Método de pronóstico de la enfermedad intestinal inflamatoria.

Método para ayudar en el pronóstico de la enfermedad de Crohn (EC) en un individuo diagnosticado de EC, comprendiendo dicho método:

(a) analizar una muestra obtenida de dicho individuo para determinar la presencia, el nivel o el genotipo de una combinación de marcadores séricos y marcadores genéticos,

en el que dichos marcadores séricos comprenden inmunoglobulina A anti-Saccharomyces cerevisiae (IgAAASC), inmunoglobulina G anti-Saccharomyces cerevisiae (IgG-AASC), un anticuerpo anti-proteína C de la membrana externa (anti-OmpC), un anticuerpo anti-CBir-1, un anticuerpo anti-I2 y un anticuerpo perinuclear anti-neutrófilo citoplasmático (ANACp) y

en el que dichos marcadores genéticos comprenden PSN8 (R702W), PSN12 (G908R) y PSN13 (3020InsC) en el gen NOD2,

(b) aplicar un análisis de cuartiles a dichos marcadores séricos con el fin de obtener una puntuación de suma de cuartiles (PSC) para dicho individuo mediante:

(b1) la conversión del nivel de los marcadores séricos IgA-AASC, IgG-AASC, anti-OmpC, un anticuerpo anti- CBir-1 y un anticuerpo anti-I2 en una puntuación de cuartil,

(b2) la conversión del estado del marcador sérico ANACp en una puntuación de cuartil invertida,

en la que un estatus positivo de este marcador se convierte en un "1" y un estatus negativo de este marcador se convierte en un "4", y

(b3) sumar dicha puntuación de cuartiles para cada uno de dichos marcadores séricos, y

(c) ayudar en el pronóstico de la EC mediante la determinación del riesgo de que dicho individuo desarrolle una complicación de EC durante el tiempo, seleccionando dicha complicación de EC de entre el grupo que consiste de enfermedad estenosante interna, enfermedad penetrante interna y una combinación de las mismas, en la que dicho riesgo se determina comparando dicho PSC y el genotipo de dichos marcadores genéticos para dicho individuo con un modelo serogenético que proporciona una probabilidad acumulada de desarrollo de una complicación de EC durante el tiempo, en el que dicho modelo serogenético se deriva mediante la aplicación de un análisis de regresión logística a las puntuaciones de suma de cuartiles obtenidas de la presencia o nivel de dichos marcadores séricos y el genotipo de dichos marcadores genéticos determinado en una cohorte retrospectiva con resultados conocidos de EC.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/US2010/030934.

Solicitante: NESTEC S.A..

Inventor/es: SINGH, SHARAT, BARKEN,DERREN, PRINCEN,FRED, EGGLESTON,LEONARD.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/68 (en los que intervienen ácidos nucleicos)
  • SECCION G — FISICA > METROLOGIA; ENSAYOS > INVESTIGACION O ANALISIS DE MATERIALES POR DETERMINACION... > Investigación o análisis de materiales por métodos... > G01N33/68 (en los que intervienen proteínas, péptidos o aminoácidos)
  • SECCION G — FISICA > METROLOGIA; ENSAYOS > INVESTIGACION O ANALISIS DE MATERIALES POR DETERMINACION... > Investigación o análisis de materiales por métodos... > G01N33/564 (para complejos inmunológicos preexistentes o enfermedades autoinmunes)
google+ twitter facebook

Texto extraído del PDF original:

DESCRIPCIÓN

Método de pronóstico de la enfermedad intestinal inflamatoria ANTECEDENTES DE LA INVENCIÓN La enfermedad intestinal inflamatoria (EII), que se observa en todo el mundo y afecta a millones de personas, es la expresión colectiva para referirse a tres trastornos gastrointestinales de etiología desconocida: enfermedad de Crohn (EC), colitis ulcerosa (CU) y colitis indeterminada (CI). La EII, conjuntamente con el síndrome del intestino irritable (SII), afectará a la mitad de los estadounidenses a lo largo de su vida, con un coste superior a 2600 millones de dólares para la EII y de más de 8.000 millones de doláres para el SII. Un determinante principal de estos elevados costes médicos es la dificultad para diagnosticar las enfermedades digestivas y el progreso de las mismas. El coste de la EII y el SII se ve incrementado por la productividad perdida, ya que las personas que sufren estos trastornos faltan al trabajo por lo menos 8 días más anualmente que la media nacional.

La enfermedad intestinal inflamatoria presenta muchos síntomas en común con el síndrome del intestino irritable, entre ellos el dolor abdominal, la diarrea crónica, la pérdida de peso y los cólicos, dificultando en extremo el diagnóstico definitivo. De los 5 millones de personas que se sospecha que sufren de EII, sólo se diagnostica EII en 1 millón. La dificultad del diagnóstico diferencial de la EII y la determinación de su resultado dificulta el tratamiento precoz y efectivo de estas enfermedades. De esta manera, existe una necesidad de métodos de ensayo rápidos y sensibles para pronosticar la gravedad de la EII. El documento nº WO 2010/056682 describe métodos para la predicción de la enfermedad intestinal inflamatoria (EII) utilizando marcadores séricos. El documento nº WO 2008/109782 da a conocer métodos para diagnosticar y predecir la progresión de la enfermedad de Crohn utilizando marcadores genéticos. El documento nº WO 2008/141148 se refiere a métodos de diagnóstico o predicción de la susceptibilidad a la enfermedad de Crohn mediante la determinación de la presencia o ausencia de variantes genéticas. El artículo de Konstantinos P. et al. informa de asociaciones fenotípicas y genéticas de la anti-flagelina (CBir1) con la enfermedad de Crohn (Inflammatory Bowel Diseases 13(5):524,530, 1 de mayo de 2007).

Mow et al. informan de la asociación de respuestas de anticuerpos a antígenos microbianos y complicaciones de la enfermedad de Crohn en el intestino delgado (Gastroenterology 126(2):414-424, 1 de febrero de 2004). En un artículo por el Western Regional Pediatric IBD Research Alliance se informa de que una reactividad inmunológica incrementada predice una enfermedad Crohn complicada agresiva en niños (Clinical Gastroenterology and Hepatology 6(10):1105-1111, 1 de octubre de 2008).

El artículo de Devlin et al. informa de variantes de NOD2 (por el inglés "Nucleotide-binding Oligomerization Domain 2") y la respuesta de anticuerpos a antígenos microbianos en pacientes de enfermedad de Crohn y sus parientes no afectados (Gastroenterology 132(2):576-586, 19 de febrero de 2007).Landers C.J. et al. informan de que la pérdida de tolerancia seleccionada puede ponerse de manifiesto en respuestas inmunológicas asociadas a la enfermedad de Crohn frente a autoantígenos y antígenos microbianos (Gastroenterology 123:689-699, 1 de enero de 2002).

Targan S.R. et al. informan de que los anticuerpos contra la flagelina CBir1 definen una respuesta única que se encuentra independientemente asociada a enfermedad de Crohn complicada (Gastroenterology 128(7):2020-2028, 7 de junio de 2005). El documento nº US 2008/131439 se refiere a métodos, sistemas y código para clasificar con exactitud si una muestra de un individuo se asocia a la enfermedad intestinal inflamatoria (EII) o a un subtipo clínico de la misma.

El documento nº WO 2006/063093 da a conocer una respuesta sérica elevada a flagelina CBir1 en los pacientes de enfermedad de Crohn. El documento nº US2006/154276 se refiere a métodos de diagnóstico de enfermedad intestinal inflamatoria (EII) o de diferenciación entre la enfermedad de Crohn (EC), la colitis ulcerosa (CU) y la colitis indeterminada (CI) en un individuo mediante la utilización de una combinación de aprendizaje de clasificadores estadísticos basados en la presencia o nivel de uno o más marcadores de EII en un muestra del individuo. Dubinsky M.C. et al. informan de que las respuestas inmunológicas séricas predicen una progresión rápida de la enfermedad en niños con enfermedad de Crohn y que las respuestas inmunológicas predicen la progresión de la enfermedad (The American Journal of Gastroenterology 101(2):360-367, febrero de 2006).

Aunque se han realizado avances en el diagnóstico preciso de subtipos clínicos de EII, en la actualidad no existen métodos para determinar su pronóstico. De esta manera, existe una necesidad de métodos de pronóstico mejorados para individuos diagnosticados de EII, de la gravedad de la enfermedad y de si el individuo responderá a la terapia. Debido a que el 70% de los pacientes de EC finalmente necesitarán una operación quirúrgica GI, es importante la capacidad de predicción de aquellos pacientes que necesitarán cirugía en el futuro. La presente invención satisface esta necesidad y también proporciona ventajas relacionadas. BREVE DESCRIPCIÓN RESUMIDA DE LA INVENCIÓN La presente invención se refiere a un método para ayudar en el pronóstico de la enfermedad de Crohn (EC) en un individuo diagnosticado de EC, comprendiendo dicho método: (a) analizar una muestra obtenida de dicho individuo para determinar la presencia, el nivel o el genotipo de una combinación de marcadores séricos y marcadores genéticos, en el que dichos marcadores séricos comprenden inmunoglobulina A anti-Saccharomyces cerevisiae (IgA-AASC), inmunoglobulina G anti-Saccharomyces cerevisiae (IgG-AASC), un anticuerpo anti-proteína C de la membrana externa (anti-OmpC, 'OmpC' por el inglés "Outer-membrana porin C"), un anticuerpo anti-CBir-1, un anticuerpo anti-I2 y un anticuerpo perinuclear anti- neutrófilo citoplasmático (ANACp) y en el que dichos marcadores genéticos comprenden SNP8 (R702W), SNP12 (G908R) y SNP13 (3020InsC) en el gen NOD2, (b) aplicar un análisis de cuartiles a dichos marcadores séricos con el fin de obtener una puntuación de suma de cuartiles (PSC) para dicho individuo mediante: (b1) la conversión del nivel de los marcadores séricos IgA-AASC, IgG-AASC, anti-OmpC, un anticuerpo anti- CBir-1 y un anticuerpo anti-I2 en una puntuación de cuartil, (b2) la conversión del estado del marcador sérico ANACp en una puntuación de cuartil invertida, en la que un estado positivo de este marcador se convierte en un "1" y un estado negativo de este marcador se convierte en un "4", y (b3) la suma de dicha puntuación de cuartil para cada uno de dichos marcadores séricos, y (c) ayudar en el pronóstico de la EC mediante la determinación del riesgo de que dicho individuo desarrolle una complicación de EC durante el tiempo, seleccionando dicha complicación de EC de entre el grupo que consiste de enfermedad estenosante interna, enfermedad penetrante interna y una combinación de las mismas, en la que dicho riesgo se determina comparando dicho PSC y el genotipo de dichos marcadores genéticos para dicho individuo con un modelo serogenético que proporciona una probabilidad acumulada de desarrollo de una complicación de EC durante el tiempo, en el que dicho modelo serogenético se deriva mediante la aplicación de un análisis de regresión logística a las puntuaciones de suma de cuartiles obtenidas de la presencia o nivel de dichos marcadores séricos y el genotipo de dichos marcadores genéticos determinado en una cohorte retrospectiva con resultados conocidos de EC.

La muestra puede seleccionarse de entre el grupo que consiste de suero, plasma, sangre completa y heces. Los marcadores séricos utilizados en el método comprenden además un anticuerpo antineutrófilo, un anticuerpo anti-Saccharomyces cerevisiae, un anticuerpo antimicrobiano, una proteína de fase aguda, una apolipoproteína, una defensina, un factor de crecimiento, una citoquina, una cadherina y una combinación de los mismos. El anticuerpo anti-neutrófilo puede comprender un anticuerpo anti-citoplasma de neutrófilo (ANAC). El anticuerpo antimicrobiano puede comprender un anticuerpo antiflagelina.

La presencia o el nivel de cada uno de dichos marcadores séricos puede detectarse con un ensayo de hibridación, un ensayo basado en la amplificación, un inmunoensayo o un ensayo inmunohistoquímico. El marcador genético utilizado en el método puede comprender además por lo menos uno de los genes indicados en las Tablas 1A-1E. El genotipo de dichos marcadores genéticos puede detectarse mediante genotipado para la presencia o la ausencia de dicho polimorfismo de un solo nucleótido (PSN).

El modelo serogenético puede construirse con PSC, duración de la enfermedad y la mutación SNP 13 como factores predictivos y estado de complicación como el resultado, en el que dicho modelo serogenético preferentemente se ilustra en la figura 38b. El modelo serogenético puede comprender una tabla de consulta o gráfico.

La tabla o gráfico de consulta puede proporcionar una probabilidad acumulada de que dicho individuo desarrolle o no dicha complicación de EC durante el tiempo. La tabla o gráfico de búsqueda puede proporcionar una probabilidad acumulada de que dicho individuo necesite cirugía o no necesite cirugía durante el tiempo, en el que dicha cirugía preferentemente es cirugía del intestino delgado. El método de la invención puede comprender además la recomendación de un curso de terapia para dicho individuo basada en dicha comparación de dicho PSC y el genotipo de dichos marcadores genéticos de dicho individuo con dicho modelo serogenético. Otros objetivos, características y ventajas de la presente invención resultarán evidentes para el experto en la materia a partir de la descripción detallada y figuras siguientes.

BREVE DESCRIPCIÓN DE LOS DIBUJOS La FIG. 1 ilustra un diagrama de la fisiopatología de la EII. La FIG. 2 ilustra un árbol de decisión ejemplar de EII en el que se utiliza el panel pronóstico de EII descrito en la presente memoria (1) para predecir el curso de la enfermedad y (2) para realizar un seguimiento y predecir la respuesta a la terapia. La FIG. 3 ilustra un sistema de clasificación de enfermedades (SCE). La FIG. 4 ilustra un informe de laboratorio ejemplar que utiliza una escala de grises o de color para la visualización y magnitud del comportamiento y/o pronóstico de enfermedad.

La FIG. 5 ilustra otro informe de laboratorio ejemplar que utiliza una escala de grises o de color para la visualización y magnitud del comportamiento y/o pronóstico de enfermedad. La FIG. 6 ilustra un informe de laboratorio ejemplar con potencial de adición de características de la enfermedad así como marcadores de ensayo, genéticos y de resultado predictivo, que mejora las capacidades diagnósticas y pronósticas.

La FIG. 7 ilustra un gráfico radial para la visualización de la magnitud a modo de un indicador de comportamiento y/o pronóstico de enfermedad. La FIG. 8 ilustra mediciones de biomarcador cuantitativas en serie (MBCS) en combinación con la 'ponderación' en la determinación del curso de la enfermedad en respuesta al tratamiento. La FIG. 9 ilustra la separación de muestras en normales, EC y CU basándose en la concentración de ASA.

La FIG. 10 ilustra la separación de muestras en normales, EC y CU basándose en la concentración de PCR. La FIG. 11 ilustra la distribución de los pacientes de EC en subgrupos con PSC. La FIG. 12 ilustra el análisis de Kaplan-Meier basado en los niveles de biomarcadores séricos. La FIG. 13 ilustra el análisis de Kaplan-Meier basado en PSC de actividad sérica. La FIG. 14 ilustra una curva de titulación anti-CBir1 ejemplar.

La FIG. 15 ilustra una curva de titulación anti-OmpC ejemplar. La FIG. 16 ilustra una curva de calibración ejemplar para I2. La FIG. 17 ilustra una curva de calibración ejemplar para I2 con estándares. La FIG. 18 ilustra un patrón ejemplar de los estándares utilizando una curva de calibración nominal. La FIG. 19 ilustra un diagrama del porcentaje de complicaciones.

La FIG. 20 ilustra un diagrama del porcentaje de cirugías. La FIG. 21 ilustra que la identificación precoz de marcadores reduce el riesgo. La FIG. 22 ilustra un diagrama que muestra las complicaciones mostradas con un único marcador. La FIG. 23 ilustra un diagrama que muestra las cirugías mostradas con un único marcador. La FIG. 24 ilustra un diagrama que muestra el porcentaje de cirugías.

La FIG. 25 ilustra un gel desnaturalizante con tres preparaciones de antígeno GST-I2. La FIG. 26 ilustra un diagrama que muestra la distribución de valores de PSC para todas las muestras evaluadas en el Ejemplo 16. La FIG. 27 ilustra un diagrama que muestra la distribución de valores de PSC para todas las muestras con fenotipos no complicados tal como se indica en el Ejemplo 16.

La FIG. 28 ilustra un diagrama que muestra la distribución de valores de PSC para todas las muestras con fenotipos complicados tal como se indica en el Ejemplo 16. La FIG. 29 ilustra un diagrama que muestra la distribución de duraciones para todas las muestras evaluadas en el Ejemplo 16. La FIG. 30 ilustra un diagrama que muestra las duraciones de las muestras con un fenotipo de complicación tal como se indica en el Ejemplo 16. La FIG. 31 ilustra un diagrama que muestra las duraciones de las muestras con un fenotipo de no complicación tal como se indica en el Ejemplo 16. La FIG. 32 ilustra un modelo de regresión logística de tipo salvaje que muestras las probabilidades predichas por el modelo para un abanico de valores de PSC y de duración tal como se indica en el Ejemplo 16.

La FIG. 33 ilustra un modelo de regresión logística serogenético que muestra las probabilidades predichas por el modelo para un abanico de valores de PSC y de duración tal como se indica en el Ejemplo 16. La FIG. 34 ilustra la correspondencia de complicaciones predichas (en el eje Y) y complicaciones reales (en el eje X) tal como se indica en el Ejemplo 16. La FIG. 35 ilustra una curva de COR ejemplar generada utilizando las probabilidades informadas mediante los cálculos de validación cruzada tal como se indican en el Ejemplo 16. La FIG. 36 ilustra una curva de COR ejemplar con líneas trazadas en 73% de sensibilidad y especificidad tal como se indica en el Ejemplo 16. La FIG. 37 ilustra las distribuciones de puntuación de suma de cuartiles (PSC) según estado de complicación: enfermedad complicada y no complicada.

La FIG. 38 ilustra las predicciones de los modelos de regresión logística séricos y serogenéticos. (A) El modelo de regresión logística sérico se construyó con PSC y duración de la enfermedad como factores predictivos y estado de complicación como el resultado. Se utilizó este modelo para predecir la probabilidad de complicación para un abanico de PSC (6-24) y de duraciones (1-40). (B) El modelo de regresión logística serogenético se construyó con PSC, duración de la enfermedad y mutación SNP13 como factores predictivos y estado de complicación como el resultado. Se utilizó este modelo para predecir la probabilidad de complicación para un abanico de PSC (6-24) y de duraciones (1-40), en presencia de mutación SNP13. La FIG. 39 ilustra una comparación entre las tasas predichas y observadas de complicación según categoría (decil). Las predicciones se agruparon en categorías y se compararon con las tasas observadas de complicación para cada categoría. El número de pacientes en cada grupo de categoría de predicción fue: 0 en la categoría 0- 10%; 13 en la categoría >10-20%; 49 en la categoría >20-30%; 54 en la categoría >30-40%; 64 en la categoría >40-50%; 74 en la categoría >50-60%; 83 en la categoría >60-70%; 85 en la categoría >70-80%; 112 en la categoría >80-90%; 76 en la categoría >90-99%, y 9 en la categoría >99%. La FIG. 40 ilustra una curva característica de operador-receptor (COR) para predicciones de validación cruzada.

Se generaron probabilidades utilizando una validación cruzada dejando uno fuera para generar repetidamente una regresión logística sérica y serogenética. La FIG. 41 ilustra un diagrama que muestra la velocidad de la puntuación de suma de cuartiles durante el tiempo. La FIG. 42A ilustra un gel que confirma la expresión del antígeno GST-I2. La FIG. 42B ilustra un gel que confirma la presencia del antígeno GST-I2 en la muestra desnaturalizada (DEN). La FIG. 42C ilustra un gel que confirma la presencia del antígeno GST-I2 en la muestra filtrada (FIL). La FIG. 43 ilustra un gráfico de una curva de estándares para muestras con controles tal como se indica en el Ejemplo 20. La FIG. 44A ilustra un ELISA anti-I2 que utiliza un anticuerpo monoclonal (McAb) contra GST y un antígeno GSTI2 replegado. La FIG. 44B ilustra un ELISA anti-I2 que utiliza neutravidina y un antígeno GSTI2 replegado biotinilado.

DESCRIPCIÓN DETALLADA I. Introducción La presente exposición se basa, en parte, en el inesperado descubrimiento de que la precisión del diagnóstico o pronóstico de la EII o de la predicción de una respuesta a una agente terapéutico de la EII puede mejorarse sustancialmente mediante la detección de la presencia, nivel o genotipo de determinados marcadores en una muestra biológica de un individuo. De esta manera, se dan a conocer plataformas diagnósticas y pronósticas basadas en un panel sérico y/o genético de marcadores. La figura 1 es una ilustración de la fisiopatología de la EII, que ilustra que en determinados casos, un paciente presenta una predisposición genética, un defecto mucosal del sistema inmunológico, una inflamación luminal (respuesta inmunológica incrementada a antígenos microbianos entéricos), una función de barrera que se encuentra comprometida, o una combinación de los mismos. La figura 2 es una ilustración de un árbol de decisión de la EII. Se dan a conocer métodos y sistemas para mejorar el diagnóstico y pronóstico de la CU y la EC. En determinados casos, los métodos en la presente memoria predicen con exactitud "CU similar a EC", una enfermedad que es conocido que resulta muy difícil de diagnosticar y de predecir su resultado. En un aspecto, los métodos descritos en la presente memoria utilizan múltiples marcadores serológicos, de proteínas y/o genéticos, solos o en combinación con uno o más algoritmos u otros tipos de análisis estadístico, para proporcionar a los médicos información diagnóstica o pronóstica valiosa. En algunos aspectos los métodos y sistemas proporcionan una indicación de la respuesta proyectada de un paciente a la terapia biológica. En otros aspectos, los métodos y sistemas utilizan múltiples marcadores (por ejemplo serológicos, de proteínas y/o genéticos) conjuntamente con análisis estadísticos (por ejemplo análisis de cuartiles) para proporcionar un valor pronóstico mediante la identificación de los pacientes con una enfermedad complicada o un riesgo de desarrollar complicaciones de la enfermedad (por ejemplo enfermedad estenosante interna o penetrante interna) y/o una necesidad de intervención quirúrgica, ayudando simultáneamente en la evaluación de la tasa de progresión de la enfermedad. En determinados otros casos, los métodos permiten la clasificación de la gravedad de la enfermedad a lo largo de un continuo de subgrupos de EII, y no meramente como EC o CU. Además, los métodos guían en las decisiones terapéuticas de los pacientes que presentan una enfermedad avanzada. En aspectos adicionales, la utilización de múltiples marcadores (por ejemplo séricos, proteicos y/o genéticos) proporciona la capacidad de distinguir los respondedores de los no respondedores y guía en las opciones terapéuticas iniciales (por ejemplo si prescribir o no un tratamiento agresivo), con el potencial de modificar el comportamiento de la enfermedad.

En determinados casos, los métodos y sistemas comprenden una etapa que presenta una "transformación" o "aparato" asociado a la misma. Por ejemplo, puede llevarse a cabo una técnica de ELISA para medir la presencia o el nivel de concentración de muchos de los marcadores descritos en la presente memoria. Un ELISA incluye la transformación del marcador, por ejemplo un autoanticuerpo, en un complejo entre el marcador (por ejemplo el autoanticuerpo) y un agente de unión (por ejemplo antígeno), que seguidamente puede medirse con un anticuerpo secundario marcado. En muchos casos, el marcaje es un enzima que transforma un sustrato en un producto detectable. La medición del producto detectable puede llevarse a cabo utilizando un lector de placas, tal como un espectrofotómetro. En otros casos se determinan marcadores genéticos utilizando diversas técnicas de amplificación, tales como la PCR. Las etapas del método, incluyendo la amplificación, tal como la PCR, resultan en la transformación de cadenas sencillas o dobles cadenas de ácidos nucleicos en múltiples cadenas para la detección. La detección puede incluir la utilización de un fluoróforo, la cual se lleva a cabo utilizando un aparato tal como un fluorímetro. II. Definiciones Tal como se utiliza en la presente memoria, los términos y expresiones siguientes presentan los significados asignados a los mismos, a menos que se indique lo contrario. El término "clasificar" incluye "asociar" o "categorizar" una muestra o un individuo con un estado de enfermedad o pronóstico. En determinados casos, "clasificar" se basa en la evidencia estadística, la evidencia empírica, o en ambas. Se da a conocer que los métodos y sistemas de clasificación utilizando un conjunto de muestras denominado de entrenamiento de los individuos con estados de enfermedad o pronósticos conocidos. Tras su establecimiento, el grupo de datos de entrenamiento sirve de base, modelo o plantilla frente a la que se comparan las características de una muestra desconocida de un individuo, a fin de clasificar el estado de enfermedad desconocido o proporcionar un pronóstico del estado de enfermedad del individuo. En algunos casos, "clasificar" es igual a diagnosticar el estado de enfermedad y/o diferenciar el estado de enfermedad de otro estado de enfermedad. En otros casos, "clasificar" es igual a proporcionar un pronóstico del estado de enfermedad en un individuo diagnosticado con el estado de enfermedad.

La expresión "enfermedad intestinal inflamatoria" o "EII" incluye trastornos gastrointestinales tales como, por ejemplo, la enfermedad de Crohn (EC), la colitis ulcerosa (CU) y la colitis indeterminada (CI). Las enfermedades intestinales inflamatorias (por ejemplo EC, CU e CI) se distinguen de todas los demás trastornos, síndromes y anormalidades del tracto gastroentérico, incluyendo el síndrome del intestino irritable (SII). Se hace referencia a la publicación de patente US nº 2008/0131439, titulada "Methods of Diagnosing Inflammatory Bowel Disease" [Métodos de diagnóstico de enfermedad intestinal inflamatoria]. El término "muestra" incluye cualquier espécimen biológico obtenido de un individuo. Entre las muestras adecuadas se incluyen, aunque sin limitación, sangre completa, plasma, suero, saliva, orina, heces, lágrimas, cualquier otro líquido corporal, muestras de tejido (por ejemplo biopsia) y extractos celulares de las mismas (por ejemplo un extracto celular de glóbulos rojos). Se da a conocer que la muestra es una muestra de suero. La utilización de muestras, tales como suero, saliva y orina es bien conocida de la técnica (ver, por ejemplo, Hashida et al., J. Clin. Lab. Anal. 11:267-86, 1997). El experto en la materia apreciará que pueden diluirse muestras tales como muestras de suero, antes del análisis de los niveles de marcador.

El término “marcador” incluye cualquier marcador bioquímico, marcador sérico, marcador genético u otra característica clínica o ecográfica que pueda utilizarse en el diagnóstico de la EII, en la predicción del curso probable y resultado de la EII, y/o en la predicción de la probabilidad de recuperación de la enfermedad. Entre los ejemplos no limitativos de dichos marcadores se incluyen marcadores séricos tales como un anticuerpo anti-neutrófilo, un anticuerpo anti-Saccharomyces cerevisiae, un anticuerpo antimicrobiano, una proteína de fase aguda, una apolipoproteína, una defensina, un factor de crecimiento, una citoquina, una cadherina, una molécula de adhesión celular; marcadores genéticos tales como NOD2/CARD15, y combinaciones de los mismos. Se da a conocer que los marcadores se utilizan en combinación con un análisis estadístico para proporcionar un diagnóstico o pronóstico de la EII en un individuo. En determinados casos, el diagnóstico puede ser EII o un subtipo clínico de la misma, tal como la enfermedad de Crohn (EC), la colitis ulcerosa (CU) o la colitis indeterminada (CI). En determinados otros casos, el pronóstico puede ser la necesidad de cirugía (por ejemplo la probabilidad o el riesgo de requerir cirugía del intestino delgado), el desarrollo de un subtipo clínico de EC o CU (por ejemplo la probabilidad o el riesgo de ser susceptible de una EC o CU de un subtipo clínico particular, tal como el subtipo de EC estenosante, penetrante o inflamatoria), el desarrollo de uno o más factores clínicos (por ejemplo la probabilidad o el riesgo de ser susceptible a un factor clínico particular), el desarrollo de cáncer intestinal (por ejemplo la probabilidad o el riesgo de ser susceptible a cáncer intestinal) o la recuperación de la enfermedad (por ejemplo la probabilidad de remisión). La expresión “perfil de marcadores” incluye uno, dos, tres, cuatro, cinco, seis, siete, ocho, nueve, diez o más marcadores diagnósticos y/o pronósticos, en la que los marcadores pueden ser marcadores séricos, marcadores proteicos, marcadores genéticos y similares. El perfil de marcadores conjuntamente con un análisis estadístico puede proporcionar a los médicos y profesionales del cuidado de la salud información diagnóstico y pronóstica valiosa. Se da a conocer que el perfil de marcadores con opcionalmente un análisis estadístico proporciona una respuesta proyectada a la terapia biológica. Mediante la utilización de múltiples marcadores (por ejemplo séricos, proteicos, genéticos, etc.) conjuntamente con análisis estadísticos, los ensayos descritos en la presente memoria proporcionan un valor diagnóstico, pronóstico y terapéutico mediante la identificación de los pacientes con EII o un subtipo clínico de la misma, la predicción del riesgo de desarrollar una enfermedad complicada, la asistencia en la evaluación de la tasa de progresión de la enfermedad (por ejemplo la tasa de progresión a enfermedad o cirugía complicada) y la asistencia en la selección de la terapia. La expresión “perfil pronóstico” incluye uno, dos, tres, cuatro, cinco, seis, siete, ocho, nueve, diez o más marcadores de un individuo, en la que los marcadores pueden ser marcadores séricos, marcadores proteicos, marcadores genéticos y similares. Un análisis estadístico transforma el perfil de marcadores en un perfil pronóstico. Un análisis estadístico preferente es una puntuación de cuartiles y la puntuación de cuartiles para cada uno de los marcadores puede sumarse para generar una puntuación de suma de cuartiles. La expresión “modelo pronóstico” incluye modelos séricos, modelos genéticos, modelos serogenéticos y una combinación de los mismos. En un aspecto preferente, se lleva a cabo un análisis retrospectivo en una cohorte de resultados de enfermedad conocidos con complicaciones conocidas y se llevan a cabo procedimientos quirúrgicos. En un aspecto, puede llevarse a cabo un análisis de regresión (por ejemplo regresión logística) de la presencia o nivel de concentración de uno o más marcadores séricos y/o del genotipo de uno o más marcadores genéticos para desarrollar un modelo pronóstico. El modelo puede ilustrarse o representarse en, por ejemplo, una tabla de consulta, gráfico u otro medio de visualización. A continuación, puede compararse un perfil pronóstico de un individuo con un modelo pronóstico y determinarse el pronóstico (por ejemplo el riesgo o la probabilidad de desarrollar una complicación con el tiempo). La expresión “perfil terapéutico” incluye uno, dos, tres, cuatro, cinco, seis, siete, ocho, nueve, diez o más marcadores de un individuo, en la que los marcadores pueden ser marcadores séricos, marcadores proteicos, marcadores genéticos y similares. Un análisis estadístico transforma el perfil de marcadores en un perfil terapéutico. Un análisis estadístico preferente es una puntuación de cuartiles y la puntuación de cuartiles para cada uno de los marcadores puede sumarse para generar una puntuación de suma de cuartiles.

La expresión “modelo terapéutico” incluye modelos séricos, modelos genéticos, modelos serogenéticos y una combinación de los mismos. En un aspecto preferente, se lleva a cabo un análisis retrospectivo en una cohorte de resultados terapéuticos conocidos con terapias conocidas, entre las que se incluyen agentes biológicos, esteroides, fármacos convencionales y procedimientos quirúrgicos realizados. En un aspecto, puede llevarse a cabo un análisis de regresión (por ejemplo regresión logística) de la presencia o nivel de concentración de uno o más marcadores séricos y/o del genotipo de uno o más marcadores genéticos para desarrollar un modelo terapéutico. El modelo puede ilustrarse o representarse en, por ejemplo, una tabla de consulta, gráfico u otro medio de visualización. A continuación puede compararse un perfil terapéutico de un individuo con un modelo terapéutico y determinarse la terapia (por ejemplo estrategias ascendentes (“step up”), o descendentes o (“top down”)).

La expresión “perfil de eficacia” incluye uno, dos, tres, cuatro, cinco, seis, siete, ocho, nueve, diez o más marcadores de un individuo, en la que los marcadores pueden ser marcadores séricos, marcadores proteicos, marcadores genéticos y similares, y en la que cada uno de los marcadores cambia con la administración terapéutica. En determinados casos, se compara el perfil de marcadores con el perfil de eficacia con el fin de evaluar la eficacia terapéutica. En determinados aspectos, el perfil de eficacia es equivalente al perfil de marcadores, pero en el que los marcadores se miden posteriormente en el tiempo. En determinados otros aspectos, el perfil de eficacia corresponde a un perfil de marcadores de pacientes de EII que respondieron a un agente o fármaco terapéutico particular. En estos aspectos, las similitudes o diferencias entre el perfil de marcadores de ensayo y el perfil de eficacia de referencia indican si ese fármaco particular resulta adecuado o inadecuado para el tratamiento de la EII. En determinados casos, uno o más marcadores son más indicativos de eficacia que el diagnóstico o el pronóstico. De esta manera, puede existir una correlación uno-a-uno de los marcadores diagnóstico o pronósticos en el perfil de marcadores en comparación con los marcadores en el perfil de eficacia, aunque ello no resulta necesario. El término "individual", "sujeto", o "paciente" típicamente incluye seres humanos, aunque incluye también otros animales, tales como, por ejemplo, otros primates, roedores, caninos, felinos, equinos, ovinos, porcinos y similares.

Tal como se utiliza en la presente memoria, la expresión “sustancialmente la misma secuencia de aminoácidos” incluye una secuencia de aminoácidos que es similar, aunque no idéntica, a la secuencia de aminoácidos natural. Por ejemplo, una secuencia de aminoácidos, es decir, un polipéptido, que presenta sustancialmente la misma secuencia de aminoácidos que una proteína I2 puede presentar una o más modificaciones, tales como adiciones, deleciones o sustituciones de aminoácidos respecto a la secuencia de aminoácidos de la proteína I2 natural, con la condición de que el polipéptido modificado conserve sustancialmente por lo menos una actividad biológica de I2, tal como la inmunorreactividad. La comparación para similitud sustancial entre las secuencias de aminoácidos habitualmente se lleva a cabo con secuencias de entre aproximadamente 6 y 100 residuos, preferentemente de entre aproximadamente 10 y 100 residuos, y más preferentemente de entre aproximadamente 25 y 35 residuos. Una modificación particularmente útil de un polipéptido, o de un fragmento del mismo, es una modificación que confiere, por ejemplo, una estabilidad incrementada. La incorporación de uno o más D-aminoácidos es una modificación útil para incrementar la estabilidad de un polipéptido o fragmento de polipéptido. De manera similar, la deleción o la sustitución de residuos de lisina puede incrementar la estabilidad mediante la protección del polipéptido o fragmento de polipéptido frente a la degradación.

La expresión “factor clínico” incluye un síntoma en un individuo que se asocia a la EII. Entre los ejemplos de factores clínicos se incluyen, aunque sin limitación, diarrea, dolor abdominal, cólicos, fiebre, anemia, pérdida de peso, ansiedad, depresión y combinaciones de los mismos. Se da a conocer que un diagnóstico o pronóstico de la EII se basa en una combinación del análisis de una muestra obtenida de un individuo para determinar la presencia, el nivel o el genotipo de uno o más marcadores mediante la aplicación de uno o más análisis estadísticos y la determinación de si el individuo presenta uno o más factores clínicos.

Se da a conocer que los métodos se utilizan tras diagnosticar EII en el individuo. Sin embargo, en otros casos, los métodos pueden utilizarse para diagnosticar la EII o pueden utilizarse como una “segunda opinión” en el caso de que, por ejemplo, se sospeche de EII o haya sido previamente diagnosticada utilizando otros métodos. La expresión “diagnóstico de EII” incluye la utilización de los métodos y sistemas descritos en la presente memoria para determinar la presencia o la ausencia de EII en un individuo. La expresión incluye además evaluar el nivel de actividad de la enfermedad en un individuo. Se da a conocer que se utiliza un análisis estadístico para diagnosticar una forma leve, moderada, grave o fulminante de EII basándose en los criterios desarrollados por Truelove et al., Br. Med. J. 12:1041-1048, 1955. Se da a conocer que se utiliza un análisis estadístico para diagnosticar una forma leve, moderada a grave, o grave a fulminante de EII basándose en los criterios desarrollados por Hanauer et al., Am. J. Gastroenterol. 92:559-566, 1997. El experto en la materia conocerá otros métodos para evaluar la gravedad de la EII en un individuo. En determinados casos, los métodos se utilizan para pronosticar la progresión de la EII. Los métodos pueden utilizarse para monitorizar la enfermedad, tanto la progresión como la regresión. La expresión "monitorizar la progresión o regresión de la EII" incluye la utilización de los métodos y perfiles de marcadores para determinar el estado de la enfermedad (por ejemplo la presencia o la gravedad de la EII) de un individuo. En determinados casos se comparan los resultados de un análisis estadístico con los resultados obtenidos para el mismo individuo en un tiempo anterior. En algunos aspectos, los métodos, sistemas y código también pueden utilizarse para predecir la progresión de la EII, por ejemplo determinando una probabilidad de que la EII progrese rápidamente o lentamente en un individuo basándose en la presencia o el nivel de por lo menos un marcador en una muestra. En otros aspectos, los métodos, sistemas y código también pueden utilizarse para predecir la progresión de la EII, por ejemplo determinando una probabilidad de que la EII progrese rápidamente o lentamente en un individuo basándose en la presencia o el nivel de por lo menos un marcador en una muestra.

La expresión “monitorización de la eficacia de un fármaco en un individuo que recibe un fármaco útil para tratar la EII” incluye la determinación de un perfil de marcadores, solo o en combinación con la aplicación de un análisis estadístico, con el fin de determinar el estado de la enfermedad (por ejemplo la presencia o la gravedad de la EII) de un individuo tras la administración de un agente terapéutico para tratar la EII.

La expresión “terapia optimizadora en un individuo que presenta EII” incluye la utilización de los métodos y un perfil de marcadores para determinar el curso de la terapia para un individuo antes de administrar un agente terapéutico (por ejemplo un fármaco para la EII) o para ajustar el curso de la terapia para un individuo después de administrar un agente terapéutico, con el fin de optimizar la eficacia terapéutica del agente terapéutico. En determinados casos se comparan los resultados de un análisis estadístico con los resultados obtenidos para el mismo individuo en un tiempo anterior durante el curso de la terapia. De esta manera, una comparación de los resultados proporciona una indicación de la necesidad de cambiar el curso de la terapia o una indicación de la necesidad de incrementar o reducir la dosis del curso actual de terapia.

La expresión “curso de terapia” incluye cualquier enfoque terapéutico administrado para alivar o prevenir uno o más síntomas (es decir, factores clínicos) asociados a la EII. La expresión “curso de terapia” comprende administrar cualquier compuesto, fármaco, procedimiento o régimen útil para mejorar la salud de un individuo con EII e incluye cualquiera de los agentes terapéuticos (por ejemplo agentes biológicos y fármacos convencionales para la EII) indicados en la presente memoria, así como la cirugía. El experto en la materia apreciará que el curso de la terapia o la dosis del curso actual de terapia pueden modificarse, por ejemplo basándose en los resultados obtenidos mediante la aplicación de un análisis estadístico. La expresión “cantidad o dosis terapéuticamente eficaz” incluye una dosis de un fármaco (por ejemplo un agente biológico o fármaco convencional para la EII) que es capaz de conseguir un efecto terapéutico en un sujeto que lo requiere. Por ejemplo, una cantidad terapéuticamente eficaz de un fármaco útil para tratar la EII puede ser la cantidad que es capaz de prevenir o aliviar uno o más síntomas asociados a la EII. La cantidad exacta puede ser determinable por un experto en la materia utilizando técnicas conocidas (ver, por ejemplo, Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding, 1999; Pickar, Dosage Calculations, 1999, y Remington: The Science and Practice of Pharmacy, 20a edición, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins). El término “gen” se refiere al segmento de ADN que participa en la producción de una cadena polipeptídica; incluye regiones que preceden o siguen a la región codificante, tales como el promotor y la región 3’ no traducida, respectivamente, así como secuencias intermedias (intrones) entre los segmentos codificantes individuales (exones).

El término “genotipo” se refiere a la composición genética de un organismo, incluyendo, por ejemplo, si un organismo diploide es heterocigótico u homocigótico para una o más alelos variantes de interés. El término “polimorfismo” se refiere a la incidencia de dos o más secuencias alternativas determinadas genéticamente o alelos en una población. Un “sitio polimórfico” se refiere al locus en el que se produce la divergencia. Los sitios polimórficos preferentes presentan por lo menos dos alelos, observándose cada uno a una frecuencia particular en una población. Un locus polimórfico puede ser de tan sólo un par de bases (es decir, un polimorfismo de un solo nucleótido o PSN). Entre los marcadores polimórficos se incluyen polimorfismos de longitud de fragmentos de restricción, un número variable de repeticiones en tándem (NVRT), regiones hipervariables, minisatélites, repeticiones dinucleótidas, repeticiones trinucleótidas, repeticiones tetranucleótidas, repeticiones de secuencia simple y elementos de inserción tales como Alu. El primer alelo identificado se considera arbitrariamente el alelo de referencia y los otros alelos se consideran los alelos alternativos, “alelos variantes” o “varianzas”. El alelo observado con mayor frecuencia en una población seleccionada en ocasiones se denomina alelo “de tipo salvaje”. Los organismos diploides pueden ser homocigóticos o heterocigóticos para los alelos variantes. El alelo variante puede producir o no una característica bioquímica o física observable ("fenotipo") en un individuo que porta el alelo variante. Por ejemplo, un alelo variante puede alterar la actividad enzimática de una proteína codificada por un gen de interés. Los términos “ARNmi”, “microARN” o “miR” se utilizan intercambiablemente e incluyen moléculas de ARN de cadena sencilla de 21 a 23 nucleótidos de longitud, que regulan la expresión génica. Los ARNmi están codificados por genes a partir de cuyo ADN son transcritos, aunque los ARNmi no se traducen a proteínas (ARN no codificante); por el contrario, cada transcrito primario (un ARNprimi) es procesado para formar una estructura corta de tallo-bucle denominada pre-ARNmi y finalmente en un ARNmi funcional. Los miR maduros son parcialmente complementarios a una o más moléculas de ARN mensajero (ARNm) y su función principal es regular negativamente la expresión génica. Se dan a conocer aplicaciones tanto diagnósticas como terapéuticas.

En el análisis de cuartiles, existen tres números (valores) que dividen un rango de datos en cuatro partes iguales. El primer cuartil (también denominado ‘cuartil inferior’) es el número por debajo del cual se encuentra el 25 por ciento de los datos inferiores. El segundo cuartil (la ‘mediana’) divide el rango por la mitad y presenta el 50 por ciento de los datos por debajo del mismo. El tercer cuartil (también denominado ‘cuartil superior’) presenta el 75 por ciento de los datos debajo del mismo y el 25 por ciento superior de los datos por encima del mismo. A modo de ejemplo no limitativo, el análisis de cuartiles puede aplicarse al nivel de concentración de n marcador, tal como un anticuerpo u otro marcador proteico indicado en la presente memoria, de manera que a un nivel de marcador en el primer cuartil (<25%) se le asigna un valor de 1, a un nivel de marcador en el segundo cuartil (25-50%) se le asigna un valor de 2, a un nivel de marcador en el tercer cuartil (51%-<75%) se le asigna un valor de 3 y a un nivel de marcador en el cuarto cuartil (75%-100%) se le asigna un valor de 4. Tal como se utiliza en la presente memoria, “puntuación de suma de cuartiles" o "PSC" incluye la suma de puntuaciones de cuartiles para todos los marcadores de interés. A modo de ejemplo no limitativo, una puntuación de suma de cuartiles para un panel de 6 marcadores (por ejemplo séricos, proteicos y/o genéticos) puede encontrarse comprendida entre 6 y 24, en la que a cada uno de los marcadores individuales se le asigna una puntuación de cuartil de entre 1 y 4 basándose en la presencia o la ausencia del marcador, el nivel de concentración del marcador o el genotipo del marcador. III. Descripciones Se dan a conocer métodos y sistemas para mejorar el diagnóstico de la enfermedad intestinal inflamatoria (EII) y para mejorar el pronóstico de la progresión y complicaciones de la EII. Mediante la identificación de los pacientes con enfermedad complicada y la asistencia en la evaluación de la tasa de progresión de enfermedad, los métodos y sistemas descritos en la presente memoria proporcionan información valiosa para evaluar la gravedad de la enfermedad y las opciones de tratamiento. En determinados otros casos, los métodos y sistemas permiten la clasificación de la gravedad de la enfermedad a lo largo de un continuo de subgrupos de EII, y no meramente como EC, CU o CI. En otros aspectos, la utilización de múltiples marcadores (séricos, proteicos y/o genéticos) proporciona la capacidad de distinguir los respondedores de los no respondedores frente a determinadas terapias. Se da a conocer que la aplicación de un análisis estadístico a un perfil de marcadores séricos, proteicos y/o genéticos mejora la exactitud de la predicción de la progresión de la EII y de las complicaciones de la enfermedad, y que también permite la selección de las opciones de tratamiento apropiadas, incluyendo la terapia, tal como la terapia biológica, convencional o quirúrgica, o alguna combinación de las mismas. De acuerdo con lo anteriormente expuesto, resulta posible predecir el resultado de la enfermedad y los pacientes que presentan un riesgo particular de complicaciones de la enfermedad y/o la progresión hasta la cirugía.

