ID SEC 10

• V TN FLL SL GV HLN PNK T K X ID SEC 15

401 CTGTTACCAA TTTTCTITTO TCTTTGGGTG TACATTTAAA CCCTAACAAA ACAAAAGNAT ID SEC 9

GACAATWFT AAAAGAAAAC AGAAACCCAC ATGTAAATTT accarrarrr TOTTTTC1VTA ID SEC 10

FIGURA 2e

P1 GVGLSPFLLAUTSAICSVVRRAFPHCLAFSYMDDVVLGAKSVOILEALFTAVTNFLLSLGVHLNPNKTK id sec 16 P2 bADF GVGLSPFLLAQFTSA/CSVVRRAFPEICLAFSTIDDVVLGAKSVQHLESLFTAVTN7LLSLGVHLNPNXTE id sec 17 P2 pADF OIVGLSPFLLAQFTSAICgVVRRAFPHCLAFSYMDDVVLGAKSVOILESLFTAVTNFLLSLGVHLIONKTK id sec 18 P3 bADF GLGLSPFLLAQFTSAICSVVRRAFPECLAFSTIDDVVLGAKSVOILESLFTAVTNTLLSLGVHLNPNKTK id sec 19

P3 pADF GVGLSPFLLAQFTSAICSVVRRAFPNCLAFSYIDDVVLGARSVOLESLFTAVTNFLLSLGVELNPNKTIC id sec 20 wt P GVGLSPFLLAQFTSAICSVVRRAFPHCLAFSYMDDVVLGAKSVOLESLETAVTNFLLSLGIRLNPNKTE id sec 21

LMV LMV ADF? LW? AD? AD? 113 180 181 204 217219 233236

FIGURA 3

quot;II 0 54116.4 100 zn:ay A150

0, 1 .10

100

0 - -- 50

100 0, 1 10

2-• 50

0 # 0, 1 10

FIGURA 4

ADF estandar pM 0 0, 5 1 5 10 102 103 104 -

VHB wt

VHB 1233V

FIGURA 5