Se da a conocer un método para ayudar en el pronóstico de la enfermedad intestinal inflamatoria (EII) en un individuo en el que se ha diagnosticado la EII, comprendiendo el método: (a) analizar una muestra obtenida del individuo para determinar la presencia, el nivel o el genotipo de uno o más marcadores seleccionados de entre el grupo que consiste de un marcador sérico, un marcador genético y una combinación de los mismos en la muestra con el fin de obtener un perfil de marcadores, (b) aplicar un análisis estadístico al perfil de marcadores con el fin de obtener un perfil pronóstico para el individuo, y (c) comparar el perfil pronóstico para el individuo con un modelo pronóstico para ayudar en el pronóstico de la EII.

Se da a conocer que el marcador sérico se selecciona de entre el grupo que consiste de un anticuerpo antineutrófilo, un anticuerpo anti-Saccharomyces cerevisiae, un anticuerpo antimicrobiano, una proteína de fase aguda, una apolipoproteína, una defensina, un factor de crecimiento, una citoquina, una cadherina y una molécula de adhesión celular y una combinación de los mismos. Se da a conocer que el anticuerpo antineutrófilo comprende un anticuerpo anticitoplasma de neutrófilo (AACN), tal como AACN detectado mediante un inmunoensayo (por ejemplo ELISA), un anticuerpo anticitoplasma de neutrófilo perinuclear (AACNp), tal como AACNp detectado mediante un ensayo inmunohistoquímico (por ejemplo IFA) o un ensayo inmunohistoquímico sensible a la ADNasa, o una combinación de los mismos. Se da a conocer que el anticuerpo anti-Saccharomyces cerevisiae comprende una inmunoglobulina A anti-Saccharomyces cerevisiae (IgA-ASCA), inmunoglobulina G anti-Saccharomyces cerevisiae (IgG-ASCA) o una combinación de los mismos. Se da a conocer que el anticuerpo antimicrobiano comprende un anticuerpo de proteína C de la membrana externa (anti-OmpC), un anticuerpo anti-I2, un anticuerpo anti-flagelina o una combinación de los mismos. En determinados casos, el anticuerpo antiflagelina comprende un anticuerpo antiflagelina Cbir-1, un anticuerpo antiflagelina X, un anticuerpo antiflagelina A, un anticuerpo antiflagelina B o una combinación de los mismos. Se da a conocer que la proteína de fase aguda es la proteína C reactiva (PCR). Se da a conocer que la apolipoproteína es amiloide sérico A (ASA). En todavía otra, la defensina es la defensina β (por ejemplo la defensina β1 (DB1) y/o la defensina β2 (DB2)). Se da a conocer que el factor de crecimiento es el factor de crecimiento epidérmico (FCE). Se da a conocer que la citoquina comprende inductor débil de la apoptosis relacionado con TNF (TWEAK, del inglés TNF-related weak inducer of apoptosis), IL-1β, IL-6 o una combinación de los mismos. Se da a conocer que la cadherina es cadherina E. Se da a conocer que la molécula de adhesión celular comprende MAIC-1, MACV-1 o una combinación de los mismos. Se da a conocer que el marcador sérico comprende o consiste de IgA-ASCA, IgG-ASCA, anticuerpo anti-OmpC, anticuerpo anti-CBir-1, anticuerpo anti-I2, ANACp (por ejemplo IFA ANACp y/o IFA ANACp sensible a ADNasa) o una combinación de los mismos. La presencia o nivel (de concentración) del marcador sérico puede detectarse (por ejemplo determinarse, medirse, analizarse, etc.) con un ensayo de hibridación, ensayo basado en la amplificación, inmunoensayo, ensayo inmunohistoquímico o una combinación de los mismos. Se describen ejemplo no limitativos de ensayos, técnicas y kits para detectar o determinar la presencia o el nivel de uno o más marcadores séricos en una muestra en la Sección VI, posteriormente. Se da a conocer que el marcador genético es por lo menos uno de los genes indicados en las Tablas 1A-1E (por ejemplo la Tabla 1A, 1B, 1C, 1D y/o 1E). Se da a conocer que el marcador genético es NOD2. El genotipo del marcador genético puede detectarse (por ejemplo determinarse, analizarse, etc.) mediante el genotipado de un individuo para la presencia o la ausencia de uno o más alelos variantes, tales como, por ejemplo, uno o más polimorfismos de un solo nucleótido (PSN) en uno o más marcadores genéticos. Se da a conocer que el PSN es por lo menos uno de los PSN indicados en las Tablas 1B-1E (por ejemplo la Tabla 1B, 1C, 1D y/o 1E). Se describen ejemplo no limitativos de técnicas para detectar o determinar el genotipo de uno o más marcadores genéticos en una muestra en la Sección VII, posteriormente. Se da a conocer que el marcador genético es NOD2 y el PSN es PSN8 (R702W), PSN12 (G908R) y/o PSN13 (1007fs). En determinados casos, la presencia o la ausencia de uno o más PSN de NOD2 se determina en combinación con la presencia o el nivel de uno o más marcadores séricos, por ejemplo IgA-ASCA, IgG-ASCA, anticuerpo anti-OmpC, anticuerpo anti-CBir-1, anticuerpo anti-I2, ANACp (por ejemplo IFA ANACp y/o IFA ANACp sensible a ADNasa) o una combinación de las mismas. En los métodos, el perfil de marcadores puede determinarse mediante la detección la presencia, el nivel o el genotipo de por lo menos dos, tres, cuatro, cinco, seis, siete, ocho, nueve o diez marcadores. Se da a conocer que la muestra es de suero, plasma, sangre completa y/o heces. Se da a conocer que se diagnostica en el individuo enfermedad de Crohn (EC), colitis ulcerosa (CU) o colitis indeterminada (CI). El análisis estadístico aplicado en el perfil de marcadores puede comprender cualquiera de entre una diversidad de métodos estadísticos, modelos y algoritmos descritos en la Sección IX, posteriormente. Se da a conocer que el análisis estadístico es un análisis de cuartiles. En algunos casos, el análisis de cuartiles convierte la presencia, el nivel o el genotipo de cada marcador en una puntuación de cuartiles. A modo de ejemplo no limitativo, el perfil pronóstico puede corresponder a una puntuación de suma de cuartiles (PSC) para el individuo que se obtiene sumando la puntuación de cuartiles para cada uno de los marcadores. Se da a conocer que el marcador biológico ANACp es una variable binaria y no cuantitativa, ya que adopta valor positivo o negativo. Tal como se indica en el Ejemplo 16 de la presente memoria, un estado positivo para ANACp se asocia a una tasa y/o riesgo más bajo de complicaciones (por ejemplo enfermedad estenosante interna, enfermedad penetrante interna y/o cirugía). En algunos casos, la puntuación de cuartiles para ANACp se invierte, de manera que un estado positivo se puntúa como “1” y un estado negativo se puntúa como “4”. Se da a conocer que el modelo pronóstico se establece utilizando una cohorte retrospectiva con resultados conocidos de un subtipo clínico de EII (por ejemplo EC, CU o CI). Se da a conocer que el modelo pronóstico se selecciona de entre el grupo que consiste de un modelo sérico, un modelo serogenético, un modelo genético y una combinación de los mismos. Se da a conocer que el modelo sérico se deriva mediante la aplicación de un análisis de regresión logística a la presencia o nivel de uno o más marcadores séricos determinados en la cohorte retrospectiva (ver, por ejemplo, los Ejemplos 16 y 17). Se da a conocer que el modelo serogenético se deriva mediante la aplicación de un análisis de regresión logística a la presencia o nivel de uno o más marcadores séricos y el genotipo de uno o más marcadores genéticos determinados en la cohorte retrospectiva (ver, por ejemplo, los Ejemplos 16 y 17). Se da a conocer que el modelo pronóstico es una escala de riesgo estandarizada (ver, por ejemplo, Ejemplo 16). Se da a conocer que la escala de riesgo estandarizada convierte un perfil pronóstico, tal como una puntuación de suma de cuartiles (PSC) para el individuo en un número de escala estandarizado, que puede corresponder a la probabilidad de un fenotipo de complicación (por ejemplo enfermedad estenosante interna, enfermedad penetrante interna, necesidad de cirugía de intestino delgado) alcanzado un año específico (por ejemplo el año 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, etc.) tras el diagnóstico. Se da a conocer que el modelo pronóstico comprende una visualización, impresión y/o informe, tal como una tabla de consulta o gráfico. Se da a conocer que la tabla de consulta o gráfico proporciona una probabilidad acumulada de que el individuo desarrolle o no una complicación de enfermedad de Crohn (EC) durante el tiempo. Se da a conocer que la tabla de consulta o gráfico proporciona una probabilidad acumulada de que el individuo requiera cirugía o de que no requiera cirugía durante el tiempo. La tabla de consulta o gráfico puede proporcionar una probabilidad acumulada de que dicho individuo desarrolle o no dicha complicación de colitis ulcerosa (CU) durante el tiempo.

En determinados casos, la complicación de EC se selecciona de entre el grupo que consiste de enfermedad estenosante interna, enfermedad penetrante interna y una combinación de las mismas. En determinados otros casos, la complicación de EC se selecciona de entre el grupo que consiste de un subtipo fibroestenótico de EC, EC caracterizada por enfermedad del intestino delgado, EC caracterizada por enfermedad fistulizante perianal, EC caracterizada por enfermedad perforante interna, EC caracterizada por la necesidad de cirugía del intestino delgado, EC caracterizada por la presencia de características de la CU, EC caracterizada por la ausencia de características de la CU, y una combinación de las mismas. En todavía otros casos, la cirugía es cirugía del intestino delgado. En otros casos, la complicación de CU se selecciona de entre el grupo que consiste de proctitis ulcerosa, proctosigmoiditis, colitis del lado izquierdo, pancolitis, colitis fulminante y una combinación de las mismas.

Se da a conocer que el perfil pronóstico es una puntuación de suma de cuartiles (PSC) para el individuo y la PSC se compara con un modelo pronóstico (por ejemplo un modelo sérico, un modelo serogenético, una escala de riesgos estandarizada, etc.). En determinados casos, el modelo pronóstico comprende el modelo sérico ilustrado en la figura 38a. En otros casos, el modelo pronóstico comprende el modelo serogenético ilustrado en la figura 38b. En casos adicionales, el modelo pronóstico comprende la escala de riesgos estandarizada mostrada en la Tabla 53. Se da a conocer que los métodos descritos en la presente memoria proporcionan una predicción de que las complicaciones de EC y/o progresión a cirugía se producirán a una tasa de (por lo menos) aproximadamente 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% o 100% (o cualquier intervalo en los mismos) alcanzado un año específico (por ejemplo el año 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, etc.) tras el diagnóstico basado en el perfil pronóstico de un individuo, por ejemplo en el PSC del individuo, opcionalmente en combinación con la presencia o ausencia de uno o más alelos variantes en uno o más marcadores genéticos, por ejemplo NOD2 (ver, por ejemplo, Ejemplos 16 a 17, figuras 38a-38b, y la Tabla 53). Los métodos pueden comprender además recomendar un curso de terapia para el individuo basado en la comparación entre el perfil pronóstico y el modelo pronóstico. Los métodos pueden comprender además enviar los resultados de la comparación a un médico.

Se da a conocer un método para predecir la probabilidad de que un individuo en el que se ha diagnosticado enfermedad intestinal inflamatoria (EII) responderá a un agente terapéutico de la EII, comprendiendo el método: (a) analizar una muestra obtenida del individuo para determinar la presencia, el nivel o el genotipo de uno o más marcadores seleccionados de entre el grupo que consiste de un marcador sérico, un marcador genético y una combinación de los mismos en la muestra con el fin de obtener un perfil de marcadores, (b) aplicar un análisis estadístico al perfil de marcadores con el fin de obtener un perfil terapéutico para el individuo, y (c) comparar el perfil terapéutico del individuo con un modelo terapéutico para ayudar en la predicción de la probabilidad de que un individuo en el que se ha diagnosticado EII responderá a un agente terapéutico para la EII.

Se da a conocer un método para seleccionar un fármaco adecuado para el tratamiento de la enfermedad intestinal inflamatoria (EII) en un individuo, comprendiendo el método: (a) analizar una muestra obtenida del individuo con el fin de determinar la presencia, el nivel o el genotipo de uno o más marcadores en la muestra a fin de obtener un perfil de marcadores, (b) aplicar un análisis estadístico al perfil de marcadores con el fin de obtener un perfil terapéutico para el individuo, y (c) comparar el perfil terapéutico para el individuo con un modelo terapéutico para ayudar en la selección de un fármaco adecuado para el tratamiento de la EI.

Los métodos encuentran utilizada en la predicción de si un individuo responderá a un agente biológico particular y/o fármaco convencional, incluyendo, aunque sin limitación, la terapia anti-factor de necrosis tumoral (FNT) (por ejemplo monoclonales quiméricos (por ejemplo infliximab), monoclonales humanizados (por ejemplo CDP571 y CDP870 PEGilado) y monoclonales humanos (por ejemplo adalimumab)), proteínas de fusión de p75 (por ejemplo etanercept), receptores solubles de p55 (por ejemplo onercept), moléculas pequeñas tales como inhibidores de la MAP quinasa y una combinación de las mismas. Los métodos también encuentran utilidad en la selección de un fármaco adecuado para el tratamiento de la EII, tal como un agente biológico particular y/o fármaco convencional indicado en la presente memoria. Se da a conocer que el marcador sérico se selecciona de entre el grupo que consiste de un anticuerpo antineutrófilo, un anticuerpo anti-Saccharomyces cerevisiae, un anticuerpo antimicrobiano, una proteína de fase aguda, una apolipoproteína, una defensina, un factor de crecimiento, una citoquina, una cadherina, una molécula de adhesión celular y una combinación de los mismos. Se da a conocer que el anticuerpo antineutrófilo comprende un anticuerpo anticitoplasma de neutrófilo (AACN), tal como AACN detectado mediante un inmunoensayo (por ejemplo ELISA), un anticuerpo anticitoplasma de neutrófilo perinuclear (AACNp), tal como AACNp detectado mediante un ensayo inmunohistoquímico (por ejemplo IFA) o un ensayo inmunohistoquímico sensible a la ADNasa, o una combinación de los mismos. Se da a conocer que el anticuerpo anti-Saccharomyces cerevisiae comprende una inmunoglobulina A anti-Saccharomyces cerevisiae (IgA-ASCA), inmunoglobulina G anti-Saccharomyces cerevisiae (IgG-ASCA) o una combinación de los mismos. Se da a conocer que el anticuerpo antimicrobiano comprende un anticuerpo anti-proteína C de la membrana externa (anti-OmpC), un anticuerpo anti-I2, un anticuerpo antiflagelina o una combinación de los mismos. En determinados casos, el anticuerpo antiflagelina comprende un anticuerpo antiflagelina Cbir-1, un anticuerpo antiflagelina X, un anticuerpo antiflagelina A, un anticuerpo antiflagelina B o una combinación de los mismos. Se da a conocer que la proteína de fase aguda es la proteína C reactiva (PCR). Se da a conocer que la apolipoproteína es amiloide sérico A (ASA). Se da a conocer que la defensina es la defensina β (por ejemplo la defensina β1 (DB1) y/o la defensina β2 (DB2)). Se da a conocer que el factor de crecimiento es el factor de crecimiento epidérmico (FCE). Se da a conocer que la citoquina comprende inductor débil de la apoptosis relacionado con TNF (TWEAK, del inglés TNF-related weak inducer of apoptosis), IL-1β, IL-6 o una combinación de los mismos. Se da a conocer que la cadherina es cadherina E. Se da a conocer que la molécula de adhesión celular comprende MAIC-1, MACV-1 o una combinación de los mismos.

Se da a conocer que el marcador sérico comprende o consiste de IgA-ASCA, IgG-ASCA, anticuerpo anti-OmpC, anticuerpo anti-CBir-1, anticuerpo anti-I2, ANACp (por ejemplo IFA ANACp y/o IFA ANACp sensible a ADNasa) o una combinación de los mismos. La presencia o nivel (de concentración) del marcador sérico puede detectarse (por ejemplo determinarse, medirse, analizarse, etc.) con un ensayo de hibridación, ensayo basado en la amplificación, inmunoensayo, ensayo inmunohistoquímico o una combinación de los mismos. Se describen ejemplo no limitativos de ensayos, técnicas y kits para detectar o determinar la presencia o el nivel de uno o más marcadores séricos en una muestra en la Sección VI, posteriormente.

Se da a conocer que el marcador genético es por lo menos uno de los genes indicados en las Tablas 2A-1E (por ejemplo la Tabla 1A, 1B, 1C, 1D y/o 1E). Se da a conocer que el marcador genético es NOD2. El genotipo del marcador genético puede detectarse (por ejemplo determinarse, analizarse, etc.) mediante el genotipado de un individuo para la presencia o la ausencia de uno o más alelos variantes, tales como, por ejemplo, uno o más polimorfismos de un solo nucleótido (PSN) en uno o más marcadores genéticos. Se da a conocer que el PSN es por lo menos uno de los PSN indicados en las Tablas 1B-1E (por ejemplo la Tabla 1B, 1C, 1D y/o 1E). Se describen ejemplo no limitativos de técnicas para detectar o determinar el genotipo de uno o más marcadores genéticos en una muestra en la Sección VII, posteriormente. Se da a conocer que el marcador genético es NOD2 y el PSN es PSN8 (R702W), PSN12 (G908R) y/o PSN13 (1007fs). En determinados casos, la presencia o la ausencia de uno o más PSN de NOD2 se determina en combinación con la presencia o el nivel de uno o más marcadores séricos, por ejemplo IgA-ASCA, IgG-ASCA, anticuerpo anti-OmpC, anticuerpo anti-CBir-1, anticuerpo anti-I2, ANACp (por ejemplo IFA ANACp y/o IFA ANACp sensible a ADNasa) o una combinación de las mismas. En los métodos, el perfil de marcadores puede determinarse mediante la detección de la presencia, el nivel o el genotipo de por lo menos dos, tres, cuatro, cinco, seis, siete, ocho, nueve o diez marcadores. Se da a conocer que la muestra es de suero, plasma, sangre completa y/o heces. Se da a conocer que se diagnostica en el individuo enfermedad de Crohn (EC), colitis ulcerosa (CU) o colitis indeterminada (CI).

El análisis estadístico aplicado en el perfil de marcadores puede comprender cualquiera de entre una diversidad de métodos estadísticos, modelos y algoritmos descritos en la Sección IX, posteriormente. En algunos casos, el análisis estadístico predice de que el individuo presenta una determinada probabilidad (por ejemplo alta o baja) de responder o no responder al agente terapéutico de la EII. En otros casos, el análisis estadístico predice si un determinado fármaco (por ejemplo un agente terapéutico para la EII) resulta adecuado para el tratamiento de la EII. Se da a conocer que el análisis estadístico es un análisis de cuartiles. En algunos casos, el análisis de cuartiles convierte la presencia, el nivel o el genotipo de cada marcador en una puntuación de cuartiles. A modo de ejemplo no limitativo, el perfil terapéutico puede corresponder a una puntuación de suma de cuartiles (PSC) para el individuo que se obtiene sumando la puntuación de cuartiles para cada uno de los marcadores. Se da a conocer que el modelo terapéutico se establece utilizando una cohorte retrospectiva de resultados terapéuticos conocidos con terapias conocidas, incluyendo agentes biológicos, esteroides, fármacos convencionales y/o procedimientos quirúrgicos. Se da a conocer que el modelo terapéutico se selecciona de entre el grupo que consiste de un modelo sérico, un modelo serogenético, un modelo genético y una combinación de los mismos. Se da a conocer que el modelo terapéutico es un modelo sérico que se deriva mediante la aplicación de un análisis de regresión logística respecto a la presencia o nivel de uno o más marcadores séricos determinados en la cohorte retrospectiva. Se da a conocer que el modelo terapéutico es un modelo serogenético que se deriva mediante la aplicación de un análisis de regresión logística respecto a la presencia o el nivel de uno o más marcadores séricos y el genotipo de uno o más marcadores genéticos determinados en la cohorte retrospectiva. Se da a conocer que el modelo terapéutico es una escala de riesgos estandarizada. Se da a conocer que la escala de riesgo estandarizada convierte un perfil terapéutico, tal como una puntuación de suma de cuartiles (PSC) para el individuo en un número de escala estandarizado, que puede corresponder a la probabilidad de respuesta a un agente terapéutico de la EII alcanzado un año específico (por ejemplo el año 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, etc.) tras el diagnóstico. Se da a conocer que el modelo terapéutico comprende una visualización, impresión y/o informe, tal como una tabla de consulta o gráfico. Se da a conocer que la tabla de consulta o gráfico proporciona una probabilidad acumulada de que el individuo responda o no al agente terapéutico para la EII durante el tiempo.

Se da a conocer que el perfil terapéutico es una puntuación de suma de cuartiles (PSC) para el individuo y la PSC se compara con un modelo terapéutico (por ejemplo un modelo sérico, un modelo serogenético, una escala de riesgos estandarizada, etc.).

Se da a conocer que los métodos descritos en la presente memoria proporcionan una predicción de que una respuesta a un agente terapéutico para la EII se producirá a una tasa de (por lo menos) aproximadamente 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% o 100% (o cualquier intervalo en los mismos) alcanzado un año específico (por ejemplo el año 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, etc.) tras el diagnóstico basado en el perfil terapéutico de un individuo, por ejemplo en el PSC del individuo, opcionalmente en combinación con la presencia o ausencia de uno o más alelos variantes en uno o más marcadores genéticos, por ejemplo NOD2. Los métodos pueden comprender además recomendar un curso de terapia para el individuo basado en la comparación entre el perfil terapéutico y el modelo terapéutico. Los métodos pueden comprender además enviar los resultados de la comparación a un médico. Se da a conocer un método para predecir una probabilidad de complicaciones de la enfermedad y/o cirugía en un individuo en el que se ha diagnosticado la enfermedad de Crohn (EC), comprendiendo el método: (a) analizar una muestra obtenida del individuo con el fin de determinar el nivel o el genotipo de uno o más marcadores en la muestra, y (b) comparar el nivel o el genotipo de cada uno de los marcadores con un nivel o genotipo de referencia con el fin de predecir la probabilidad de complicaciones de la enfermedad y/o cirugía en un individuo en que se ha diagnosticado la EII.

Se da a conocer que los marcadores se seleccionan de entre los marcadores séricos y/o genéticos descritos en la presente memoria. A modo de ejemplo no limitativo, el marcador sérico se selecciona de entre el grupo que consiste de un anticuerpo antineutrófilo, un anticuerpo anti-Saccharomyces cerevisiae, un anticuerpo antimicrobiano, una proteína de fase aguda, una apolipoproteína, una defensina, un factor de crecimiento, una citoquina, una cadherina, una molécula de adhesión celular y una combinación de los mismos. Se da a conocer que el anticuerpo antineutrófilo comprende un anticuerpo anticitoplasma de neutrófilo (AACN), tal como AACN detectado mediante un inmunoensayo (por ejemplo ELISA), un anticuerpo anticitoplasma de neutrófilo perinuclear (AACNp), tal como AACNp detectado mediante un ensayo inmunohistoquímico (por ejemplo IFA) o un ensayo inmunohistoquímico sensible a la ADNasa, o una combinación de los mismos. Se da a conocer que el anticuerpo anti-Saccharomyces

cerevisiae comprende una inmunoglobulina A anti-Saccharomyces cerevisiae (IgA-ASCA), inmunoglobulina G anti- Saccharomyces cerevisiae (IgG-ASCA) o una combinación de los mismos. Se da a conocer que el anticuerpo antimicrobiano comprende un anticuerpo de proteína C de la membrana externa (anti-OmpC), un anticuerpo anti-I2, un anticuerpo anti-flagelina o una combinación de los mismos. En determinados casos, el anticuerpo antiflagelina comprende un anticuerpo antiflagelina Cbir-1, un anticuerpo antiflagelina X, un anticuerpo antiflagelina A, un anticuerpo antiflagelina B o una combinación de los mismos. Se da a conocer que la proteína de fase aguda es la proteína C reactiva (PCR). Se da a conocer que la apolipoproteína es amiloide sérico A (ASA). Se da a conocer que la defensina es la defensina β (por ejemplo la defensina β1 (DB1) y/o la defensina β2 (DB2)). Se da a conocer que el factor de crecimiento es el factor de crecimiento epidérmico (FCE). Se da a conocer que la citoquina comprende inductor débil de la apoptosis relacionado con TNF (TWEAK, del inglés TNF-related weak inducer of apoptosis), IL-1β, IL-6 o una combinación de los mismos. Se da a conocer que la cadherina es cadherina E. Se da a conocer que la molécula de adhesión celular comprende MAIC-1, MACV-1 o una combinación de los mismos.

Se da a conocer que los marcadores comprenden o consisten de IgA-ASCA, IgA-ASCA, anticuerpo anti-OmpC, anticuerpo anti-CBir-1, anticuerpo anti-I2 o una combinación de los mismos. Se da a conocer que el marcador genético es por lo menos uno de los genes indicados en las Tablas 1A-1E (por ejemplo la Tabla 1A, 1B, 1C, 1D y/o 1E). Se da a conocer que el marcador genético es NOD2. El genotipo del marcador genético puede detectarse mediante el genotipado de un individuo para la presencia o la ausencia de uno o más alelos variantes, tales como, por ejemplo, uno o más PSN en uno o más marcadores genéticos. Se da a conocer que el PSN es por lo menos uno de los PSN indicados en las Tablas 1B-1E (por ejemplo la Tabla 1B, 1C, 1D y/o 1E). Se da a conocer que el marcador genético es NOD2 y el PSN es PSN8 (R702W), PSN12 (G908R) y/o PSN13 (1007fs). En determinados casos, la presencia o la ausencia de uno o más PSN de NOD2 se determina en combinación con la presencia o el nivel de uno o más marcadores séricos. En los métodos, puede determinarse la presencia, el nivel o el genotipo de por lo menos dos, tres, cuatro, cinco, seis, siete, ocho, nueve o diez marcadores. Se da a conocer que la muestra es de suero, plasma, sangre completa y/o heces. En determinados casos, se predice que el individuo presenta una probabilidad más alta de complicaciones de la enfermedad y/o de cirugía en el caso de que el nivel (de concentración) de por lo menos uno de los marcadores sea más alta que un nivel (concentración) de referencia. En determinados otros casos, se predice que el individuo presenta una probabilidad más alta de complicaciones de la enfermedad y/o de cirugía en el caso de que el genotipo de por lo menos uno de los marcadores sea un alelo variante de un genotipo de referencia. Entre los ejemplos no limitativos de complicaciones de enfermedad se incluyen la enfermedad estenosante interna y/o la enfermedad penetrante interna, así como cualquiera de entre las otras complicaciones de EC indicadas en la presente memoria.

Se da a conocer que el nivel (concentración) de referencia corresponde a un nivel (concentración) de uno de los marcadores en una muestra de un individuo que no presenta EC (por ejemplo un individuo sano, un individuo sin EC, un individuo sin EII, un individuo con EC, etc.). Se da a conocer que el genotipo de referencia corresponde a un genotipo de tipo salvaje (por ejemplo un alelo no variante o PSN) de uno de los marcadores genéticos.

Se da a conocer que los métodos descritos en la presente memoria proporcionan una predicción de que las complicaciones de enfermedad y/o cirugía se producirán a una tasa de (por lo menos) aproximadamente 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% o 100% (o cualquier intervalo en los mismos) alcanzado un año específico (por ejemplo el año 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, etc.) tras el diagnóstico basado en los niveles de marcador y/o genotipos de un individuo. En algunos casos, se predice que el individuo presenta una probabilidad de complicaciones de enfermedad y/o cirugía de entre aproximadamente 40% y aproximadamente 70% (por ejemplo de entre aproximadamente 40% y aproximadamente 60%, de entre aproximadamente 50% y aproximadamente 70%, etc.) pasados aproximadamente 10 años del diagnóstico de EC. En otros casos, se predice que el individuo presentará una probabilidad de complicaciones de enfermedad y/o de cirugía de entre aproximadamente 70% y aproximadamente 90% aproximadamente 20 años después de diagnosticarle EC. En otros casos, se predice que el individuo presentará una probabilidad de complicaciones de enfermedad y/o de cirugía de entre aproximadamente 80% y aproximadamente 100% aproximadamente 30 años después de diagnosticarle EC.

Los métodos pueden comprender además recomendar un curso de terapia para el individuo basándose en la comparación entre el nivel o el genotipo de cada uno de los marcadores y un nivel o genotipo de referencia. Los métodos pueden comprender además enviar los resultados de la comparación a un médico. Se da a conocer un método para predecir una probabilidad de complicaciones de la enfermedad y/o cirugía en un individuo en el que se ha diagnosticado la enfermedad de Crohn (EC), comprendiendo el método: (a) analizar una muestra obtenida del individuo con el fin de determinar la presencia, el nivel o el genotipo de uno o más marcadores en la muestra a fin de obtener un perfil de marcadores, (b) aplicar un análisis estadístico al perfil de marcadores con el fin de obtener un perfil pronóstico para el individuo, y (c) comparar el perfil pronóstico para el individuo con un modelo pronóstico con el fin de predecir la probabilidad de complicaciones de la enfermedad y/o de cirugía en un individuo en el que se ha diagnosticado la EC.

Se da a conocer que los marcadores se seleccionan de entre los marcadores séricos y/o genéticos descritos en la presente memoria. A modo de ejemplo no limitativo, el marcador sérico se selecciona de entre el grupo que consiste de un anticuerpo antineutrófilo, un anticuerpo anti-Saccharomyces cerevisiae, un anticuerpo antimicrobiano, una proteína de fase aguda, una apolipoproteína, una defensina, un factor de crecimiento, una citoquina, una cadherina, una molécula de adhesión celular y una combinación de los mismos. Se da a conocer que el anticuerpo antineutrófilo comprende un anticuerpo anticitoplasma de neutrófilo (AACN), tal como AACN detectado mediante un inmunoensayo (por ejemplo ELISA), un anticuerpo anticitoplasma de neutrófilo perinuclear (AACNp), tal como AACNp detectado mediante un ensayo inmunohistoquímico (por ejemplo IFA) o un ensayo inmunohistoquímico sensible a la ADNasa, o una combinación de los mismos. Se da a conocer que el anticuerpo anti-Saccharomyces cerevisiae comprende una inmunoglobulina A anti-Saccharomyces cerevisiae (IgA-ASCA), inmunoglobulina G anti- Saccharomyces cerevisiae (IgG-ASCA) o una combinación de los mismos.

Se da a conocer que el anticuerpo antimicrobiano comprende un anticuerpo de proteína C de la membrana externa (anti-OmpC), un anticuerpo anti-I2, un anticuerpo anti-flagelina o una combinación de los mismos. En determinados casos, el anticuerpo antiflagelina comprende un anticuerpo antiflagelina Cbir-1, un anticuerpo antiflagelina X, un anticuerpo antiflagelina A, un anticuerpo antiflagelina B o una combinación de los mismos. Se da a conocer que la proteína de fase aguda es la proteína C reactiva (PCR). Se da a conocer que la apolipoproteína es amiloide sérico A (ASA). Se da a conocer que la defensina es la defensina β (por ejemplo la defensina β1 (DB1) y/o la defensina β2 (DB2)). Se da a conocer que el factor de crecimiento es el factor de crecimiento epidérmico (FCE). Se da a conocer que la citoquina comprende inductor débil de la apoptosis relacionado con TNF (TWEAK, del inglés TNF-related weak inducer of apoptosis), IL-1β, IL-6 o una combinación de los mismos. Se da a conocer que la cadherina es cadherina E. Se da a conocer que la molécula de adhesión celular comprende MAIC-1, MACV-1 o una combinación de los mismos. Se da a conocer que los marcadores comprenden o consisten de IgA-ASCA, IgA-ASCA, anticuerpo anti-OmpC, anticuerpo anti-CBir-1, anticuerpo anti-I2 o una combinación de los mismos.

Se da a conocer que el marcador genético es por lo menos uno de los genes indicados en las Tablas 1A-1E (por ejemplo la Tabla 1A, 1B, 1C, 1D y/o 1E). Se da a conocer que el marcador genético es NOD2. El genotipo del marcador genético puede detectarse mediante el genotipado de un individuo para la presencia o la ausencia de uno o más alelos variantes, tales como, por ejemplo, uno o más PSN en uno o más marcadores genéticos. Se da a conocer que el PSN es por lo menos uno de los PSN indicados en las Tablas 1B-1E (por ejemplo la Tabla 1B, 1C, 1D y/o 1E). Se da a conocer que el marcador genético es NOD2 y el PSN es PSN8 (R702W), PSN12 (G908R) y/o PSN13 (1007fs). En determinados casos, la presencia o la ausencia de uno o más PSN de NOD2 se determina en combinación con la presencia o el nivel de uno o más marcadores séricos. En los métodos, puede determinarse la presencia, el nivel o el genotipo de por lo menos dos, tres, cuatro, cinco, seis, siete, ocho, nueve o diez marcadores. Se da a conocer que la muestra es de suero, plasma, sangre completa y/o heces. El análisis estadístico aplicado en el perfil de marcadores puede comprender cualquiera de entre una diversidad de métodos estadísticos, modelos y algoritmos descritos en la Sección IX, posteriormente. Se da a conocer que el análisis estadístico es un análisis de cuartiles. En algunos casos, el análisis de cuartiles convierte la presencia, el nivel o el genotipo de cada marcador en una puntuación de cuartiles. A modo de ejemplo no limitativo, el perfil pronóstico puede corresponder a una puntuación de suma de cuartiles (PSC) para el individuo que se obtiene sumando la puntuación de cuartiles para cada uno de los marcadores.

Se da a conocer que el modelo pronóstico comprende una visualización, impresión y/o informe, tal como una tabla de consulta o gráfico. Se da a conocer que la tabla de consulta o gráfico proporciona una probabilidad acumulada de que el individuo desarrolle o no una complicación de enfermedad de Crohn (EC) durante el tiempo. Se da a conocer que la tabla de consulta o gráfico proporciona una probabilidad acumulada de que el individuo requiera cirugía o de que no requiera cirugía durante el tiempo. Entre los ejemplos no limitativos de complicaciones de enfermedad se incluyen la enfermedad estenosante interna y/o la enfermedad penetrante interna, así como cualquiera de entre las otras complicaciones de EC indicadas en la presente memoria. Se da a conocer que el perfil pronóstico es una puntuación de suma de cuartiles (PSC) para el individuo y la PSC se compara con un modelo pronóstico (por ejemplo un modelo sérico, un modelo serogenético, una escala de riesgos estandarizada, etc.). Se da a conocer que se predice que el individuo presenta una probabilidad de complicaciones de enfermedad y/o de cirugía más elevadas en el caso de que el PSC sea superior a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, etc. (por ejemplo preferentemente superior a 10). Se da a conocer que los métodos descritos en la presente memoria proporcionan una predicción de que se produzcan complicaciones de enfermedad y/o cirugía a una tasa de (por lo menos) aproximadamente 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% o 100% (o cualquier intervalo en los mismos) alcanzado un año específico (por ejemplo el año 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, etc.) tras el diagnóstico basado en el perfil pronóstico de un individuo, tal como, por ejemplo, el PSC del individuo, opcionalmente en combinación con la presencia o ausencia de uno o más alelos variantes en uno o más marcadores genéticos, por ejemplo NOD2. En algunos casos, se predice que el individuo presentará una probabilidad de complicaciones de enfermedad y/o de cirugía de entre aproximadamente 40% y aproximadamente 70% (por ejemplo entre aproximadamente 40% y aproximadamente 60%, entre aproximadamente 50% y aproximadamente 70%, etc.) pasados aproximadamente 10 años del diagnóstico de EC en el caso de que la PSC sea superior a 10. En otros casos, se predice que el individuo presenta una probabilidad de complicaciones de enfermedad y/o de cirugía de entre aproximadamente 70% y aproximadamente 90% pasados aproximadamente 20 años desde el diagnóstico de EC en el caso de que la PSC sea superior a 10. En casos adicionales, se predice que el individuo presentará una probabilidad de complicaciones de enfermedad y/o de cirugía de entre aproximadamente 80% y aproximadamente 100% pasados aproximadamente 30 años del diagnóstico de EC en el caso de que la PSC sea superior a 10. Los métodos pueden comprender además recomendar un curso de terapia para el individuo basado en la comparación entre el perfil pronóstico y el modelo pronóstico. Los métodos pueden comprender además enviar los resultados de la comparación a un médico.

Se da a conocer un método para ayudar en el diagnóstico de enfermedad intestinal inflamatoria (EII), comprendiendo el método: (a) analizar una muestra obtenida del individuo con el fin de determinar el nivel o el genotipo de uno o más marcadores en la muestra, y (b) comparar el nivel o el genotipo de cada uno de los marcadores con un nivel o genotipo de referencia con el fin de ayudar en el diagnóstico de la EII.

Se da a conocer que los marcadores se seleccionan de entre los marcadores séricos y/o genéticos descritos en la presente memoria. A modo de ejemplo no limitativo, el marcador sérico se selecciona de entre el grupo que consiste de un anticuerpo antineutrófilo, un anticuerpo anti-Saccharomyces cerevisiae, un anticuerpo antimicrobiano, una proteína de fase aguda, una apolipoproteína, una defensina, un factor de crecimiento, una citoquina, una cadherina, una molécula de adhesión celular y una combinación de los mismos. Se da a conocer que el anticuerpo antineutrófilo comprende un anticuerpo anticitoplasma de neutrófilo (AACN), tal como AACN detectado mediante un inmunoensayo (por ejemplo ELISA), un anticuerpo anticitoplasma de neutrófilo perinuclear (AACNp), tal como AACNp detectado mediante un ensayo inmunohistoquímico (por ejemplo IFA) o un ensayo inmunohistoquímico sensible a la ADNasa, o una combinación de los mismos. Se da a conocer que el anticuerpo anti-Saccharomyces cerevisiae comprende una inmunoglobulina A anti-Saccharomyces cerevisiae (IgA-ASCA), inmunoglobulina G anti- Saccharomyces cerevisiae (IgG-ASCA) o una combinación de los mismos.

Se da a conocer que el anticuerpo antimicrobiano comprende un anticuerpo de proteína C de la membrana externa (anti-OmpC), un anticuerpo anti-I2, un anticuerpo anti-flagelina o una combinación de los mismos. En determinados casos, el anticuerpo antiflagelina comprende un anticuerpo antiflagelina Cbir-1, un anticuerpo antiflagelina X, un anticuerpo antiflagelina A, un anticuerpo antiflagelina B o una combinación de los mismos. Se da a conocer que la proteína de fase aguda es la proteína C reactiva (PCR). Se da a conocer que la apolipoproteína es amiloide sérico A (ASA). Se da a conocer que la defensina es la defensina β (por ejemplo la defensina β1 (DB1) y/o la defensina β2 (DB2)). Se da a conocer que el factor de crecimiento es el factor de crecimiento epidérmico (FCE). Se da a conocer que la citoquina comprende inductor débil de la apoptosis relacionado con TNF (TWEAK, del inglés TNF-related weak inducer of apoptosis), IL-1β, IL-6 o una combinación de los mismos. Se da a conocer que la cadherina es cadherina E. Se da a conocer que la molécula de adhesión celular comprende MAIC-1, MACV-1 o una combinación de los mismos. Se da a conocer que el marcador genético es por lo menos uno de los genes indicados en las Tablas 1A-1E (por ejemplo la Tabla 1 A, 1B, 1C, 1D y/o 1E). Se da a conocer que el marcador genético es NOD2. El genotipo del marcador genético puede detectarse mediante el genotipado de un individuo para la presencia o la ausencia de uno o más alelos variantes, tales como, por ejemplo, uno o más PSN en uno o más marcadores genéticos. Se da a conocer que el PSN es por lo menos uno de los PSN indicados en las Tablas 1B-1E (por ejemplo la Tabla 1B, 1C, 1D y/o 1E). Se da a conocer que el marcador genético es NOD2 y el PSN es PSN8 (R702W), PSN12 (G908R) y/o PSN13 (1007fs). En determinados casos, la presencia o la ausencia de uno o más PSN de NOD2 se determina en combinación con la presencia o el nivel de uno o más marcadores séricos.

En los métodos, puede determinarse la presencia, el nivel o el genotipo de por lo menos dos, tres, cuatro, cinco, seis, siete, ocho, nueve o diez marcadores. Se da a conocer que la muestra es de suero, plasma, sangre completa y/o heces.

Se da a conocer que el nivel (concentración) de referencia corresponde a un nivel (concentración) de uno de los marcadores en una muestra de un individuo que no presenta EC (por ejemplo un individuo sano, un individuo sin EII, un individuo sin EC, un individuo con CU, etc.). Se da a conocer que el genotipo de referencia corresponde a un genotipo de tipo salvaje (por ejemplo un alelo no variante o PSN) de uno de los marcadores genéticos.

Se da a conocer que los métodos descritos en la presente memoria proporcionan una probabilidad de EII (o un subtipo clínico de la misma) de (por lo menos) aproximadamente 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% o 100% (o cualquier intervalo en los mismos) basado en los niveles de marcador y/o genotipos del individuo.

Los métodos pueden comprender además recomendar un curso de terapia para el individuo basándose en la comparación entre el nivel o el genotipo de cada uno de los marcadores y un nivel o genotipo de referencia. Los métodos pueden comprender además enviar los resultados de la comparación a un médico.

Se da a conocer un método para ayudar en el diagnóstico de enfermedad intestinal inflamatoria (EII), comprendiendo el método: (a) analizar una muestra obtenida del individuo con el fin de determinar la presencia, el nivel o el genotipo de uno o más marcadores en la muestra a fin de obtener un perfil de marcadores, y (b) aplicar un análisis estadístico al perfil de marcadores con el fin de ayudar en el diagnóstico de la EII.

Se da a conocer que los marcadores se seleccionan de entre los marcadores séricos y/o genéticos descritos en la presente memoria. A modo de ejemplo no limitativo, el marcador sérico se selecciona de entre el grupo que consiste de un anticuerpo antineutrófilo, un anticuerpo anti-Saccharomyces cerevisiae, un anticuerpo antimicrobiano, una proteína de fase aguda, una apolipoproteína, una defensina, un factor de crecimiento, una citoquina, una cadherina, una molécula de adhesión celular y una combinación de los mismos. Se da a conocer que el anticuerpo antineutrófilo comprende un anticuerpo anticitoplasma de neutrófilo (AACN), tal como AACN detectado mediante un inmunoensayo (por ejemplo ELISA), un anticuerpo anticitoplasma de neutrófilo perinuclear (AACNp), tal como AACNp detectado mediante un ensayo inmunohistoquímico (por ejemplo IFA) o un ensayo inmunohistoquímico sensible a la ADNasa, o una combinación de los mismos. Se da a conocer que el anticuerpo anti-Saccharomyces cerevisiae comprende una inmunoglobulina A anti-Saccharomyces cerevisiae (IgA-ASCA), inmunoglobulina G anti- Saccharomyces cerevisiae (IgG-ASCA) o una combinación de los mismos. Se da a conocer que el anticuerpo antimicrobiano comprende un anticuerpo de proteína C de la membrana externa (anti-OmpC), un anticuerpo anti-I2, un anticuerpo anti-flagelina o una combinación de los mismos. En determinados casos, el anticuerpo antiflagelina comprende un anticuerpo antiflagelina Cbir-1, un anticuerpo antiflagelina X, un anticuerpo antiflagelina A, un anticuerpo antiflagelina B o una combinación de los mismos. En un caso adicional, la proteína de fase aguda es la proteína C reactiva (PCR). Se da a conocer que la apolipoproteína es amiloide sérico A (ASA). Se da a conocer que la defensina es la defensina β (por ejemplo la defensina β1 (DB1) y/o la defensina β2 (DB2)). Se da a conocer que el factor de crecimiento es el factor de crecimiento epidérmico (FCE). Se da a conocer que la citoquina comprende inductor débil de la apoptosis relacionado con TNF (TWEAK, del inglés TNF-related weak inducer of apoptosis), IL-1β, IL-6 o una combinación de los mismos. Se da a conocer que la cadherina es cadherina E. Se da a conocer que la molécula de adhesión celular comprende MAIC-1, MACV-1 o una combinación de los mismos.

Se da a conocer que el marcador genético es por lo menos uno de los genes indicados en las Tablas 1A-1E (por ejemplo la Tabla 1A, 1B, 1C, 1D y/o 1E). Se da a conocer que el marcador genético es NOD2. El genotipo del marcador genético puede detectarse mediante el genotipado de un individuo para la presencia o la ausencia de uno o más alelos variantes, tales como, por ejemplo, uno o más PSN en uno o más marcadores genéticos. Se da a conocer que el PSN es por lo menos uno de los PSN indicados en las Tablas 1B-1E (por ejemplo la Tabla 1B, 1C, 1D y/o 1E). Se da a conocer que el marcador genético es NOD2 y el PSN es PSN8 (R702W), PSN12 (G908R) y/o PSN13 (1007fs). En determinados casos, la presencia o la ausencia de uno o más PSN de NOD2 se determina en combinación con la presencia o el nivel de uno o más marcadores séricos.

En los métodos, puede determinarse la presencia, el nivel o el genotipo de por lo menos dos, tres, cuatro, cinco, seis, siete, ocho, nueve o diez marcadores. Se da a conocer que la muestra es de suero, plasma, sangre completa y/o heces. El análisis estadístico aplicado en el perfil de marcadores puede comprender cualquiera de entre una diversidad de métodos estadísticos, modelos y algoritmos descritos en la Sección IX, posteriormente. Se da a conocer que el análisis estadístico es un análisis de cuartiles. En algunos casos, el análisis de cuartiles convierte la presencia, el nivel o el genotipo de cada marcador en una puntuación de cuartiles. A modo de ejemplo no limitativo, el perfil pronóstico puede corresponder a una puntuación de suma de cuartiles (PSC) para el individuo que se obtiene sumando la puntuación de cuartiles para cada uno de los marcadores. Se da a conocer que el análisis estadístico comprende uno o más sistemas clasificadores estadísticos de aprendizaje tal como se indica en la presente memoria. Se da a conocer que el análisis estadístico comprende una combinación de por lo menos dos sistemas clasificadores estadísticos de aprendizaje. Un ejemplo no limitativo de dicha combinación incluye un árbol de decisión/clasificación (por ejemplo un árbol de clasificación y regresión (ACyR), un bosque aleatorio, etc.) y una red neural, por ejemplo aplicada en tándem. En determinados casos, los métodos comprenden aplicar un primer análisis estadístico (por ejemplo un árbol de decisión/clasificación) a la presencia, nivel o genotipo determinado para cada uno de los marcadores con el fin de generar una predicción o valor de probabilidad, y después aplicar un segundo análisis estadístico (por ejemplo una red neural) a la predicción o valor de probabilidad y a la presencia, nivel o genotipo determinado para cada uno de los marcadores con el fin de ayudar en el diagnóstico de EII (por ejemplo mediante la clasificación de la muestra como muestra de EII o muestra no de EII).

Se da a conocer que los métodos comprenden además comparar los resultados del análisis estadístico (es decir, el perfil diagnóstico) con una referencia (es decir, un modelo diagnóstico) con el fin de ayudar en el diagnóstico de la EII. En algunos casos, el modelo diagnóstico comprende una visualización, impresión y/o informe, tal como una tabla de consulta o gráfico. En otros casos, el perfil diagnóstico es una puntuación de suma de cuartiles (PSC) para el individuo y la PSC se compara con un modelo diagnóstico. Se da a conocer que se predice que el individuo presenta una probabilidad más elevada de presentar EII en el caso de que la PSC sea superior a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, etc. Se da a conocer que los métodos descritos en la presente memoria proporcionan una probabilidad de EII (o un subtipo clínico de la misma) de (por lo menos) aproximadamente 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% o 100% (o cualquier intervalo en los mismos) basado en el perfil diagnóstico del individuo, tal como, por ejemplo, la PSC del individuo, opcionalmente en combinación con la presencia o la ausencia de uno o más alelos variantes en uno o más marcadores genéticos, por ejemplo NOD2.

Los métodos pueden comprender además recomendar un curso de terapia para el individuo basado en el análisis estadístico o la comparación entre el perfil diagnóstico y el modelo diagnóstico. Los métodos pueden comprender además enviar los resultados del análisis estadístico o comparación a un médico. IV. Subtipos clínicos de EII La enfermedad intestinal inflamatoria (EII) es un grupo de condiciones inflamatorias del intestino grueso y el intestino delgado. Las formas principales de EII son la enfermedad de Crohn (EC) y la colitis ulcerosa (CU). Entre otras formas menos comunes de EII se incluyen, por ejemplo, la colitis indeterminada (CI), la colitis colagenosa, la colitis linfocítica, la colitis isquémica, la colitis de diversión, el síndrome de Behçet, la colitis infecciosa y similares. Se hace referencia a la publicación de patente US nº 2008/0131439, titulada "Methods of Diagnosing Inflammatory Bowel Disease" [Métodos de diagnóstico de la enfermedad intestinal inflamatoria]. A. Enfermedad de Crohn La enfermedad de Crohn (EC) es una enfermedad de inflamación crónica que puede implicar cualquier parte del tracto gastrointestinal. Comúnmente resulta afectada la parte distal del intestino delgado, es decir, el íleo, y el ciego. En otros casos, la enfermedad se confina al intestino delgado, colon o región anorrectal. La EC ocasionalmente implica al duodeno y al estómago, y más raramente al esófago y a la cavidad oral.

Las manifestaciones clínicas variables de la EC son un resultado, en parte, de la localización anatómica variable de la enfermedad. Los síntomas más frecuentes de la EC son el dolor abdominal, la diarrea y la fiebre recurrente. La EC se asocia comúnmente a obstrucción intestinal o fístula, un paso anormal entre asas intestinales enfermas. La EC incluye además complicaciones tales como la inflamación ocular, de las articulaciones y de la piel, enfermedad hepática, cálculos renales y amiloidosis. Además, la EC se asocia a un riesgo incrementado de cáncer intestinal.

Son características varios elementos de la patología de la EC. La inflamación asociada a la EC, conocida como inflamación transmural, implica todas las capas de la pared intestinal. El engrosamiento y el edema, por ejemplo, típicamente aparecen también en toda la pared intestinal, con presencia de fibrosis en las formas antiguas de la enfermedad. La inflamación característica de la EC es discontinua en el aspecto de que los segmentos de tejido inflamado, conocidos como "lesiones discontinuas", se encuentran separados por intestino de apariencia normal. Además, las ulceraciones lineales, edema e inflamación del tejido intermedio conducen a una apariencia "parcheada" de la mucosa intestinal, que es signo distintivo de la EC. Una característica distintiva de la EC es la presencia de agregaciones discretas de células inflamatorias, conocidas como granulomas, que se observan generalmente en la submucosa. Algunos casos de EC muestran granulomas discretos típicos, mientras que otros muestran una reacción granulomatosa difusa o una inflamación transmural no específica. Como resultado, la presencia de granulomas discretos es indicativa de EC, aunque la ausencia de granulomas también es consistente con la enfermedad. De esta manera, la inflamación transmural o discontinua, y no la presencia de granulomas, es un indicador diagnóstico preferente de EC (Rubin y Farber, Pathology (segunda edición), Philadelphia, J.B. Lippincott Company, 1994).

La enfermedad de Crohn puede clasificarse según el comportamiento de la enfermedad a medida que progresa. Ello fue formalizado en la clasificación de Viena de la enfermedad de Crohn. Ver Gasche et al., Inflamm. Bowel Dis. 6:8- 15, 2000. Existen tres categorías de la presentación de la enfermedad de Crohn: (1) estenosante, (2) penetrante e (3) inflamatoria. La enfermedad estenosante provoca el estrechamiento del intestino, lo que puede conducir a la obstrucción del intestino o a cambios en el calibre de las heces. La enfermedad penetrante crea pasos anormales (fístulas) entre el intestino y otras estructuras, tales como la piel. La enfermedad inflamatoria (también conocida como enfermedad no penetrante no estenosante) provoca inflamación sin causar estenosis o fístulas. De esta manera, la enfermedad de Crohn representa varios subtipos heterogéneos de enfermedad que afectan al tracto gastrointestinal y que pueden producir síntomas similares. Tal como se utiliza en la presente memoria en referencia a la EC, la expresión "subtipo clínico" incluye una clasificación de la EC definida por un conjunto de criterios clínicos que distinguen una clasificación de la EC de otra. A modo de ejemplos no limitativos, los sujetos con EC pueden clasificarse como que presentan enfermedad estenosante (por ejemplo estenosis interna), penetrante (por ejemplo penetrante interna) o inflamatoria tal como se indica en la presente memoria, o estos sujetos pueden clasificarse adicional o alternativamente como que presentan enfermedad fibroestenótica, enfermedad del intestino delgado, enfermedad perforante interna, enfermedad fistulizante perianal, enfermedad similar a la CU, la necesidad de cirugía del intestino delgado, la ausencia de características de la CU o combinaciones de las mismas. En determinados casos, los sujetos con EC pueden clasificarse como que presentan EC complicada, que es un subtipo clínico caracterizado por fenotipos estenosantes o penetrantes. En determinados otros casos, los sujetos con EC pueden clasificarse como que presentan EC caracterizada por una o más de las complicaciones siguientes: fibroestenosis, enfermedad perforante interna y la necesidad de cirugía del intestino delgado. En casos adicionales, los sujetos con EC pueden clasificarse como que presentan una forma agresiva de enfermedad fibroestenótica que requiere de cirugía del intestino delgado. Los criterios referentes a dichos subtipos han sido descritos en, por ejemplo, Gasche et al., Inflamm. Bowel Dis. 6:8-15, 2000; Abreu et al., Gastroenterology 123:679-688, 2002; Vasiliauskas et al., Gut 47:487-496, 2000; Vasiliauskas et al., Gastroenterology 110:1810-1819, 1996; y Greenstein et al., Gut 29:588-592, 1988. El "subtipo fibroestenóstico" de la EC es una clasificación de la EC caracterizada por una o más características aceptadas de la enfermedad fibroestenosante. Entre dichas características de la enfermedad fibroestenosante se incluyen, aunque sin limitarse a ellas, la obstrucción intestinal persistente documentada o una resección intestinal por una obstrucción intestinal. El subtipo fibroestenótico de la EC puede verse acompañada de otros síntomas, tales como perforaciones, abscesos o fístulas, y puede caracterizarse además por síntomas persistentes de bloqueo intestinal, tales como náuseas, vómitos, distensión abdominal e incapacidad de ingerir alimentos sólidos. Las radiografías intestinales de los pacientes con el subtipo fibroestenótico de EC pueden mostrar, por ejemplo, distensión del intestino antes del punto de bloqueo. La necesidad de cirugía del intestino delgado en un sujeto con el subtipo fibroestenótico de EC puede indicar una forma más agresiva de este subtipo. También se conocen de la técnica subtipos adicionales de EC y pueden identificarse utilizando criterios clínicos definidos. Por ejemplo, la enfermedad perforante interna es un subtipo clínico de EC definido por pruebas actuales o previas de fístulas entero-entéricas o entero-vesiculares, abscesos intraabdominales o perforación del intestino delgado. La enfermedad perforante perianal es un subtipo clínico de la EC definida por evidencia actual o previa de fístula o abscesos perianales o fístula rectovaginal. El subtipo clínico similar a la CU de la EC puede definirse por la evidencia actual o previa de participación colónica del lado izquierdo, síntomas de sangrado o urgencia, y abscesos en criptas en biopsias colónicas. La localización de la enfermedad puede clasificarse basándose en uno o más estudios endoscópicos, radiológicos o patológicos. El experto en la materia entenderá que puede existir un solapamiento entre subtipos clínicos de la EC y que un sujeto que presenta EC puede presentar más de un subtipo clínico de EC. Por ejemplo, un sujeto que presenta EC puede presentar el subtipo fibroestenótico de EC y también puede cumplir los criterios clínicos de un subtipo clínico caracterizado por la necesidad de cirugía del intestino delgado o el subtipo de enfermedad perforante interna. De manera similar, los marcadores descritos en la presente memoria pueden estar asociados a más de un subtipo clínico de EC.

B. Colitis ulcerosa La colitis ulcerosa (CU) es una enfermedad del intestino grueso caracterizada por diarrea crónica con cólicos, dolor abdominal, sangrado rectal, descargas poco compactas de sangre, pus y moco. Las manifestaciones de la CU pueden variar ampliamente. Un patrón de exacerbaciones y remisiones típifica el curso clínico de aproximadamente el 70% de los pacientes de CU, aunque se presentan síntomas continuos sin remisión en algunos pacientes de CU. Entre las complicaciones locales y sistémicas de la CU se incluyen artritis, inflamación ocular, tal como uveitis, úlceras de la piel y enfermedad hepática. Además, la CU, y especialmente la forma extensiva de larga duración de la enfermedad, se asocia a un riesgo incrementado de carcinoma de colon. La CU es una enfermedad difusa que habitualmente se extiende desde la parte más distal del recto durante una distancia variable proximalmente. La expresión "colitis del lado izquierdo" describe una inflamación que implica la parte distal del colon, extendiéndose hasta incluso el ángulo esplénico. La no afectación del recto o la afectación del lado derecho (parte proximal) del colon solamente es poco habitual en la CU. El proceso inflamatorio de la CU se encuentra limitado al colon y no afecta, por ejemplo, al intestino delgado, estómago o esófago. Además, la CU se distingue por una inflamación superficial de la mucosa que generalmente no afecta a las capas más profundas de la pared intestinal. Los abscesos en las criptas, en las que las criptas intestinales degeneradas se llenan de neutrófilos, también son típicas de la CU (Rubin y Farber, supra). En determinados casos, con respecto a la CU, la variabilidad de los síntomas refleja diferencias en la extensión de la enfermedad (es decir, la cantidad del colon y del recto que se encuentra inflamada) y en la intensidad de la inflamación. La enfermedad se inicia en el recto y se desplaza "hacia arriba" del colon, afectando a una mayor proporción del órgano. La CU puede clasificarse según la cantidad de colon afectada. Típicamente, los pacientes con inflamación confinada al recto y a un segmento corto del colon contiguo al recto presentan síntomas más leves y un mejor pronóstico que los pacientes con una inflamación más extendida del colon.

En comparación con la EC, que es una enfermedad parcheada que frecuentemente no afecta al recto, la CU se caracteriza por una inflamación continua del colon que habitualmente es más grave distalmente que proximalmente. La inflamación en la CU es superficial en el aspecto de que habitualmente se encuentra limitada a la capa mucosal y se caracteriza por un infiltrado inflamatorio agudo con neutrófilos y abscesos en las criptas. En contraste, la EC afecta al grosor completo de la pared intestinal con presencia frecuentemente de granulomas, aunque no en todos los casos. La enfermedad que termina en la válvula ileocecal, o en el colon distal a la misma, es indicativa de CU, mientras que la afectación del íleo terminal, una apariencia parcheada, úlceras discretas o fístulas sugiere EC. Los diferentes tipos de colitis ulcerosa se clasifican según la localización y la extensión de la inflamación. Tal como se utiliza en la presente memoria en referencia a la EC, la expresión "subtipo clínico" incluye una clasificación de la EC definida por un conjunto de criterios clínicos que distinguen una clasificación de la EC de otra. A modo de ejemplos no limitativos, los sujetos con CU puede clasificarse como presentando proctitis ulcerosa, proctosigmoiditis, colitis del lado izquierdo, pancolitis, colitis fulminante y combinaciones de las mismas. Los criterios referentes a dichos subtipos han sido descritos en, por ejemplo, Kornbluth et al., Am. J. Gastroenterol. 99:1371-85, 2004.

La proctitis ulcerosa es un subtipo clínico de la CU definida por inflamación que se encuentra limitada al recto. La proctosigmoiditis es un subtipo clínico de la CU que afecta al recto y al colon sigmoide. La colitis del lado izquierdo es un subtipo clínico de la CU que afecta al lado izquierdo completo del colon, desde el resto hasta el sitio en el que el colon se une proximalmente al colon y empieza a recorrer el abdomen superior (el ángulo esplénico). La pancolitis es un subtipo clínico de la CU que afecta a todo el colon. La colitis fulminante es una forma rara aunque grave de pancolitis. Los pacientes con colitis fulminante se encuentra extremadamente enfermos, con deshidratación, dolor abdominal severo, diarrea prolongada con sangrado e incluso choque. Se da a conocer que la clasificación del subtipo clínico de CU es importante en la planificación de un curso eficaz de tratamiento. Aunque la proctitis ulcerosa, proctosigmoiditis y colitis del lado izquierdo pueden tratarse con agentes locales que se introducen por el ano, incluyendo los basados en esteroides u otros enemas y espumas, la pancolitis debe tratarse con medicación oral de manera que los ingredientes activos pueden alcanzar la totalidad de las partes afectadas del colon. El experto en la materia entenderá que puede existir un solapamiento entre subtipos clínicos de la EC y que un sujeto que presenta EC puede presentar más de un subtipo clínico de EC. De manera similar, los marcadores pronósticos descritos en la presente memoria pueden estar asociados a más de un subtipo clínico de EC. C. Colitis indeterminada La colitis indeterminada (CI) es un subtipo clínico de la EII que incluye ambas características de la EC y la CU. Dicha solapamiento de los síntomas de ambas enfermedades puede producirse temporalmente (por ejemplo en los primeros estadios de la enfermedad) o persistentemente (por ejemplo durante toda la progresión de la enfermedad) en pacientes con CI. Clínicamente, la CI se caracteriza por dolor abdominal y diarrea con o sin sangrado rectal. Por ejemplo, se observa colitis con múltiples ulceraciones intermitentes separadas por mucosa normal en los pacientes que presentan la enfermedad. Histológicamente existe un patrón de ulceración grave con inflamación transmural. El recto típicamente está libre de la enfermedad y las células inflamatorias linfoides no muestran agregación. Aunque se observan fisuras de tipo hendidura profundas con focos de miocitolisis, la mucosa intermedia típicamente presenta una congestión mínima, con conservación de las células caliciformes en los pacientes con CI.

V. Marcadores de la EII Una diversidad de marcadores de la EII, incluyendo marcadores bioquímicos, marcadores séricos, marcadores proteicos, marcadores genéticos y otras características clínicas o ecográficas, resulta adecuada para la utilización en los métodos de diagnóstico de la EII, pronosticando el resultado futuro de la enfermedad y prediciendo la respuesta a la terapia con agentes terapéuticos tales como agentes biológicos. En determinados aspectos, los métodos diagnósticos y pronósticos descritos en la presente memoria utilizan la aplicación de un algoritmo (por ejemplo el análisis estadístico) a la presencia, nivel de concentración o genotipo determinado para uno o más marcadores de la EII con el fin de ayudar o asistir en el diagnóstico de la EII o con el fin de proporcionar un pronóstico referente a la progresión de la enfermedad (por ejemplo la probabilidad de desarrollar una EC complicada o la necesidad de cirugía del intestino delgado en un momento posterior).

Entre los ejemplos no limitativos de EII se incluyen: (i) marcadores bioquímicos, séricos y proteicos, tales como, por ejemplo, citoquinas, factores de crecimiento, anticuerpos antineutrófilos, anticuerpos anti-Saccharomyces cerevisiae, anticuerpos antimicrobianos, proteínas de fase aguda, apolipoproteínas, defensinas, cadherinas, moléculas de adhesión celular y combinaciones de los mismos, e (ii) marcadores genéticos tales como, por ejemplo, cualquiera de los genes indicados en las Tablas 1A-1E (por ejemplo NOD2) y los ARNmi en la Tabla 2. A. Citoquinas La determinación de la presencia o del nivel de por lo menos una citoquina en una muestra resulta particularmente útil. Tal como se utiliza en la presente memoria, el término "citoquina" incluye cualquiera de entre una diversidad de polipéptidos o proteínas secretados por células inmunológicas que regulan un abanico de funciones del sistema inmunológico y comprende citoquinas pequeñas tales como las quimoquinas. El término "citoquina" incluye además las adipocitoquinas, que comprenden un grupo de citoquinas secretadas por adipocitos que funcionan, por ejemplo, en la regulación del peso corporal, la hematopoyesis, la angiogénesis, la cicatrización de heridas, la resistencia a la insulina, la respuesta inmunológica y la respuesta inflamatoria. En determinados aspectos, se determina la presencia o el nivel de por lo menos una citoquina, incluyendo, aunque sin limitarse a ellos, TNF-α, inductor débil relacionado con TNF de apoptosis (TWEAK), osteoprotegerina (OPG), IFN-α, IFN-β, IFN-γ, IL-1α, IL-1β, antagonista de receptores de IL-1 (IL-1ra), IL-2, IL-4, IL-5, IL-6, receptor soluble de IL-6 (sIL-6R), IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-23 e IL-27. En determinados otros aspectos, se determina en una muestra la presencia o el nivel de por lo menos una quimoquina, tal como, por ejemplo, CXCL1/GRO1/GROα, CXCL2/GRO2, CXCL3/GRO3, CXCL4/PF-4, CXCL5/ENA-78, CXCL6/GCP-2, CXCL7/NAP-2, CXCL9/MIG, CXCL10/IP-10, CXCL11/I-TAC, CXCL12/SDF-1, CXCL13/BCA-1, CXCL14/BRAK, CXCL15, CXCL16, CXCL17/DMC, CCL1, CCL2/MCP-1, CCL3/MIP-1α, CCL4/MIP-1β, CCL5/RANTES, CCL6/C10, CCL7/MCP-3, CCL8/MCP-2, CCL9/CCL10, CCL11/Eotaxina, CCL12/MCP-5, CCL13/MCP-4, CCL14/HCC-1, CCL15/MIP-5, CCL16/LEC, CCL17/TARC, CCL18/MIP-4, CCL19/MIP-3β, CCL20/MIP-3α, CCL21/SLC, CCL22/MDC, CCL23/MPIF1, CCL24/Eotaxina-2, CCL25/TECK, CCL26/Eotaxina-3, CCL27/CTACK, CCL28/MEC, CL1, CL2 y CX3CL1. En determinados aspectos adicionales, se determina en una muestra la presencia o el nivel de por lo menos una adipocitoquina, incluyendo, aunque sin limitarse a ellos, la leptina, la adiponectina, la resistina, el inhibidor 1 del activador del plasminógeno activo o total (PAI-1), visfatina y proteína 4 de unión a retinol (PUR4). Preferentemente se determina la presencia o el nivel de IL-6, IL-1β y/o TWEAK. En determinados casos, la presencia o el nivel de una citoquina particular se detecta al nivel de la expresión de ARNm con un ensayo tal como, por ejemplo, un ensayo de hibridación o un ensayo basado en la amplificación. En determinados otros casos, la presencia o el nivel de una citoquina particular se detecta al nivel de la expresión de proteínas utilizando, por ejemplo, un inmunoensayo (por ejemplo ELISA) o un ensayo inmunohistoquímico. Los kits de ELISA adecuados para determinar la presencia o el nivel de una citoquina tal como IL-6, IL-1β o TWEAK en una muestra de suero, plasma, saliva u orina se encuentran disponibles de, por ejemplo, R&D Systems, Inc. (Minneapolis, MN), Neogen Corp. (Lexington, KY), Alpco Diagnostics (Salem, NH), Assay Designs, Inc. (Ann Arbor, MI), BD Biosciences Pharmingen (San Diego, CA), Invitrogen (Camarillo, CA), Calbiochem (San Diego, CA), CHEMICON International, Inc. (Temecula, CA), Antigenix America Inc. (Huntington Station, NY), QIAGEN Inc. (Valencia, CA), Bio-Rad Laboratories, Inc. (Hercules, CA) y/o Bender MedSystems Inc. (Burlingame, CA). La secuencia del polipéptido IL-6 humano se proporciona en, por ejemplo, GenBank nº de acceso NP_000591 (SEC ID nº 1). La secuencia (codificante) del ARNm de IL-6 humano se proporciona en, por ejemplo, GenBank nº de acceso NM_000600 (SEC ID nº 2). El experto en la materia apreciará que IL-6 también es conocida como interferón beta 2 (IFNB2), FCH, FCT y FECB2. La secuencia del polipéptido IL-1β humano se proporciona en, por ejemplo, GenBank nº de acceso NP_000567 (SEC ID nº 3). La secuencia (codificante) del ARNm de IL-1β humano se proporciona en, por ejemplo, GenBank nº de acceso NM_000576 (SEC ID nº 4). El experto en la materia apreciará que IL-1β también es conocido como IL1F2 e IL-1beta. La secuencia del polipéptido TWEAK humano se proporciona en, por ejemplo, GenBank nº de acceso NP_003800 (SEC ID nº 5) y AAC51923. La secuencia (codificante) del ARNm de TWEAK humano se proporciona en, por ejemplo, GenBank nº de acceso NM_003809 (SEC ID nº 6) y BC104420. El experto en la materia apreciará que TWEAK también es conocido como el elemento 12 de la superfamilia de ligandos del factor de necrosis tumoral (TNFSF12), ligando APO3 (APO3L), CD255, ligando de DR3, ligando 14 inducible por factor de crecimiento (Fn14) y UNQ181/PR0207.

B. Factores de crecimiento La determinación de la presencia o del nivel de uno o más factores de crecimiento en una muestra también resulta útil. Tal como se utiliza en la presente memoria, la expresión "factor de crecimiento" incluye cualquiera de entre una diversidad de péptidos, polipéptidos o proteínas que son capaces de estimular la proliferación celular y/o la diferenciación celular. En determinados aspectos, se determina en una muestra la presencia o el nivel de por lo menos un factor de crecimiento, incluyendo, aunque sin limitarse a ellos, factor de crecimiento epidérmico (FCE), factor de crecimiento epidérmico de unión a heparina (FCE-UH), factor de crecimiento endotelial vascular (FCEV), factor derivado de epitelio pigmentado (FDEP, también conocido como SERPINF1), anfirregulina (AREG, también conocida como factor de crecimiento derivado de schwannoma (FCDS)), factor de crecimiento fibroblástico básico (FCFb), factor de crecimiento de hepatocitos (FCH), factor α de crecimiento transformante (FCT-α), factor β de crecimiento transformante (FCT-β), proteínas morfogenéticas óseas (por ejemplo PMO1-PMO15), factor de crecimiento derivado de plaquetas (FCDP), factor de crecimiento nervioso (FCN), factor de crecimiento nervioso β (FCN-β), factores neurotróficos (por ejemplo factor neurotrófico derivado de cerebro (FNDC), neurotrofina 3 (NT3), neurotrofina 4 (NT4), etc.), factor 9 de diferenciación del crecimiento (FDC-9), factor estimulante de colonias de granulocitos (FEC- G), factor estimulante de colonias de granulocitos-macrófagos (FEC-GM), miostatina (GDF-8), eritropoyetina (EPO) y trombopoyetina (TPO). Preferentemente se determina la presencia o el nivel de FCE.

En determinados casos, la presencia o el nivel de un factor de crecimiento particular se detecta al nivel de la expresión de ARNm con un ensayo tal como, por ejemplo, un ensayo de hibridación o un ensayo basado en la amplificación. En determinados otros casos, la presencia o el nivel de un factor de crecimiento particular se detecta al nivel de la expresión de proteínas utilizando, por ejemplo, un inmunoensayo (por ejemplo ELISA) o un ensayo inmunohistoquímico. Se encuentran disponibles kits de ELISA adecuados para determinar la presencia o el nivel de un factor de crecimiento tal como FCE en una muestra de suero, plasma, saliva u orina de, por ejemplo, Antigenix America Inc. (Huntington Station, NY), Promega (Madison, WI), R&D Systems, Inc. (Minneapolis, MN), Invitrogen (Camarillo, CA), Chemicon International, Inc. (Temecula, CA), Neogen Corp. (Lexington, KY), PreproTech (Rocky Hill, NJ), Alpco Diagnostics (Salem, NH), Pierce Biotechnology, Inc. (Rockford, IL) y/o Abazyme (Needham, MA).

La secuencia polipeptídica del factor de crecimiento epidérmico (FCE) humano se proporciona en, por ejemplo, GenBank nº de acceso NP_001954 (SEC ID nº 7). La secuencia (codificante) del ARNm del FCE humano se proporciona en, por ejemplo, GenBank nº de acceso NM_001963 (SEC ID nº 8). El experto en la materia apreciará que el FCE también se conoce como beta-urogastrona, URG y HOMG4.

C. Anticuerpos antineutrófilos La determinación de los niveles de ANAC y/o la presencia o la ausencia de ANACp en una muestra también resulta útil. Tal como se utiliza en la presente memoria, la expresión "anticuerpo citoplasmático antineutrófilos" o "ACAN" incluye anticuerpos dirigidos contra componentes citoplasmáticos y/o nucleares de los neutrófilos. La actividad de ACAN puede dividirse en varias categorías amplias basándose en el patrón de tinción de ACAN en los neutrófilos: (1) tinción de neutrófilos citoplasmáticos sin marcado perinuclear (ANACc), (2) tinción perinuclear en torno al borde exterior del núcleo (ANACp), (3) tinción perinuclear en torno al borde interior del núcleo (NSNA), y (4) tinción difusa con manchas en todo el neutrófilo (SAPPA). En determinados casos, la tinción ANACp es sensible al tratamiento de ADNasa. El término ANAC comprende todas las variedades de reactividad antineutrófilos, incluyendo, aunque sin limitación, ANACc, ANACp, NSNA y SAPPA. De manera similar, el término ANAC comprende todos los isotipos de inmunoglobulina, incluyendo, aunque sin limitarse a ellas, las inmunoglobulinas A y G. Los niveles de ANAC en una muestra de un individuo pueden determinarse utilizando, por ejemplo, un inmunoensayo tal como un ensayo de inmunosorción ligada a enzima (ELISA) con neutrófilos fijados con alcohol (ver, por ejemplo, el Ejemplo 1). La presencia o la ausencia de una categoría particular de ANAC, tal como ANACp, puede determinarse, por ejemplo, utilizando un ensayo inmunohistoquímico tal como un ensayo de anticuerpos fluorescentes indirectos (AFI). Se da a conocer que la presencia o la ausencia de ANACp en una muestra se determina utilizando un ensayo de inmunofluorescencia con neutrófilos fijados y tratados con ADNasa (ver, por ejemplo, el Ejemplo 2). Además de neutrófilos fijados, pueden utilizarse para la detección anticuerpos dirigidos contra anticuerpos humanos. Los antígenos específicos para ANAC también resultan adecuados para determinar los niveles de ANAC, incluyendo, aunque sin limitación, extractos de neutrófilos no purificados o parcialmente purificados, proteínas purificadas, fragmentos de proteínas o péptidos sintéticos, tales como histona H1 ó fragmentos reactivos con ANAC de los mismos (ver, por ejemplo, patente US nº 6.074.835), antígenos de tipo histona H1, antígenos porina, antígenos de Bacteroides o fragmentos reactivos con ANAC de los mismos (ver, por ejemplo, la patente US nº 6.033.864), antígenos de vesículas secretorias o fragmentos reactivos con ANAC de los mismos (ver, por ejemplo, solicitud de patente US nº 08/804.106) y anticuerpos idiotípicos anti-ANAC. El experto en la materia apreciará la utilización de antígenos adicionales específicos para ANAC. D. Anticuerpos anti-Saccharomyces cerevisiae

La determinación de la presencia o del nivel de ASCA (por ejemplo IgA-AASC, IgG-AASC, IgM-AASC, etc.) en una muestra también resulta útil. La expresión "inmunoglobulina A anti-Saccharomyces cerevisiae" o "AASC-IgA" incluye anticuerpos del isotipo inmunoglobulina A que reaccionan específicamente con S. cerevisiae. De manera similar, la expresión "inmunoglobulina G anti-Saccharomyces cerevisiae" o "AASC-IgG" incluye anticuerpos del isotipo inmunoglobulina G que reaccionan específicamente con S. cerevisiae. La determinación de si una muestra es positiva para AASC-IgA o AASC-IgG se lleva a cabo utilizando un antígeno específico para las secuencias de anticuerpo humanas o un antígeno específico para AASC. Dicho antígeno puede ser cualquier antígeno o mezcla de antígenos que se une específicamente a AASC-IgA y/o AASC-IgG. Aunque los anticuerpos AASC se caracterizaron inicialmente por su capacidad de unirse a S. cerevisiae, el experto en la materia entenderá que un antígeno que se une específicamente a AASC puede obtenerse a partir de S. cerevisiae o de una diversidad de otras fuentes con la condición de que el antígeno sea capaz de unirse específicamente a los anticuerpos de AASC. De acuerdo con lo anteriormente expuesto, entre las fuentes ejemplares de un antígeno específico para AASC que pueden utilizarse para determinar los niveles de AASC-IgA y/o AASC-IgG en una muestra se incluyen, aunque sin limitarse a ellos, células de levadura muertas enteras, tales como células de Saccharomyces o de Candida, manano de pared celular de levadura, tal como fosfopeptidomanano (PPM), oligosacáridos tales como oligomanósidos, neoglucolípidos, anticiuerpos idiotípicos anti-AASC y similares. Resultan adecuadas diferentes especies y cepas de levadura, tales como S. cerevisiae cepas Su1, Su2, CBS 1315 ó BM 156, o Candida albicans cepa VW32, para la utilización como antígeno específico para AASC-IgA y/o AASC-IgG. También resultan adecuados antígenos purificados y sintéticos específicos para AASC en la determinación de los niveles de AASC- IgA y/o AASC-IgG en una muestra. Entre los ejemplos de antígenos purificados se incluyen, aunque sin limitarse a ellos, antígenos oligosacáridos purificados, tales como oligomanósidos. Entre los ejemplos de antígenos sintéticos se incluyen, aunque sin limitarse a ellos, oligomanósidos sintéticos tales como los descritos en la publicación de patente US nº 2003/0105060, por ejemplo D-Man β(1-2) D-Man β(1-2) D-Man β(1-2) D-Man-OR, D-Man α(1-2) D- Man α(1-2) D-Man α(1-2) D-Man-OR y D-Man α(1-3) D-Man α(1-2) D-Man α(1-2) D-Man-OR, en donde R es un átomo de hidrógeno, un alquilo C1 a C20, o un grupo conector opcionalmente marcado. Las preparaciones de mananos de pared celular de levadura, por ejemplo PPM, pueden utilizarse para determinar los niveles de AASC-IgA y/o AASC-IgG en una muestra. Dichos antígenos de superficie solubles en agua pueden prepararse mediante cualquier técnica de extracción apropiada conocida de la técnica, incluyendo, por ejemplo, el autoclavado, o pueden obtenerse comercialmente (ver, por ejemplo, Lindberg et al., Gut 33:909-913, 1992). La fracción estable frente a ácidos de PPM también resulta útil en los algoritmos estadísticos (Sendid et al., Clin. Diag. Lab. Immunol. 3:219-226, 1996). Un PPM ejemplar que resulta útil para determinar los niveles de AASC en una muestra se deriva de S. uvarum cepa de la ATCC nº 38926. El Ejemplo 3 describe la preparación de manano de la pared celular de levadura y un análisis de los niveles de AASC en una muestra utilizando un ensayo ELISA. Los antígenos oligosacáridos purificados, tales como oligomanósidos, también pueden resultar útiles para determinar los niveles de AASC-IgA y/o AASC-IgG en una muestra. Los antígenos oligomanósido purificados preferentemente se convierten en neoglucolípidos tal como se describe en, por ejemplo, Faille et al., Eur. J.

Microbiol. Infect. Dis. 11:438-446, 1992. El experto en la materia entenderá que la reactividad de dicho antígeno oligomanósico con AASC puede optimizarse modificando la longitud de cadena del manosilo (Frosh et al., Proc. Natl. Acad. Sci. USA 82:1194-1198, 1985), la configuración anomérica (Fukazawa et al., en: "Immunology of Fungal Disease", E. Kurstak (ed.), Marcel Dekker Inc.., New York, páginas 37-62, 1989; Nishikawa et al., Microbiol. Immunol. 34:825-840, 1990; Poulain et al., Eur. J. Clin. Microbiol. 23:46-52, 1993; Shibata et al., Arch. Biochem.

Biophys. 243:338-348, 1985 Trinel et al., Infect. Immun., 60:3845-3851, 1992); o la posición del enlace (Kikuchi et al., Planta 190:525-535, 1993). Entre los oligomanósidos adecuados para la utilización en los métodos se incluyen, aunque sin limitación, un oligomanósido que presenta la manotetraosa Man(1-3) Man(1-2) Man(1-2) Man. Dicho oligomanósido puede purificarse a partir de PPM tal como se describe en, por ejemplo, Faille et al., supra. Un neoglucolípido ejemplar específico para AASC puede construirse liberando el oligomanósido de su PPM respectivo y posteriormente acoplando el oligomanósido liberado con 4-hexadecil-anilina o similar. E. Anticuerpos antimicrobianos La determinación de la presencia o del nivel de anticuerpo anti-OmpC en una muestra también resulta útil. Tal como se utiliza en la presente memoria, la expresión "anticuerpo anti-proteína C de membrana externa" o "anticuerpo anti- OmpC" incluye anticuerpos dirigidos contra una porina de membrana externa bacteriana tal como se describe en, por ejemplo, la publicación de patente PCT nº WO 01/89361. La expresión "proteína C de membrana externa" o "OmpC" se refiere a una porina bacteriana que es inmunorreactiva con un anticuerpo anti-OmpC.

El nivel de anticuerpo anti-OmpC presente en una muestra de un individuo puede determinarse utilizando una proteína OmpC o un fragmento de la misma, tal como un fragmento inmunorreactivo de la misma. Entre los antígenos OmpC adecuados que resultan útiles para determinar los niveles de anticuerpo anti-OmpC en una muestra se incluyen, aunque sin limitarse a ellos, una proteína OmpC, un polipéptido OmpC que presenta sustancialmente la misma secuencia de aminoácidos que la proteína OmpC, o un fragmento de la misma, tal como un fragmento inmunorreactivo de la misma. Tal como se utiliza en la presente memoria, un polipéptido OmpC generalmente describe los polipéptidos que presentan una secuencia de aminoácidos con una identidad superior a aproximadamente 50%, preferentemente superior a aproximadamente 60%, más preferentemente superior a aproximadamente 70%, todavía más preferentemente superior a aproximadamente 80%, 85%, 90%, 95%, 96%, 97%, 98% ó 99% respecto a una proteína OmpC, determinando la identidad de aminoácidos con un programa de alineación de secuencias tal como CLUSTALW. Dichos antígenos pueden prepararse mediante, por ejemplo, purificación a partir de bacterias entéricas, tales como E. coli, mediante expresión recombinante de un ácido nucleico, tal como GenBank nº de acceso K00541, por medios sintéticos, tal como la síntesis peptídica en solución o en fase sólida, o mediante la utilización de expresión fágica. El Ejemplo 4 describe la preparación de proteína OmpC y un análisis de los niveles de anticuerpo anti-OmpC en una muestra utilizando un ensayo ELISA. La determinación de la presencia o del nivel de anticuerpo anti-I2 en una muestra también resulta útil. Tal como se utiliza en la presente memoria, la expresión "anticuerpo anti-I2" incluye los anticuerpos dirigidos contra un antígeno microbiano que comparte homología con reguladores transcripcionales bacterianos, tal como se describe en, por ejemplo, la patente US nº 6.309.643. El término "I2" se refiere a un antígeno microbiano que es inmunorreactivo con un anticuerpo anti-I2. La proteína I2 microbiana es un polipéptido de 100 aminoácidos que comparte cierta débil homología con la proteína 4 predicha de C. pasteurianum, Rv3557c de Mycobacterium tuberculosis y un regulador transcripcional de Aquifex aeolicus. Las secuencias de ácidos nucleicos y proteica de la proteína I2 se describen en, por ejemplo, la patente US nº 6.309.643.

El nivel de anticuerpo anti-I2 presente en una muestra de un individuo puede determinarse utilizando una proteína I2 o un fragmento de la misma, tal como un fragmento inmunorreactivo de la misma. Entre los antígenos I2 adecuados que resultan útiles para determinar los niveles de anticuerpo anti-I2 en una muestra se incluyen, aunque sin limitarse a ellos, una proteína I2, un polipéptido I2 que presenta sustancialmente la misma secuencia de aminoácidos que la proteína I2, o un fragmento de la misma, tal como un fragmento inmunorreactivo de la misma. Dichos polipéptidos I2 muestran una similitud de secuencia superior respecto a la proteína I2 que respecto a la proteína 4 de C. pasteurianum e incluyen variantes de isotipo y homólogos de los mismos. Tal como se utiliza en la presente memoria, un polipéptido I2 generalmente describe los polipéptidos que presentan una secuencia de aminoácidos con una identidad superior a aproximadamente 50%, preferentemente superior a aproximadamente 60%, más preferentemente superior a aproximadamente 70%, todavía más preferentemente superior a aproximadamente 80%, 85%, 90%, 95%, 96%, 97%, 98% ó 99% respecto a una proteína I2 natural, determinando la identidad de aminoácidos con un programa de alineación de secuencias tal como CLUSTALW. Dichos antígenos I2 pueden prepararse mediante, por ejemplo, purificación a partir de microbios, mediante expresión recombinante de un ácido nucleico codificante de un antígeno I2, por medios sintéticos, tal como la síntesis peptídica en solución o en fase sólida, o mediante la utilización de expresión fágica. La determinación de los niveles de anticuerpo anti-I2 en una muestra puede llevarse a cabo mediante la utilización de un ensayo ELISA (ver, por ejemplo, los Ejemplos 5, 20 y 22) o un ensayo histológico. La determinación de la presencia o del nivel de anticuerpo antiflagelina en una muestra también resulta útil. Tal como se utiliza en la presente memoria, la expresión "anticuerpo antiflagelina" incluye anticuerpos dirigidos contra un componente proteico de los flagelos bacterianos, tal como se describe en, por ejemplo, la patente US nº 7.361.733 y en la solicitud publicada de patente PCT nº WO 03/053220. El término "flagelina" se refiere a una proteína de flagelo bacteriano que es inmunorreactiva con un anticuerpo antiflagelina. Las flagelinas microbianas son proteínas presentes en el flagelo bacteriano que se disponen en un cilindro hueco formando el filamento.

El nivel de anticuerpo antiflagelina presente en una muestra de un individuo puede determinarse utilizando una proteína flagelina o un fragmento de la misma, tal como un fragmento inmunorreactivo de la misma. Entre los antígenos flagelina adecuados que resultan útiles para determinar los niveles de anticuerpo anti-flagelina en una muestra se incluyen, aunque sin limitarse a ellos, la flagelina Cbir-1, la flagelina X, la flagelina A, la flagelina B, fragmentos de las mismas, y combinaciones de las mismas, un polipéptido flagelina que presenta sustancialmente la misma secuencia de aminoácidos que la proteína flagelina, o un fragmento de la misma, tal como un fragmento inmunorreactivo de la misma. Tal como se utiliza en la presente memoria, un polipéptido flagelina generalmente describe los polipéptidos que presentan una secuencia de aminoácidos con una identidad superior a aproximadamente 50%, preferentemente superior a aproximadamente 60%, más preferentemente superior a aproximadamente 70%, todavía más preferentemente superior a aproximadamente 80%, 85%, 90%, 95%, 96%, 97%, 98% ó 99% respecto a una proteína flagelina natural, determinando la identidad de aminoácidos con un programa de alineación de secuencias tal como CLUSTALW. Dichos antígenos flagelina pueden prepararse mediante, por ejemplo, purificación a partir de una bacteria tal como Helicobacter bilis, Helicobacter mustelae, Helicobacter pylori, Butyrivibrio fibrisolvens, y una bacteria presente en el ciego, mediante expresión recombinante de un ácido nucleico codificante de un antígeno flagelina, por medios sintéticos, tales como la síntesis peptídica en solución o en fase sólida, o mediante la utilización de expresión fágica. La determinación de los niveles de anticuerpo antiflagelina (por ejemplo anti-Cbir-1) en una muestra puede llevarse a cabo mediante la utilización de un ensayo ELISA o un ensayo histológico. F. Proteínas de fase aguda La determinación de la presencia o del nivel de uno o más proteínas de fase aguda en una muestra también resulta útil. Las proteínas de fase aguda son una clase de proteínas cuyas concentraciones plasmáticas se incrementan (proteínas de fase aguda positivas) o se reducen (proteínas de fase aguda negativas) en respuesta a la inflamación. Esta respuesta se denomina reacción de fase aguda (también denominada respuesta de fase aguda). Entre los ejemplos de proteínas de fase aguda positivas se incluyen, aunque sin limitarse a ellas, la proteína C reactiva (PRC), la proteína dímero D, la proteína de unión a manosa, alfa 1-antitripsina, alfa 1-antiquimotripsina, alfa 2- macroglobulina, fibrinógeno, protrombina, factor VIII, factor de von Willebrand, plasminógeno, factores del complemento, ferritina, componente P del amiloide sérico, amiloide sérico A (ASA), orosomucoide (glucoproteína ácida alfa 1, GPA), ceruloplasmina, haptoglobina y combinaciones de los mismos. Entre los ejemplos no limitativos de proteínas de fase aguda negativas se incluyen albumina, transferrina, transtiretina, transcortina, proteína de unión a retinol y combinaciones de las mismas. Preferentemente se determina la presencia o el nivel de PRC y/o ASA. En determinados casos, la presencia o el nivel de una proteína de fase aguda particular se detecta al nivel de la expresión de ARNm con un ensayo tal como, por ejemplo, un ensayo de hibridación o un ensayo basado en la amplificación. En determinados otros casos, la presencia o el nivel de una proteína de fase aguda particular se detecta al nivel de la expresión de proteínas utilizando, por ejemplo, un inmunoensayo (por ejemplo ELISA) o un ensayo inmunohistoquímico. Por ejemplo, puede utilizarse un ensayo ELISA colorimétrico de tipo sándwich disponible de Alpco Diagnostics (Salem, NH) para determinar el nivel de PRC en una muestra de suero, plasma, orina o heces. De manera similar, puede utilizarse un kit de ELISA disponible de Biomeda Corporation (Foster City, CA) para detectar los niveles de PRC en una muestra. Otros métodos para determinar los niveles de PRC en una muestra se describen en, por ejemplo, las patentes US nº 6.838.250 y nº 6.406.862, y las publicaciones de patente US nº 2006/0024682 y nº 2006/0019410. Entre los métodos adicionales para determinar los niveles de PRC se incluyen, por ejemplo, los ensayos de inmunoturbidimetría, los ensayos de inmunodifusión rápida y los ensayos de aglutinación visuales.

La proteína C reactiva (PRC) es una proteína presente en la sangre en respuesta a la inflamación (una proteína de fase aguda). PRC es típicamente producida por el hígado y por las células grasas (adipocitos). Es un elemento de la familia de proteínas de la pentraxina. La secuencia del polipéptido PRC humano se proporciona en, por ejemplo, GenBank nº de acceso NP_000558 (SEC ID nº 9). La secuencia (codificante) del ARNm del PRC humano se proporciona en, por ejemplo, GenBank nº de acceso NM_000567 (SEC ID nº 10). El experto en la materia apreciará que PRC también es conocido como PTX1, MGC88244 y MGC149895. G. Apolipoproteínas La determinación de la presencia o del nivel de una o más apolipoproteínas en una muestra también resulta útil. Las apolipoproteínas son proteínas que se unen a grasas (lípidos). Forman lipoproteínas, las cuales transportan grasas ingeridas por el flujo sanguíneo. Las grasas ingeridas son digeridas en el intestino y transportadas hasta el hígado. Las grasas también son sintetizadas en el hígado mismo. Las grasas se almacenan en las células grasas (adipocitos). Las grasas son metabolizadas según los requisitos energéticos del músculo esquelético, corazón y otros órganos y son secretadas en la leche materna. Las apolipoproteínas sirven también como cofactores enzimáticos, ligandos de receptores y portadores de transferencia de lípidos que regulan el metabolismo de las lipoproteínas y su incorporación en los tejidos. Entre los ejemplos de apolipoproteínas se incluyen, aunque sin limitarse a ellos, ApoA (por ejemplo, ApoA-I, ApoA-II, ApoA-IV, ApoA-V), ApoB (por ejemplo, ApoB48, ApoB100), ApoC (por ejemplo, ApoC-I, ApoC-II, ApoC-III, ApoC-IV), ApoD, ApoE, ApoH, amiloide A sérico (AAS) y combinaciones de los mismos. Preferentemente se determina la presencia o el nivel de AAS. En determinados casos, la presencia o el nivel de una apolipoproteína particular se detecta al nivel de la expresión de ARNm con un ensayo tal como, por ejemplo, un ensayo de hibridación o un ensayo basado en la amplificación. En determinados otros casos, la presencia o el nivel de una apolipoproteína particular se detecta al nivel de la expresión de proteínas utilizando, por ejemplo, un inmunoensayo (por ejemplo ELISA) o un ensayo inmunohistoquímico. Los kits de ELISA adecuados para determinar la presencia o el nivel de AAS en una muestra, tal como suero, plasma, saliva, orina o heces, se encuentran disponibles de, por ejemplo, Antigenix America Inc. (Huntington Station, NY), Abazyme (Needham, MA), USCN Life (Missouri City, TX) y/o U.S. Biological (Swampscott, MA).

Las proteínas del amiloide A sérico (AAS) son una familia de apolipoproteínas asociadas a lipoproteína de alta densidad (HDL, por el inglés "High Density LipoPROTEÍNA") en el plasma. Se expresan constitutivamente diferentes isoformas de AAS (ASS constitutivas) a niveles diferentes o en respuesta a estímulos inflamatorios (AAS de fase aguda). Estas proteínas son producidas predominantemente por el hígado. La conservación de estas proteínas en todos los invertebrados y vertebrados sugiere que las AAS desempeñan una función absolutamente esencial en todos los animales. Las proteínas de amiloide A sérico de fase aguda (AAS-A) son secretadas duarnte la fase aguda de la inflamación. La secuencia del polipéptido AAS humano se proporciona en, por ejemplo, GenBank nº de acceso NP_000322 (SEC ID nº 11). La secuencia (codificante) del ARNm del AAS humano se proporciona en, por ejemplo, GenBank nº de acceso NM_000331 (SEC ID nº 12). El experto en la materia apreciará que AAS también es conocido como PIG4, TP53I4, MGC111216 y AAS1.

H. Defensinas La determinación de la presencia o del nivel de una o más defensinas en una muestra también resulta útil. Las defensinas son proteínas catiónicas ricas en cisteínas pequeñas presentes tanto en vertebrados como invertebrados. Son activos contra bacterias, hongos y muchos virus con cubierta y sin cubierta. Típicamente consisten de 18 a 45 aminoácidos, incluyendo 6 (en vertebrados) a 8 residuos de cisteína conservados. Las células del sistema inmunológico contienen dichos péptidos para ayudar en la eliminación de las bacterias fagocitadas, por ejemplo en granulocitos neutrófilos y prácticamente todas las células epiteliales. La mayoría de defensinas funcionan mediante la unión a membranas celulares microbianas, y una vez incluidas, formando defectos similares a poros en la membrana que permiten el flujo de salida de iones esenciales y nutrientes. Entre los ejemplos no limitativos de las defensinas se incluyen las α-defensinas (por ejemplo, DEFA 1, DEFA1A3, DEFA3, DEFA4), β-defensinas (por ejemplo, la β-defensina-1 (DEFB1), la β-defensina-2 (DEFB2), DEFB103A/DEFB103B a DEFB107A/DEFB107B, DEFB110 a DEFB133), y las combinaciones de los mismos. Preferentemente se determina la presencia o el nivel de DEFB1 y/o DEFB2.

En determinados casos, la presencia o el nivel de una defensina particular se detecta al nivel de la expresión de ARNm con un ensayo tal como, por ejemplo, un ensayo de hibridación o un ensayo basado en la amplificación. En determinados otros casos, la presencia o el nivel de una defensina particular se detecta al nivel de la expresión de proteínas utilizando, por ejemplo, un inmunoensayo (por ejemplo ELISA) o un ensayo inmunohistoquímico. Los kits de ELISA adecuados para determinar la presencia o el nivel de DEFB1 y/o DEFB2 en una muestra, tal como suero, plasma, saliva, orina o heces, se encuentran disponibles de, por ejemplo, Alpco Diagnostics (Salem, NH), Antigenix America Inc. (Huntington Station, NY), PreproTech (Rocky Hill, NJ) y/o Alpha Diagnostics Intl. Inc. (San Antonio, TX). Las β-defensinas son péptidos antimicrobianos implicados en la resistencia de las superficies epiteliales a la colonización microbiana. Son las más ampliamente distribuidas de entre todas las defensinas, siendo secretadas por leucocitos y células epiteliales de muchos tipos. Por ejemplo, pueden encontrarse en la lengua, la piel, la córnea, las glándulas salivares, los riñones, el esófago y el tracto respiratorio. La secuencia pollipeptídica de DEFB1 humano se proporciona en, por ejemplo, GenBank nº de acceso NP_005209 (SEC ID nº 13). La secuencia (codificante) del ARNm del DEFB1 humano se proporciona en, por ejemplo, GenBank nº de acceso NM_005218 (SEC ID nº 14). El experto en la materia apreciará que DEFB1 también es conocido como BD1, HBD1, DEFB-1, DEFB101 y MGC51822. La secuencia pollipeptídica de DEFB2 humano se proporciona en, por ejemplo, GenBank nº de acceso NP_04933 (SEC ID nº 15). La secuencia (codificante) del ARNm del DEFB2 humano se proporciona en, por ejemplo, GenBank nº de acceso NM_004942 (SEC ID nº 16). El experto en la materia apreciará que DEFB2 también es conocido como SAP1, HBD-2, DEFB-2, DEFB102 y DEFB4.

I. Cadherinas La determinación de la presencia o del nivel de una o más cadherinas en una muestra también resulta útil. Las cadherinas son una clase de proteínas transmembranales de tipo 1 que desempeñan funciones importantes en la adhesión celular, garantizando que las células dentro de los tejidos se unen entre sí. Para funcionar son dependientes de los iones calcio (Ca2+). La superfamilia de la cadherina incluye cadherinas, protocadherinas, desmogleínas y desmocolinas, y otras. En la estructura comparten repeticiones de cadherina, que son dominios extracelulares de unión a Ca2+. Entre las cadherinas adecuadas para la utilización en el presente método se incluyen, aunque sin limitación, CDH1 -Cadherina-E (epitelial), CDH2 -N-cadherina (neural), CDH12 -cadherina 12, tipo 2 (N-cadherina 2), CDH3 -Pcadherina (placentaria), CDH4 -R-cadherina (retiniana), CDH5 -VCadherina-E (vascular endotelial), CDH6-K-cadherina (renal), CDH7 -cadherina 7, tipo 2, CDH8 -cadherina 8, tipo 2, CDH9 - cadherina 9, tipo 2 (T1-cadherina), CDH10 -cadherina 10, tipo 2 (T2-cadherina), CDH11 -OB-cadherina (osteoblasto), CDH13 -T-cadherina -H-cadherina (corazón), CDH15 -M-cadherina (miotúbulo), CDH16 -KSP- cadherina, CDH 17 -LI cadherina (hígado-intestino), CDH18 -cadherina 18, tipo 2, CDH 19 cadherina 19, tipo 2, CDH20 -cadherina 20, tipo 2 y CDH23 -cadherina 23, (epitelio neurosensorial). Preferentemente se determina la presencia o el nivel de cadherina E. En determinados casos, la presencia o el nivel de una defensina particular se detecta al nivel de la expresión de ARNm con un ensayo tal como, por ejemplo, un ensayo de hibridación o un ensayo basado en la amplificación. En determinados otros casos, la presencia o el nivel de una cadherina particular se detecta al nivel de la expresión de proteínas utilizando, por ejemplo, un inmunoensayo (por ejemplo ELISA) o un ensayo inmunohistoquímico. Los kits de ELISA adecuados para determinar la presencia o el nivel de cadherina E en una muestra, tal como suero, plasma, saliva, orina o heces, se encuentran disponibles de, por ejemplo, R&D Systems, Inc. (Minneapolis, MN) y/o GenWay Biotech, Inc. (San Diego, CA).

La cadherina E es una cadherina clásica de la superfamilia de las cadherinas. Es una glucoproteína de adhesión célula-célula dependiente del calcio comprendida de cinco repeticiones extracelulares de cadherina, una región transmembranal y una cola citoplasmática altamente conservada. El ectodominio de la cadherina E media en la adhesión bacteriana a las células de mamífero y se requiere el dominio citoplasmático para la internalización. La secuencia polipeptídica de la cadherina E humana se proporciona en, por ejemplo, GenBank nº de acceso NP_004351 (SEC ID nº 17). La secuencia (codificante) del ARNm de la cadherina E humana se proporciona en, por ejemplo, GenBank nº de acceso NM_004360 (SEC ID nº 18). El experto en la materia apreciará que la cadherina E también es conocida como UVO, CDHE, ECAD, LCAM, Arc-1, CD324 y CDH1.

J. Moléculas de adhesión celular (MAC IgSF) La determinación de la presencia o del nivel de una o más moléculas de adhesión celular de la superfamilia de inmunoglobulinas en una muestra también resulta útil. Tal como se utiliza en la presente memoria, la expresión "molécula de adhesión celular de la superfamilia de las inmunoglobulinas" (MAC IgSF) incluye cualquiera de entre una diversidad de polipéptidos o proteínas situadas sobre la superficie de una célula que presenta uno o más dominios plegados de tipo inmunoglobulina, y que funcionan en la adhesión intercelular y/o en la transduscción de señales. En muchos casos, las MAC IgSF son proteínas transmembranales. Entre los ejemplos no limitativos de MAC IgSF se incluyen las moléculas de adhesión a células neuronales (MACN, por ejemplo MACN-120, MACN-125, MACN-140, MACN-145, MACN-180, MACN-185, etc.), moléculas de adhesión intercelular (MAIC, por ejemplo MAIC- 1, MAIC-2, MAIC-3, MAIC-4 y MAIC-5), molécula 1 de adhesión celular vascular (MACV-1), molécula 1 de adhesión a células endoteliales-plaquetas (MAPCE-1), molécula de adhesión celular L1 (MACL1), molécula de adhesión celular con homología con MACL1 (homólogo próximo de L1) (HPL1), lectinas de tipo Ig de unión a ácido siálico (LIUAS, por ejemplo LIUAS-1, LIUAS-2, LIUAS-3, LIUAS-4, etc.), nectinas (por ejemplo nectina-1, nectina-2, nectina- 3, etc.) y moléculas de tipo nectina (por ejemplo NecI-1, NecI-2, NecI-3, NecI-4 y NecI-5). Preferentemente se determina la presencia o el nivel de MAIC-1 y/o MACV-1. 1. Molécula 1 de adhesión intercelular (MAIC-1) La MAIC-1 es una proteína de adhesión celular transmembranal que se encuentra continuamente presente a bajas concentraciones en las membranas de los leucocitos y las células endoteliales. Con la estimulación de las citoquinas, las concentraciones se incrementan mucho. La MAIC1 puede ser inducida por IL-1 y TNF-α y es expresada por el endotelio vascular, los macrófagos y los linfocitos. En la EII, las citoquinas proinflamatorias causan la inflamación mediante la regulación positiva de la expresión de las moléculas de adhesión, tales como MAIC1 y MACV-1. La expresión incrementada de las moléculas de adhesión recluta más linfocitos al tejido infectado, resultando en la inflamación del tejido (ver Goke et al., J. Gastroenterol. 32:480, 1997, y Rijcken et al., Gut. 51:529, 2002). MAIC1 está codificada por el gen de la molécula 1 de adhesión intercelular (MAIC1, Entrez ID génico 3383, GenBank nº de acceso NM_000201) (SEC ID nº 19) y es producida tras el procesamiento del polipéptido precursor de la molécula 1 de adhesión intercelular (GenBank nº de acceso SNP_000192 (SEC ID nº 20)).

2. Molécula 1 de adhesión de células vasculares (MACV-1) MACV-1 es una proteína de adhesión celular transmembrana que media en la adhesión de los linfocitos, monocitos, eosinófilos y basófilos al endotelio vascular. La regulación positiva de MACV-1 en las células endoteliales por las citoquinas se produce como resultado de una transcripción génica incrementada (Por ejemplo en respuesta al factor alfa de necrosis tumoral (TNF-α) y la interleuquina-1 (IL-1)). La MACV-1 está codificada por el gen de la molécula 1 de adhesión celular vascular (MACV-1, Entrez ID génico 7412) y es producida tras el procesamiento diferencial del transcrito (GenBank nº de acceso NM_001078 (variante 1, SEC ID nº 21) o NM_080682 (variante 2)) y el procesamiento de la isoforma de procesamiento del polipéptido precursor (GenBank nº de acceso NP_001069 (isoforma a, SEC ID nº 22) o NP_542413 (isoforma b)).

En determinados casos, la presencia o el nivel de una MAC IgSF se detecta al nivel de la expresión de ARNm con un ensayo tal como, por ejemplo, un ensayo de hibridación o un ensayo basado en la amplificación. En determinados otros casos, la presencia o el nivel de una MAC IgSF se detecta al nivel de la expresión de proteínas utilizando, por ejemplo, un inmunoensayo (por ejemplo ELISA) o un ensayo inmunohistoquímico. Los anticuerpos y/o kits de ELISA adecuados para determinar la presencia o el nivel de MAIC-1 y/o MACV-1 en una muestra, tal como una muestra de tejido, biopsia, suero, plasma, saliva, orina o heces se encuentran disponibles de, por ejemplo, Invitrogen (Camarillo, CA), Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) y/o Abcam Inc. (Cambridge, MA). K. Marcadores genéticos La determinación de la presencia o ausencia de variantes alélicas en uno o más marcadores genéticos en una muestra también resulta útil. Entre los ejemplos no limitativos de marcadores genéticos se incluyen, aunque sin limitarse a ellos, cualquiera de los genes indicados en las Tablas 1A-1E (por ejemplo un gen NOD2/CARD15, un gen de la ruta IL12/IL23, etc.). Preferentemente, se determina la presencia o la ausencia de por lo menos un polimorfismo de un solo nucleótido (PSN) en el gen NOD2/CARD15 y/o uno o más genes en la ruta IL12/IL23. Ver, por ejemplo, Barrett et al., Nat. Genet. 40:955-62, 2008, y Wang et al., Amer. J. Hum. Genet. 84:399-405, 2009.

La Tabla 1A proporciona una lista ejemplar de genes de EII, CU y EC, en la que el genotipado para la presencia o ausencia de una o más variantes alélicas (por ejemplo PSN) en el mismo resulta útil en los métodos diagnósticos y pronósticos. La Tabla 1B proporciona marcadores genéticos ejemplares adicionales y PSN correspondientes que pueden genotiparse de acuerdo con los métodos diagnósticos y pronósticos de la EII. Las Tablas 1C-1E proporcionan marcadores genéticos ejemplares adicionales de EII, CU y EC y los PSN correspondientes que pueden genotiparse de acuerdo con los métodos diagnósticos y pronósticos descritos en la presente memoria.

Tabla 1A. Genes de EII, EC y CU Genes de EII (EC y Genes de EII Genes de Genes de EC CU) colónica CU IL23R Regiones HLA ECM1 NOD2 IL12B/p40 IL10 ATG16L1 JAK2 IFNg IRGM STAT3 IL22 NLRP3 NKX2.3 IL26 5p13/PTGER4 3p21/MST1 OTUD3 PTPN2 CCNY PLA2G2E TNFSF15 (TL1A) IL18RAP ARPC2 IBD5/5q31 LYRM4 ZNF365 CDKAL4 PTPN22 TNFRSF6B CCR6 PSMG1 LRRK2 ICOSLG ITLN1 ORMDL3 Tabla 1B. Genes de EII, EC y CU y PSN Gen PSN NOD2/CARD15 rs2066847 IL23R rs11465804 ATG16L1 rs3828309 MST1 rs3197999 PTGER4 rs4613763 IRGM rs11747270 TNFSF15 rs4263839 ZNF365 rs10995271 NKX2-3 rs11190140 PTPN2 rs2542151 PTPN22 rs2476601 ITLN1 rs2274910 IL12B rs10045431 CDKAL1 rs6908425 CCR6 rs2301436 JAK2 rs10758669 C11orf30 rs7927894 LRRK2, MUC19 rs11175593 ORMDL3 rs2872507 STAT3 rs744166 ICOSLG rs762421 GCKR rs780094 BTNL2, SLC26A3, HLA-DRB1, HLA-DQA1 rs3763313 PUS10 rs13003464 CCL2, CCL7 rs991804 LYRM4 rs12529198 SLC22A23 rs17309827 IL18RAP rs917997 IL12RB2 rs7546245 IL12RB1 rs374326 CD3D rs3212262 CD3G rs3212262 CD247 rs704853 JUN rs6661505 CD3E rs7937334 IL18R1 rsl035127 CCR5 MAPK14 rs2237093 IL18 rs11214108 IFNG rs10878698 MAP2K6 rs2905443 STAT4 rs1584945 IL12A rs6800657 TYK2 rs12720356 ETV5 rs9867846 MAPK8 rs17697885 Tabla 1C. Genes de EC y PSN Gen PSN NOD2 (R702W) rs2066844 NOD2 (G908R) rs2066845 NOD2 (3020insC) rs5743293 ATG16L1 (T300A) rs2241880 ATG16L1 rs3828309 IRGM rs13361189 IRGM rs4958847 IRGM rs1000113 IRGM rs11747270 TL1A/TNFSF15 rs6478109 TL1A/TNFSF15 rs6478108 TL1A/TNFSF15 rs4263839 PTN22 rs2476601 CCR6 rs1456893 CCR6 rs2301436 5p13/PTGER4 rs1373692 5p13/PTGER4 rs4495224 5p13/PTGER4 rs7720838 5p13/PTGER4 rs4613763 ITLN1 rs2274910 ITLN1 rs9286879 ITLN1 rs11584383 IBD5/5q31 rs2188962 IBD5/5q31 rs252057 IBD5/5q31 rs10067603 GCKR rs780094 TNFRSF6B rs1736135 ZNF365 rs224136 ZNF365 rs10995271 C11orf30 rs7927894 LRRK2;MUC19 rs1175593 DLG5 rs2165047 IL-27 rs8049439 TLR2 rs4696480 TLR2 rs3804099 TLR2 rs3804100 TLR2 rs5743704 TLR2 rs2405432 TLR4 (D299G) rs4986790 TLR4 (T399I) rs4986791 TLR4 (S360N) rs4987233 TLR9 rs187084 TLR9 rs352140 NFC4 rs4821544 KIF21B rs11584383 IKZF1 rs1456893 C11orf30 rs7927894 CCL2,CCL7 rs991804 ICOSLG rs762421 TNFAIP3 rs7753394 FLJ45139 rs2836754 PTGER4 rs4613763 Tabla 1D. Genes de EC y PSN Gen PSN ECUM1 rs7511649 ECM1 (T130M) rs3737240 ECM1 (G290S) rs13294 GLI1 (G933D) rs2228224 GLI1 (Q1100E) rs2228226 MDR1 (3435C>T) rs1045642 MDR1 (A893S/T) rs2032582 MAGI2 rs6962966 MAGI2 rs2160322 IL26 rs12815372 IFNG,IL26 rs1558744 IFNG,IL26 rs971545 IL26 rs2870946 ARPC2 rs12612347 IL10,IL19 rs3024493 IL10,IL19 rs3024505 IL23R rs1004819 IL23R rs2201841 IL23R rs11209026 IL23R rs11465804 IL23R rs10889677 BTLN2 rs9268480 HLA-DRB 1 rs660895 MEP1 rs6920863 MEP1 rs2274658 MEP1 rs4714952 MEP1 rs1059276 PUS10 rs13003464 PUS10 rs6706689 RNF186 rs3806308 RNF186 rs1317209 RNF186 rs6426833 FCGR2A,C rs10800309 CEP72 rs4957048 DLD,LAMB1 rs4598195 CAPN10,KIF1A rs4676410 Tabla 1E. Genes de EC y PSN Gen PSN IL23R (R381Q) rs11209026 IL23R rs11805303 IL23R rs7517847 IL12B/p40 rs1368438 IL12B/p40 rs10045431 IL12B/p40 rs6556416 IL12B/p40 rs6887695 IL12B/p40 rs3212227 STAT3 rs744166 JAK2 rs10974914 JAK2 rs10758669 NKX2-3 rs6584283 NKX2-3 rs10883365 NKX2-3 rs11190140 IL18RAP rs917997 LYRM4 rs12529198 CDKAL11 rs6908425 MAGI2 rs2160322 TNFRSF6B rs2160322 TNFRSF6B rs2315008 TNFRSF6B rs4809330 PSMG1 rs2094871 PSMG1 rs2836878 PTPN2 rs2542151 MST1/3p21 rs9858542 MST1/3p21 rs3197999 SLC22A23 rs17309827 MHC rs660895 XBP1 rs35873774 ICOSLG1 rs762421 BTLN2 rs3763313 BTLN2 rs2395185 BTLN2 rs9268480 ATG5 rs7746082 CUL2,CREM rs17582416 CARD9 rs4077515 ORMDL3 rs2872507 ORMDL3 rs2305480 Entre los PSN adicionales útiles se incluyen, por ejemplo, rs2188962, rs9286879, rs11584383, rs7746082, rs1456893, rs1551398, rs17582416, rs3764147, rs1736135, rs4807569, rs7758080 y rs8098673. Ver, por ejemplo, Barrett et al., Nat. Genet. 40:955-62, 2008.

1. NOD2/CARD15 La determinación de la presencia o la ausencia de variantes alélicas tales como los PSN en el gen NOD2/CARD15 resulta particularmente útil. Tal como se utiliza en la presente memoria, la expresión "variante de NOD2/CARD15" o "variante de NOD2" incluye una secuencia de nucleótidos de un gen NOD2 que contiene uno o más cambios en comparación con el gen NOD2 de tipo salvaje o una secuencia de aminoácidos de un polipéptido NOD2 que contiene uno o más cambios en comparación con la secuencia del polipéptido NOD2 de tipo salvaje. NOD2, también conocido como CARD15, se ha sido localizado en el locus IBD1 del cromosoma 16 y ha sido identificado mediante clonación posicional (Hugot et al., Nature 411:599-603, 2001), así como una estrategia de gen candidato posicional (Ogura et al., Nature 411:603-606, 2001; Hampe et al., Lancet 357:1925-1928, 2001). El locus IBD1 presenta una puntuación elevada de ligamiento de puntos múltiples (LPM) para la enfermedad intestinal inflamatoria (LPM=5,7 en el marcador D16S411 en 16q12). Ver, por ejemplo, Cho et al., Inflamm. Bowel Dis., 3:186-190, 1997; Akolkar et al., Am. J. Gastroenterol. 96:1127-1132, 2001; Ohmen et al., Hum. Mol. Genet. 5:1679-1683, 1996; Parkes et al., Lancet 348:1588, 1996; Cavanaugh et al., Ann. Hum. Genet. 62:291-8, 1998; Brant et al., Gastroenterology 115:1056-1061, 1998; Curran et al., Gastroenterology 115:1066-1071, 1998; Hampe et al., Am. J. Hum. Genet. 64:808-816, 1999; y Annese et al., Eur. J. Hum. Genet. 7:567-573, 1999. Las secuencias de ARNm (codificante) y polipeptídica de NOD2 humana se proporcionan en, por ejemplo, GenBank nº de acceso NM_022162 (SEC ID nº 23) y NP_071445 (SEC ID nº 24), respectivamente. Además, la secuencia completa del clon RP11-327F22 del cromosoma 16 humano, que incluye NOD2, se proporciona en, por ejemplo, GenBank nº de acceso AC007728. Además, la secuencia de NOD2 de otras especies puede encontrarse en la base de datos GenBank. La proteína NOD2 contiene dominios amino-terminales de reclutamiento de caspasa (DRCA) que pueden activar NF- kappa B (NF-kB) y varios dominios repetidos ricos en leucinas carboxi-terminales (Ogura et al., J. Biol. Chem. 276:4812-4818, 2001). NOD2 presenta homología estructura con el regulador de apoptosis Apaf-1/CED-4 y una clase de productos génicos resistentes a enfermedades vegetales (Ogura et al., supra). De manera similar a los productos génicos resistentes a enfermedades vegetales, NOD2 presenta un dominio efecto aminoterminal, un dominio de unión a nucleótidos y repeticiones ricas en leucinas (RRL). NOD2 de tipo salvaje activa el factor nuclear NF-kappa B, sensibilizándolo frente a lipopolisacáridos bacterianos (LPS, Ogura et al., supra; Inohara et al., J. Biol. Chem. 276:2551-2554, 2001). NOD2 puede funcionar como receptor intercelular para LPS, requiriéndose las repeticiones ricas en leucinas para la sensibilidad.

Se han descrito previamente variaciones en tres polimorfismos de un solo nucleótido en la región codificante de NOD2. Estos tres PSN, denominados R702W ("PSN 8"), G908R ("PSN 12") y 1007fs ("PSN 13") se encuentran situados en la región carboxi-terminal del gen NOD2 (Hugot et al., supra). Una descripción adicional de PSN 8, PSN 12 y PSN 13, así como PSN adicionales en el gen NOD2 adecuados para la utilización en el método, pueden encontrarse en, por ejemplo, las patentes US nº 6.835.815, nº 6.858.391 y nº 7.592.437 y en las publicaciones de patente US nº 20030190639, nº 20050054021 y nº 20070072180. Se da a conocer que una variante de NOD2 se localiza en una región codificante del locus NOD2, por ejemplo dentro de una región codificante de varias repeticiones ricas en leucinas en la parte carboxi-terminal del polipéptido NOD2. Entre dichas variantes de NOD2 situadas en la región repetida rica en leucinas de NOD2 se incluyen, aunque sin limitarse a ellas, R702W ("PSN 8") y G908R ("PSN 12"). Una variante de NOD2 útil en el método también puede codificar un polipéptido NOD2 con capacidad reducida de activar NF-kappa B en comparación con la activación de NF-kappa B por un polipéptido NOD2 de tipo salvaje. A título de ejemplo no limitativo, la variante de NOD2 1007fs ("PSN 13") resulta en un polipéptido NOD2 truncado que presenta una capacidad reducida de inducir NF-kappa B en respuesta a la estimulación con LPS (Ogura et al., Nature 411:603-606, 2001). Una variante de NOD2 puede ser, por ejemplo, R702W, G908R ó 1007fs. R702W, G908R y 1007fs se encuentran localizados dentro de la región codificante de NOD2. Se da a conocer que un método puede ponerse en práctica con la variante R702W de NOD2. Tal como se utiliza en la presente memoria, el término "R702W" incluye un polimorfismo de un solo nucleótido dentró del exón 4 del gen NOD2, que aparece dentro de un triplete codificante del aminoácido 702 de la proteína NOD2. El alelo de NOD2 de tipo salvaje contiene un residuo de citosina (c) en la posición 138.991 de la secuencia AC007728, que se encuentra dentro de un triplete codificante de una arginina en el aminoácido 702. La variante R702W de NOD2 contiene un residuo de timina (t) en la posición 138.991 de la secuencia AC007728, resultando en una sustitución de arginina (R) por triptófano (W) en el aminoácido 702 de la proteína NOD2. De acuerdo con lo anteriormente expuesto, dicha variante de NOD2 se denomina "R702W" o "702W" y también puede denominarse "R675W" basándose en el sistema anterior de numeración de Hugot et al., supra. Además, la variante R702W también es conocida como alelo "PSN 8" o un alelo "2" en PSN 8. El número ID de PSN del NCBI para R702W o PSN 8 es rs2066844. Tal como se da a conocer en la presente memoria y se describe en mayor detalle posteriormente, la presencia de la variante R702W de NOD2 y otras variantes de NOD2 pueden detectarse convenientemente mediante, por ejemplo, ensayos de discriminación alélica o análisis de secuencias. Pueden encontrarse cebadores y sondas específicos para la variante R702W de NOD2 en las Tablas 3 y 4 en el Ejemplo 6. También puede ponerse en práctica un método con la variante G908R de NOD2. Tal como se utiliza en la presente memoria, el término "G908R" incluye un polimorfismo de un solo nucleótido dentro del exón 8 del gen NOD2, que aparece dentro de un triplete codificante del aminoácido 908 de la proteína NOD2. El aminoácido 908 se encuentra localizado dentro de una región repetida rica en leucinas del gen NOD2. El alelo de NOD2 de tipo salvaje contiene un residuo de guanina (g) en la posición 128.377 de la secuencia AC007728, que se encuentra dentro de un triplete codificante de glicina en el aminoácido 908. La variante G908R de NOD2 contiene un residuo de citosina (c) en la posición 128.377 de la secuencia AC007728, resultando en una sustitución de glicina (G) por arginina (R) en el aminoácido 908 de la proteína NOD2. De acuerdo con lo anteriormente expuesto, dicha variante de NOD2 se denomina "G908R" o "908R" y también puede denominarse "G881R" basándose en el sistema anterior de numeración de Hugot et al., supra. Además, la variante G908R también es conocida como alelo "PSN 12" o un alelo "2" en PSN 12. El número ID de PSN del NCBI para G908R o PSN 12 es rs2066845. Pueden encontrarse cebadores y sondas específicos para la variante G908R de NOD2 en las Tablas 3 y 4 en el Ejemplo 6. También puede ponerse en práctica un método con la variante 1007fs de NOD2. Esta variante es una insreción de un solo nucleótido que resulta en un desplazamiento de marco en la décima repetición rica en leucinas de la proteína NOD2 y le sigue un codón de parada prematuro. El truncado resultante de la proteína NOD2 aparentemente evita la activación de NF-kappaB en respuesta a lipopolisacáridos bacterianos (Ogura et al., supra). Tal como se utiliza en la presente memoria, el término "1007fs" incluye un polimorfismo de un solo nucleótido dentro del exón 11 del gen NOD2, que se encuentra dentro de un triplete codificante del aminoácido 1007 de la proteína NOD2. La variante 1007fs contiene una citosina que ha sido añadida a la posición 121.139 de la secuencia AC007728, resultando en una mutación de desplazamiento de marco en el aminoácido 1007. De acuerdo con lo anterior, dicha variante de NOD2 se denomina "1007fs" y también puede denominarse "3020insC" o "980fs" basándose en el sistema de numeración anterior de Hugot et al., supra. Además, la variante 1007fs de NOD2 también es conocida como alelo "PSN 13" o un alelo "2" en PSN 13. El número ID de PSN del NCBI para 1007fs o PSN 13 es rs2066847. Pueden encontrarse cebadores y sondas específicos para la variante 1007fs de NOD2 en las Tablas 3 y 4 en el Ejemplo 6.

El experto en la materia reconoce que un alelo variante particular de NOD2 u otro alelo polimórfico puede definirse convenientemente, por ejemplo en comparación con un individuo de referencia del Centre d'Etude du Polymorphisme Humain (CEPH), tal como el individuo designado 1347-02 (Dib et al., Nature 380:152-154, 1996) utilizando ADN de referencia disponible comercialmente, obtenido, por ejemplo, de PE Biosystems (Foster City, CA).

Además, puede obtenerse información específica sobre las PSN obtenidas de la dbPSN del National Center for Biotechnology Information (NCBI).

También puede localizarse una variante de NOD2 en una región no codificante del locus NOD2. Entre las regiones no codificantes se incluyen, por ejemplo, secuencias de intrón, así como secuencias 5' y 3' no traducidas. Un ejemplo no limitativo de un alelo variante de NOD2 situado en una región no codificante del gen NOD2 es la variante JW1, que se describe en Sugimura et al., Am. J. Hum. Genet. 72:509-518, 2003, y en la publicación de patente US nº 2007/0072180. Entre los ejemplos de alelos variantes de NOD2 situados en la región 3' no traducida del gen NOD2 se incluyen, aunque sin limitarse a ellos, los alelos variantes JW15 y JW16, que se describen en la publicación de patente US nº 2007/0072180. Entre los ejemplos de alelos variantes de NOD2 situados en la región 5' no traducida (por ejemplo la región promotora) del gen NOD2 se incluyen, aunque sin limitarse a ellos, los alelos variantes JW17 y JW18, los cuales se describen en la publicación de patente US nº 2007/0072180. Tal como se utiliza en la presente memoria, la expresión "alelo variante JW1" incluye una variación genética en el nucleótido 158 de la secuencia intermedia 8 (intrón 8) del gen NOD2. En relación a la secuencia AC007728, el alelo variante JW1 se encuentra situado en la posición 128.143. La variación genética en el nucleótido 158 del intrón 8 puede ser, aunque sin limitación, una sustitución de un solo nucleótido, sustituciones de múltiples nucleótidos o una deleción o inserción de uno o más nucleótidos. La secuencia de tipo salvaje del intrón 8 presenta una citosina en la posición 158. A título de ejemplos no limitativos, un alelo variante JW1 puede presentar una sustitución de citosina (c) por adenina (a), citosina (c) por guanina (g) o de citosina (c) por timina (t) en el nucleótido 158 del intrón 8. El alelo variante JW1 puede ser un cambio de una citosina (c) por una timina (t) en el nucleótido 158 del intrón 8 de NOD2. La expresión "alelo variante JW15" incluye una variación genética en la región 3' no traducida de NOD2 en la posición nucleótida 118.790 de la secuencia AC007728. La variación genética en el nucleótido 118.790 puede ser, aunque sin limitación, una sustitución de un solo nucleótido, sustituciones de múltiples nucleótidos, o una deleción o inserción de uno o más nucleótidos. La secuencia de tipo salvaje presenta una adenina (a) en la posición 118.790. A título de ejemplos no limitativos, un alelo variante JW15 puede presentar una sustitución de adenina (a) por citosina), de adenina (a) por guanina (g) o de adenina (a) por timina (t) en el nucleótido 118.790. Se da a conocer que el alelo variante JW15 es un cambio de una adenina (a) por citosina (c) en el nucleótido 118.790.

Tal como se utiliza en la presente memoria, la expresión "alelo variante JW16" incluye una variación genética en la región 3' no traducida de NOD2 en la posición nucleótida 118.031 de la secuencia AC007728. La variación genética en el nucleótido 118.031 puede ser, aunque sin limitación, una sustitución de un solo nucleótido, sustituciones de múltiples nucleótidos, o una deleción o inserción de uno o más nucleótidos. La secuencia de tipo salvaje presenta una guanina (g) en la posición 118.031. A título de ejemplos no limitativos, un alelo variante JW16 puede presentar una sustitución de guanina (g) por citosina (c), de guanina (g) por adenina (a) o de guanina (g) por timina (t) en el nucleótido 118.031. Se da a conocer que el alelo variante JW16 puede ser un cambio de una guanina (g) por adenina (a) en el nucleótido 118.031. La expresión "alelo variante JW17" incluye una variación genética en la región 5' no traducida de NOD2 en la posición nucleótida 154.688 de la secuencia AC007728. La variación genética en el nucleótido 154.688 puede ser, aunque sin limitación, una sustitución de un solo nucleótido, sustituciones de múltiples nucleótidos, o una deleción o inserción de uno o más nucleótidos. La secuencia de tipo salvaje presenta una citosina (c) en la posición 154.688. A título de ejemplos no limitativos, un alelo variante JW17 puede presentar una sustitución de citosina (c) por guanina (g), de citosina (c) por adenina (a) o de citosina (c) por timina (t) en el nucleótido 154.688. El alelo variante JW17 puede ser un cambio de una citosina (c) por timina (t) en el nucleótido 154.688. Tal como se utiliza en la presente memoria, la expresión "alelo variante JW18" incluye una variación genética en la región 5' no traducida de NOD2 en la posición nucleótida 154.471 de la secuencia AC007728. La variación genética en el nucleótido 154.471 puede ser, aunque sin limitación, una sustitución de un solo nucleótido, sustituciones de múltiples nucleótidos, o una deleción o inserción de uno o más nucleótidos. La secuencia de tipo salvaje presenta una citosina (c) en la posición 154.471. A título de ejemplos no limitativos, un alelo variante JW18 puede presentar una sustitución de citosina (c) por guanina (g), de citosina (c) por adenina (a) o de citosina (c) por timina (t) en el nucleótido 154.471. Se da a conocer que el alelo variante JW18 puede ser un cambio de una citosina (c) por timina (t) en el nucleótido 154.471.

Se entiende que los métodos pueden ponerse en práctica con dichos alelos variantes u otros alelos variantes de NOD2 situados en una región codificante o una región no codificante (por ejemplo intrón o región promotora) del locus NOD2. Se entiende además que los métodos pueden implicar la determinación de la presencia de una, dos, tres, cuatro o más variantes de NOD2, incluyendo, aunque sin limitarse a ellas, los alelos PSN 8, PSN 12 y PSN 13, y otras variantes de región codificante, así como de no codificante. 2. ARNmi Generalmente, los microARN (ARNmi) son moléculas de ARN de cadena sencilla de aproximadamente 21 a 23 nucleótidos de longitud que regulan la expresión génica. Los ARNmi están codificados por genes a partir de cuyo ADN son transcritos, aunque los ARNmi no se traducen en proteínas (ARN no codificante). Por el contrario, cada transcrito primario (un ARNmi-pri) es procesado para formar una estructura corta de tallo-bucle denominada pre- ARNmi y finalmente en un ARNmi maduro funcional. Las moléculas de ARNmi maduras son parcial o completamente complementarias a una o más moléculas de ARN mensajero (ARNm) y su función principal es regular negativamente la expresión génica. La identificación de los ARNmi se describe en, por ejemplo, Lagos- Quintana et al., Science 294:853-858; Lau et al., Science 294:858-862, y Lee et al., Science 294:862-864. Los ARNmi de mamífero habitualmente son complementarios a un sitio en la RNT 3' de la secuencia diana de ARNm. La hibridación del ARNmi con el ARNm diana inhibe la traducción en proteínas mediante el bloqueo de la maquinaria de traducción en proteínas o facilita la escisión y degradación del ARNm diana mediante un proceso similar a la interferencia de ARN (ARNi). Los ARNmi también pueden focalizar la metilación de sitios genómicos que corresponden a ARNm diana. Se da a conocer que el marcador pronóstico de EII comprende por lo menos una secuencia de ARNmi (por ejemplo pre-ARNmi o ARNmi maduro). Se da a conocer que la secuencia de ARNmi presenta como diana la expresión de cualquiera de los marcadores bioquímicos, séricos o genéticos indicados en la presente memoria, por ejemplo citoquinas, factores de crecimiento, proteínas de fase aguda, apolipoproteínas, defensinas, cadherinas, o cualquiera de los genes indicados en las Tablas 1A-1E (por ejemplo NOD2). Generalmente, la presencia o el nivel de la secuencia de ARNmi de interés se detecta en la muestra de un individuo y se incluye en el perfil de marcadores pronósticos para ayudar en el pronóstico de la EII y en la predicción de la respuesta a la terapia. Las secuencias ejemplares de ARNmi adecuadas para la detección como marcadores diagnósticos y/o pronósticos se listan en la Tabla 2.

Tabla 2 Gen diana Nombres de ARNmi diana (nº de acceso) Proteína C reactiva (PCR) hsa-miR-142-5p (MIMAT0000433); hsa-miR-939 (MIMAT0004982); hsa-miR- 323-5p (MIMAT0004696); hsa-miR-550* (MIMAT0003257); hsa-miR-920 (MIMAT0004970); hsa-miR-7 (MIMAT0000252); hsa-miR-424 (MIMAT0001341); hsa-miR-135a* (MIMAT0004595); hsa-miR130b* (MIMAT0004680); hsa-miR-503 (MIMAT0002874); hsa-miR-16 (MIMAT0000069); hsa-miR15b (MIMAT0000417); hsa-miR-20b* (MIMAT0004752); hsa-miR-30c-1* (MIMAT0004674); hsamiR-578 (MIMAT0003243); hsa-miR-195 (MIMAT0000461); hsa-miR-141* (MIMAT0004598); hsamiR-220c (MIMAT0004915); hsa-miR-362-5p (MIMAT0000705); hsa-miR-30c-2* (MIMAT0004550); hsa-miR-186 (MIMAT0000456); hsa-miR-497 (MIMAT0002820); hsa-miR-15a (MIMAT0000068); hsa-miR-873 (MIMAT0004953); hsa-miR-657 (MIMAT0003335); hsa-miR-10a (MIMAT0000253); hsa-miR-379* (MIMAT0004690); hsa-miR-371-5p (MIMAT0004687); hsa-miR-150 (MIMAT0000451); hsa-miR-890 (MIMAT0004912); hsa-miR-518f (MIMAT0002842); hsa-miR-624 (MIMAT0004807); hsa-miR-518a-3p (MIMAT0002863); hsa-miR-517* (MIMAT0002851); hsa-miR943 (MIMAT0004986); hsa-miR-27a (MIMAT0000084); hsa-miR-27b (MIMAT0000419); hsa-miR500 (MIMAT0004773); hsa-miR-30a* (MIMAT0000088); hsa-miR-30d* (MIMAT0004551); hsa-miR411* (MIMAT0004813); hsa-miR-27b (MIMAT0000419); hsa-miR-518d-3p (MIMAT0002864); hsamiR-518e (MIMAT0002861); hsa-miR-10b (MIMAT0000254); hsa-miR-551b (MIMAT0003233); hsamiR-518c (MIMAT0002848); hsa-miR-934 (MIMAT0004977); hsa-miR-200c* (MIMAT0004657); hsa-miR-542-5p (MIMAT0003340); hsa-miR-299-5p (MIMAT0002890); hsa-miR-299-3p (MIMAT0000687) Amiloide A sérico (AAS) hsa-miR-339-5p (MIMAT0000764); hsa-miR-660 (MIMAT0003338); hsa-miR- 18a* (MIMAT0002891); hsa-miR-125b (MIMAT0000423); hsa-miR-125a-5p (MIMAT0000443); hsa-miR937 (MIMAT0004980); hsa-miR-874 (MIMAT0004911); hsa-miR-502-5p (MIMAT0002873); hsamiR-526b (MIMAT0002835); hsa-miR-339-3p (MIMAT0004702); hsa-miR-643 (MIMAT0003313); hsa-miR-496 (MIMAT0002818) β defensina-1 (DEFB1) hsa-miR-186* (MIMAT0004612); hsa-miR-548d-5p (MIMAT0004812); hsa- miR-202 (MIMAT0002811); hsa-miR-548b-5p (MIMAT0004798); hsa-miR-198 (MIMAT0000228); hsa-miR186 (MIMAT0000456); hsa-miR-335 (MIMAT0000765); hsa-miR-223* (MIMAT0004570); hsa-miR196b (MIMAT0001080); hsa-miR-653 (MIMAT0003328); hsa-miR-668 (MIMAT0003881) β defensina-2 (DEFB2) hsa-miR-593 (MIMAT0004802); hsa-miR-299-5p (MIMAT0002890); hsa-miR- 518c* (MIMAT0002847); hsa-miR-511 (MIMAT0002808); hsa-miR-646 (MIMAT0003316); hsa-miR-129-3p (MIMAT0004605); hsa-miR-767-5p (MIMAT0003882); hsa-miR-129* (MIMAT0004548); hsamiR-588 (MIMAT0003255); hsa-miR-187 (MIMAT0000262) Factor de crecimiento hsa-miR-625 (MIMAT0003294); hsa-miR-29a* (MIMAT0004503); hsa-miR- epidérmico (FCE) 499-5p (MIMAT0002870); hsa-miR-335* (MIMAT0004703); hsa-miR-17* (MIMAT0000071); hsa-miR-199b-5p (MIMAT0000263); hsa-miR-7-2* (MIMAT0004554); hsa-miR-134 (MIMAT0000447); hsa-miR-890 (MIMAT0004912); hsa-miR-93* (MIMAT0004509); hsa-miR-7-1* (MIMAT0004553); hsa-miR-302b* (MIMAT0000714); hsa-miR-548c-3p (MIMAT0003285); hsa-miR-135b* (MIMAT0004698); hsa-miR-19b-2* (MIMAT0004492); hsa-miR-200a (MIMAT0000682); hsa-miR-26b (MIMAT0000083); hsamiR-199a-5p (MIMAT0000231); hsa-miR-632 (MIMAT0003302); hsa-miR-644 (MIMAT0003314); hsa-miR-142-3p (MIMAT0000434); hsa-miR-518c (MIMAT0002848); hsa-miR-369-5p (MIMAT0001621) TWEAK hsa-miR-620 (MIMAT0003289); hsa-miR-939 (MIMAT0004982); hsa-miR-498 (MIMAT0002824); hsa-miR-452* (MIMAT0001636); hsa-miR-623 (MIMAT0003292); hsa-miR-21* (MIMAT0004494); hsa-miR-886-3p (MIMAT0004906); hsa-miR-423-5p (MIMAT0004748); hsa-miR-609 (MIMAT0003277); hsa-miR-27b* (MIMAT0004588); hsa-miR-222 (MIMAT0000279); hsa-miR-619 (MIMAT0003288); hsa-miR-585 (MIMAT0003250); hsa-miR-221 (MIMAT0000278); hsa-miR-654-3p (MIMAT0004814); hsa-miR-524-3p (MIMAT0002850); hsa-miR-199b-5p (MIMAT0000263); hsa-miR-566 (MIMAT0003230); hsa-miR-525-3p (MIMAT0002839); hsa-miR-598 (MIMAT0003266); hsa-miR-887 (MIMAT0004951); hsa-miR-551a (MIMAT0003214); hsa-miR-585 (MIMAT0003250) IL-1β hsa-miR-888 (MIMAT0004916); hsa-miR-616* (MIMAT0003284); hsa-miR- 548d-3p (MIMAT0003323); hsa-miR-211 (MIMAT0000268); hsa-miR-587 (MIMAT0003253); hsa-miR-296-3p (MIMAT0004679); hsa-miR-548b-3p (MIMAT0003254); hsa-miR-595 (MIMAT0003263); hsa-miR-204 (MIMAT0000265); hsa-miR-578 (MIMAT0003243); hsa-miR-208 (MIMAT0000241); hsa-miR-208b (MIMAT0004960); hsa-miR-330-5p (MIMAT0004693); hsa-miR-26b* (MIMAT0004500); hsa-miR-495 (MIMAT0002817); hsa-miR-616 (MIMAT0004805); hsa-miR-590-5p (MIMAT0003258); hsa-miR-943 (MIMAT0004986); hsa-miR-135a* (MIMAT0004595); hsamiR-361-5p (MIMAT0000703); hsa-miR-299-3p (MIMAT0000687); hsa-miR-603 (MIMAT0003271); hsa-miR-518e (MIMAT0002861); hsa-miR-556-3p (MIMAT0004793) IL-6 hsa-miR-548b-5p (MIMAT0004798); hsa-miR-335* (MIMAT0004703); hsa- miR-126* (MIMAT0000444); hsa-miR-376b (MIMAT0002172); hsa-miR-146a* (MIMAT0004608); hsa-miR571 (MIMAT0003236); hsa-miR-153 (MIMAT0000439); hsa-miR-760 (MIMAT0004957); hsa-miR106a* (MIMAT0004517); hsa-miR-371-5p (MIMAT0004687); hsa-miR-376a (MIMAT0000729); hsamiR-144 (MIMAT0000436); hsa-miR-518c* (MIMAT0002847); hsa-miR-548d-5p (MIMAT0004812); hsa-miR-365 (MIMAT0000710); hsa-miR-548c-5p (MIMAT0004806); hsa-miR-587 (MIMAT0003253); hsa-miR-33a* (MIMAT0004506); hsa-miR-574-3p (MIMAT0003239); hsa-miR568 (MIMAT0003232); hsalet-7i (MIMAT0000415); hsa-miR-148b* (MIMAT0004699); hsa-miR-655 (MIMAT0003331); hsa-miR- 548a-5p (MIMAT0004803); hsa-miR-148a* (MIMAT0004549); hsa-miR613 (MIMAT0003281); hsa-miR-146b-3p (MIMAT0004766); hsa-miR-149 (MIMAT0000450); hsamiR-217 (MIMAT0000274); hsa-miR-196b (MIMAT0001080); hsa-miR-22* (MIMAT0004495); hsamiR-137 (MIMAT0000429); hsa-miR-498 (MIMAT0002824); hsalet-7g (MIMAT0000414); hsa-miR155 (MIMAT0000646); hsa-miR-383 (MIMAT0000738); hsa-miR-576-3p (MIMAT0004796); hsamiR-183* (MIMAT0004560); hsa-miR-555 (MIMAT0003219); hsa-miR-589 (MIMAT0004799); hsamiR-338-5p (MIMAT0004701); hsa-miR-522 (MIMAT0002868); hsa-miR-643 (MIMAT0003313); hsa-miR-369-3p (MIMAT0000721); hsa-miR-552 (MIMAT0003215); hsa-miR-499-5p (MIMAT0002870); hsa-miR-137 (MIMAT0000429); hsa-miR-338-5p (MIMAT0004701); hsa-miR374b (MIMAT0004955); hsa-miR-376c (MIMAT0000720); hsa-miR-588 (MIMAT0003255); hsa-miR212 (MIMAT0000269); hsa-miR-132 (MIMAT0000426) Cadherina-E hsa-miR-143* (MIMAT0004599); hsa-miR-544 (MIMAT0003164); hsa-miR- 920 (MIMAT0004970); hsa-miR-635 (MIMAT0003305); hsa-miR-340* (MIMAT0000750); hsa-miR-665 (MIMAT0004952); hsa-miR-217 (MIMAT0000274); hsa-miR-9* (MIMAT0000442); hsa-miR-612 (MIMAT0003280); hsamiR-920 (MIMAT0004970); hsa-miR-382 (MIMAT0000737); hsa-miR-340 (MIMAT0004692); hsamiR-34c-3p (MIMAT0004677); hsa-miR-1 (MIMAT0000416); hsa-miR-571 (MIMAT0003236); hsamiR-499-3p (MIMAT0004772); hsa-miR-708* (MIMAT0004927); hsa-miR-220b (MIMAT0004908); hsa-miR-206 (MIMAT0000462); hsa-miR-92a (MIMAT0000092); hsa-miR-92b (MIMAT0003218); hsa-miR-217 (MIMAT0000274) NOD2 hsa-miR-671-5p (MIMAT0003880); hsa-miR-20a* (MIMAT0004493); hsa-miR- 124 (MIMAT0000422); hsa-miR-122 (MIMAT0000421); hsa-miR-192 (MIMAT0000222); hsa-miR-215 (MIMAT0000272); hsa-miR-495 (MIMAT0002817); hsa-miR-342-5p (MIMAT0004694); hsa-miR-512-5p (MIMAT0002822); hsa-miR-453 (MIMAT0001630); hsa-miR-215 (MIMAT0000272); hsamiR-192 (MIMAT0000222) Los nº de acceso para las secuencias de ARNmi maduro corresponden a entradas que pueden encontrarse en la base de datos de secuencias miRBase del Instituto Sanger. La base de datos de secuencias miRBase es una base de datos abierta a búsquedas de secuencias y anotaciones de ARNmi publicadas. Se hace referencia en la presente memoria a los nº de acceso de la base de datos de secuencias miRBase.

Se da a conocer que el miR indicado en la Tabla 2 presenta una longitud de entre aproximadamente 17 y 25 nucleótidos y comprende una secuencia que es por lo menos 90% idéntica a un ARNmi indicado en el nº de acceso listado para la secuencia de ARNmi maduro. Se da a conocer que un ARNmi presenta una longitud de 17, 18, 19, 20, 21, 22, 23, 24 o 25 nucleótidos, o cualquier intervalo derivable de los mismos. Además, un miR puede presentar una secuencia que es por lo menos 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9 o 100% idéntica al ARNmi en la Tabla 2. Se da a conocer que el complemento del miR indicado en la Tabla 2 resulta útil. Lo anterior se conoce como un inhibidor de ARNmi. Un inhibidor de ARNmi presenta una longitud de entre aproximadamente 17 y 25 nucleótidos y comprende una secuencia 5' a 3' que es por lo menos 90% complementaria a la secuencia 5' a 3' de un ARNmi maduro. Se da a conocer que una molécula inhibidora de ARNmi presenta una longitud de 17, 18, 19, 20, 21, 22, 23, 24 o 25 nucleótidos, o cualquier intervalo derivable de los mismos. Además, un inhibidor de miR puede presentar una secuencia (de 5' a 3') que es por lo menos 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99,1, 99,2, 99,3, 99,4, 99,5, 99,6, 99,7, 99,8, 99,9 o 100% complementaria, o cualquier intervalo derivable de los mismos, a la secuencia 5' a 3' de un ARNmi maduro. L. Otros marcadores diagnósticos y pronósticos Entre los marcadores diagnósticos y/o pronósticos adicionales adecuados para la utilización en el presente método se incluyen, aunque sin limitarse a ellos, lactoferrina, anticuerpos antilactoferrina, elastasa, calprotectina, hemoglobina y combinaciones de los mismos. La determinación de la presencia o del nivel de lactoferrina en una muestra también resulta útil. En determinados casos, la presencia o el nivel de lactoferrina se detecta al nivel de la expresión de ARNm con un ensayo tal como, por ejemplo, un ensayo de hibridación o un ensayo basado en la amplificación. En determinados otros casos, la presencia o el nivel de una lactoferrina particular se detecta al nivel de la expresión de proteínas utilizando, por ejemplo, un inmunoensayo (por ejemplo ELISA) o un ensayo inmunohistoquímico. Puede utilizarse un kit de ELISA disponible de Calbiochem (San Diego, CA) para detectar la lactoferrina humana en una muestra de plasma, orina, lavado broncoalveolar o líquido cerebroespinal. De manera similar, puede utilizarse un kit de ELISA disponible de U.S. Biological (Swampscott, MA) para detectar los niveles de PRC en una muestra. De manera similar, pueden utilizarse kits de ELISA disponibles de TECHLAB, Inc. (Blacksburg, VA) para determinar el nivel de lactoferrina en una muestra de heces. Además, la publicación de patente US nº 2004/0137536 describe un ensayo ELISA para determinar la presencia de niveles elevados de lactoferrina en una muestra de heces, y la publicación de patente US nº 2004/0033537 describe un ensayo ELISA para determinar la concentración de lactoferrina endógena en una muestra de heces, moco o bilis. La presencia o el nivel de anticuerpos antilactoferrina puede detectarse en una muestra utilizando, por ejemplo, proteína lactoferrina o un fragmento de la misma. Además, la sangre hemoculta, oculta en heces, con frecuencia es indicativa de enfermedad gastrointestinal y se han desarrollado diversos kits para monitorizar el sangrado gastrointestinal. Por ejemplo, Hemoccult SENSA, un producto de Beckman Coulter, es una ayuda diagnóstica para el sangrado gastrointestinal, deficiencia de hierro, úlceras pépticas, colitis ulcerosa y, en algunos casos, en el cribado para el cáncer colorrectal. Este ensayo particular se basa en la oxidación del guaiac por peróxido de hidrógeno para producir color azul. Un ensayo colorimétrico similar se encuentra disponible comercialmente de Helena Laboratories (Beaumont, TX) para la detección de sangre en muestras de heces. Otros métodos para detectar sangre oculta en una muestra de heces mediante la determinación de la presencia o el nivel de hemoglobina o actividad de heme se describen en, por ejemplo, las patentes US nº 4.277.250, nº 4.920.045, nº 5.081.040 y nº 5.310.684. La calprotectina es una proteína de unión a calcio y cinc observada en todas las células, tejidos y líquidos en el cuerpo. La calprotectina es una proteína importante en los granulocitos y macrófagos neutrófilos y constituye hasta 60% de las proteínas totales en la fracción citosólica de estas células. Por lo tanto, es un marcador sustitutivo de la producción de neutrófilos. Su concentración en las heces se correlaciona con la intensidad de la infiltración de los neutrófilos en la mucosa intestinal y con la gravedad de la inflamación. La calprotectina puede medirse con un ELISA utilizando muestras fecales pequeñas (50 a 100 mg) (ver, por ejemplo, Johne et al., Scand. J. Gastroenterol. 36:291- 296, 2001). VI. Ensayos Puede utilizarse cualquiera de entre una diversidad de ensayos, técnicas y kits conocidos de la técnica con el fin de detectar o determinar la presencia o el nivel de uno o más marcadores de EII en una muestra para diagnosticar la EII, para clasificar el diagnóstico de la EII (por ejemplo EC o CU), para clasificar el pronóstico de EII (por ejemplo el riesgo o probabilidad de un pronóstico más grave (por ejemplo la probabilidad de desarrollar complicaciones de la enfermedad y/o progresión a cirugía y/o susceptibilidad de desarrollar un subtipo clínico particular de EC o CU) o para predecir la probabilidad de respuesta a terapia con uno o más agentes terapéuticos (por ejemplo terapia biológica). El presente método se basa, en parte, en la determinación de la presencia o el nivel de por lo menos un marcador en una muestra obtenida de un individuo. Tal como se utiliza en la presente memoria, la expresión "detectar la presencia de por lo menos un marcador" incluye determinar la presencia de cada marcador de interés mediante la utilización de cualquier ensayo cuantitativo o cualitativo conocido por el experto en la materia. En determinados casos, los ensayos cualitativos que determinan la presencia o la ausencia de un carácter, variable o sustancia bioquímica o sérica particular (por ejemplo proteína o anticuerpo), resultan adecuados para detectar cada marcador de interés. En determinados otros casos, los ensayos cuantitativos que determinan la presencia o la ausencia de ARN, proteínas, anticuerpos o actividad resultan adecuados para detectar cada marcador de interés. Tal como se utiliza en la presente memoria, la expresión "detectar el nivel de por lo menos un marcador" incluye determinar la presencia de cada marcador de interés mediante la utilización de cualquier ensayo cuantitativo o cualitativo conocido por el experto en la materia. En determinados casos, los ensayos cuantitativos que determinan, por ejemplo, la cantidad relativa o absoluta de ARN, proteínas, anticuerpo o actividad resultan adecuados para detectar cada marcador de interés. El experto en la materia apreciará que cualquier ensayo útil para detectar el nivel de un marcador también resulta útil para detectar la presencia o la ausencia del marcador. Tal como se utiliza en la presente memoria, el término "anticuerpo" incluye una población de moléculas de inmunoglobulina que pueden ser policlonales o monoclonales y de cualquier isotipo, o de un fragmento inmunológicamente activo de una molécula de inmunoglobulina. Dicho fragmento inmunológicamente activo contiene las regiones variables de las cadenas pesada y ligera, que constituyen la parte de la molécula de anticuerpo que se une específicamente a antígeno. Por ejemplo, un fragmento inmunológicamente activo de una molécula de inmunoglobulina conocida de la técnica, tal como Fab, Fab' F(ab')2 se encuentra comprendida dentro del significado del término anticuerpo.

Puede utilizarse la citometría de flujo para detectar la presencia o el nivel de uno o más marcadores en una muestra. Dichos ensayos de citometría de flujo, incluyendo los inmunoensayos basados en perlas, pueden utilizarse para determinar, por ejemplo, los niveles de marcador de anticuerpo de la manera indicada para detectar anticuerpos séricos contra Candida albicans y proteínas del VIH (ver, por ejemplo, Bishop and Davis, J. Immunol. Methods 210:79-87, 1997; McHugh et al., J. Immunol. Methods 116:213, 1989; Scillian et al., Blood 73:2041, 1989).

La tecnología de expresión fágica para expresar un antígeno recombinante específico para un marcador también puede utilizarse para detectar la presencia o el nivel de uno o más marcadores en una muestra. Las partículas fágicas que expresan un antígeno específico para, por ejemplo, un marcador anticuerpo pueden anclarse, si se desea, a una placa multipocillo utilizando un anticuerpo tal como un anticuerpo monoclonal antifago (Feliciet et al., "Phage-Displayed Peptides as Tools for Characterization of Human Sera", en Abelson (ed.), Methods in Enzymol. 267, San Diego: Academic Press, Inc., 1996). Puede utilizarse una diversidad de técnicas de inmunoensayo, incluyendo inmunoensayos competitivos y no competitivos, para detectar la presencia o el nivel de uno o más marcadores en una muestra (ver, por ejemplo, Self y Cook, Curr. Opin. Biotechnol. 7:60-65, 1996). El término inmunoensayo comprende técnicas que incluyen, aunque sin limitarse a ellas, inmunoensayos enzimáticos (EIA), tales como la técnica de inmunoensayo de enzimas multiplicados (TIEM), el ensayo de inmunosorción ligada a enzima (ELISA, por el inglés Enzyme-Linked ImmunoSorbent Assay), el ELISA de captura de antígeno, el ELISA de tipo sándwich, la ELISA de captura de anticuerpos IgM (ELISA CAM) y el inmunoensayo enzimático de micropartículas (IEEM), los inmunoensayos de electroforesis capilar (IEEC), los radioinmunoensayos (RIE), los ensayos inmunorradiométricos (EIRM), los inmunoensayos de polarización de fluorescencia (IEPF) y los ensayos de quimioluminiscencia (EQ). Si se desea, dichos inmunoensayos pueden automatizarse. Los inmunoensayos también pueden utilizarse conjuntamente con fluorescencia inducida por láser (ver, por ejemplo, Schmalzing y Nashabeh, Electrophoresis 18:2184-2193, 1997; Bao, J. Chromatogr. B. Biomed. Sci. 699:463-480, 1997). Los inmunoensayos de liposomas, tales como los inmunoensayos de liposomas de inyección de flujo y los inmunosensores de liposomas, también resultan adecuados (ver, por ejemplo, Rongen et al., J. Immunol. Methods 204:105-133, 1997). Además, resultan adecuados los ensayos nefelométricos, en los que la formación de complejos de proteína/anticuerpo resulta en una dispersión incrementada de la luz que se convierte en una señal de tasa pico como función de la concentración de marcador. Los ensayos de nefelometría se encuentran disponibles comercialmente de Beckman Coulter (Brea, CA, kit nº 449430) y pueden llevarse a cabo utilizando un analizador nefelométrico Behring (Fink et al., J. Clin. Chem. Clin. Biol. Chem. 27:261- 276, 1989). Puede resultar útil el ELISA de captura de antígeno para detectar la presencia o el nivel de uno o más marcadores en una muestra. Por ejemplo, en un ELISA de captura de antígenos, un anticuerpo dirigido contra un marcador de interés se une a una fase sólida y se añade la muestra de manera que el marcado se une al anticuerpo. Tras eliminar mediante lavado las proteínas no unidas, puede cuantificarse la cantidad de marcador unido utilizando, por ejemplo, un radioinmunoensayo (ver, por ejemplo, Harlow y Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1988). Un ELISA de tipo sándwich también puede resultar adecuado para la utilización en el presente método. Por ejemplo, en un ensayo de tipo sándwich de dos anticuerpo, se une un primer anticuerpo a un soporte sólido y se permite la unión del marcador de interés al primer anticuerpo. La cantidad del marcador se cuantifica mediante la medición de la cantidad de un segundo anticuerpo que se une al marcador. Los anticuerpos pueden inmovilizarse en una diversidad de soportes sólidos, tales como partículas magnéticas o de matriz cromatográfica, la superficie de una placa de ensayo (por ejemplo pocillos de microtitulación), trozos de un material o membrana de sustrato sólido (por ejemplo plástico, nilón y papel) y similares. Puede prepararse una tira de ensayo mediante el recubrimiento del anticuerpo o de una pluralidad de anticuerpos en una matriz sobre un soporte sólido. A continuación, la tira puede sumergirse en la muestra de ensayo y procesarse rápidamente mediante lavados y etapas de detección con el fin de generar una señal medible, tal como un punto de color. Un radioinmunoensayo que utilice, por ejemplo, un anticuerpo secundario marcado con yodo 125 (125I) (Harlow y Lane, supra) también resulta adecuado para detectar la presencia o el nivel de uno o más marcadores en una muestra. Un anticuerpo secundario marcado con un marcador quimioluminiscente también puede resultar adecuado para la utilización en el presente método. Un ensayo de quimioluminiscencia que utilice un anticuerpo secundario quimioluminiscente resulta adecuado para la detección no radioactiva sensible de los niveles de marcador. Dichos anticuerpos secundarios pueden obtenerse comercialmente de diversas fuentes, por ejemplo de Amersham Lifesciences, Inc. (Arlington Heights, IL).

Los inmunoensayos indicados anteriormente resultan particularmente útiles para detectar la presencia o el nivel de uno o más marcadores en una muestra. A modo de ejemplo no limitativo, resulta útil un ELISA de neutrófilos fijados para determinar si una muestra es positiva para ANAC o para determinar los niveles de ANAC en una muestra. De manera similar, un ELISA que utilice fosfopeptidomanano de las paredes celulares de levadura resulta útil para determinar si una muestra es positiva para IgA-AASC o para determinar los niveles de IgA-AASC y/o IgG-AASC en una muestra. Un ELISA que utilice la proteína OmpC o un fragmento de la misma resulta útil para determinar si una muestra es positiva para anticuerpos anti-OmpC o para determinar los niveles de anticuerpo anti-OmpC en una muestra. Un ELISA que utilice la proteína I2 o un fragmento de la misma resulta útil para determinar si una muestra es positiva para anticuerpos anti-I2 o para determinar los niveles de anticuerpo anti-I2 en una muestra. Un ELISA que utilice la proteína flagelina (por ejemplo la flagelina Cbir-1) o un fragmento de la misma resulta útil para determinar si una muestra es positiva para anticuerpos antiflagelina o para determinar los niveles de anticuerpo antiflagelina en una muestra. Además, los inmunoensayos indicados anteriormente resultan particularmente útiles para detectar la presencia o el nivel de uno o más marcadores en una muestra.

La unión inmunológica específica del anticuerpo al marcador de interés puede detectarse directa o indirectamente. Entre los marcajes directos se incluyen las etiquetas fluorescentes o luminiscentes, los metales, los pigmentos, los radionucleidos y similares, unidos al anticuerpo. Un anticuerpo marcado con yodo 125 (125I) puede utilizarse para determinar los niveles de uno o más marcadores en una muestra. Un ensayo de quimioluminiscencia que utilice un anticuerpo quimioluminiscente específico para el marcador resulta adecuado para la detección no radioactiva sensible de los niveles del marcador. Un anticuerpo marcado con fluorocromo también resulta adecuado para determinar los niveles de uno o más marcadores en una muestra. Entre los ejemplos de fluorocromos se incluyen, aunque sin limitarse a ellos, DAPI, fluoresceína, Hoechst 33258, R-ficocianina, B-ficoeritrina, R-ficoeritrina, rodamina, rojo Texas y lisamina. Pueden obtenerse comercialmente anticuerpos secundarios unidos a fluorocromos, por ejemplo, F(ab')2 de cabra anti-IgG humano-FITC se encuentra disponible de Tago Immunologicals (Burlingame, CA).

Entre los marcajes indirectos se incluyen diversos enzimas bien conocidos de la técnica, tales como la peroxidasa de rábano picante (PRP), la fosfatasa alcalina (FA), la β-galactosidasa, la urea y similares. Puede utilizarse un sistema de detección de peroxidasa de rábano picante, por ejemplo con el sustrato cromogénico tetrametilbencidina (TMB), que rinde un producto soluble en presencia de peróxido de hidrógeno que es detectable a 450 nm. Puede utilizarse un sistema de detección de fosfatasa alcalina con el sustrato cromogénico fosfato de p-nitrofenilo, por ejemplo, que rinde un producto soluble fácilmente detectable a 405 nm. De manera similar, puede utilizarse un sistema de detección de β-galactosidasa con el sustrato cromogénico o-nitrofenil-β-D-galactopiranósido (ONPG), que rinde un producto soluble fácilmente detectable a 410 nm. Puede utilizarse un sistema de detección de ureasa con un sustrato tal como urea-violeta bromocresol (Sigma Immunochemicals, St. Louis, MO). Puede obtenerse un anticuerpo secundario útil unido a un enzima a partir de varias fuentes comerciales, por ejemplo F(ab')2 de cabra anti-IgG humana-fosfatasa alcalina puede obtenerse de Jackson ImmunoResearch (West Grove, PA). Puede analizarse una señal procedente del marcaje directo o indirecto utilizando, por ejemplo, un espectrofotómetro para detectar el color de un sustrato cromogénico; un contador de radiación para detectar la radiación, tal como un contador gamma para la detección de 125I, o un fluorímetro para detectar la fluorescencia en presencia de luz de una determinada longitud de onda. Para la detección de anticuerpos unidos a enzima, puede llevarse a cbo un análisis cuantitativo de los niveles de marcador utilizando un espectrofotómetro, tal como un lector de microplacas EMAX (Molecular Devices, Menlo Park, CA) siguiendo las instrucciones del fabricante. Si se desea, los ensayos descritos en la presente memoria pueden automatizarse o ejecutarse robóticamente, y puede detectarse simultáneamente la señal de múltiples muestras.

También puede utilizarse la transferencia western cuantitativa para detectar la presencia o el nivel de uno o más marcadores en una muestra. Las transferencias western pueden cuantificarse mediante métodos bien conocidos tales como la densitometría de barrido o la obtención de imágenes en placas de fósforo. A modo de ejemplo no limitativo, se someten a electroforesis muestras de proteínas en geles de SDS-PAGE Laemmli al 10%. Se hacen reaccionar anticuerpos monoclonales murinos primarios con la membrana de transferencia, y puede confirmarse que la unión de anticuerpo es lineal utilizando un experimento preliminar de transferencia en ranura ("slot blot"). Se utilizan anticuerpos de cabra antiratón acoplados a peroxidasa de rábano picante (BioRad) a modo de anticuerpo secundario y se lleva a cabo la detección de las señales utilizando quimioluminiscencia, por ejemplo con el kit de quimioluminiscencia Renaissance (New England Nuclear, Boston, MA) siguiendo las instrucciones del fabricante.

Las autorradiografías de las membranas de transferencia se analizan utilizando un densitómetro de barrido (Molecular Dynamics, Sunnyvale, CA) y se normalizan respecto a un control positivo. Los valores se informan, por ejemplo, como una proporción entre el valor real y el control positivo (índice densitométrico). Dichos métodos son bien conocidos de la técnica, tal como se indica en, por ejemplo, Parra et al., J. Vasc. Surg. 28:669-675, 1998.

Alternativamente puede utilizarse una diversidad de técnicas de ensayo inmunohistoquímico para detectar o determinar la presencia o el nivel de uno o más marcadores en una muestra. La expresión "ensayo inmunohistoquímico" comprende las técnicas que utilizan la detección visual de pigmentos fluorescentes o enzimas acoplados (es decir, conjugados) con anticuerpos que reaccionan con el marcador de interés utilizando microscopía fluorescente o microscopía óptica e incluye, aunque sin limitación, un ensayo directo de anticuerpos fluorescentes, un ensayo indirecto de anticuerpos fluorescentes (IAF), inmunofluorescencia anticomplemento, inmunofluorescencia de avidina-biotina y ensayos de inmunoperoxidasa. Un ensayo IAF resulta útil, por ejemplo, para determinar si una muestra es positiva para AANC, el nivel de AANC en una muestra, si una muestra es positiva para AANCp, el nivel de AANCp en una muestra y/o un patrón de tinción de AANC (por ejemplo AANCc, AANCp y/o un patrón de tinción SAPPA). La concentración de AANC en una muestra puede cuantificarse, por ejemplo, mediante titulación de punto final o mediante la medición de la intensidad visual de la fluorescencia en comparación con un estándar de referencia conocido. Alternativamente, la presencia o el nivel de un marcador de interés puede determinarse mediante la detección o la cuantificación de la cantidad de marcador purificado. La purificación del marcador puede llevarse a cabo, por ejemplo, mediante cromatografía líquida de alta presión (HPLC), sola o en combinación con espectrometría de masas (MALDI/EM, MALDI-TOF (por sus siglas en inglés Matrix-Assisted Laser Desorption Ionization-Time Of Flight)/EM, SELDI-TOF/EM, EM en tándem, etc.). La detección cualitativa o cuantitativa de un marcador de interés también puede determinarse mediante métodos bien conocidos, incluyendo, aunque sin limitación, ensayos de Bradford, tinción de azul de Coomassie, tinción de plata, ensayos para proteína marcada radioactivamente y espectrometría de masas. El análisis de una pluralidad de marcadores puede llevarse a cabo separadamente o simultáneamente con una muestra de ensayo. Para el ensayo separado o secuencial de marcadores, entre los aparatos adecuados se incluyen los analizadores de laboratorio clínico, tales como los sistemas de inmunoensayo ElecSys (Roche), el AxSym (Abbott), el Access (Beckman), el ADVIA®, el CENTAUR® (Bayer) y el NICHOLS ADVANTAGE® (Nichols Institute). Los aparatos o chips de proteínas preferentes llevan a cabo ensayos simultáneos de una pluralidad de marcadores en una única superficie. Los formatos físicos particularmente útiles comprenden superficies que presentan una pluralidad de sitios discretos localizables para la detección de una pluralidad de marcadores diferentes. Entre dichos formatos se incluyen micromatrices de proteínas o "chips de proteínas" (ver, por ejemplo Ng

et al., J. Cell Mol. Med., 6:329-340, 2002) y determinados dispositivos capilares (ver, por ejemplo, la patente US nº 6.019.944). Cada sitio superficial discreto puede comprender anticuerpos para inmovilizar uno o más marcadores para la detección en cada sitio. Las superficies pueden comprender alternativamente una o más partículas discretas (por ejemplo micropartículas o nanopartículas) inmovilizadas en sitios discretos de una superficie, en la que las micropartículas comprenden anticuerpos para inmovilizar uno o más marcadores para la detección.

Además de los ensayos anteriormente indicados para detectar la presencia o nivel de diversos marcadores de interés, también se da a conocer el análisis de los niveles de ARNm de marcador utilizando técnicas rutinarias tales como el análisis northern, la reacción en cadena de la polimerasa-transcriptasa inversa (RT-PCR) o cualesquiera otros métodos basados en la hibridación con una secuencia de ácidos nucleicos que es complementaria a una parte de la secuencia codificante del marcador (por ejemplo la hibridación en ranura). Se describen técnicas de amplificación por PCR aplicables en, por ejemplo, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. New York, 1999, capítulo 7 y suplemento 47; Theophilus et al., "PCR Mutation Detection Protocols", Humana Press, 2002; e Innis et al., PCR Protocols, San Diego, Academic Press, Inc., 1990. Los métodos generales de hibridación de ácidos nucleicos se describen en Anderson, "Nucleic Acids Hybridization", BIOS Scientific Publishers, 1999. La amplificación o hibridación de una pluralidad de secuencias de ácidos nucleicos transcritas (por ejemplo ARNm o ADNc) también puede llevarse a cabo a partir de secuencias de ARNm o ADNc dispuestas en una micromatriz. Los métodos de micromatriz se describen de manera general en Hardiman, "Microarrays Methods and Applications: Nuts & Bolts", DNA Press, 2003; y Baldi et al., "DNA Microarrays and Gene Expression: From Experiments to Data Analysis and Modeling", Cambridge University Press, 2002.

Pueden combinarse varios marcadores dei nterés en un ensayo para el procesamiento eficientes de una multiplicidad de muestras. Además, el experto en la materia reconocerá el valor de someter a ensayo múltiples muestras (por ejemplo en puntos temporales consecutivos, etc.) del mismo sujeto. Dicho ensayo de muestras seriadas puede permitir la identificación de cambios en los niveles de marcador durante el tiempo. Los incrementos o reducciones de los niveles de marcadores, así como la ausencia de cambio en los niveles de marcador, también pueden proporcionar información pronóstica y predictiva útil para facilitar el tratamiento de la EII. Puede construirse un panel para medir uno o más de los marcadores anteriormente indicados con el fin de proporcionar información relevante relacionada con el enfoque de diagnóstico de la EII, para predecir el curso y resultado probables de la EII, y para predecir la probabilidad de respuesta a la terapia de la EII. Dicho panel puede construirse con el fin de detectar o determinar la presencia o el nivel de 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40 o más marcadores individuales. El análisis de un único marcador o subgrupos de marcadores también puede ser llevado a cabo por el experto en la materia en diversos contextos clínicos. Entre ellos se incluyen, aunque sin limitación, los contextos ambulatorio, atención urgente, cuidados críticos, cuidados intensivos, unidad de seguimiento, intrahospitalario, consulta externa, consulta médica, clínica médica y de cribado de salud. El análisis de marcadores podría llevarse a cabo también en una diversidad de formatos físicos. Por ejemplo, podrían utilizarse placas de microtitulación o la automatización con el fin de facilitar el procesamiento de un gran número de muestras de ensayo. Alternativamente, podrían desarrollarse formatos de una sola muestra para facilitar el tratamiento, diagnóstico y pronóstico a tiempo. En vista de lo anteriormente expuesto, el experto en la materia es consciente de que los métodos para proporcionar información diagnóstica con respecto a la EII o subtipos clínicos de la misma, para proporcionar información pronóstica y predictiva respecto al resultado y curso de progresión de la EII y para proporcionar información sobre la selección de un régimen terapéutico adecuado para el tratamiento de la EII (por ejemplo mediante la determinación de la presencia o nivel de concentración de uno o más marcadores de EII tal como se indica en la presente memoria) puede ponerse en práctica utilizando uno o cualquier combinación de los ensayos bien conocidos indicados anteriormente u otros ensayos conocidos de la técnica.

VII. Métodos de genotipado Puede utilizarse una diversidad de medios para genotipar un individuo en un sitio polimórfico en el gen NOD2 o cualquier otro marcador genético indicado en la presente memoria con el fin de determinar si una muestra (por ejemplo una muestra de ácidos nucleicos) contiene un alelo variante o haplotipo específico. Por ejemplo, puede utilizarse convenientemente la amplificación enzimática de ácidos nucleicos de un individuo a fin de obtener ácidos nucleicos para el análisis posterior. La presencia o ausencia de un alelo variante o haplotipo específico en uno o más marcadores genéticos de interés también puede determinarse directamente de los ácidos nucleicos del individuo sin amplificación enzimática. Se da a conocer que se genotipa un individuo en el locus NOD2.

El genotipado de ácidos nucleicos de un individuo, amplificado o no, puede llevarse a cabo utilizando cualquiera de entre diversas técnicas. Entre las técnicas útiles se incluyen, aunque sin limitación, el análisis basado en la reacción en cadena de la polimerasa (PCR), el análisis de secuencias y el análisis electroforético, los cuales pueden utilizarse solos o en combinación. Tal como se utiliza en la presente memoria, la expresión "ácido nucleico" se refiere a un polinucleótido, tal como una molécula de ADN o ARN de cadena sencilla o de doble cadena, por ejemplo ADN genómico, ADNc y ARNm. Dicha expresión comprende moléculas de ácidos nucleicos de origen tanto natural como sintético, así como moléculas de configuración lineal, circular o ramificada que representan la cadena de sentido o antisentido, o ambas, de una molécula nativa de ácidos nucleicos. Se entiende que dichos ácidos nucleicos pueden estar no purificados, purificados o unidos, por ejemplo, a un material sintético, tal como una perla o matriz de columna.

El material que contiene ácidos nucleicos se obtiene rutinariamente de individuos.Dicho material es cualquier material biológico a partir del cual pueden prepararse ácidos nucleicos. Como ejemplos no limitativos, el material puede ser sangre completa, suero, plasma, saliva, raspado bucal, esputo u otro líquido o tejido corporal que contenga ácidos nucleicos. Se da a conocer que se pone en práctica un método con sangre completa, que puede obtenerse fácilmente por medios no invasivos y utilizarse para preparar ADN genómico. Se da a conocer que el genotipado implica la amplificación de los ácidos nucleicos de un individuo utilizando la reacción en cadena de la polimerasa (PCR). La utilización de PCR para la amplificación de ácidos nucleicos es bien conocida de la técnica (ver, por ejemplo, Mullis et al. (editores), The Polymerase Chain Reaction, Birkhäuser, Boston, 1994. Se da a conocer que la amplificación por PCR se lleva a cabo utilizando uno o más cebadores marcados fluorescentemente.

Se da a conocer que la amplificación por PCR se lleva a cabo utilizando uno o más cebadores marcados o no marcados que contienen un ligante de surco menor de ADN. Puede utilizarse cualquiera de entre una diversidad de diferentes cebadores para amplificar el ácido nucleico de un individuo por PCR con el fin de determinar la presencia o la ausencia de un alelo variante en el gen NOD2 u otro marcador genético en un método. Por ejemplo, los cebadores de PCR listados en la Tabla 3 (SEC ID nº 25 a nº 32) pueden utilizarse para amplificar regiones específicos del locus NOD2. A modo de ejemplos no limitativos, la región circundante a R702W ("SNP8") puede amplificarse utilizando SEC ID nº 27 y nº 28, G908R ("SNP12") puede amplificarse utilizando las SEC ID nº 29 y nº 30, y la región circundante a 1007fs ("SNP13") puede amplificarse utilizando las SEC ID nº 31 y nº 32. Tal como entenderá el experto en la materia, pueden diseñarse cebadores adicionales para el análisis de PCR basándose en la secuencia flanqueante del sitio o sitios polimórficos de interés en el gen NOD2 u otro marcador genético. A modo de ejemplo no limitativo, un cebador de secuencia puede contener entre aproximadamente 15 y aproximadamente 30 nucleótidos de una secuencia antes o después del sitio polimórfico de interés en el gen NOD2 u otro marcador genético. Dichos cebadores generalmente se diseñan para que presenten un contenido suficiente de guanina y citosina para alcanzar una temperatura de fusión elevada que permita una etapa de hibridación estable en la reacción de amplificación. Se encuentran disponibles varios programas informáticos, tales como Primer Select, para ayudar en el diseño de los cebadores de PCR. Un ensayo de discriminación alélica Taqman® disponible de Applied Biosystems puede resultar útil para el genotipado de un individuo en un sitio polimórfico y para determinar de esta manera la presencia o ausencia de un alelo variante o haplotipo particular en el gen NOD2 u otro marcador genético indicado en la presente memoria. En un ensayo de discriminación alélica Taqman®, se construye una sonda específica marcada con pigmento fluorescente para cada alelo. Las sondas contienen diferentes pigmentos informadores fluorescentes, tales como FAM y VIC, para diferenciar la amplificación de cada alelo. Además, cada sonda presenta un pigmento inhibidor en un extremo que inhibe la fluorescencia mediante transferencia de energía de resonancia fluorescente. Durante la pCR, cada sonda se hibrida específicamente con secuencias complementarias en el ácido nucleico del individuo. La actividad de 5'-nucleasa de la polimerasa Taq se utiliza para cortar únicamente la sonda que se hibrida con el alelo. El corte separa el pigmento informado del pigmento inhibidor, resultando en una fluorescencia incrementada del pigmento informador. De esta manera, la señal de fluorescencia generada mediante la amplificación por PCR indica qué alelos se encuentran presentes en la muestra. Las no correspondencias entre una sonda y un alelo reducen la eficiencia de tanto la hibridación de la sonda como el corte por la polimerasa Taq, resultando en una señal fluorescente reducida o nula. El experto en la materia entenderá que puede conseguirse una especificidad mejorada en los ensayos de discriminación alélica mediante la conjugación de un ligante de surco menor (LSM) de ADN a una sonda de ADN tal como se indica en, por ejemplo, Kutyavin et al., Nuc. Acids Research 28:655-661, 2000. Entre los ligantes de surco menor se incluyen, aunque sin limitarse a ellos, compuestos tales como el tripéptido dihidrociclopirroloindol (DPI3). Las sondas Taqman® ejemplares adecuadas para detectar las variantes alélicas PSN8, PSN12 y PSN13 en el gen NOD2 se indican en la Tabla 4 (SEC ID nº 33 a nº 42). Un análisis de las secuencias también puede resultar útil para el genotipado de un individuo según los métodos descritos en la presente memoria para determinar la presencia o ausencia de un alelo variante o haplotipo particular en el gen NOD2 u otro marcador genético. Tal como es conocido por el experto en la materia, puede detectarse un alelo variante de interés mediante análisis de secuencias utilizando los cebadores apropiados, que se diseñan basándose en la secuencia flanqueante del sitio polimórfico de interés en el gen NOD2 u otro marcador genético. Por ejemplo, puede detectarse un alelo variante de NOD2 mediante análisis de secuencias utilizando los cebadores dados a conocer en la presente memoria, por ejemplo los cebadores de PCR indicados en la Tabla 3 (SEC ID nº 25 a nº 32). Los cebadores de secuencia adicional o alternativa pueden contener entre aproximadamente 15 y aproximadamente 30 nucleótidos de una secuencia que corresponde a una secuencia entre aproximadamente 40 y aproximadamente 400 pares de bases antes o después del sitio polimórfico de interés en el gen NOD2 u otro marcador genético. Dichos cebadores generalmente se diseñan para que presenten un contenido suficiente de guanina y citosina para alcanzar una temperatura de fusión elevada que permita una etapa de hibridación estable en la reacción de secuenciación. La expresión "análisis de secuencias" incluye cualquier procedimiento manual o automatizado mediante el que se determina el orden de los nucleótidos en un ácido nucleico. A título de ejemplo, el análisis de secuencias puede utilizarse para determinar la secuencia de nucleótidos de una muestra de ADN. La expresión análisis de secuencias comprende, sin limitación, algunos métodos químicos y enzimáticos tales como los métodos enzimáticos dideoxi, incluyendo, por ejemplo, la secuenciación de Maxam-Gilbert y de Sanger, así como variaciones de los mismos. La expresión análisis de secuencias comprende además, aunque sin limitación, la secuencia de ADN en matriz capilar, que se basa en la electroforesis capilar y la detección de fluorescencia inducida por láser y puede llevarse a cabo utilizando instrumentos tales como MegaBACE 1000 o ABI 3700. A título de ejemplos no limitativos adicionales, la expresión análisis de secuencias comprende la secuenciación de ciclo térmico (ver Sears et al., Biotechniques 13:626-633, 1992), la secuenciación de fase sólida (ver Zimmerman et al., Methods Mol. Cell Biol. 3:39-42, 1992, y la secuenciación con espectrometría de masas, tal como la espectrometría de masas de desorción/ionización láser asistida por matriz y tiempo de vuelo (ver EM MALDI-TOF; Fu et al., Nature Biotech. 16:381-384 (1998)). La expresión análisis de secuencias incluye además, aunque sin limitación, la secuenciación mediante hibridación (SMH), basada en un abanico de todos los posibles oligonucleótidos cortos con el fin de identificar un segmento de secuencia (ver Chee et al., Science 274:610-614, 1996; Drmanac et al., Science 260:1649-1652, 1993; y Drmanac et al., Nature Biotech. 16:54-58, 1998). El experto en la materia entenderá que dicha variaciones y variaciones adicionales se encuentran comprendidas en la expresión análisis de secuencias tal como se define en la presente memoria.

El análisis electroforético también puede resultar útil para el genotipado de un individuo según los métodos para determinar la presencia o ausencia de un alelo variante o haplotipo particular en el gen NOD2 u otro marcador genético. La expresión "análisis electroforético" tal como se utiliza en la presente memoria en referencia a uno o más ácidos nucleicos, tales como fragmentos amplificados, incluye un procedimiento en el que las moléculas con carga se desplazan a través de un medio estacionario bajo la influencia de un campo eléctrico. La migración electroforética separa los ácidos nucleicos principalmente basándose en su carga, que es proporcional a su tamaño, migrando las moléculas más pequeñas con mayor rapidez. La expresión análisis electroforético incluye, sin limitación, el análisis con electroforesis de placa de gel, tal como electroforesis en gel de agarosa o poliacrilamida, o electroforesis capilar. El análisis mediante electroforesis capilar generalmente se produce en el interior de un capilar de cuarzo de diámetro reducido (50 a 100 µm) en presencia de voltajes de separación elevados (orden de kilovoltios) con tiempos de separación de unos cuantos minutos. Mediante la utilización del análisis de electroforesis capilar se detectan convenientemente ácidos nucleicos mediante absorción de UV o marcaje fluorescente y puede obtenerse una resolución de bases individuales en fragmentos de hasta varios cientos de pares de bases. Dichos métodos de análisis electroforético y variaciones de los mismos son bien conocidos de la técnica, tal como se indica, por ejemplo, en Ausubel et al., Current Protocols in Molecular Biology, capítulo 2 (suplemento 45), John Wiley & Sons, Inc., New York, 1999. El análisis de polimorfismos de longitud de fragmentos de restricción (PLFR) también puede resultar útil para el genotipado de un individuo según los métodos para determinar la presencia o ausencia de un alelo variante o haplotipo particular en el gen NOD2 u otro marcador genético (ver Jarcho et al., en Dracopoliet et al., Current Protocols in Human Genetics, páginas 2.7.1-2.7.5, John Wiley & Sons, New York; Innis et al., ed., PCR Protocols, San Diego Academic Press, Inc., 1990). Tal como se utiliza en la presente memoria, "análisis de polimorfismos de longitud de fragmentos de restricción" incluye cualquier método para distinguir los alelos polimórficos utilizando un enzima de restricción, que es una endonucleasa que cataliza la degradación de los ácidos nucleicos tras el reconocimiento de una secuencia de bases específica, generalmente un palíndromo o repetición invertida. El experto en la materia entenderá que la utilización del análisis de PLFR depende de un enzima que puede diferenciar un alelo variante de un alelo de tipo salvaje u otro alelo en un sitio polimórfico. Además, la hibridación de oligonucleótidos específica de alelo puede resultar útil para el genotipado de un individuo en los métodos descritos en la presente memoria para determinar la presencia o ausencia de un alelo variante o haplotipo particular en el gen NOD2 u otro marcador genético. La hibridación de oligonucleótidos específica de alelo se basa en la utilización de una sonda oligonucleótida marcada que presenta una secuencia perfectamente complementaria, por ejemplo, respecto a la secuencia que comprende el alelo variante. Bajo las condiciones apropiadas, la sonda específica de alelo variante se hibrida con un ácido nucleico que contiene el alelo variante pero que no se hibrida con otro u otros alelos, que presentan una o más no correspondencias de nucleótidos en comparación con la sonda. Si se desea, también puede utilizarse una segunda sonda oligonucleótida específica de alelo que se corresponda con un alelo alternativo (por ejemplo de tipo salvaje). De manera similar, puede utilizarse la técnica de amplificación de oligonucleótidos específica de alelo para amplificar selectivamente, por ejemplo, un alelo variante mediante la utilización de un cebador oligonucleótido específico de alelo que es perfectamente complementario a la secuencia de nucleótidos del alelo variante pero que presenta una o más no correspondencias en comparación con otros alelos (Mullis et al., supra). El experto en la materia entenderá que una o más no correspondencias de nucleótidos que distinguen entre el alelo variante y otros alelos con frecuencia se localizan en el centro de un cebador oligonucleótido específico de alelo que debe utilizarse en la hibridación de oligonucleótidos específica de alelo. En contraste, un cebador oligonucleótido específico de alelo que debe utilizarse en la amplificación por PCR generalmente contiene la no correspondencia o no correspondencias de nucleótidos que distinguen entre el alelo variante y otros alelos en el extremo 3' del cebador. El análisis de movilidad de heterodúplex (EMH) es otro ensayo bien conocido que puede utilizarse para el genotipado en los métodos para determinar la presencia o ausencia de un alelo variante o haplotipo particular en el gen NOD2 u otro marcador genético. El EMH resulta útil para detectar la presencia de un alelo variante ya que un dúplex de ADN que porta una no correspondencia presenta una movilidad reducida en un gel de poliacrilamida en comparación con la movilidad de un dúplex con perfecto apareamiento de las bases (ver Delwart et al., Science 262:1257-1261, 1993; White et al., Genomics 12:301-306, 1992). La técnica de polimorfismos conformacionales de cadena sencilla (PCCS) también puede resultar útil para el genotipado de un individuo según los métodos descritos en la presente memoria para determinar la presencia o ausencia de un alelo variante o haplotipo particular en el gen NOD2 u otro marcador genético (ver Hayashi, Methods Applic. 1:34-38, 1991). Esta técnica se utiliza para detectar alelos variantes basándose en diferencias de la estructura secundaria del ADN de cadena sencilla que producen una movilidad electroforética alterada en la electroforesis en gel no desnaturalizante. Se detectan los alelos variantes mediante la comparación del patrón electroforético del fragmento de ensayo con fragmentos estándares correspondientes que contienen los alelos conocidos. La electroforesis en gel con gradiente desnaturalizante (EGGD) también puede resultar útil en los métodos para determinar la presencia o ausencia de un alelo variante o haplotipo particular en el gen NOD2 u otro marcador genético. En la EGGD, el ADN de doble cadena se somete a electroforesis en un gel que contiene una concentración creciente de desnaturalizante; los fragmentos de doble cadena constituidos por alelos no correspondientes presentan segmentos que se separan más rápidamente, provocando que dichos fragmentos migren de manera diferente a las secuencias perfectamente complementarias (ver Sheffield et al., "Identifying DNA Polymorphisms by Denaturing Gradient Gel Electrophoresis", en: Innis et al., supra, 1990).

Se da a conocer que la presencia o ausencia de uno o más alelos variantes de NO2 (por ejemplo PSN8, PSN12 y/o PSN13) se determina utilizando el ensayo NOD2/CARD15 disponible de Prometheus Laboratories Inc. (San Diego, CA, nº de cat. 6000).

Otros métodos moleculares útiles para el genotipado de un individuo son conocidos de la técnica y resultan útiles en los métodos. Entre dichos enfoques bien conocidos de genotipado se incluyen, aunque sin limitación, la secuenciación automatizada y las técnicas de no correspondencias de ARNasa (ver Winter et al., Proc. Natl. Acad. Sci. 82:7575-7579, 1985). Además, el experto en la materia entenderá que, en el caso de que deba determinarse la presencia o ausencia de múltiples alelos variantes, podrán detectarse alelos variantes individuales mediante cualquier combinación de métodos moleculares. Ver, en general, Birren et al., (editores) Genome Analysis: A Laboratory Manual, volumen 1 (Analyzing DNA), Cold Spring Harbor Laboratory Press, New York, 1997. Además, el experto en la materia entenderá que pueden detectarse múltiples alelos variantes en reacciones individuales o en una única reacción (un ensayo "multiplex").

En vista de lo anteriormente expuesto, el experto en la materia entenderá que los métodos para pronosticar el resultado futuro de la EII y para predecir la probabilidad de respuesta a agentes terapéuticos para la EII, tales como agentes biológicos (por ejemplo mediante la determinación de la presencia o ausencia de uno o más alelos variantes de NOD2) puede ponerse en práctica utilizando uno o cualquier combinación de los bien conocidos ensayos de genotipado indicados anteriormente u otros ensayos conocidos de la técnica.

VIII. Extracción, purificación y enriquecimiento de ARNmi Para los métodos que utilizan ARNmi, se aíslan las células y se lisan para producir un extracto celular; las especies de ARN pequeñas, tales como ARNmi, pueden extraerse, purificarse y/o enriquecerse del extracto celular mediante cualquier técnica conocida. En algunos casos, puede añadirse, mezclarse o incubarse con el lisado o extracto celular una solución alcohólica, previamente a la extracción de los ARNmi. La solución alcohólica puede comprender por lo menos un alcohol y típicamente presenta una concentración de alcohol comprendida en el intervalo de entre aproximadamente 5% y aproximadamente 100%. Se da a conocer que la cantidad de solución de alcohol añadida al lisado le proporciona una concentración alcohólica de entre aproximadamente 35% y aproximadamente 70%, o de entre aproximadamente 50% y aproximadamente 60%. Se da a conocer que la cantidad de solución alcohólica añadida al lisado le proporciona una concentración alcohólica de aproximadamente 55%. Entre los alcoholes adecuados se incluyen, aunque sin limitarse a ellos, etanol, propanol, isopropanol, metanol y mezclas de los mismos. Se contempla además que pueda utilizarse una solución alcohólica en etapas adicionales en métodos para precipitar el ARN. En determinados aspectos, los ARNmi pueden extraerse del lisado o extracto celular con una solución de extracción que comprende un solvente orgánico no alcohólico antes de aplicar el lisado o extracto celular a un soporte sólido. Se da a conocer que la solución de extracción contiene un solvente orgánico no alcohólico, tal como fenol y/o cloroformo. La solución de solvente orgánico no alcohólico se entiende que contiene por lo menos un solvente orgánico no alcóholico, aunque puede contener también un alcohol. Las concentraciones indicadas anteriormente con respecto a las soluciones alcohólicas son aplicables a las concentraciones de soluciones que presentan solventes orgánicos no alcohólicos. En determinados casos se mezclan cantidades iguales del lisado y fenol y/o cloroformo. Se da a conocer que la solución alcohólica se añade al lisado antes de la extracción con un solvente orgánico no alcohólico.

Se da a conocer que la extracción de los ARNmi del lisado o extracto celular incluye utilizar un soporte sólido, tal como un soporte mineral o de polímero. Un "soporte sólido" incluye una estructura física que contiene un material que entra en contacto con el lisado y que no reacciona irreversiblemente con las macromoléculas en el lisado, particularmente con moléculas de ARN pequeñas, tales como ARNmi. Se da a conocer que el soporte sólido se une a moléculas de ARN pequeñas; en casos adicionales, se une a moléculas de ARN pequeñas pero no se une a otro u otros tipos de macromoléculas en la muestra. El material en el soporte sólido puede incluir un mineral o polímero, en cuyo caso el soporte se denomina "soporte mineral o de polímero". Entre los soportes minerales o de polímero se incluyen los soportes que incluyen sílice. Se da a conocer que el sílice es vidrio. Entre los soportes adecuados se incluyen, aunque sin limitación, perlas, columnas y filtros. Se da a conocer que el soporte mineral o de polímero es un filtro o columna de fibra de vidrio (GFF). El soporte mineral o de polímero puede incluir polímeros o no polímeros con grupos electronegativos. En algunos casos, el material comprende poliacrilato, poliestireno, látex, poliacrilonitrilo, cloruro de polivinilo, metacrilato y/o metacrilato de metilo.

Un lisado que puede haberse mezclado o no con una solución alcohólica o de solvente orgánico no alcohólico se aplica a un soporte sólido y se eluye el ARN (que contiene ARNmi) del soporte. Tras aplicar o mezclar un lisado con un soporte sólido, el material puede mezclarse con una solución. Se da a conocer que un soporte mineral o de polímero se lava con una primera solución de lavado tras aplicar el lisado al soporte mineral o de polímero. Se da a conocer que una solución de lavado comprende un agente caotrópico o reductor. El agente caotrópico es guanidinio en algunas soluciones de lavado. Una solución de lavado puede incluir alcohol, y en algunos casos, puede presentar tanto alcohol como guanidinio. Se contempla adicionalmente que la etapa de extracción incluya 1, 2, 3, 4, 5 o más lavados con una solución de lavado. La solución de lavado utilizada en el caso de que se aplique más de un lavado puede ser igual o diferente. Se da a conocer que las soluciones de lavado presentan los mismos componentes, aunque en diferentes concentraciones. Se entiende generalmente que las moléculas que atraviesan el material en un ciclo de lavado son descartadas. Las moléculas de ARN deseadas típicamente se eluyen del soporte sólido. Se da a conocer que las moléculas de ARN pequeñas (por ejemplo ARNmi) son eluidas de un soporte sólido, tal como un soporte mineral o de polímero, a una temperatura de entre aproximadamente 60ºC y aproximadamente 100ºC. La temperatura a la que se eluyen las moléculas de ARN puede ser de aproximadamente o por lo menos entre aproximadamente 5ºC y aproximadamente 100ºC o más, o cualquier intervalo de los mismos. Las moléculas pueden eluirse con cualquier solución de elución. Se da a conocer que la solución de elución es una solución iónica. Se da a conocer que la solución de elución incluye hasta aproximadamente 10 mM de sal (por ejemplo aproximadamente 0,1, 0,5, 1,5, 10 o más mM de sal). Se da a conocer que la sal consiste de una combinación de Li+, Na+, K+ o NH + 4 como el catión y Cl-, Br-, I-, tetraacetato de etilendiamina o citrato como el anión. Entre las etapas adicionales se incluyen pasar las moléculas de ARN pequeñas a través de un filtro de fibra de vidrio (GFF), uniéndose únicamente los ARN de mayor tamaño. Se da a conocer que las moléculas de ARN pequeñas pasadas son capturas en un segundo GFF y después eluídas. El material que no es capturado sobre el segundo filtro GFF puede descartarse o no utilizarse. Se da a conocer que la extracción de los ARNmi se lleva a cabo de la manera siguiente: se añade una solución de extracción a un lisado celular que contiene los ARNmi; se añade una solución alcohólica a la muestra extraída; se aplica la muestra a un soporte mineral o de polímero; y se eluye el ARN que contiene los ARNmi del soporte mineral o de polímero con una solución iónica. Se da a conocer que la muestra eluida está enriquecida por lo menos aproximadamente 10 veces en ARNmi en masa.

A modo de ejemplo no limitativo, la extracción, purificación y enriquecimiento de los ARNmi puede llevarse a cbo siguiendo el protocolo siguiente. Se añaden 60 ml de acetato de Na 2 M, pH 4,0, a un lisdo celular, seguido inmediatamente de 0,6 ml de ácido fenol-cloroformo. En determinados casos, se añade etanol al lisado celular antes de la extracción con fenol-cloroformo a fin de proporcionar una concentración final de aproximadamente 55% de etanol. Tras 30 s de agitación vigorosa, se separa la fase acuosa mediante centrifugación a 16.000xg durante 5 min.

Se utilizan cuatro alícuotas de 100 ml de esta fase acuosa en cuatro separaciones independientes. A las cuatro alícuotas se han añadido 100 ml de etanol al 40%, 50%, 60% y 70%, y después se pasan a través de filtros de fibra de vidrio, tal coo en el procedimiento RNaqueous (Ambion, Inc.; Austin, TX). Las soluciones de etanol al 20%, 25%, 30% y 35% que habían sido pasadas por estos filtros (el eluido) seguidamente se ajustan a 55% de etanol, concentración final, mediante la adición de 156, 133, 111 y 88,9 ml de etanol, respectivamente. Se pasan las cuatro muestras por columnas independientes de filtración de fibra de vidrio. A continuación, se lavan los filtros con 0,7 ml de isocianato de guanidinio 4 M (GuSCN)/etanol al 70%, seguido de dos lavados con 0,5 ml de alcohol al 80%/NaCl 0,1 M/EDTA 4,5 mM/Tris-HCl 10 mM, pH 7,5. Tras pasar cada lavado por el filtro, se vacía y se sustituye el tubo de recolección. Cada lavado se pasa por el filtro mediante centrifugación, de la misma manera que en el protoclo RNAqueous (Ambion, Inc.). A continuación se eluye la muestra separándola del filtro con 100 ml de EDTA 0,1 mM, pH 8,0, que se aplica directamente en el filtro a temperatura ambiente y se centrifuga hasta el interior de un tubo de recolección nuevo.

Se describen métodos adicionales para extraer, purificar y enriquecer ARNmi en, por ejemplo, la publicación de patente US nº 2005/0059024, y en el protocolo del kit de aislamiento de ARNmi mirVanaTM (Ambion, Inc.; Austin, TX).

IX. Análisis estadístico Se dan a conocer métodos, sistemas y código para diagnosticar la EII, para clasificar el diagnóstico de la EII (por ejemplo la EC o la CU), para clasificar el pronóstico de la EII (por ejemplo el riesgo o probabilidad de un pronóstico más grave (por ejemplo la probabilidad de desarrollar complicaciones de enfermedad y/o progresión a cirugía y/o susceptibilidad de desarrollar un subtipo clínico particular de EC o CU)) o para predecir la probabilidad de respuesta a la terapia para EII (por ejemplo la terapia con agentes biológicos). Se da a conocer que se aplica el análisis de cuartiles a la presencia, nivel y/o genotipo de uno o más marcadores de EII determinados mediante cualquiera de los ensayos indicados en la presente memoria para diagnosticar la EII, pronosticar la EII o predecir la respuesta a la terapia de EII. Se da a conocer que se aplica uno o más sistemas clasificadores estadísticos de aprendizaje a la presencia, nivel y/o genotipo de uno o más marcadores de EII determinados mediante cualquiera de los ensayos indicados en la presente memoria para diagnosticar la EII, pronosticar la EII o predecir la respuesta a la terapia de EII. Tal como se indica en la presente memoria, los análisis estadísticos proporcionan ventajosamente una sensibilidad, especificidad, valor predictivo negativo, valor predictivo positivo y/ precisión global mejorados en el diagnóstico de la EII, el pronóstico de la EII y la predicción de respuestas a la terapia de la EII. La expresión "análisis estadístico" o "algoritmo estadístico" o "procedimiento estadístico" incluye cualquiera de entre una diversidad de métodos y modelos estadísticos utilizados para determinar las relaciones entre variables. Se da a conocer que las variables son la presencia, el nivel o el genotipo de por lo menos un marcador de interés. Puede analizarse cualquier número de marcadores utilizando el análisis estadístico descrito en la presente memoria. Por ejemplo, puede incluirse en un análisis estadístico la presencia o el nivel de 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60 o más marcadores individuales. Se da a conocer que se utiliza la regresión logística. Se da a conocer que se utiliza la regresión lineal. Se da a conocer que los análisis estadísticos comprenden una medición de cuartiles de uno o más marcadores, por ejemplo dentro de una población dada, como variable. Los cuartiles se fijan en "puntos de corte" que dividen una muestra de datos en grupos que contienen (en la medida de lo posible) un número igual de observaciones. Por ejemplo, los cuartiles son valores que dividen una muestra de datos en cuatro grupos que contienen (en la medida de lo posible) un número igual de observaciones. El cuartil inferior es el valor de datos un cuarto hacia arriba dentro del conjunto ordenado de datos; el cuartil superior es el valor de datos un cuarto hacia abajo dentro del conjunto ordenado de datos. Los quintiles son valores que dividen una muestra de datos en cinco grupos que contienen (en la medida de lo posible) un número igual de observaciones. El presente método puede incluir además la utilización de intervalos percentiles de niveles de marcadores (por ejemplo terciles, cuartiles, quintiles, etc.) o sus índices acumulativos (por ejemplo sumas de cuartiles de niveles de marcados con el fin de obtener puntuaciones de suma de cuartiles (PSC), etc.) como variables en los análisis estadísticos (exactamente de la misma manera que con variables continuas).

Se da a conocer que el presente método implica la detección o la determinación de la presencia, nivel (por ejemplo magnitud) y/o genotipo de uno o más marcadores de interés utilizando el análisis de cuartiles. En este tipo de análisis estadístico, el nivel de un marcador de interés se define como dentro del primer cuartil (<25%), segundo cuartil (25-50%), tercer cuartil (51%-<75%) o cuarto cuartil (75-100%) en relación a una base de datos de referencia de muestras. A estos cuartiles se les puede asignar una puntuación de cuartil de 1, 2, 3 y 4, respectivamente. En determinados casos, a un marcador que no se detecta en una muestra se le asigna una puntuación de cuartil de 0 o 1, mientras que a un marcador que se detecta (por ejemplo que se encuentra presente) en una muestra (por ejemplo la muestra es positiva para el marcador) se le asigna una puntuación de cuartil de 4. Se da a conocer que el cuartil 1 representa las muestras con los niveles de marcador más bajos, mientras que el cuartil 4 representa la muestras con los niveles de marcador más altos. Se da a conocer que el cuartil 1 representa muestras con un genotipo de marcador particular (por ejemplo alelo de tipo salvaje), mientras que el cuartil 4 representa muestras con otro genotipo de marcador particular (por ejemplo variante alélica). La base de datos de referencia de las muestras puede incluir un gran espectro de pacientes de EII (por ejemplo de EC y/o de CU). A partir de dicha base de datos pueden fijarse valores de corte de cuartiles. Un ejemplo no limitativo de análisis de cuartiles se describe en, por ejemplo, Mow et al., Gastroenterology 126:414-24, 2004. Se da a conocer que los análisis estadísticos comprenden uno o más sistemas clasificadores estadísticos de aprendizaje. Tal como se utiliza en la presente memoria, la expresión "sistema clasificador estadístico de aprendizaje" incluye una máquina que aprende técnica algorítmica que es capaz de adaptar grupos complejos de datos (por ejemplo un panel de marcadores de interés) y de tomar decisiones basándose en dichos grupos de datos. Se da a conocer que se utiliza un único sistema clasificador estadístico de aprendizaje, tal como un árbol de decisión/clasificación (por ejemplo un bosque aleatorio (BA) o un árbol de clasificación y regresión (ACyR)). Se da a conocer que se utiliza una combinación de 2, 3, 4, 5, 6, 7, 8, 9, 10 o mas sistemas clasificadores estadísticos de aprendizaje, preferentemente en tándem. Entre los ejemplos de sistemas clasificadores estadísticos de aprendizaje se incluyen, aunque sin limitarse a ellos, aquellos que utilizan el aprendizaje inductivo (por ejemplo árboles de decisión/clasificación tales como bosques aleatorios, árboles de clasificación y regresión (ACyR), árboles ampliados, etc.), aprendizaje probablemente aproximadamente correcto (PAC), aprendizaje conexionista (por ejemplo redes neuronales (RN), redes neuronales artificiales (RNA), redes neurodifusas (RND), estructuras de redes, perceptrones tales como perceptrones multicapa, redes unidireccionales multicapa, aplicaciones de redes neuronales, aprendizaje bayesiano en redes de creencia, etc.), aprendizaje por refuerzo (por ejemplo aprendizaje pasivo en un entorno conocido, tal como el aprendizaje naive, el aprendizaje dinámico adaptativo y el aprendizaje por diferencia temporal, el aprendizaje pasivo en un entorno desconocido, el aprendizaje activo en un entorno desconocido, las funciones de acción-valor de aprendizaje, las aplicaciones de aprendizaje por refuerzo, etc.), y algoritmos genéticos y la programación evolutiva. Entre otros sistemas clasificadores estadísticos de aprendizaje se incluyen las máquinas de vectores soporte (por ejemplo los métodos de núcleo), las curvas de regresión adaptativa multivariante (MARS, por el inglés Multivariant Adaptative Regression Splines), algoritmos de Levenberg-Marquardt, algoritmos de Gauss- Newton, mezclas de gausianos, algoritmos de descenso de gradiente y cuantización de vector de aprendizaje (CVA). Los bosques aleatorios son sistemas clasificadores estadísticos de aprendizaje que se construyen utilizando un algoritmo desarrollado por Leo Breiman y Adele Cutler. Los bosques aleatorios utilizan un gran número de árboles de decisión individuales y deciden la clase mediante la selección de la moda (es decir, el valor más frecuente) de las clases según se determina mediante los árboles individuales. El análisis de bosques aleatorios puede llevarse a cabo, por ejemplo, utilizando el software RandomForests disponible de Salford Systems (San Diego, CA). Ver, por ejemplo, Breiman, Machine Learning 45:5-32, 2001, y http://stat-www.berkeley.edu/users/breiman/Random- Forests/cc_home.htm, para una descripción de los bosques aleatorios.

Los árboles de clasificación y regresión representan una alternativa de computación intensiva al ajuste de modelos de regresión clásica y se utilizan típicamente para determinar el mejor modelo posible para una respuesta categórica o continua de interés basándose en uno o más factores predictivos. El análisis de árboles de clasificación y regresión puede llevarse a cabo, por ejemplo, utilizando el software ACyR disponible de Salford Systems o el software de análisis de datos Statistica, disponible de StatSoft, Inc. (Tulsa, OK). Se encuentra una descripción de los árboles de clasificación y regresión en, por ejemplo, Breiman et al., "Classification and Regression Trees", Chapman and Hall, New York, 1984; y Steinberg et al., "CART: Tree-Structured Non-Parametric Data Analysis", Salford Systems, San Diego, 1995.

Las redes neuronales son grupos interconectados de neuronas artificiales que utilizan un modelo matemático o computacional para el procesamiento de información basado en un enfoque conexionista a la computación. Típicamente las redes neuronales son sistemas adaptativos que modifican su estructura basándose en información externa o interna que fluye a través de la red. Entre los ejemplos específicos de redes neuronales se incluyen las redes neuronales unidireccionales, tales como perceptrones, perceptrones de una sola capa, perceptrones multicapa, redes de retropropagación, redes ADALINE, redes MADALINE, redes Learnmatrix, redes de función de base radial (FBR) y mapas autoorganizados o redes autoorganizantes de Kohonen; redes neuronales recurrentes, tales como redes recurrentes simples y redes de Hopfield; redes neuronales estocásticas, tales como máquinas de Boltzmann; redes neuronales modulares, tales como conjunto de máquinas y redes neuronales asociativas, y otros tipos de redes, tales como redes neuronales instantáneamente entrenadas, redes neuronales de impulsos, redes neuronales dinámicas y redes neuronales en cascada. Puede llevarse a cabo el análisis de redes neuronales, por ejemplo utilizando el software de análisis de los datos Statistica, de StatSoft, Inc. Ver, por ejemplo, Freeman et al., en: "Neural Networks: Algorithms, Applications and Programming Techniques", Addison-Wesley Publishing Company, 1991; Zadeh, Information and Control, 8:338-353, 1965; Zadeh, "IEEE Trans. on Systems, Man and Cybernetics", 3:28-44, 1973; Gersho et al., en: "Vector Quantization and Signal Compression", Kluywer Academic Publishers, Boston, Dordrecht, London, 1992; y Hassoun, "Fundamentals of Artificial Neural Networks", MIT Press, Cambridge, Massachusetts, London, 1995, para una descripción de redes neuronales. Las máquinas de vectores soporte son un grupo de técnicas de aprendizaje supervisado relacionadas para la clasificación y regresión y se describen, por ejemplo, en Cristianini et al., "An Introduction to Support Vector Machines and Other Kernel-Based Learning Methods", Cambridge University Press, 2000. El análisis de maquinas de vectores soporte puede llevarse a cabo, por ejemplo, utilizando el software SVMlight desarrollado por Thorsten Joachims (Cornell University) o utilizando el software LIBSVM desarrollado por Chih-Chung Chang y Chih-Jen Lin (National Taiwan University).

Los diversos métodos y modelos estadísticos indicados en la presente memoria pueden entrenarse y someterse a ensayo utilizando una cohorte de muestras (por ejemplo muestras séricas y/o genómicas) procedentes de individuos sanos y pacientes de EII (por ejemplo de EC y/o CU). Por ejemplo, las muestras de pacientes diagnosticados por un médico, y preferentemente por un gastroenterólogo, como de EII o un subtipo clínico de la misma utilizando una biopsia, colonoscopia o un inmunoensayo tal como se indica en, por ejemplo, la patente US nº 6.218.129, resultan adecuadas para la utilización en el entrenamiento y ensayo de los métodos y modelos estadísticos. Las muestras de pacientes diagnosticados con EII también pueden estratificarse en enfermedad de Crohn o colitis ulcerosa utilizando un inmunoensayo tal como el descrito en, por ejemplo, las patentes US nº 5.750.355 y nº 5.830.675. Las muestras de individuos sanos pueden incluir aquellos que no han sido identificados como muestras de EII. El experto en la materia conocerá técnicas y criterios diagnósticos adicionales para obtener una cohorte de muestras de pacientes que pueden utilizarse en el entrenamiento y ensayo de los métodos y modelos estadísticos.

Tal como se utiliza en la presente memoria, el término "sensibilidad" se refiere a la probabilidad de un método, sistema o código diagnóstico, pronóstico o predictivo proporcione un resultado positivo en el caso de que la muestra sea positiva, por ejemplo que presenta el diagnóstico predicho, el resultado pronóstico o la respuesta a la terapia de EII. La sensibilidad se calcula como el número de resultados positivos verdaderos dividido por la suma de los positivos verdaderos y los falsos negativos. La sensibilidad esencialmente es una medida de lo bien que el presente método identifica correctamente aquellos que presentan el diagnóstico, resultado pronóstico o respuesta a terapia de la EII predichos separándolos de aquellos que no presentan el diagnóstico, pronóstico o respuesta terapéutica predichos. Los métodos y modelos estadísticos pueden seleccionarse de manera que la sensibilidad sea de por lo menos aproximadamente 60%, y puede ser, por ejemplo, de por lo menos aproximadamente 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% o 99%. El término "especificidad" se refiere a la probabilidad de un método, sistema o código diagnóstico, pronóstico o predictivo proporcione un resultado negativo en el caso de que la muestra no sea positiva, por ejemplo que no presenta el diagnóstico, resultado pronóstico o respuesta a la terapia de EII predichos. La especificidad se calcula como el número de resultados negativos verdaderos dividido por la suma de los negativos verdaderos y los falsos positivos. La especificidad esencialmente es una medida de lo bien que el presente método excluye aquellos que no presentan el diagnóstico, resultado pronóstico o respuesta a terapia de la EII predichos separándolos de aquellos que sí presentan el diagnóstico, pronóstico o respuesta terapéutica predichos. Los métodos y modelos estadísticos pueden seleccionarse de manera que la especificidad sea de por lo menos aproximadamente 60%, y puede ser, por ejemplo, de por lo menos aproximadamente 65%, 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% o 99%. Tal como se utiliza en la presente memoria, la expresión "valor predictivo negativo" o "VPN" se refiere a la probabilidad de que un individuo identificado como que no presenta el diagnóstico, resultado pronóstico o respuesta a la terapia de la EII predichos realmente no presente el diagnóstico, pronóstico o respuesta terapéutica predicho. El valor predictivo negativo puede calcularse como el número de negativos verdaderos dividido por la suma de los negativos verdaderos y los falsos negativos. El valor predictivo negativo se determina a partir de las características del método, sistema o código diagnóstico o pronóstico, así como la prevalencia de la enfermedad en la población analizada. Los métodos y modelos estadísticos pueden seleccionarse de manera que el valor predictivo negativo en una población que presenta una prevalencia de enfermedad se encuentre comprendida en el intervalo de entre aproximadamente 70% y aproximadamente 99% y puede ser de, por ejemplo, por lo menos aproximadamente 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% o 99%.

La expresión "valor predictivo positivo" o "VPP" se refiere a la probabilidad de que un individuo identificado como que no presenta el diagnóstico, resultado pronóstico o respuesta a la terapia de la EII predichos realmente no presente el diagnóstico, pronóstico o respuesta terapéutica predicho. El valor predictivo positivo puede calcularse como el número de positivos verdaderos dividido por la suma de los positivos verdaderos y los falsos positivos. El valor predictivo positivo se determina a partir de las características del método, sistema o código diagnóstico o pronóstico, así como la prevalencia de la enfermedad en la población analizada. Los métodos y modelos estadísticos pueden seleccionarse de manera que el valor predictivo positivo en una población que presenta una prevalencia de enfermedad se encuentre comprendida en el intervalo de entre aproximadamente 70% y aproximadamente 99% y puede ser de, por ejemplo, por lo menos aproximadamente 70%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% o 99%. Los valores predictivos, incluyendo los valores predictivos negativos y positivos, se ven influidos por la prevalencia de la enfermedad en la población analizada. Los métodos y modelos estadísticos pueden seleccionarse para producir un parámetro clínico deseado para una población clínica con una prevalencia de EII particular. Por ejemplo, los métodos y modelos estadísticos pueden seleccionarse para una prevalencia de EII de hasta aproximadamente 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% o 70%, que puede observarse, por ejemplo, en la consulta médica, tal como la consulta del gastroenterólogo o la consulta de un médico generalista.

Tal como se utiliza en la presente memoria, la expresión "concordancia global" o "exactitud global" se refiere a la exactitud con la que un método, sistema o código diagnostica la EII, pronostica la EII o predice la respuesta a una terapia de EII particular. La exactitud global se calcula como la suma de los positivos verdaderos y los negativos verdaderos dividido por el número total de resultados de muestra y se ve afectada por la prevalencia de la enfermedad en la población analizada. Por ejemplo, los métodos y modelos estadísticos pueden seleccionarse de manera que la exactitud global en una población de pacientes que presenta una prevalencia de enfermedad sea de por lo menos aproximadamente 40%, y puede ser, por ejemplo, de por lo menos aproximadamente 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% o 99%.

X. Sistema de clasificación de enfermedades La figura 3 ilustra un sistema de clasificación de enfermedades (SCE) (300). Tal como se muestra en el mismo, un SCE incluye un modelo de inteligencia de SCE (305), tal como un ordenador, que presenta un procesador (315) y un módulo de memoria (310). El módulo de inteligencia incluye además módulos de comunicación (no mostrados) para transmitir y recibir información en una o más conexiones directas (por ejemplo USB, Firewire u otra interfaz) y una o más conexiones de red (por ejemplo incluyendo un módem u otro dispositivo de interfaz de red). El módulo de memoria puede incluir dispositivos de memoria internos y uno o más dispositivos de memoria externos. El módulo de inteligencia incluye además un módulo de visualización (325), tal como un monitor o impresora. En un aspecto, el módulo de inteligencia recibe datos, tales como los resultados de ensayo del paciente desde un módulo de adquisición de datos, tal como un sistema de ensayo (350), mediante una conexión directa o a través de una red (340). Por ejemplo, el sistema de ensayo puede configurarse para realizar ensayos multianalito en una o más muestras de pacientes (355) y proporcionar automáticamente los resultados de ensayo al módulo de inteligencia. Los datos también pueden proporcionarse al módulo de inteligencia mediante entrada directa por parte del usuario o pueden descargarse de un medio portátil, tal como un disco compacto (CD) o un disco versátil digital (DVD). El sistema de ensayo puede integrarse en el módulo de inteligencia, acoplado directamente al módulo de inteligencia, o puede acoplarse remotamente con el módulo de inteligencia a través de la red. El módulo de inteligencia también puede comunicar datos hacia y desde uno o más sistemas cliente (330) a través de la red, tal como es bien conocido. Por ejemplo, un médico o profesional sanitario peticionario puede obtener y visionar un informe del módulo de inteligencia, que puede ser residente en un laboratorio u hospital, utilizando un sistema cliente (330).

La red puede ser una red LAN (red de área local), WAN (red de área amplia), red inalámbrica, red punto a punto, red en estrella, red en anillo, red de nodos u otra configuración. Debido a que el tipo más común de red en uso actualmente es una red TCP/IP (por el inglés Transfer Control Protocol and Internet Protocol, o protocolo de control de transferencia y protocolo de internet), tal como la red global de redes con frecuencia denominada "Internet", con una "I" mayúscula que será utilizada en muchos de los ejemplos en la presente memoria, pero debe entenderse que las redes no se encuentran limitadas de esta manera, aunque TCP/IP es actualmente el protocolo preferido. Entre varios elementos en el sistema mostrado en la figura 3 pueden incluirse elementos bien conocidos convencionales que no requieren mayor explicación en la presente memoria. Por ejemplo, el módulo de inteligencia podría implementarse como un ordenador personal de sobremesa, una estación de trabajo, ordenador central, ordenador portátil, etc. Cada sistema cliente podría incluir un ordenador personal de sobremesa, estación de trabajo, ordenador portátil, PDA, teléfono móvil o cualquier dispositivo con la función WAP o cualquier otro dispositivo de computación capaz de establecer una interfaz directa o indirectamente con Internet u otra conexión de red. Un sistema cliente típicamente opera un cliente HTTP, por ejemplo un programa de búsqueda, tal como un buscador Internet ExplorerTM de Microsoft, un buscador Netscape NavigatorTM, buscador Opera o un buscador con WAP en el caso de un móvil, PDA u otro dispositivo inalámbrico, o similar, permitiendo al usuario del sistema cliente el acceso, procesamiento y visionado de información y páginas disponibles desde el módulo de inteligencia a través de la red. CAda sistema cliente típicamente incluye además uno o más dispositivos de interfaz de usuario, tales como teclado, un ratón, pantalla táctil, lápiz o similar, para interactuar con una interfaz gráfica de usuario (IGU) proporcionada por el buscador en una pantalla (por ejemplo monitor, pantalla LCD, etc.) (335) conjuntamente con páginas, formularios y otra información proporcionada por el módulo de inteligencia. Tal como se ha comentado anteriormente, el presente método resulta adecuado para la utilización en Internet, que se refiere a una red global específica de redes. Sin embargo, debe entenderse que pueden utilizarse otras redes en lugar de Internet, tal como una intranet, una extranet, una red privada virtual (VPN, por el inglés Virtual Private Network), una red no basada en TCP/IP, cualquier LAN o WAN, o similar. Se da a conocer que cada sistema cliente y todos sus componentes son configurables por el operador utilizand aplicaciones tales como un buscador, incluyendo código informático operado utilizando una unidad central de procesamiento, tal como un procesador Intel® Pentium® o similar. De manera similar, el módulo de inteligencia y todos sus componentes pueden ser configurables por el operador utilizando una o más aplicaciones, incluyendo código informático operado utilizando una unidad central de procesamiento (315), tal como un procesador Intel Pentium o similar, o múltiples unidades de procesamiento. El código informático para operar y configurar el módulo de inteligencia para el procesamiento de los datos y resultados de ensayo tal como se indica en la presente memoria preferentemente se descarga y se almacena en un disco duro, aunque el código informático entero, o partes del mismo, también pueden almacenarse en cualquier otro medio o dispositivo de memoria volátil o no volátil, tal como es bien conocido, tal como un medio ROM o RAM, o proporcionado en cualquier otro medio legible por ordenador (160) capaz de almacenar código informático, tal como un medio disco compacto (CD), medio disco versátil digital (DVD), un disquete, ROM, RAM y similar.

El código informático para implementar diversos aspectos del presente método puede implementarse en cualquier lenguaje de programación que puede ejecutarse en un sistema informático, tal como, por ejemplo, en lenguaje C, C++, C#, HTML, Java, JavaScript, o cualquier otro lenguaje de secuencia de comandos, tal como VBScript. Además, el código informático entero, o partes del mismo, pueden realizarse en forma de una señal portadora, que puede transmitirse y descargarse de una fuente de software (por ejemplo un servidor) por Internet, o cualquier otra conexión de red convencional, tal como es bien conocido (por ejemplo extranet, VPN, LAN, etc.) utilizando cualquier medio y protocolos de comunicación (por ejemplo TCP/IP, HTTP, HTTPS, Ethernet, etc.), tal como se conoce bien.

Se da a conocer que el módulo de inteligencia implementa un procedimiento de clasificación de enfermedades para analizar los resultados de ensayo de pacientes con el fin de determinar un diagnóstico de la EII o el pronóstico de la EII (por ejemplo el riesgo o probabilidad de un pronóstico más grave (por ejemplo la probabilidad de desarrollar complicaciones de la enfermedad y/o progresión a cirugía y/o la susceptibilidad de desarrollar un subtipo clínico particular de EC o CU)). Se da a conocer que el módulo de inteligencia implementa un procedimiento de clasificación de las enfermedades para analizar los resultados de ensayo de los pacientes con el fin de predecir la probabilidad de respuesta a la terapia de la EII con uno o más agentes terapéuticos (por ejemplo la terapia con agentes biológicos). Los datos pueden almacenarse en una o más tablas de datos u otras estructuras de datos lógicas en la memoria (310) o en un sistema independiente de almacenamiento o de base de datos acoplado al módulo de inteligencia. Típicamente se aplica uno o más análisis o procedimientos estadísticos a un conjunto de datos, incluyendo datos de ensayos para un paciente particular. Por ejemplo, los datos de ensayo podrían incluir un perfil de marcadores diagnósticos o pronósticos, que comprenda datos que indiquen la presencia, nivel y/o genotipo de por lo menos un marcador en una muestra del paciente. Se da a conocer que un análisis estadístico, tal como un análisis de cuantiles (por ejemplo cuartiles) se aplica a los datos de ensayo para un paciente particular, en el que los datos de ensayo comprenden la presencia, nivel y/o genotipo de por lo menos un marcador determinado en una muestra del paciente. La decisión o decisiones derivadas estadísticamente pueden visionarse en un dispositivo de visualización asociado o acoplado al módulo de inteligencia, o la decisión o decisiones pueden proporcionarse y visionarse en un sistema independiente, por ejemplo un sistema cliente (330). La decisión o decisiones derivadas estadísticamente pueden visionarse en forma de un informe o impresión, que opcionalmente puede incluir una tabla de consulta, diagrama, gráfico o modelo que permite que el médico compare e interprete los resultados visualizados a fin de realizar un diagnóstico, pronóstico o predicción de la respuesta terapéutica razonado de la EII. XI. Terapia y seguimiento terapéutico Tras la clasificación del diagnóstico o pronóstico de la EII o tras la predicción de la probabilidad de respuesta a un agente terapéutico de la EII en un individuo diagnosticado de EII según los métodos descritos en la presente memoria, el presente método puede comprender además la recomendación de un curso de terapia basado en la clasificación o predicción. Se da a conocer que el presente método puede comprender además la administración en el individuo de una cantidad terapéuticamente eficaz de un agente terapéutico de la EII que resulta útil para tratar uno o más síntomas asociados a la EII, EC, CU o subtipos clínicos de EC o CU. Para aplicaciones terapéuticas, el agente terapéutico de la EII puede administrarse solo o coadministrarse en combinación con uno o más agentes terapéuticos de la EII adicionales y/o uno o más fármacos que reducen los efectos secundarios asociados al agente terapéutico para la EII. Entre los ejemplos de agentes terapéuticos de la EII se incluyen, aunque sin limitación, agentes biológicos, fármacos convencionales y combinaciones de los mismos. De esta manera, el presente método permite ventajosamente que un médico clínico ponga en práctica una "medicina personalizada" mediante el guiado de las decisiones de tratamiento y que informe la selección de terapia para la EII de manera que se administre el fármaco correcto al paciente correcto en el momento correcto.

Los agentes terapéuticos para la EII pueden administrarse con un excipiente farmacéutico adecuado según resulte necesario y la administración puede llevarse a cabo mediante cualquiera de los modos de administración aceptados. De esta manera, la administración puede ser, por ejemplo, intravenosa, tópica, subcutánea, transcutánea, transdérmica, intramuscular, oral, bucal, sublingual, gingival, palatal, intraarticular, parenteral, intraarteriolar, intradérmica, intraventricular, intracraneal, intraperitoneal, intralesional, intranasal, rectal, vaginal o mediante inhalación. El término "coadministrar" se refiere a que un agente terapéutico para la EII se administra simultáneamente, justo antes o justo después de la administración de un segundo fármaco (por ejemplo otro agente terapéutico para la EII, un fármaco útil para reducir los efectos secundarios del agente terapéutico para la EII, etc.). Una cantidad terapéuticamente eficaz de un agente terapéutico para la EII puede administrarse repetidamente, por ejemplo por lo menos 2, 3, 4, 5, 6, 7, 8 ó más veces, o la dosis puede administrarse mediante infusión continua. La dosis puede adoptar la forma de sólido, semisólido, polvos liofilizados o formas de dosificación líquida tales como, por ejemplo, tabletas, píldoras, pellets, cápsulas, polvos, soluciones, suspensiones, emulsiones, supositorios, enemas de retención, cremas, pomadas, lociones, geles, aerosoles, espumas o similares, preferentemente en formas de dosificación unitaria adecuadas para la administración simple de dosis exactas.

Tal como se utiliza en la presente memoria, la expresión "forma de dosificación unitaria" se refiere a unidades físicamente discretas que resultan adecuadas como dosis unitarias para sujetos humanos y otros mamíferos, conteniendo cada unidad una cantidad predeterminada de un agente terapéutico para la EII calculada para producir el inicio, tolerabilidad y/o efectos terapéuticos deseados, asociada a un excipiente farmacéutico adecuado (por ejemplo una ampolla). Además, pueden prepararse formas de dosificación concentrada a partir de la que pueden producirse las formas de dosificación unitaria más diluidas. De esta manera, las formas de dosificación más concentradas contendrán sustancialmente más de, por ejemplo, por lo menos 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ó más veces la cantidad del agente terapéutico para la EII.

Los métodos para preparar dichas formas de dosificación son conocidos por el experto en la materia (ver, por ejemplo, REMINGTON'S PHARMACEUTICAL SCIENCES, 18a edición, Mack Publishing Co., Easton, PA, 1990).

Entre las formas de dosificación típicamente se incluyen un portador o excipiente farmacéutico convencional y adicionalmente puede incluir otros agentes medicinales, portadores, adyuvantes, diluyentes, intensificadores de la permeación en tejidos, solubilizadores y similares. Pueden adaptarse excipientes apropiados a la forma de dosificación particular y a la vía de administración mediante métodos bien conocidos de la técnica (ver, por ejemplo, REMINGTON'S PHARMACEUTICAL SCIENCES, supra). Entre los ejemplos de excipientes adecuados se incluyen, aunque sin limitarse a ellos, lactosa, dextrosa, sacarosa, sorbitol, manitol, almidones, goma acacia, fosfato de calcio, alginatos, tragacanto, gelatina, silicato de calcio, celulosa microcristalina, polivinilpirrolidona, celulosa, agua, solución salina, jarabe, metilcelulosa, etilcelulosa, hidroxipropilmetilcelulosa y ácidos poliacrílicos, tales como carbopoles, por ejemplo Carbopol 941, Carbopol 980, Carbopol 981, etc. Entre las formas de dosificación pueden incluirse adicionalmente agentes lubricantes tales como talco, estearato de magnesio y aceite mineral; agentes humectantes; agentes emulsionantes; agentes de suspensión; agentes conservantes tales como metilhidroxibenzoatos, etilhidroxibenzoatos y propilhidroxibenzoatos (es decir, los parabenos); agentes de ajuste del pH tales como ácidos y bases inorgánicos y orgánicos; agentes edulcorantes y agentes saborizantes. Las formas de dosificación pueden comprender además perlas de polímero biodegradable, dextrano y complejos de inclusión con ciclodextrina. Para la administración oral, la dosis terapéuticamente eficaz puede encontrarse en forma de tabletas, cápsulas, emulsiones, suspensiones, soluciones, jarabes, sprays, pastillas, polvos y formulaciones de liberación sostenida.

Entre los excipientes adecuados para la administración oral se incluyen grados farmacéuticos de manitol, lactosa, almidón, estearato de magnesio, sacarina sódica, talco, celulosa, glucosa, gelatina, sacarosa, carbonato de magnesio y similares. Se da a conocer que la dosis terapéuticamente eficaz adopta la forma de una píldora, tableta o cápsula, y de esta manera, la forma de dosificación puede contener, conjuntamente con un agente terapéutico para la EII, cualquiera de los siguientes: un diluyente tal como lactosa, sacarosa, fosfato dicálcico y similares; un desintegrante tal como almidón o derivados del mismo; un lubricante tal como estearato de magnesio y similares; y un ligante tal como almidón, goma acacia, polivinilpirrolidona, gelatina, celulosa y derivados de los mismos. También puede formularse un agente terapéutico para la EII en forma de supositorio dispuesto, por ejemplo, en un portador de polietilenglicol (PEG). Las formas de dosificación líquidas pueden prepararse mediante disolución o dispersión de un agente terapéutico para la EII y opcionalmente uno o más adyuvantes farmacéuticamente aceptables en un portador tal como, por ejemplo, solución salina acuosa (por ejemplo cloruro sódico al 0,9% p/v), dextrosa acuosa, glicerol, etanol y similares, para formar una solución o supsensión, por ejemplo, para la administración oral, tópica o intravenosa. También puede formularse un agente terapéutico para la EII en un enema de retención. Para la administración tópica, la dosis terapéuticamente eficaz puede encontrarse en forma de emulsiones, lociones, geles, espumas, cremas, gelatinas, soluciones, suspensiones, pomadas y parches transdérmicos. Para la administración mediante inhalación, puede administrarse un agente terapéutico para la EII en forma de polvos secos o en forma líquida mediante un nebulizador. Para la administración parenteral, la dosis terapéuticamente efectiva puede encontrarse en forma de soluciones inyectables estériles y de polvos empaquetados estériles. Preferentemente, las soluciones inyectables se formulan a un pH de entre aproximadamente 4,5 y aproximadamente 7,5.

La dosis terapéuticamente eficaz también puede proporcionarse en una forma liofilizada. Entre dichas formas de dosificación pueden incluirse un tampón, por ejemplo bicarbonato, para la reconstitución antes de la administración, o el tampón puede incluirse en la forma de dosificación liofilizada, para la reconstitución con, por ejemplo, agua. La forma de dosificación liofilizada puede comprender además un vasoconstrictor adecuado, por ejemplo epinefrina. La forma de dosificación liofilizada puede proporcionarse en una jeringa, opcionalmente empaquetada en combinación con el tampón para la reconstitución, de manera que la forma de dosificación reconstituida pueda administrarse inmediatamente en un sujeto. Durante el uso terapéutico para el tratamiento de la EII o un subtipo clínico de la misma, puede administrarse un agente terapéutico de la EII a la dosis inicial de entre aproximadamente 0,001 mg/kg y aproximadamente 1.000 mg/kg diarios. Puede utilizarse un intervalo de dosis diarias de entre aproximadamente 0,01 mg/kg y aproximadamente 500 mg/kg, de entre aproximadamente 0,1 mg/kg y aproximadamente 200 mg/kg, de entre aproximadamente 1 mg/kg y aproximadamente 100 mg/kg, o de entre aproximadamente 10 mg/kg y aproximadamente 50 mg/kg. Sin embargo, las dosis pueden modificarse dependiendo de los requisitos del individuo, la gravedad de los síntomas de la EII, y el agente terapéutico de la EII que se está utilizando. Por ejemplo, las dosis pueden determinarse empíricamente considerando el tipo y gravedad de los síntomas de la EII en un individuo clasificado como paciente de un subtipo clínico particular de EC o CU según los métodos descritos en la presente memoria. La dosis administrada en el individuo debería ser suficiente para dar lugar a una respuesta terapéutica beneficiosa en el individuo durante el tiempo. El tamaño de la dosis también puede determinarse a partir de la existencia, naturaleza y extensión de cualesquiera efectos secundarios adversos que acompañan a la administración de un agente terapéutico particular de la EII en un individuo. La determinación de la dosis correcta para una situación particular se encuentra dentro de los conocimientos del profesional. Generalmente el tratamiento se inicia con dosis más pequeñas que son inferiores a la dosis óptima del agente terapéutico de la EII. A continuación, se incrementa la dosis en incrementos pequeños hasta alcanzar el efecto óptimo bajo las circunstancias. Por comodidad la dosis diaria total puede dividirse y administrarse en partes durante el día, si se desea.

Tal como se utiliza en la presente memoria, la expresión "agente terapéutico para la EII" incluye todas las formas farmacéuticamente aceptables de un fármaco que resulta útil para tratar uno o más síntomas asociados a la EII. Por ejemplo, el agente terapéutico de la EII puede encontrarse en una mezcla racémica o isomérica, un complejo sólido unido a una resina de intercambio iónico, o similar. Además, el agente terapéutico de la EII puede encontrarse en una forma solvatada. El término también pretende incluir todas las sales, derivados y análogos farmacéuticamente aceptables del agente terapéutico para la EII que se describe, así como las combinaciones de los mismos. Por ejemplo, entre las sales farmacéuticamente aceptables de un agente terapéutico para la EII se incluyen, aunque sin limitarse a ellos, las formas salinas tartrato, succinato, tartarato, bitartarato, dihidrocloruro, salicilato, hemisuccinato, citrato, maleato, hidrocloruro, carbamato, sulfato, nitrato y benzoato, así como las combinaciones de los mismos y similares. Cualquier forma de un agente terapéutico para la EII resulta adecuado para la utilización en los métodos, por ejemplo una sal farmacéuticamente aceptable de un agente terapéutico para la EII, una base libre de un agente terapéutico para la EII o una mezcla de los mismos. Entre los ejemplos de agentes terapéuticos de la EII adecuados se incluyen, aunque sin limitación, agentes biológicos, fármacos convencionales y combinaciones de los mismos.

Entre los agentes biológicos se incluyen, por ejemplo, anticuerpos anticitoquina y de quimoquina, tales como anticuerpos anti-factor alfa de necrosis tumoral (FNTα). Entre los ejemplos no limitativos de anticuerpos anti-FNTα se incluyen: anticuerpos monoclonales quiméricos, tales como infliximab (Remicade®) (Centocor, Inc.; Horsham, PA), que es un anticuerpo monoclonal quimérico IgG1 anti-FNTα; anticuerpos monoclonales humanizados, tales como CDP571 y CDP870 PEGilado; anticuerpos monoclonales totalmente humanos, tales como adalimumab (Humira®) (Abbott Laboratories; Abbott Park, IL); proteínas de fusión p75, tales como etanercept (Enbrel®) (Amgen; Thousand Oaks, CA; Wyeth Pharmaceuticals Inc.; Collegeville, PA), moléculas pequeñas (por ejemplo, inhibidores de quinasa MAP), y combinaciones de los mismos. Ver Ghosh, Novartis Found Symp., 263:193-205, 2004. Entre otros agentes biológicos se incluyen, por ejemplo, anticuerpos antiadhesión celular, tales como natalizumab (Tysabri®) (Elan Pharmaceuticals, Inc.; Dublin, Irlanda; Biogen Idec; Cambridge, MA), que es un anticuerpo monoclonal humanizado contra la molécula de adhesión celular α4-integrina y MLN-02 (Millennium Pharmaceuticals; Cambridge, MA), que es un anticuerpo monoclonal humanizado IgG1 anti-integrina α4β7; agentes anti-células T; anticuerpos anti-CD3, tales como visilizumab (Nuvion®) (PDL BioPharma; Incline Village, NV), que es un anticuerpo monoclonal humanizado IgG2M3 anti-CD3; anticuerpos anti-CD4, tales como priliximab (cM-T412) (Centocor, Inc.; Horsham, PA), que es un anticuerpo monoclonal anti-CD4; anticuerpos anti-IL-2 receptor alfa (CD25), tales como daclizumab Zenapax®) (PDL BioPharma; Incline Village, NV; Roche; Nutley, NJ), que es un anticuerpo monoclonal humanizado IgG1 anti-CD25 y basiliximab (Simulect®) (Novartis; Basel, Suiza), que es un anticuerpo monoclonal quimérico IgG1 anti-CD25, y combinaciones de los mismos.

Además de los agentes biológicos anteriormente indicados, los miR de la Tabla 2 o un inhibidor de los miR de la Tabla 2 resultan útiles. De esta manera, el presente método proporciona tratamiento o prevención de la EII mediante la introducción o provisión para el paciente que presenta EII de una cantidad eficaz de i) una molécula inhibidora de ARNmi, o ii) una molécula de ARNmi que corresponde a una secuencia de ARNmi indicada en la Tabla 2.

Una formulación útil para la adminitración de los miR son los liposomas. Los liposomas y emulsiones son ejemplos bien conocidos de vehículos de administración que pueden utilizarse para administrar los ácidos nucleicos. Un ácido nucleico puede administrarse en combinación con un portador o lípido para incrementar la incorporación celular. Por ejemplo, el oligonucleótido puede administrarse en combinación con un lípido catiónico. Entre los ejemplos de lípidos catiónicos se incluyen, aunque sin limitación, lipofectina, DOTMA, DOPE y DOTAP. La publicación nº WO00/71096 describe diferentes formulaciones, tales como una formulación de DOTAP:colesterol o de un derivado de colesterol que puede utilizarse eficazmente para la terapia génica. Otras exposiciones comentan también diferents formulaciones de lípidos o liposomas, incluyendo nanopartículas, y métodos de administración; entre ellos se incluyen, aunque sin limitación, las publicaciones de patente US nº 2003/0203865, nº 2002/0150626, nº 2003/0032615 y nº 2004/0048787. Los métodos utilizados para formar partículas también se dan a conocer en las patentes US nº 5.844.107, nº 5.877.302, nº 6.008.336, nº 6.077.835, nº 5.972.901, nº 6.200.801 y nº 5.972.900. Los ácidos nucleicos también pueden administrarse en combinación con una amina catiónica tal como poli(L-lisina). Entre los ejemplos de fármacos convencionales se incluyen, aunque sin limitación, aminosalicilatos (por ejemplo mesalazina, sulfasalazina y similares), corticoesteroides (por ejemplo prednisona), tiopurinas (por ejemplo azatioprina, 6-mercaptopurina y similares), metotrexato, bases libres de los mismos, sales farmacéuticamente aceptables de los mismos, derivados de los mismos, análogos de los mismos y combinaciones de los mismos. El experto en la materia conocerá agentes terapéuticos para la EII adicionales adecuados para la utilización en el presente método (ver, por ejemplo, Sands, Surg. Clin. North Am. 86:1045-1064, 2006; Danese et al., Mini Rev. Med.

Chem. 6:771-784, 2006; Domenech, Digestion 73(Supl.1):67-76, 2006; Nakamura et al., World J. Gastroenterol. 12:4628-4635, 2006; y Gionchetti et al., World J. Gastroenterol. 12:3306-3313, 2006).

También puede realizarse un seguimiento de un individuo a intervalos de tiempo periódicos con el fin de evaluar la eficacia de un determinado régimen terapéutico tras obtener información diagnóstica, pronóstica y/o predictiva de la muestra del individuo. Por ejemplo, la presencia o nivel de determinados marcadores puede cambiar según el efecto terapéutico de un tratamiento, tal como un fármaco. Puede realizarse un seguimiento del paciente con el fin de evaluar la respuesta y comprender los efectos de determinados fármacos o tratamientos en un enfoque personalizado. Además, algunos pacientes pueden no responder a un fármaco, aunque los marcadores pueden cambiar, lo que sugiere que estos pacientes pertenecen a una población especial (no sensible) que puede identificarse a partir de sus niveles de marcadores. Estos pacientes pueden interrumpir su terapia actual y prescribirse tratamientos alternativos. También puede realizarse un seguimiento del individuo a intervalos de tiempo periódicos con el fin de evaluar las concentraciones o niveles de diversos marcadores. Los niveles de marcadores en diversos puntos temporales, así como la tasa de cambio de los niveles de marcadores durante el tiempo, son significativos. En determinados casos, la tasa de incremento de uno o más marcadores en un individuo sobre un nivel umbral indica que el individuo presenta un riesgo significativamente superior de desarrollar complicaciones o riesgo de someterse a cirugía. La información obtenida del ensayo en serie en forma de un marcador velocidad (es decir, el cambio del nivel de marcador durante un periodo de tiempo) está significativamente asociada a la gravedad de la enfermedad, el riesgo de complicaciones de la enfermedad y el riesgo de someterse a un tratamiento quirúrgico.

En determinados casos, se calcula la velocidad de por lo menos un marcador, por lo menos dos marcadores, por lo menos tres marcadores, por lo menos cuatro marcadores, por lo menos cinco marcadores, por lo menos seis marcadores, por lo menos siete marcadores, etc., o el agregado de velocidad de marcador, y se prepara un análisis para proporcionar un pronóstico. En determinados casos se utiliza la velocidad agregada de los marcadores para evaluar la progresión de la enfermedad. Puede dibujarse un gráfico de puntuación de suma de cuartiles (PSC) (por ejemplo 6 marcadores) durante el tiempo. Un cuartil es cualquiera de las cuatro categorías que dividen el grupo de datos en cuatro partes iguales, de manera que cada parte representa un cuarto de la población muestreada. Para cada marcador resulta posible presentar un valor de 0 a 4 o de 1 a 4 (por ejemplo cero o 1 en el caso de no hallarse presente el marcador). Para seis marcadores, puede calcularse la puntuación de suma de cuartiles puede ser de 0 a 24 o de 6 a 24. La puntuación de suma de cuartiles durante varios años (por ejemplo 2 a 80) de la velocidad agregada de los marcadores en varios individuos con enfermedad de Crohn. En otros aspectos los marcadores individuales y sus velocidades también son significativos.

En un caso, la velocidad de determinados marcadores tal como se indica en la presente memoria se pondera según el agregado de velocidad de marcador. En otras palabras, la velocidad de determinados marcadores es más significativa en el análisis o en el pronóstico de determinadas complicaciones. Estos marcadores significativos reciben más peso ya que sus velocidades son más significativas en la velocidad agregada.

En todavía otro aspecto, una vez el individuo se encuentra en un régimen terapéutico, se realiza un seguimiento durante el tiempo de las velocidades y/o niveles de los marcadores iniciales y/o el agregado de marcadores. A medida que dichas velocidades y/o niveles se reducen durante el tiempo, se consigue información con respecto a la eficacia de las terapias. Tras obtener información pronóstica y/o predictiva de la muestra individual, puede obtenerse el efecto del régimen terapéutico mediante el seguimiento de los marcadores. Por ejemplo, la presencia o nivel y/o velocidad de determinado marcador o marcadores puede cambiar según el efecto terapéutico de un tratamiento, tal como un fármaco. Puede realizarse un seguimiento del paciente con el fin de evaluar la respuesta y comprender los efectos de determinados fármacos o tratamientos en un enfoque personalizado. Además, algunos pacientes pueden no responder a un fármaco, aunque los marcadores pueden cambiar, lo que sugiere que estos pacientes pertenecen a una población especial (no sensible) que puede identificarse a partir de sus niveles de marcadores. Estos pacientes pueden interrumpir su terapia actual y prescribirse tratamientos alternativos. La velocidad de los marcadores puede combinarse además con otros marcadores séricos, tales como PCR, AAS (marcadores inflamatorios) o con FCE, FCT-alfa, heregulina u otros factores de crecimiento que participan en la reparación mucosal. La combinación de los marcadores conjuntamente con el análisis estadístico, tal como un algoritmo, pueden predecir adicionalmente la agresividad de la enfermedad. En determinados casos, por ejemplo, la velocidad a menos de los marcadores puede combinarse además con PCR, AAS (marcadores inflamatorios) o con FCE, FCT-alfa, heregulina u otros factores de crecimiento (positivos) que participan en la reparación mucosal. Un algoritmo combinado con un panel de marcadores puede predecir o pronosticar la cicatrización mucosal o la respuesta a terapéuticos. XII. Ejemplos Los ejemplos siguientes se ofrecen a título ilustrativo, aunque no limitativo, de la invención reivindicada.

Ejemplo 1. Determinación de los niveles de ANAC.

El presente ejemplo ilustra un análisis de los niveles de ANAC en una muestra utilizando un ensayo ELISA. Puede utilizarse un ensayo de inmunosorción ligada a enzima (ELISA) de neutrófilos fijados para detectar ANAC tal como se indica en Saxon et al., J. Allergy Clin. Immunol., 86:202-210, 1990. Brevemente, se recubrieron placas de microtitulación con 2,5x105 neutrófilos en cada pocillo procedentes de sangre humana periférica purificada mediante centrifugación Ficoll-Hypaque y se trataron con metanol al 100% durante 10 minutos para fijar las células. Las células se incubaron con albúmina de suero bovino (ASB) al 0,25% en solución salina tamponada con fosfato para bloquear la unión no específica de anticuerpos durante 60 minutos a temperatura ambiente en una cámara humidificada. A continuación se añadieron sueros de control y codificados a una dilución 1:100 al suero bovino/solución salina tamponada con fosfato tampón de bloqueo y se incubaron durante 60 minutos a temperatura ambiente en una cámara humidificada. Se añadió anticuerpo F(ab')2 de cabra anti-inmunoglobulina G humana conjugada con fosfatasa alcalina (específica de cadena γ; Jackson Immunoresearch Labs, Inc.; West Grove, Pa.) a una dilución 1:1.000 para marcar el anticuerpo unido a neutrófilos y se incubó durante 60 minutos a temperatura ambiente. Se añadió una solución de sustrato fosfato de p-nitrofenol y se dejó que se produjese el desarrollo de color hasta alcanzar la absorbancia a 405 nm en los pocillos de control positivo 0,8 a 1,0 unidades de densidad óptica más que la absorbancia en los pocillos de blanco. Los niveles de ANAC pueden determinarse respecto a un estándar que consiste de sueros agrupados obtenidos de pacientes de colitis ulcerosa (CU) positiva para ANACp bien caracterizada. Los resultados se expresan en unidades de ELISA. Los sueros con niveles circulantes de ANAC superiores al valor del intervalo de referencia también pueden denominarse positivos para ANAC, mientras que los valores numéricos inferiores al intervalo de referencia también pueden denominarse negativos para ANAC.

Ejemplo 2. Determinación de la presencia o ausencia de ANACp. El presente ejemplo ilustra un análisis de la presencia o ausencia de ANACp en una muestra utilizando un ensayo de inmunofluorescencia, tal como se indica en, por ejemplo, las patentes US nº 5.750.355 y nº 5.830.675. En particular, la presencia de ANACp se detecta sometiendo a ensayo la pérdida de un valor positivo (por ejemplo la pérdida de un marcador de anticuerpo detectable y/o un patrón de tinción celular específico en comparación con un control) tras el tratamiento de neutrófilos con ADNasa. Los neutrófilos aislados de una muestra, tal como suero, se inmovilizan en un portaobjetos de vidrio siguiendo el protocolo siguiente: 1. Resuspender neutrófilos en un volumen suficiente de 1X solución salina equilibrada de Hank (SSEH) para alcanzar aproximadamente 2,5x106 células por ml. 2. Utilizar una centrífuga Cytospin3 (Shandon, Inc., Pittsburgh, PA) a 500 rpm durante 5 minutos para aplicar 0,01 ml de los neutrófilos resuspendidos a cada portaobjetos.

3. Fijar neutrófilos al portaobjetos mediante la incubación de los mismos durante 10 minutos en un volumen suficiente de metanol al 100% para cubrir la muestra. Dejar secar al aire. Los portaobjetos pueden almacenarse a -20ºC.

Los neutrófilos fijados inmovilizados seguidamente se tratan con ADNasa, de la manera siguiente: 1. Preparar una solución de ADNasa mediante la combinación de 3 unidades de ADNasa Promega RQ1TM (Promega, Madison, WI) por ml de tampón que contiene Tris-HCl 40 mM (pH 7,9), cloruro sódico 10 mM, cloruro de magnesio 6 mM y cloruro de calcio 10 mM. 2. Enjuagar los portaobjetos preparados utilizando el protocolo anterior con aproximadamente 100 ml de solución salina tamponada con fosfato (pH 7,0 a 7,4) durante 5 minutos. Incubar los neutrófilos inmovilizados en 0,05 ml de solución de ADNasa en cada portaobjetos durante aproximadamente 30 minutos a 37ºC. Lavar los portaobjetos tres veces con aproximadamente 100 a 250 ml de solución salina tamponada con fosfato a temperatura ambiente. La reacción de ADNasa llevada a cabo tal como se indica en la presente memoria causa una digestión sustancialmente completa del ADN celular si alterar significativamente la morfología de los neutrófilos nucleares o celulares.

A continuación, se lleva a cabo un ensayo de inmunofluorescencia en los neutrófilos fijados y tratados con ADNasa siguiendo el protocolo siguiente: 1. Añadir 0,05 ml de una dilución 1:20 de suero humano en solución salina tamponada con fosfato a portaobjetos tratados con ADNasa y a portaobjetos no tratados. Añadir 0,05 ml de solución salina tamponada con fosfato a portaobjetos limpios a modo de blancos. Incubar durante aproximadamente 0,5 a 1,0 horas a temperatura ambiente en humedad suficiente para minimizar la pérdida de volumen. 2. Enjuagar el suero mediante inmersión en un recipiente con 100 a 250 ml de solución salina tamponada con fosfato. 3. Sumergir el portaobjetos en solución salina tamponada con fosfato durante 5 minutos. Seca ligeramente.

4. Añadir 0,05 ml de F(ab')2 de cabra anti-IgG(m) humano-FITC (Tago Immunologicals; Burlingame, CA) a una dilución de anticuerpo:solución salina tamponada con fosfato de 1:1.000, a cada portaobjetos. Incubar durante 30 minutos a temperatura ambiente en humedad suficiente para minimizar la pérdida de volumen. 5. Desprender mediante enjuague el anticuerpo utilizando 100 a 250 ml de solución salina tamponada con fosfato. Sumergir los portaobjetos durante 5 minutos en 100 a 250 ml de solución salina tamponada con fosfato, seguido del secado al aire. 6. Leer el patrón de florescencia en un microscopio de fluorescencia a 40X. 7. Si se desea, puede teñirse cualquier ADN con yoduro de propidio enjuagando bien los portaobjetos con solución salina tamponada con fosfato a temperatura ambiente y tinción durante 10 segundos a temperatura ambiente. Lavar los portaobjetos tres veces con 100 a 250 ml de solución salina tamponada con fosfato a temperatura ambiente y montar el cubreobjetos.

El ensayo de inmunofluorescencia indicado anteriormente puede utilizarse para determinar la presencia de ANACp en neutrófilos fijados y tratados con ADNasa, por ejemplo por la presencia de una reacción de ANACp en neutrófilos de contorl (es decir, neutrófilos fijados que no han sido tratados con ADNasa) que resulta anulada con el tratamiento de ADNasa o con la presencia de una reacción de ANACp en neutrófilos de control que se convierte en citoplasmática con el tratamiento de ADNasa. Ejemplo 3. Determinación de los niveles de AASC.

El presente ejemplo ilustra la preparación de manano de pared celular de levadura y un análisis de los niveles de AASC utilizando un ensayo ELISA. El manano de paredes celulares de levadura puede prepararse tal como se describe en Faille et al., Eur. J. Clin.

Microbiol. Infect. Dis. 11:438-446, 1992, y en Kocourek et al., J. Bacteriol. 100:1175-1181, 1969. Brevemente, se obtuvo un pellet liofilizado de la levadura Saccharomyces uvarum de la American Type Culture Collection (nº 38926). Se reconstituyeron levaduras en 10 ml de 2x medio YT, preparado siguiendo Sambrook et al., en: "Molecular Cloning", Cold Spring Harbor Laboratory Press, 1989. Se cultivo S. uvarum durante dos a tres días a 30ºC. El cultivo terminal de S. uvarum se inoculó en una placa de 2 x YT agar y seguidamente se cultivó durante dos a tres días a 30ºC. Se utilizó una colonia individual para inocular 500 ml de medio 2 x YT y se cultivó durante dos a tres días a 30ºC. Se preparó medio de fermentación (pH 4,5) mediante la adición de 20 g de glucosa, 2 g de extracto de bacto- levadura, 0,25 g de MgSO4 y 2,0 ml de H3PO4 al 28% por litro de agua destilada. Se utilizó el cultivo de 500 ml para inocular 50 litros de medio de fermentación y el cultivo se fermentó durante tres a cuatro días a 37ºC.

Se preparó extracto de manano de S. uvarum mediante la adición de 50 ml de tampón citrato 0,02 M (5,88 g/l de citrato sódico, pH 7,0 ± 0,1) a cada 100 g de pasta celular. La mezcla de células/citrato se autoclavó a 125ºC durante noventa minutos y se dejó enfriar. Tras centrifugar a 5.000 rpm durante 10 minutos, se separó el sobrenadante y se reservó. A continuación, las células se lavaron con 75 ml de tampón citrato 0,02 M y la mezcla de células/citrato se autoclavó nuevamente a 125ºC durante noventa minutos. La mezcla de células/citrato se centrifugó a 5.000 rpm durante 10 minutos y se reservó el sobrenadante. Con el fin de precipitar los complejos de cobre/manano, se añadió un volumen igual de solución de Fehling a los sobrenadantes agrupados bajo agitación. La solución de Fehling completa se preparó mediante la mezcla de la solución de Fehling A con la solución de Fehling B en una proporción 1:1 inmediatamente antes de la utilización. Se dejó que los complejos de cobre sedimentaran y se decantó cuidadosamente el líquido del precipitado. A continuación, los complejos de precipitado de cobre/manano se disolvieron en 6 a 8 ml de HCl 3 N por cada 100 gramos de pasta de levadura. La solución resultante se vertió bajo agitación vigorosa en 100 ml de 8:1 metanol: ácido acético y se dejó que el precipitado sedimentase durante varias horas. Se decantó el sobrenadante y se descartó, después se repitió el procedimiento de lavado hasta que el sobrenadante de tornó incoloro, aproximadamente dos a tres veces. Se recolectó el precipitado en un embudo de vidrio sinterizado, se lavó con metanol y se secó al aire durante la noche. En algunas ocasiones el precipitado puede recolectarse mediante centrifugación a 5.000 rpm durante 10 minutos antes del lavado con metanol y el secado al aire durante la noche. El manano seco en polvo se disolvió en agua destilada hasta una concentración de aproximadamente 2 g/ml. Puede utilizarse un ELISA del manano de S. uvarum para detectar AASC. Las placas de ELISA de manano de S. uvarum se saturaron con antígeno de la manera siguiente. Se diluyó el manano de S. uvarum purificado, preparado tal como se ha indicado anteriormente, hasta una concentración de 100 µg/ml con solución salina tamponada con fosfato/azida sódica al 0,2%. Utilizando un pipeteador multicanal, se añadieron 100 µl de manano de S. uvarum 100 µg/ml por cada pocillo de una placa Costar de 96 pocillos de alta unión (nº de catálogo 3590; Costar Corp., Cambridge, Mass.). Se dejó que el antígeno recubriese la placa a 4ºC durante un mínimo de 12 horas. Se comparó cada lote de placas con un lote previo antes de la utilización. Las placas se almacenaron a una temperatura de entre 2ºC y 8ºC durante un máximo de un mes.

Los sueros de los pacientes pueden analizarse por duplicado para la reactividad de IgA-AASC o IgG-AASC. Las placas de microtitulación saturadas con antígeno tal como se ha indicado anteriormente se incubaron con solución salina tamponada con fosfato/Tween-20 al 0,05% durante 45 minutos a temperatura ambiente para inhibir la unión no específica de anticuerpo. A continuación se añadieron los sueros de paciente a una dilución de 1:80 para el análisis de IgA-AASC y 1:800 para el análisis de IgG-AASC y se incubaron durante 1 hora a temperatura ambiente. Los pocillos se lavaron tres veces con PBS/Tween-20 al 0,05%. A continuación, se añadió una dilución 1:1000 de anticuerpo de cabra anti-IgA humana conjugado con fosfatasa alcalina (Jackson Immunoresearch; West Grove, Pa.) o una dilución 1:1.000 de F(ab')2 de cabra anti-IgG humana conjugado con fosfatasa alcalina (Pierce, Rockford, IL), y las placas de microtitulación se incubaron durante 1 hora a temperatura ambiente. Se añadió una solución de fosfato de p-nitrofenol en tampón de sustrato de dietanolamina y se dejó que se desarrollase el color durante 10 minutos. Se analizó la absorbancia a 405 nm utilizando un lector de placas EMAX automatizado (Molecular Devices; Sunnyvale, Calif.). Los niveles de AASC (por ejemplo IgG, IgA o ambos) pueden determinarse respecto a un estándar consistente de sueros agrupados obtenidos de pacientes con un diagnóstico establecido de enfermedad de Crohn (EC). Los resultados de muestras de ensayo de pacientes se expresan como unidades de ELISA y pueden expresarse como porcentaje de la unión estándar de los sueros de pacientes de EC de referencia. Los sueros con niveles circulantes de AASC superiores al valor del intervalo de referencia también pueden denominarse positivos para AASC, mientras que los valores numéricos inferiores al intervalo de referencia también pueden denominarse negativos para AASC.

Ejemplo 4. Determinación de los niveles de anticuerpo anti-OmpC. El presente ejemplo ilustra la preparación de proteína OmpC y un análisis de los niveles de anticuerpo anti-OmpC en una muestra utilizando un ensayo ELISA.

El protocolo siguiente describe la purificación de proteína OmpC utilizando la lisis de esferoplastos. Se inocularon E. coli mutantes OmpF/OmpA procedentes de un cultivo parental en glicerol, en 10 a 20 ml de caldo de Luria-Bertani complementado con 100 µg/ml de estreptomicina (LB-Strep; Teknova, Half Moon Bay, CA) y se cultivaron vigorosamente a 37ºC durante aproximadamente 8 horas hasta la fase logarítmica, seguido de la expansión a 1 litro en LB-Strep durante 15 horas a 25ºC. Se recolectaron las células mediante centrifugación. En caso necesario, las células se lavaron dos veces con 100 ml de Tris-Cl 20 mM helado, pH 7,5. Las células se resuspendieron posteriormente en tampón formador de esferoplastos helado (Tris-Cl 20 mM, pH 7,5, sacarosa al 20%, EDTA 0,1 M, pH 8,0; 1 mg/ml de lisozima), seguido de la incubación de las células resuspendidas sobre hielo durante aproximadamente 1 hora con mezcla ocasional mediante inversión. En caso necesario, los esferoplastos se centrifugaron y se resuspendieron en un volumen menor de tampón formador de esferoplastos (TFE). El pellet de esferoplastos se congeló opcionalmente antes de la resuspensión con el fin de mejorar la eficiencia de la lisis. Se evitó utilizar tampón hipotónico a fin de evitar que estallasen los esferoplastos y liberasen el ADN cromosómico, lo que reduciría significativamente la eficiencia de la lisis.

La preparación de esferoplastos se diluyó 14 veces en Tris-Cl 10 mM helado, pH 7,5, que contenía 1 mg/ml de ADNasa I y se agitó con vórtex vigorosamente. La preparación se sonicó sobre hielo 4x30 segundos a 50% de potencia en el dial 4, con un tiempo de pulso de 1 segundo, sin espumado o sobrecalentamiento de la muestra. Se peletizaron los residuos celulares mediante centrifugación y se separó el sobrenadante y se clarificó mediante centrifugación una segunda vez. Se separó el sobrenadante sin recolectar nada del pellet y se introdujo en tubos de ultracentrífuga. Se llenaron los tubos hasta 1,5 mm desde el tope con Tris-Cl 20 mM, pH 7,5. La preparación de membranas se peletizó mediante ultracentrifugación a 100.000 x g durante 1 h a 4ºC en un rotor flotante Beckman SW 60. Se resuspendió el pellet mediante homogeneización en Tris-Cl 20 mM, pH 7,5, utilizando una punta de pipeta de 1 ml removiendo el pellet antes de pipetear arriba y abajo durante aproximadamente 10 minutos por tubo. Se extrajo el material durante 1 h en Tris-Cl 20 mM, pH 7,5, que contenía SDS al 1%, con rotación a 37ºC. La preparación se transfirió a tubos de ultracentrifugación y las membranas se peletizaron a 100.000 x g. El pellet se resuspendió mediante homogeneización en Tris-Cl 20 mM, pH 7,5, tal como anteriormente. La preparación de membranas se dejó opcionalmente a 4ºC durante la noche. Se extrajo OmpC durante 1 h con rotación a 37ºC en Tris-Cl 20 mM, pH 7,5, que contenía SDS al 3% y NaCl 0,5 M.

Se transfirió el material a tubos de ultracentrifugación y las membranas se peletizaron mediante centrifugación a 100.000 x g. El sobrenadante que contenía OmpC extraído seguidamente se dializó frente a más de 10.000 volúmenes con el fin de eliminar el contenido elevado de sales. Se eliminó el SDS mediante intercambio de detergente frente a Triton al 0,2%. Se eliminó el Triton mediante diálisis adicional frente a Tris-Cl 50 mM. OmpC purificado, que funciona como una porina en su forma trimérica, se analizó mediante SDS-PAGE. La electroforesis a temperatura ambiente resulta en una escalera de bandas de aproximadamente 100 kDa, 70 kDa y 30 kDa. El calentamiento durante 10 a 15 minutos a 65-70ºC disocia parcialmente el complejo y resulta en únicamente dímeros y monómeros (es decir, bandas de aproximadamente 70 kDa y 30 kDa). La ebullición durante 5 minutos resulta en monómeros de 38 kDa.

Los ensayos de ELISA directos de OmpC pueden llevarse a cabo esencialmente de la manera siguiente. Las placas (USA Scientific, Ocala, FL) se recubrieron durante la noche a 4ºC con 100 µl/pocillo de OmpC a una concentración de 0,25 µg/ml en solución salina tamponada con borato, pH 8,5. Tras tres lavados en Tween-20 al 0,05% en solución salina tamponada con fosfato (PBS, por el inglés Phosphate Buffered Saline), las placas se bloquearon con 150 µl/pocillo de albúmina de suero bovino al 0,5% en PBS, pH 7,5 (BSA-PBS) durante 30 minutos a temperatura ambiente. A continuación, la solución de bloqueo se sustituyó por 100 µl/pocillo de suero de enfermedad de Crohn o suero de control normal, diluida 1:100. Seguidamente las placas se incubaron durante 2 horas a temperatura ambiente y se lavaron tal como anteriormente. Se añadió anticuerpo de cabra anti-IgA (específico de la cadena α) o IgG (específico de la cadena γ) humana conjugado con fosfatasa alcalina (Jackson ImmunoResearch, West Grove, Pa.) a las placas a una dilución de 1:1.000 en BSA-PBS. Las placas se incubaron durante 2 horas a temperatura ambiente antes de lavar tres veces con Tween-20 al 0,05%/PBS, seguido de otros tres lavados con solución salina normal tamponada con Tris, pH 7,5. Se añadió solución de sustrato (1,5 mg/ml de fosfato de p-nitrofenol disódico (Aresco, Solon, Ohio) en MgCl2 2,5 mM, Tris 0,01 M, pH 8,6) a razón de 100 µl/pocillo y se dejó que se desarrollase el color durante una hora. A continuación, se analizaron las placas a 405 nm. Los niveles de anticuerpo anti-OmpC pueden determinarse respecto a un estándar consistente de sueros agrupados obtenidos de pacientes con un diagnóstico establecido de enfermedad de Crohn (EC). Los sueros con niveles circulantes de anticuerpo anti-OmpC superiores al valor del intervalo de referencia también pueden denominarse positivos para anticiuerpo anti-OmpC, mientras que los valores numéricos inferiores al intervalo de referencia también pueden denominarse negativos para anticuerpo anti-OmpC. En determinados casos, la reactividad positiva para anticuerpo anti-OmpC puede definirse como la reactividad superior a dos desviaciones estándares sobre la reactividad media obtenida con sueros de control (normales) analizados simultáneamente a las muestras de ensayo. Ejemplo 5. Determinación de los niveles de anticuerpo anti-I2. El presente ejemplo ilustra la preparación de proteína I2 recombinante y un análisis de los niveles de anticuerpo anti- I2 en una muestra utilizando un ensayo ELISA o un ensayo histológico. La secuencia de ácidos nucleicos codificante de I2 de longitud completa puede clonarse en el vector de expresión de GST pGEX. Tras la expresión en E. coli, la proteína se purificó en una columna GST. Puede demostrarse que la proteína purificada presenta el peso molecular esperado mediante tinción de plata y peude demostrarse que presenta reactividad anti-GST con el análisis de transferencia western. La secuencia de ácidos nucleicos codificante de I2 de longitud completa también puede clonarse en un vector de expresión Hex-His6, expresado en E. coli, y purificarse la proteína resultante. Los anticuerpos IgA e IgG humanos que se unen al polipéptido de fusión GST-I2 pueden detectarse mediante ensayos de ELISA directo esencialmente de la manera siguiente. Las placas (Immulon 3; Dynex Technologies; Chantilly, VA) se recubrieron durante la noche a 4ºC con 100 µl/pocillo de polipéptido de fusión GST-I2 (5 µg/ml en solución salina tamponada con borato, pH 8,5). Tras tres lavados en Tween-20 al 0,05% en solución salina tamponada con fosfato (PBS), las placas se bloquearon con 150 µl/pocillo de albúmina de suero bovino al 0,5% en PBS, pH 7,4 (BSA-PBS) durante 30 minutos a temperatura ambiente. A continuación, la solución de bloqueo se sustituyó por 100 µl/pocillo de suero de EC, suero de colitis ulcerosa (CU) o suero de control normal, diluido 1:100. Seguidamente las placas se incubaron durante 2 horas a temperatura ambiente y se lavaron tal como anteriormente. Se añadió anticuerpo secundario conjugado con fosfatasa alcalina (de cabra anti-IgA humana (específico de la cadena α); Jackson ImmunoResearch, West Grove, Pa.) a las placas de IgA a una dilución de 1:1.000 en BSA-PBS. Para la reactividad de IgG, se añadió anticuerpo secundario conjugado con fosfatasa alcalina (de cabra anti-IgG humana (específico de la cadena γ); Jackson ImmunoResearch). Las placas se incubaron durante 2 horas a temperatura ambiente antes de lavar tres veces con Tween-20 al 0,05%/PBS, seguido de otros tres lavados con solución salina normal tamponada con Tris, pH 7,5. Se añadió solución de sustrato (1,5 mg/ml de fosfato de p- nitrofenol disódico (Aresco, Solon, Ohio) en MgCl2 2,5 mM, Tris 0,01 M, pH 8,6) a razón de 100 µl/pocillo y se dejó que se desarrollase el color durante una hora. A continuación, se analizaron las placas a 405 nm. Se restó la unión no específica de los sueros a la proteína GST de control (típicamente <0,1) de los valores en bruto de unión de I2 con el fin de obtener las absorbancias específicas de I2. Los niveles de anticuerpo anti-I2 pueden determinarse respecto a un estándar consistente de sueros agrupados obtenidos de pacientes con un diagnóstico establecido de enfermedad de Crohn (EC). Los sueros con niveles circulantes de anticuerpo anti-I2 superiores al valor del intervalo de referencia también pueden denominarse positivos para anticuerpo anti-I2, mientras que los valores numéricos inferiores al intervalo de referencia también pueden denominarse negativos para anticuerpo anti-I2. En determinados casos, la reactividad positiva para anticuerpo anti-I2 puede definirse como la reactividad superior a dos desviaciones estándares sobre la reactividad media obtenida con sueros de control (normales) analizados simultáneamente a las muestras de ensayo.

Para el análisis histológico, pueden prepararse anticuerpos de conejo anti-I2 utilizando proteína de fusión GST-I2 purificada a modo de inmunógeno. Los anticuerpos de unión a GST se separaron mediante adherencia a GST unido a un soporte de agarosa (Pierce; Rockford, IL) y los sueros de conejo se validaron para inmunorreactividad anti-I2 mediante análisis ELISA. Los portaobjetos se prepararon a partir de especímenes de biopsia incluidos en parafina procedentes de EC, CU y controles normales. Se llevó a cabo la tinción de hematoxilina y eosina, seguido de la incubación con anticuerpo específico de I2. La unión de anticuerpos se detectó con anticuerpos secundarios anticonejo marcados con peroxidasa (Pierce; Rockford, Ill.). El ensayo puede optimizarse con el fin de maximizar la proporción de señal a fondo y la diferenciación entre poblaciones de EC y de control. Ejemplo 6. Genotipado de tres variantes de NOD2 asociadas a la enfermedad de Crohn.

El presente ejemplo muestra un ensayo de genotipado que puede utilizarse para detectar la presencia o ausencia de una variante de NOD2. El genotipado puede llevarse a cabo utilizando un ensayo de genotipado utilizando tecnología de 5'-exonucleasa, el ensayo TaqMan MGBTM (PE Biosystems, Foster City, CA). Pueden diseñarse cebadores utilizando el software PrimerExpress 1.5TM (PE Biosystems) y puede encontrarse información de secuencia en dbSNP para las variantes de NOD2 R702W ("PSN8"), G908R ("PSN12") y 1007fs ("PSN13"). El diseño MGBTM añade un "ligante de surco menor" al extremo 3' de las sondas TaqManTM, incrementando de esta manera la temperatura de unión de la sonda y permitiendo la utilización de sondas más cortas que en los ensayos TaqManTM convencionales (Kutyavin et al., Nucleic Acids Res. 25:3718-3723, 1997). Lo anterior presenta el efecto de incrementar la discriminación entre los alelos en el ensayo (Kutyavin et al., Nucleic Acids Res. 28:655-661, 2000). Los ensayos pueden llevarse a cabo siguiendo las recomendaciones del fabricante (PE Biosystems Bulletin 4317594) en un instrumento ABI 7900. El genotipado se lleva a cabo típicamente en ciego respecto al estado clínico de los sujetos. En las Tablas 3 y 4 se muestran cebadores y sondas ejemplares adecuados para la utilización en el ensayo de genotipado de NOD2.

Tabla 3 Cebadores para la utilización en el ensayo Taqman MGBTM para los PSN 5, 8, 12 y 13 PSN Cebador directo Cebador inverso SEC ID nº PSN5 5’ GGTGGCTGGGCTCTTCT 3’ 5’ CTCGCTTCCTCAGTACCTATGATG 3’ Dir.: 25 Inv.: 26 PSN8 5’ CTGGCTGAGTGCCAGACATCT 3’ 5’ GGCGGGATGGAGTGGAA 3’ Dir.: 27 Inv.: 28 PSN12 5’ CCACCTCAAGCTCTGGTGATC 3’ 5’ GTTGACTCTTTTGGCCTTTTCAG 3’ Dir.: 29 Inv.: 30 PSN13 5’ CCTTACCAGACTTCCAGGATGGT 3’ 5’ TGTCCAATAACTGCATCACGTACCT 3’ Dir.: 31 Inv.: 32 Tabla 4 SONDAS TAQMAN Alelo detectado Secuencia de la sonda SEC ID nº PSN5 alelo de tipo salvaje 6FAM-CATGGCTGGACCC-MGBNFQ 33 ("1") PSN5 alelo variante ("2") TET-CATGGCTGGATCC-MGBNFQ 34 PSN8 alelo de tipo salvaje 6FAM-TGCTCCGGCGCCA-MGBNFQ ("1") PSN8 alelo variante ("2") TET-CTGCTCTGGCGCCA-MGBNFQ 36 PSN12 alelo de tipo salvaje 6FAM-CTCTGTTGCCCCAGAA-MGBNFQ 37 ("1") PSN12 alelo variante ("2") TET-CTCTGTTGCGCCAGA-MGBNFQ 38 PSN13 alelo de tipo salvaje TET-CTTTCAAGGGCCTGC-MGBNFQ 39 ("1") PSN13 alelo variante ("2") 6FAM-CCTTTCAAGGGGCCT-MGBNFQ JW1 alelo de tipo salvaje 6FAM-AAGACTCGAGTGTCCT-MGBNFQ 41 JW1 alelo variante VIC-AGACTCAAGTGTCCTC-MGBNFQ 42 Ejemplo 7. Matriz basada en cuartiles para el pronóstico de la EII. El presente ejemplo ilustra la utilización de un informe de laboratorio de un método que comprende un "mapa térmico" correspondiente a las puntuaciones de cuartil de un panel de marcadores pronósticos para ayudar en el pronóstico de la EII.

Se da a conocer una visualización detallada en un formato fácil de entender. La figura 4 es un informe de laboratorio. Tal como puede observarse en el mismo, se utiliza una escala de grises o de color para la visualización y la magnitud del comportamiento/pronóstico de la enfermedad EII. En particular, se utiliza una escala de grises o matriz de color de cuartiles para "ordenar y agrupar" los marcadores pronósticos individuales. Este "mapa térmico" proporciona una comprensión prácticamente instantánea del nivel de cada uno de los marcadores en la matriz y proporciona una guía para un pronóstico más exacto del estado de la enfermedad EII. El informe de laboratorio ejemplar proporciona ventajosamente un pronóstico más claro debido a que el panel de marcadores pronósticos proporcionado en el "mapa térmico" asocia la puntuación de cuartiles asignada a cada marcador a un subtipo clínico particular de EC, tal como, por ejemplo, enfermedad inflamatoria, fibroestenótica, fistulizante o perforante interna. La combinación de puntuaciones de cuartil para el panel de marcadores pronósticos puede utilizarse para visualizar patrones, lo que proporciona una indicación pronóstica del comportamiento de la enfermedad EII. En algunos casos, el informe de laboratorio proporciona predicciones más exactas con asociaciones de biomarcadores crecientes y es indicativo de la presencia o ausencia de un estado de enfermedad EII dado. En otros casos, el informe de laboratorio proporciona información pronóstica sobre si el individuo presenta un riesgo elevado o bajo de requerir cirugía, tal como cirugía del intestino delgado. En el informe de laboratorio ejemplar mostrado en la figura 4, al riesgo de cirugía se le asigna una puntuación de cuartil de 1, lo que implica un pronóstico correspondiente a un riesgo bajo de cirugía. Además de los marcadores pronósticos mostrados en el presente informe de laboratorio ejemplar, pueden incluirse otros marcadores, tales como marcadores genéticos (por ejemplo NOD2) para ayudar en el pronóstico de la EII. La figura 5 es otro informe de laboratorio obtenido de un paciente pediátrico. En el presente informe de laboratorio ejemplar, al riesgo de cirugía se le asigna una puntuación de cuartil de 0, lo que significa un pronóstico correspondiente a un riesgo nulo de cirugía (por ejemplo la no necesidad de cirugía del intestino delgado). Sin embargo, dependiendo de las puntuaciones de cuartiles asignadas a cada uno de los marcadores pronósticos en el panel, el paciente puede presentar un riesgo o susceptibilidad de desarrollar un subtipo clínico de EC, tal como enfermedad inflamatoria, fibroestenótica, fistulizante o perforante interna. Además de los marcadores pronósticos mostrados en el presente informe de laboratorio ejemplar, pueden incluirse otros marcadores, tales como marcadores genéticos (por ejemplo NOD2) para ayudar en el pronóstico de la EII en pacientes pediátricos. De esta manera, las matrices o modelos basados en cuartiles descritos en la presente memoria resultan útiles para proporcionar información pronóstica para los pacientes pediátricos diagnosticados de EII. La figura 6 es un informe de laboratorio adicional. Tal como se muestra en el mismo, el informe puede expandirse añadiendo información respecto a las características de la enfermedad, ensayos, información genética y marcadores predictivos, que podrían mejorar la capacidad diagnóstica y predictiva. Además de los métodos de "mapa térmico", la figura 7 es un informe de laboratorio que es un gráfico radial. Tal como se muestra en el mismo, el gráfico radial o diagrama puede utilizarse para la visualización de la magnitud de los marcadores como indicador del comportamiento y/o pronóstico de la enfermedad EII. Por ejemplo, el gráfico radial utiliza la concentración real de niveles de marcador o datos de área bajo la curva (ABC). Además, la forma y tamaño de la ABC pueden utilizarse para proporcionar un pronóstico y puede añadirse la clasificación en bandas para mostrar los límites de los intervalos. Puede añadirse una escala de color o de grises para la visualización e identificación inmediata de la información.

En referencia a la figura 8, esta figura ilustra un gráfico de columnas que muestra mediciones de biomarcador cuantitativas en serie (MBCS) en combinación con la 'ponderación' en la determinación del curso de la enfermedad en respuesta, por ejemplo, al tratamiento. La presente figura muestra una serie de extracciones frente a un paciente que está recibiendo tratamiento. El gráfico muestra la historia del paciente como función del tiempo y proporciona vistas longitudinales de los efectos del tratamiento en el paciente, alejándose de la 'instantánea' única de los ensayos más actuales. Ejemplo 8. Contribución del FCE a un algoritmo diagnóstico de la EII. En una cohorte de 527 muestras se evaluaron los efectos contributivos de la concentración de FCE en un algoritmo inteligente. En el presente caso, se construyeron algoritmos comparativos de bosque aleatorio, que incluían o excluían (con y sin) los valores de concentración del FCE. Los otros marcadores medidos fueron ANAC, IgA AASC, IgG AASC, CBir-1, OmpC y ANACp. Ver la solicitud de patente US nº 11/565.544 (publicación de patente US nº 2008/0131439), titulada "Methods of Diagnosing Inflammatory Bowel Disease" [Métodos de diagnóstico de la enfermedad intestinal inflamatoria].

La Tabla 4 a continuación muestra que el FCE incrementó la sensibilidad de la EC y la especificidad de la EC. En un aspecto, el FCE resulta útil en muestras en las que el valor de corte de ANAC se encuentra en el límite (8 a 12 unidades). En estos casos, mediante la inclusión de FCE resulta posible incrementar la sensibilidad y/o especificidad de la EII (por ejemplo la CU). De esta manera, estos resultados indican que el FCE puede incrementar el rendimiento de predicción diagnóstica de la EII. En determinados otros casos, el FCE resulta útil para determinar la agresividad de la EII.

Tabla 5 SIN FCE CON FCE EC SEN 70,89% 73,42% EC SPE 86,38% 85,49% EC PPV 47,86% 47,15% EC NPV 94,39% 94,80% CU SEN 67,63% 71,94% CU SPE 86,08% 87,63% CU PPV 63,51 % 67,57% CU NPV 88,13% 89,71% EII SEN 80,73% 86,70% EII SPE 71,20% 73,46% EII PPV 66,42% 69,74% EII NPV 83,97% 88,67% La Tabla 6 a continuación ilustra la magnitud de la importancia del FCE para un algoritmo de bosque aleatorio (ver la solicitud de patente US nº 11/565.544 (publicación de patente US nº 2008/0131439), titulada "Methods of Diagnosing Inflammatory Bowel Disease" [Métodos de diagnóstico de la enfermedad intestinal inflamatoria].

Tabla 6 Variable Puntuación ANACp 100 ||||||||||||||||||||||||||||||||||| IgA-AASC 57,51 |||||||||||||||||||| OmpC 49,88 ||||||||||||||| FCE 29,91 ||||||||| IgG-AASC 29,87 ||||||||| CBir-I 17,89 |||||| Ejemplo 9. Contribución de la defensina a un algoritmo diagnóstico de la EII.

En una cohorte de 51 muestras, se determinó la concentración de la defensina humana (DHβ1 y DHβ2) y sus efectos contributivos evaluados en un algoritmo diagnóstico. En el presente caso, la cohorte contenía las muestras siguientes: CU=26; EC=18 y Sano=7. Además, 7 de las 18 muestras de EC eran de EC similar a CU. El ensayo incluía los marcadores siguientes: ANAC >12; ANACp (sensible a ADNasa) y defensina > media + 2SD en la comparación con los controles sanos. Los resultados indican que una combinación de DHβ1 y 2, ANAC y ANACp sensibilidad a ADNasa incrementa el rendimiento de predicción diagnóstica de la CU. Por ejemplo, en las Tablas 7A- B, la Evaluación 1 muestra que DHβ1 y 2, ANAC y ANACp sensibilidad a ADNasa pueden utilizarse para predecir la CU en 23/26 muestras. En vista de estos resultados resulta evidente que la defensina es un buen marcador de la CU.

Evaluación 1, Tabla 7A Predicción Total CU No CU CU 26 23 3 No CU 14 11 Evaluación 2, Tabla 7B Predicción Total CU No CU CU 26 23 3 EC similar a CU? 7 7 No CU 18 6 12 Ejemplo 10. Contribución de la cadherina-E a un algoritmo diagnóstico de la EII. En una cohorte de 157 muestras, se determinaron los valores de concentración de la cadherina-E. Se construyeron modelos comparativos de bosque aleatorio que incluían y excluían la cadherina-E (con o sin cadherina-E). Ver la solicitud de patente US nº 11/565.544 (publicación de patente US nº 2008/0131439), titulada "Methods of Diagnosing Inflammatory Bowel Disease" [Métodos de diagnóstico de la enfermedad intestinal inflamatoria]. Otros marcadores incluidos: ANAC, IgA AASC, IgG AASC, CBir1 y OmpC. Se muestran los resultados en las Tablas 8A-B. Los datos indican que la cadherina-E incrementa la predicción diangóstica de la EC en aproximadamente +6%. I. Modelo de bosque aleatorio sin cadherina-E (Tabla 8A) Clase real Total de casos Porcentaje correcto 1 2 N=54 N=45 N=58 64 64,063 41 13 1 48 47,917 6 23 19 2 57,778 7 12 26 II. Modelo de bosque aleatorio con cadherina-E (Tabla 8B) Clase real Total de casos Porcentaje correcto 1 2 N=56 N=46 N=55 64 64,063 41 9 14 1 48 54,167 7 26 2 57,778 8 11 26 Ejemplo 11. Contribución de PCR y AAS a un algoritmo diagnóstico de la EII. En una cohorte de 768 muestras, se determinaron los valores de concentración de la proteína C reactiva (PCR) y el amiloide A sérico (AAS). A continuación, se evaluaron los efectos contributivos de PCR y AAS mediante la comparación de modelos construidos con o sin PCR y AAS en un algoritmo de bosque aleatorio. Ver la solicitud de patente US nº 11/565.544 (publicación de patente US nº 2008/0131439), titulada "Methods of Diagnosing Inflammatory Bowel Disease" [Métodos de diagnóstico de la enfermedad intestinal inflamatoria]. Otros marcadores incluidos: ANAC, IgA AASC, IgG AASC, CBir1 y OmpC. Se muestran los resultados en las Tablas 9A-B. Los datos indican que la PCR y el AAS incrementan la predicción diangóstica de la EC en aproximadamente +5%. Además, las figuras 9 y 10 muestran que AAS y PCR se encuentran, cada uno independientemente, elevados en las muestras de pacientes de EC y CU comparado con las muestras de control normal. I. Modelo de bosque aleatorio sin PCR/AAS (Tabla 9A) Clase real Total de casos Porcentaje correcto 1 2 N=398 N=185 N=185 544 63,787 347 101 96 1 115 56,522 26 24 2 109 59,633 19 II. Modelo de bosque aleatorio con PCR/AAS (Tabla 9B) Clase real Total de casos Porcentaje correcto 1 2 N=422 N=171 N=175 544 69,118 376 86 82 1 115 61,739 21 71 23 2 109 64,220 14 Ejemplo 12. Contribución de marcador sérico a un algoritmo diagnóstico de la EII.

La Tabla 10 es un resumen de los efectos de la contribución de FCE, DHβ1 y 2, cadherina-E, PCR y AAS a un algoritmo de bosque aleatorio (ver la solicitud de patente US nº 11/565.544 (publicación de patente US nº 2008/0131439), titulada "Methods of Diagnosing Inflammatory Bowel Disease" [Métodos de diagnóstico de la enfermedad intestinal inflamatoria].

Tabla 10 No Predicción Predicción de Marcador Número Método de evaluación predicción de EC CU de EII FCE 527 FR +2,5% +4,3% +2,3% Valor de corte 23/26 predichos DHβ1 y 2 51 - - (ANAC, ADNasa y DHβ1 y 2+) correctamente Cadherina-E 157 FR +6,3% - - PCR y AAS 768 FR +5,2% +4,6% +5,4% Ejemplo 13. La respuesta de anticuerpos séricos elevados frente a componentes microbianos en pacientes de enfermedad de Crohn predice una probabilidad elevada de cirugía.

RESUMEN Objetivo: debido a que el 70% de los pacientes de enfermedad de Crohn (EC) finalmente requeriría una intervención quirúrgica, la capacidad de predecir qué pacientes progresarán a cirugía resultaría extremadamente valiosa. El objetivo del presente análisis era derivar un método que pueda utilizarse para predecir qué pacientes de EC presentan un riesgo de futura cirugía gastrointestinal (GI).

Métodos: se recogieron muestras de sangre y datos clínicos previamente de 200 pacientes adultos de EC cuya enfermedad había sido confirmada mediante biopsia. Todos los pacientes habían recibido el diagnóstico de EC por lo menos 1 años antes de la extracción de sangre. Se obtuvo el consentimiento informado de todos los pacientes. En el presente análisis retrospectivo, se midieron los niveles de 4 marcadores séricos de EII (IgG-AASC, IgA-AASC, anti-OmpC y anti-CBir1). Para cada paciente se puntuó cada marcador en 1 de entre 4 cuartiles (1-4) y se sumaron las puntuaciones de cuartiles de los 4 marcadores (intervalo: 4 a 16) para producir una puntuación de suma de cuartiles (PSC). Los pacientes fueron definidos como de alto o bajo riesgo utilizando 2 parámetros diferentes: un número de marcadores elevados (riesgo elevado: 1+ marcadores) o un puntuación de suma de cuartiles (riesgo elevado: PSC 11+). Para cada uno de dichos parámetros se llevó a cabo un análisis de Kaplan-Meier con el fin de comparar el tiempo hasta la cirugía en pacientes de alto vs. bajo riesgo. Resultados: los pacientes que habían sido sometidos a cirugía GI se encontró que presentaban niveles estadísticamente significativamente más elevados de marcadores de EII que los pacientes que no habían sido sometidos a cirugía GI. Además, el 74% de los pacientes con sumas de cuartiles elevadas (11-16) presentaba por lo menos 1 cirugía GI comparado con 28% de los pacientes con sumas de cuartiles bajas (4-10). El análisis de Kaplan- Meier también demostró que los pacientes seropositivos de por lo menos 1 biomarcador positivo presentaban una tasa significativamente más alta de progresión a cirugía que los que no presentaban biomarcadores biopositivos (P=0,0014). Unos análisis similares que comparaban los pacientes con una PSC de 11-16 con pacientes con una PSC de 4-10 demostraron que los pacientes con una PSC más alta también presentaban una probabilidad significativamente más elevada de necesidad de cirugía (P=0,0010). Diez años después del diagnóstico, el 59% de los pacientes con PSC elevada habían sido sometidos a cirugía, comparado con 24% de los pacientes con PSC bajo.

Conclusión: El presente estudio demuestra que la inmunorreactividad incrementada hacia los antígenos microbianos se asocia a un riesgo incrementado de cirugía en pacientes con EC. El presente estudio sugiere además que los marcadores séricos podrían presentar utilidad clínica en la predicción de la progresión de la enfermedad y la necesidad posterior de cirugía.

INTRODUCCIÓN La enfermedad de Crohn (EC) comprende un grupo heterogéneo de enfermedades cuya etiopatogénesis consiste de inmunorreactividad contra bacterias luminales en individuos genéticamente susceptibles1. La reactividad de los anticuerpos a los antígenos, incluyendo anti-Saccharomyces cerevisiae (AASC), la secuencia bacteriana I2 (anti-I2), la porina C de la membrana externa (OmpC)2 y la flagelina bacteriana (CBir1) han sido descritas en la EC3. La inmunorreactividad de dichos antígenos se ha asociado a diversos fenotipos de enfermedad en la EC2,4-6. Debido a que el 70% de los pacientes de EC en última instancia requerirá de una intervención quirúrgica, la capacidad de predecir dicha progresión de la enfermedad resultaría extremadamente valiosa.

OBJETIVO El presente análisis se llevó a acbo en un esfuerzo por obtener un método para predecir el riesgo futuro de cirugía en los pacientes de EC.

MÉTODOS Se analizaron datos clínicos y muestras de sangre previamente recogidos de 200 pacientes adultos de EC confirmados mediante biopsia, diagnosticados por lo menos 1 años antes del muestreo de sangre, para 4 biomarcadores séricos de EII (IgG-AASC, IgA-AASC, anti-OmpC y anti-CBir1) y se compararon con pacientes que habían sido sometidos a cirugía frente a aquellos que no habían sido sometidos. La respuesta inmunológica sérica para cada biomarcador se clasificó como "Positiva" (superior a un valor de referencia) y "Negativa" (inferior a un valor de referencia).

Para cada paciente se puntuó cada marcador en 1 de entre 4 cuartiles (1-4) y se sumaron las puntuaciones de cuartiles de los 4 marcadores (intervalo: 4 a 16) para producir una puntuación de suma de cuartiles (PSC). Con el fin de cuantificar la respuesta de anticuerpos antimicrobianos en los pacientes, la cohorte se dividió en 13 subgrupos (4-16) basándose en su PSC: - PSC=4: la totalidad de los 4 valores de biomarcador se encontraba comprendido dentro del intervalo del cuartil percentil 25.

- PSC=16: la totalidad de los 4 valores de biomarcador era superior al intervalo del cuartil percentil 75.

Se determinó si los pacientes seropositivos presentaban un riesgo mayor de someterse a cirugía que los pacientes seronegativos basándose en 2 métodos analíticos: - Análisis basado en la utilización de valores de referencia de biomarcador de EEI: • Seropositivo: 1 o más valores de biomarcador de EII (IgA-AASC, IgG-AASC, anti-OmpC y anti-CBir1) superiores a los valores de referencia.

Seronegativo: todos los valores de marcador de EII inferiores al valor de referencia.

- Análisis basado en la utilización del PSC: • Subgrupos con PSC>10.

• Subgrupos con PSC≤10.

Para cada uno de dichos parámetros se llevó a cabo un análisis de Kaplan-Meier con el fin de comparar el tiempo hasta la cirugía en pacientes de alto vs. bajo riesgo.

RESULTADOS: 1. Las características clínicas demostraron un comportamiento de la enfermedad diferente en pacientes de EC con y sin cirugía (Tabla 11).

2. Aquellos pacientes que habían sido sometidos a cirugía GI se encontró que mostraban una respuesta sérica de anticuerpos significativamente más alta a componentes microbianos, tales como AASC y CBir1, que los pacientes que no habían sido sometidos a cirugía GI (Tabla 12).

Se determinaron los anticuerpos séricos contra los antígenos microbianos IgG-AASC, IgA-AASC, OmpC, CBir1 y el autoantígeno ANAC en los pacientes de EC que habían sido y que no habían sido sometidos a cirugía GI. La respuesta inmunológica sérica para cada biomarcador se clasificó como "Positiva" (superior a un valor de referencia) y "Negativa" (inferior a un valor de referencia). Los resultados del análisis de chi-cuadrado sugieren que los valores de IgA-AASC, IgG-AASC, anti-CBir1 y ANAC son estadísticamente diferentes en cohortes de EC que habían sido frente a los que no habían sido sometidos a cirugía.

[0367] 3. El setenta y cuatro por ciento de los pacientes con PSC elevada (11-16) había sido sometido a por lo menos 1 cirugía GI, comparado con 28% de los pacientes con PSC baja (4-10) [P<0,001] (figura 11).

Tabla 13: cuartiles de biomarcadores IgA-AASC UE/ml IgG-AASC UE/ml Anti-OmpC UE/ml Anti-CBir1 UE/ml Cuartil percentil 25 6,20 4,68 9,18 13,28 Cuartil percentil 50 11,20 15,35 21,05 22,95 Cuartil percentil 75 19,93 43,88 53,75 45,78 Con el fin de cuantificar la respuesta de anticuerpos antimicrobianos en los pacientes, la cohorte se dividió en 13 subgrupos (4-16) basándose en su PSC: el subgrupo de PSC=4 presentaba los 4 biomarcadores dentro del intervalo del 1º cuartil y el subgrupo de PSC=16 presentaba los 4 biomarcadores sobre el intervalo del cuartil percentil 75: - los resultados indican que el porcentaje de pacientes que había sido sometido a cirugía GI se encontraba entre los subgrupos con PSC elevada. La probabilidad de cirugía en los pacientes de EC puede predecirse mediante el análisis de Kaplan-Meier: - Análisis basado en la utilización de valores de referencia de biomarcador de EEI: • Seropositivo: 1 o más valores de biomarcador de EII (IgA-AASC, IgG-AASC, anti-OmpC y anti-CBir1) superiores a los valores de referencia.

Seronegativo: todos los valores de marcador de EII inferiores al valor de referencia.

- Pacientes que habían sido sometidos a cirugía (N=56): • Más de 1 respuesta de marcador positiva: n=52. • Todas las respuestas de marcador negativas: n=4. • Lapso de tiempo promedio entre diagnóstico y primera cirugía GI=9,0 años.

• Tiempo medio de seguimiento sérico tras primera cirugía GI=12,2 años.

- Pacientes no sometidos a cirugía (controles) basados en los últimos datos colonoscópicos disponibles (N=53): • Más de 1 respuesta de marcador positiva: n=31.

• Todas las respuestas de marcador negativas: n=22. • Lapso de tiempo promedio entre diagnóstico y última colonoscopia=7,0 años. • Tiempo medio de seguimiento sérico tras la última colonoscopia=1,9 años.

El análisis de Kaplan-Meier demostró que los pacientes seropositivos de por lo menos 1 biomarcador positivo presentaban una probabilidad de historia de cirugía significativamente más alta que los que no presentaban biomarcadores biopositivos (P=0,0014) (figura 12). Los pacientes de EC con todos los valores de biomarcador de EII negativos presentaban un riesgo más bajo de progresar a cirugía en el futuro que los pacientes que presentaban por lo menos 1 valor de biomarcador de EII superior al valor de referencia. La figura 13 muestra un análisis de Kaplan-Meier que compara los pacientes con PSC>10 (11-16) con aquellos con PSC≤10 (4-10). El estudio demostró que los pacientes con PSC más alta también presentaban una probabilidad significativamente más alta de haber sido sometidos a cirugía (P=0,0010). Diez años después del diagnóstico, el 59% de los pacientes con PSC más alta habían sido sometidos a cirugía, comparado con 24% de los pacientes con PSC bajo. Los pacientes de EC en los subgrupos con PSC≤10 presentan menos riesgo de progresar a cirugía que los pacientes en los subgrupos con PSC superior a 10. CONCLUSIÓN El presente estudio confirmó que los marcadores séricos elevados presentan asociaciones significativas con cirugía en los pacientes de EC. Los estudios prospectivos futuros expandirán adicionalmente la utilidad clínica de los marcadores séricos en la predicción de la progresión y gravedad de la enfermedad en los pacientes de EC.

REFERENCIAS 1. Podolsky DK. N Engl J Med. 2002; 347:417-29. 2. Arnott IDR, et al. Am J Gastroenterol. 2004; 99:2376-84. 3. Targan SR, et al. Gastroenterology. 2005; 128:2020-8.

4. Mow WS, et al. Gastroenterology. 2004; 126:414-24. 5. Dubinsky MC, et al. Am J Gastroenterol. 2006; 101:360-7. 6. Dubinsky MC, et al. Clin Gastroenterol Hepatol. 2008; 6:1105-11.

Ejemplo 14. Selección de pacientes para la terapia de tratamiento precoz ("top-down"): Diseño de estudio pronóstico.

El presente ejemplo describe el diseño de un estudio de pronóstico de la EII consistente de los tres estudios siguientes (N total=1.172): 1. N=200 procedentes de 25 centros secundarios (ver el Ejemplo 13).

2. N=451 muestras adicionales procedentes de la Institución A. 3. N=521 muestras adicionales procedentes de la Institución B.

El presente ejemplo ilustra un estudio transversal en el que se analizaron dos resultados pronósticos: (1) complicaciones de enfermedad (estenosante/penetrante), y (2) necesidad de cirugía. La preparación y caracterización de los antígenos fue robusta, conteniendo cada ensayo curvas de calibración de múltiples puntos y una automatización completa de todas las etapas del ensayo. Se generó antisuero de conejo para CBir-1 (figura 14) y OmpC (figura 15) con un título muy elevado. Se desarrollaron paneles que contenían un gran número de sueros de pacientes con enfermedad bien caracterizada y perfiles de autoanticuerpos bien definidos, así como sueros normales que no contenían autoanticuerpos detectables. La Tabla 14 proporciona una lista de los marcadores séricos y genéticos analizados en el presente estudio pronóstico.

Tabla 14 Marcadores Gen II de EII IgA-AASC Anticuerpos IgA anti-Saccharomyces cerevisiae

IgG-AASC Anticuerpos IgG anti-Saccharomyces cerevisiae

Anti-OmpC Porina C de membrana externa de E. coli

Anti-CBir1 Flagelina bacteriana ANACp Anticuerpos citoplasmáticos perinucleares antineutrofílicos Anti-I2 (replegado) Secuencia bacteriana I2 de Pseudomonas fluorescens

PRC Proteína C reactiva AAS Amiloide A sérico FCE Factor de crecimiento epidérmico MAC-V1 Molécula 1 de adhesión celular vascular MAC-I1 Molécula 1 de adhesión celular intracelular NOD2 Dominio de oligomerización de unión a nucleótidos 2 rs5743293 PSN13 -(3020insC) rs2066845 PSN12 -(G908R) rs2066844 PSN8 -(R702W) En el presente ejemplo, se estudiaron 1.172 muestras de múltiples instituciones. Cada placa presentaba 5 a 6 calibradores/estándares. El protocolo de pronóstico comprendía análisis de proteínas séricas y de genotipado. Todos los ensayos para anti-OmpC, anti-I2, IgG-AASC, IgA-AASC, CBir1 y ANAC se llevaron a cabo a dos diluciones del suero (1:100 y 1:200). Se determinaron los niveles de los anticuerpos y se expresaron los resultados como unidades de ELISA (UE/ml), que son relativos a un estándar que se deriva de una agrupación de sueros de pacientes con enfermedad bien caracterizada. El nivel del analito en las muestras desconocidas se determinó utilizando por lo menos los dos estándares más próximos. El CV para los duplicados se fijó en 15%. El análisis de genotipado incluía tres polimorfismos de un solo nucleótido (PSN) de NOD2/CARD15: rs5743293 PSN13 -(3020insC); rs2066845 PSN12 -(G908R) y rs2066844SNP8 -(R702W).

La figura 16 ilustra una curva de calibración ejemplar para I2. La figura 17 ilustra una curva de calibración ejemplar para I2 con estándares. La figura 18 muestra las tendencias de los estándares utilizando una curva de calibración nominal. En determinados aspectos, basándose en el número de marcadores elevados, se evalúa el riesgo de cada paciente de complicaciones y cirugía. En determinados aspectos, se mide y analiza un panel de biomarcadores (séricos, genéticos y proteicos). En un aspecto, se utilizan doce biomarcadores y por lo menos uno, por lo menos dos, por lo menos tres, por lo menos cuatro, por lo menos cinco, por lo menos seis, por lo menos siete, por lo menos ocho, por lo menos nueve, por lo menos diez, por lo menos once o por lo menos doce marcadores. En un aspecto, cada biomarcador se considera elevado en el caso de que sea superior a la mediana.

Se da a conocer que se calcula el número de marcadores elevados y todos los marcadores contribuyen igualmente. Los marcadores pueden ser una media ponderada, o pueden ser una puntuación de análisis de cuartiles (por ejemplo PSC), un análisis de percentiles, o en determinados casos, se pondera la interacción entre determinados marcadores (sinergia).

Tabla 15. Tablas de contingencia - Complicaciones Co Co Valor de P Co Co Valor de P No No NoCo mp mp de la prueba NoC mp mp de la prueba Co Co mp.

.

.

exacta de omp.

.

.

exacta de mp.

mp.

Fisher Fisher IgA- B 295 54 46 0,0000 AA Ba 260 46 54 0,0001 AA aj 1 % % S ja 2 % % SC as s Al 39 29 71 Alt 36 ta 156 196 % % as 6 % % s No Co No Co No Co No Co Comp mp Co mp Com mp Co mp .

.

mp.

.

p.

.

mp.

.

IgG- B 297 27 52 48 0,0000 MAI Ba 258 46 54 0,0004 AA aj 1 % % C1 ja 3 % % SC as s Al 29 71 Alt 36 ta 166 199 2 % % as 2 % % s No Co No Co No Co No Co Comp mp Co mp Com mp Co mp .

.

mp.

.

p.

.

mp.

.

CBir B 271 27 0,0000 MA Ba 259 29 47 53 0,0000 1 aj % % CV ja 2 % % as 1 s Al 36 32 68 Alt 36 34 66 ta 174 189 8 % % as 3 % % s No Co No Co No Co No Co Comp mp Co mp Com mp Co mp .

.

mp.

.

p.

.

mp.

.

B Ba Om FC aj 251 0,0000 ja 251 0,0074 pC 3 % % E 9 % % as s Al Alt 37 63 ta 154 206 1 % % as 4 % % s No Co No Co No Co No Co Comp mp Co mp Com mp Co mp .

.

mp.

.

p.

.

mp.

.

B Ba 26 PC 31 12 aj 219 0,0159 ja 256 0,0025 8 % % R 1 % % as s Al 37 63 AA Alt 36 36 64 ta 181 0,0000 205 6 % % S as 2 % % s En la Tabla 15 se muestran diez marcadores. Para cada marcador se dividen las muestras en superiores e inferiores a la mediana ("Altas" y "Bajas"). Cada muestra se clasificó también como con complicaciones (por ejemplo fenotipo/comportamiento de enfermedad estenosante, penetrante) o sin complicaciones. Para cada marcador se muestran los recuentos de muestras en una tabla 2x2 (bajas vs. altas y complicaciones vs. sin compl.). Para los diez marcadores la población con niveles "Altos" presentó un porcentaje significativamente más alto de personas con complicaciones que la población con niveles "Bajos" de marcador, tal como muestran los porcentajes que pueden leerse directamente a la derecha de los recuentos de cada marcador. Se muestra la significancia estadística; todos los valores son <0,05.

Table 16. Tablas de contingencia - Cirugía Valo Valo r de r de P de P de la la No No prue No No prue Ciru Ciru Ciru Ciru ciru ciru ba ciru ciru ba g.

g.

g.

g.

gía gía exac gía gía exac ta ta de de Fish Fish er er IgA- Baj 0,00 Baj 0,40 AAS 329 217 60% AAS 251 311 45% as % 00 as % 21 C Alta 67 Alta 53 182 364 33% 266 296 47% s % s % No No No No Ciru Ciru Ciru Ciru ciru ciru ciru ciru g.

g.

g.

g.

gía gía gía gía IgG- Baj 41 0,00 MAI Baj 0,76 AAS 337 231 59% 255 306 45% as % 00 C1 as % 46 C Alta 67 Alta 53 188 380 33% 261 300 47% s % s % Sin Sin No No Ciru Ciru Ciru Ciru ciru ciru ciru ciru g.

g.

g.

g.

gía gía gía gía CBir Baj 49 0,00 MAC Baj 51 0,03 277 264 51% 271 280 49% 1 as % 23 V1 as % Alta 58 Alta 57 227 315 42% 236 316 43% s % s % Sin Sin No No Ciru Ciru Ciru Ciru ciru ciru ciru ciru g.

g.

g.

g.

gía gía gía gía Om Baj 43 0,00 Baj 59 0,00 287 217 57% FCE 231 329 41% pC as % 00 as % 12 Alta 66 Alta 49 174 331 34% 286 274 51% s % s % Sin Sin No No Ciru Ciru Ciru Ciru ciru ciru ciru ciru g.

g.

g.

g.

gía gía gía gía Baj 52 0,27 Baj 0,43 I2 234 253 48% PCR 254 313 45% as % 46 as % 86 Alta 56 Alta 53 216 271 44% 268 299 47% s % s % En la Tabla 16, anteriormente, se muestran diez marcadores. Para cada marcador se dividen las muestras en superiores e inferiores a la mediana ("Altas" y "Bajas"). En ésta las muestras se clasifican como sometidas a cirugía o no, y no con complicaciones o sin complicaciones (tal como en la Tabla 15). Seis de diez marcadores mostraban significancia, es decir, IgA-AASC, IgG-AASC, anti-CBir1, anti-OmpC, MACV1 y FCE.

Tabla 17. Bajas/Altas=inferiores/superiores a la mediana de la población de EC Número Elevado Porcentaje de complicaciones Recuento Porcentaje del recuento 6% 16 2% 1 38% 37 5% 2 39% 88 12% 3 33% 92 12% 4 62% 132 18% 66% 138 19% 6 73% 106 14% 7 78% 81 11% 8 80% 6% 9 90% 1% Total: 745 En la Tabla 17 los marcadores se consideran "todos simultáneamente" en lugar de individualmente. Los marcadores eran los siguientes: IgA-AASC, IgG-AASC, anti-CBir1, anti-OmpC, anti-I2, MACV1, MAIC, AAS y FCE. Cada uno de dichos nueve marcadores se clasificó como "bajo" o "alto" (frente a la mediana) para cada muestra. Además, se sumó el número de marcadores que eran "altos" para cada muestra. Es decir, el número de marcadores elevados, que fueron 0-9 (ya que se incluyeron nueve marcadores en total en el presente ejemplo). Finalmente, para cada subgrupo de muestras (muestras con 0, 1, 2... 9 marcadores elevados), se muestra el porcentaje que presentó complicaciones. La figura 19 proporciona una ilustración gráfica del porcentaje de complicaciones basado en el número de marcadores elevados.

Tabla 18. Cirugía - nº de marcadores elevados (de entre 9) Número Elevado Porcentaje Cirugía Recuento Porcentaje del recuento 44% 16 2% 1 32% 37 5% 2 40% 88 12% 3 41% 92 12% 4 57% 132 18% 51% 138 19% 6 64% 106 14% 7 62% 81 11% 8 67% 6% 9 70% 1% Total: 745 En la Tabla 18 los marcadores se consideran "todos simultáneamente" en lugar de individualmente. Los marcadores eran los siguientes: IgA-AASC, IgG-AASC, anti-CBir1, anti-OmpC, anti-I2, MACV1, MAIC, AAS y FCE. Cada uno de dichos nueve marcadores se clasificó como "bajo" o "alto" (frente a la mediana) para cada muestra. Además, se sumó el número de marcadores que eran "altos" para cada muestra. Es decir, el número de marcadores elevados, que fueron 0-9 (ya que se incluyeron nueve marcadores en total en el presente ejemplo). Finalmente, para cada subgrupo de muestras (muestras con 0, 1, 2... 9 marcadores elevados), se muestra el porcentaje de los sometidos a cirugía. La figura 20 proporciona una ilustración gráfica del porcentaje de cirugías basado en el número de marcadores elevados.

Tabla 19A. Complicaciones - número de marcadores (% de complicaciones) Número IgA-AASC IgG-AASC CBir1 OmpC I2 AAS MAIC MACV FCE PRC Elevado 0 46% 43% 34% 28% 24% 22% 18% 14% 6% 8% 1 71% 62% 55% 47% 44% 33% 31% 35% 38% 34% 2 73% 71% 67% 54% 52% 43% 40% 39% 39% 3 76% 74% 69% 63% 53% 40% 33% 37% 4 78% 72% 70% 72% 70% 62% 53% 85% 75% 69% 71% 66% 65% 6 90% 82% 70% 73% 64% 7 87% 81% 78% 73% 8 87% 80% 84% 9 90% 79% 88% Tabla 19B. Recuentos Número Elevado IgA-AASC IgG-AASC CBir1 OmpC I2 AAS MAIC MACV FCE PRC 546 435 255 151 71 34 28 16 12 1 546 226 277 206 153 106 67 51 37 2 425 249 195 157 149 120 102 88 3 249 218 172 152 146 110 92 89 4 143 148 168 163 151 132 97 78 103 127 121 138 124 6 48 76 105 106 114 7 58 81 95 8 23 68 9 33 8 Total: 1092 1086 1030 913 779 771 763 749 745 745 En las Tablas 19A/B, leídas de izquierda a derecha, la primera columna muestra qué ocurre con exactamente un marcador - IgA-AASC. Cada muestra puede ser "alta" o "baja" con respecto a IgA-AASC. Entre las personas caracterizadas con un nivel "bajo" para IgA-AASC, el 46% presentó complicaciones (tal como se muestra); entre aquéllas con nivel "alto", el 71% presentó complicaciones (tal como se muestra). En la siguiente columna los presentes inventores consideraron un ensayo con dos marcadores: IgA-AASC y IgG-AASC. A continuación cada muestra se clasificó como "alta" o "baja" para dos marcadores, y cada muestra presenta un recuento de cuántos marcadores presentan valores elevados (que en el presente ejemplo pueden ser 0 a 2). Para esos dos marcadores, entre las muestras que presentaban cero elevadas, el 43% presentó complicaciones. Las muestras que presentaban un marcador elevado (de entre dos, podía ser cualquiera de los dos), presentó complicaciones el 62%. Las muestras que presentaban ambos marcadores elevados el 73% presentó complicaciones. La tercera columna muestra qué ocurre con tres marcadores (el tercer marcadores era CBir1, tal como se muestra en la primera fila). Cada columna (de izquierda a derecha) añade un marcador adicional, segmenta la población según cuántos marcadores presentaban valores elevados (en ese subgrupo) y muestra, dentro de cada segmento de la población, qué porcentaje presentó complicaciones. Observar que el orden de los marcadores (izquierda a derecha, fila superior) se ha "seleccionado manualmente" - diferentes órdenes habrían generado diferentes gráficos (aunque la columna de más a la derecha sería la misma en todos los casos, ya que la columna de más a la derecha es "todos los marcadores").

La Tabla 20 muestra cuántas personas presentaban mutaciones de NOD2. Para tres sitios dentro del gen NOD2 (PSN8, PSN12 y PSN13), lo anterior muestra cuántas muestras presentaba cero, una o dos mutaciones. Las tablas sugieren que, debido a que hay pocas personas con 2 mutaciones, es mejor agruparlas en "cero mutaciones" o "una o dos" mutaciones.

Tabla 21. Complicaciones - NOD2 Prueb Prueb a a exact exact a de a de Fishe Fishe r r Sin Sin Sin Sin Com Com valor PSN1 Com Com valor PSN8 com com com com p.

p.

de P 2, 13 p.

p.

de P p.

p.

p.

p.

Peso 100 149 40% 60% 0,858 Wt 106 138 43% 57% 0,070 1+ 21 42% 58% 1 Mut 11 27 29% 71% Mut 2+ 4 14 22% 78% Mut Prueb a exact a de Fishe r Sin Sin Prueb PSN1 Com Com valor com com a 2 p.

p.

de P p.

p.

exact a de Fishe r Peso 109 161 40% 60% 1 PSN8, Sin Com Sin Com valor 12, 13 com p.

com p.

de P p.

p.

1+ 12 19 39% 61% Peso 85 108 44% 56% 0,039 Mut 1 Mut 26 41 39% 61% 2+ 4 19 17% 83% Mut Prueb a exact a de Fishe r Sin Sin PSN1 Com Com valor com com 3 p.

p.

de P p.

p.

Peso 115 153 43% 57% 0,008 1+ 6 27 18% 82% Mut La Tabla 21 muestra tablas 2x2, (a la izquierda) divide a las personas en "cero mutaciones" y "una o dos mutaciones". Para cada uno de dichos grupos se dividieron las personas en "Presentaron complicaciones" o "No presentaron complicaciones". Sólo PSN13 fue significativo. Para PSN13, entre las personas con mutación en PSN13, un porcentaje mayor presentó complicaciones (82%) que la población sin mutaciones en PSN13 (de ellos, sólo 57% presentó complicaciones).

Tabla 22. Cirugía - NOD2 Prueba Prueba exacta de exacta de Fisher Fisher No No PSN No No PS Ciru Ciru Ciru Ciru ciru ciru valor de P 12, cirug cirug valor de P N8 gía gía gía gía g.

g.

13 .

.

Pes 33 67 Pes 82 167 0,574 87 157 36% 64% 0,006 o % % o 1+ 28 72 1 26 8 21% 79% Mut % % Mut 2+ 1 17 6% 94% Mut Prueba exacta de Fisher No No Prueba PS Ciru Ciru ciru ciru valor de P exacta de N12 gía gía g.

g.

Fisher Pes 89 181 33 67 0,310 PSN Ciru Ciru valor de P No No o % % 8, gía gía cirug cirug 12, .

.

13 1+ 23 77 Pes 7 24 73 120 38% 62% 0,005 Mut % % o 1 17 25% 75% Mut 2+ 2 21 9% 91% Mut PS No Ciru No Ciru valor de P N13 ciru gía ciru gía g.

g.

Pes 93 175 0,002 o % % 1+ 91 3 9% Mut % La Tabla 22 muestra tablas 2x2 con "Cirugía" vs. "No cirugía", y no "Complicaciones" vs. "Sin complicaciones". Nuevamente sólo PSN13 resultó ser significativo (considerado individualmente).

El gen NOD2 codifica un receptor intracelular de reconocimiento de patrones que participa en la inmunidad innata. Tres mutaciones específicas en este gen resultan en una pérdida de función y se asocian a aproximadamente un tercio de los casos de enfermedad de Crohn. Además, estas variantes de NOD2 podrían presentar valor pronóstico, ya que se han asociado a enfermedad ileal, al desarrollo de estenosis intestinales y a la progresión temprana a cirugía.

Se genotiparon tres polimorfismos de un solo nucleótido (PSN8/R702W, PSN12/G908R y PSN13/3020insC) en pacientes (N=301) con enfermedad de Crohn. Se construyeron tablas de contingencia para mutaciones vs. complicaciones (comportamiento-fenotipo estenosante o penetrante) y para mutaciones vs. necesidad de cirugía (cirugías gastrointestinales excluyendo las cirugías perianales). Se evaluaron las asociaciones mediante la prueba exacta de Fisher. Debido al reducido número de muestras con mutaciones homocigóticas, aquellos con mutaciones heterocigóticas u homocigóticas fueron agrupados en una única categoría y después comparados con los genotipos de tipo salvaje. Se construyeron tablas de contingencia para ambos PSN individuales. Para PSN8, la distribución genética fue: 87,4% de tipo salvaje, 11,6% mutante heterocigótico y 1,1% mutante homocigótico. Para PSN12, la distribución era: 89,7%, 9,0% y 1,3%, respectivamente; y para PSN13, la distribución era: 89%, 8,6% y 2,3%. Para la combinación de los tres PSN, la distribución era: 81% de tipo salvaje, 13% con una mutación y 6% con dos o más mutaciones. Para la combinación de los tres PSN, la proporción con complicaciones era de 56%, 61% y 83% para aquellos con cero, una o dos o más mutaciones, respectivamente (p<0,05) y con respecto a la proporción que progresó a cirugía, las tasas fueron de 62%, 75% y 91%, respectivamente (p<0,01). Las mutaciones en NOD2/CARD15 se encontraban significativamente asociadas a tasas elevadas de comportamiento de la enfermedad complicante y progresión a cirugía para los pacientes con enfermedad de Crohn, sugiriendo que el genotipado de NOD2/CARD15 presenta valor pronóstico en el control clínico de la enfermedad de Crohn. Ejemplo 15. Análisis estadístico de marcadores y progresión de la enfermedad de Crohn.

El presente ejemplo ilustra diversos análisis estadísticos de los datos de marcadores obtenidos del estudio transversal descrito en el Ejemplo 14 para ayudar o asistir en la predicción del riesgo de complicaciones de la enfermedad (estenosantes/penetrantes) y/o la necesidad de cirugía en pacientes con la enfermedad de Crohn. En particular, el presente ejemplo demuestra que los pacientes con un número más alto de marcadores y un nivel más alto de marcadores presentan una probabilidad más alta de comportamiento de la enfermedad complicante y/o progresión a cirugía. En el presente estudio, se midió un panel de biomarcadores (séricos, genéticos y/o proteicos). Se convirtió cada puntuación de biomarcador en un percentil (0-100%). Se calculó el percentil promedio. Se da a conocer que todos los marcadores contribuyen igualmente. Se da a conocer que además se utiliza un promedio ponderado (por ejemplo para mejorar la utilidad). Basándose en el percentil promedio, se asigna cada paciente a una de cinco categorías de riesgo posibles: (1) muy bajo; (2) bajo; (3) medio; (4) alto; o (5) muy alto. Las Tablas 23 a 25 muestran los resultados para 773 (66%) pacientes en el estudio.

Tabla 23: Complicaciones de enfermedad (Estenosante/Penetrante) Basado en una media de percentiles (ocho marcadores)

Percentil

Recuento

Porcentaje con

Categoría

promedio

complicaciones

Muy bajo 0% -20% 53 17% Bajo 20% -40% 218 42% Medio 40% -60% 303 60% Alto 60% -80% 168 69% Muy alto 80% -100% 31 87% Total 773 La Tabla 23 muestra que los pacientes con un número más alto de marcadores elevados (y, por lo tanto, en un grupo de percentil promedio más alto y asignados a una categoría de riesgo más alta) presentan un riesgo más alto de desarrollar complicaciones y, de esta manera, presentan un pronóstico de la enfermedad pobre. La figura 21 ilustra que la identificación precoz de marcadores en combinación con un tratamiento apropiado reduce el riesgo, aunque también que un número más alto de marcadores elevados se asocia a una probabilidad más alta de un suceso tal como comportamiento de enfermedad complicante.

Tabla 24A: Complicaciones de enfermedad - Porcentaje durante el tiempo

Categoría

Percentil promedio

Global

0-5 años

0-10 años

11+ años

Muy bajo 0% - 20% 0,19 0,06 0,11 0,24 Bajo 20% -40% 0,43 0,34 0,40 0,45 Medio 40% -60% 0,60 0,53 0,56 0,62 Alto 60% -80% 0,70 0,56 0,60 0,79 Muy alto 80% -100% 0,88 0,67 0,86 0,89 Tabla 24B: Complicaciones de enfermedad - recuentos de muestras

Categoría Percentil promedio

Años conoc.

0-5 años

0-10 años

11+ años

Muy bajo 0% -20% 48 16 19 29 Bajo 20% -40% 188 59 93 95 Medio 40% -60% 257 73 110 147 Alto 60% -80% 149 68 81 Muy alto 80% -100% 26 3 7 19 Total 668 196 297 371 Las Tablas 24A/B muestran un promedio no ponderado de percentiles de 8 biomarcadores. En particular, la Tabla 24A ilustra que los pacientes con un número más alto de marcadores elevados (y, por lo tanto, en un grupo de percentil promedio más alto y asignados a una categoría de riesgo más alta) presentan un riesgo más alto de desarrollar complicaciones durante el tiempo. De esta manera, los métodos descritos en la presente memoria pueden identificar dichos pacientes tempranamente en el curso de su enfermedad y permitir al médico considerar una terapia más agresiva.

Tabla 25A: Progresión a cirugía - Porcentaje durante el tiempo

Categoría

Percentil promedio

Global

0-5 años

0-10 años

11+ años

Muy bajo 0% -20% 0,23 0,13 0,11 0,31 Bajo 20% - 40% 0,46 0,34 0,44 0,47 Medio 40 -60% 0,64 0,37 0,45 0,78 Alto 60% - 80% 0,68 0,44 0,53 0,81 Muy alto 80% -100% 0,81 0,33 0,57 0,89 Tabla 25B: Progresión a cirugía - recuentos de muestras

Percentil

Categoría

Global

0-5 años

0-10 años

11+ años

promedio

Muy bajo 0% -20% 48 16 19 29 Bajo 20% -40% 188 59 93 95 Medio 40 -60% 257 73 110 147 Alto 60% -80% 68 81 Muy alto 80% -100% 26 3 7 19 Total 668 196 297 371 Las Tablas 25A/B muestran un promedio no ponderado de percentiles de 8 biomarcadores. En particular, la Tabla 25A ilustra que los pacientes con un número más alto de marcadores elevados (y, por lo tanto, en un grupo de percentil promedio más alto y asignados a una categoría de riesgo más alta) presentan una probabilidad más alta de progresión a cirugía durante el tiempo. De esta manera, los métodos descritos en la presente memoria pueden identificar dichos pacientes tempranamente en el curso de su enfermedad y permitir al médico considerar una terapia más agresiva.

Tabla 26. Complicaciones - Análisis de cuartiles de marcadores individuales Cuartil 1 Cuartil 2 Cuartil 3 Cuartil 4 IgA-AASC 38% 54% 68% 74% IgG-AASC 43% 53% 69% 73% CBir1 45% 55% 65% 71% OmpC 43% 57% 65% 74% I2 50% 60% 65% 60% PRC 53% 56% 60% 68% AAS 46% 61% 63% 67% MAIC1 51% 57% 65% 63% MACV1 53% 53% 64% 67% FCE 51% 59% 61% 65% La Tabla 26 muestra la asociación entre la puntuación de cuartiles y el porcentaje de riesgo de complicaciones de enfermedad para un solo marcador. De manera similar, la Tabla 22 proporciona un diagrama que muestra la asociación entre la puntuación de cuartiles y el porcentaje de riesgo de desarrollar un comportamiento de enfermedad complicante para un solo marcador. En particular, una puntuación de cuartiles más alta para cada marcador individuo se asoció típicamente a un porcentaje de riesgo más alto de complicaciones de enfermedad, tales como enfermedad estenosante interna y/o penetrante interna.

Tabla 27. Cirugía - Análisis de cuartiles de marcadores individuales Cuartil 1 Cuartil 2 Cuartil 3 Cuartil 4 IgA-AASC 32% 48% 64% 69% IgG-AASC 31% 50% 63% 70% CBir1 46% 52% 55% 61% OmpC 40% 46% 62% 69% I2 47% 57% 60% 52% PRC 54% 56% 54% 52% AAS 53% 58% 49% 56% MAIC1 51% 58% 57% 50% MACV1 51% 51% 62% 52% FCE 58% 60% 48% 50% La Tabla 27 muestra la asociación entre la puntuación de cuartiles y el porcentaje de riesgo de cirugía para un solo marcador. De manera similar, la Tabla 23 proporciona un diagrama que muestra la asociación entre la puntuación de cuartiles y el porcentaje de riesgo de progresión a cirugía para un solo marcador. En particular, una puntuación de cuartiles más alta para muchos de los marcadores individuales se asoció a un porcentaje de riesgo más alto de necesidad de cirugía.

Tabla 28. Cirugía - nº de marcadores elevados (de entre 5) Porcentaje del Número Elevado Porcentaje Cirugía Recuento recuento 38% 71 9% 1 32% 153 20% 2 46% 157 20% 3 65% 172 22% 4 66% 148 19% 76% 78 10% Total: 779 La Tabla 28 muestra la asociación entre el número de marcadores elevados y el porcentaje de riesgo de cirugía. Los marcadores eran los siguientes: IgA-AASC, IgG-AASC, anti-CBir1, anti-OmpC y anti-I2. La Tabla 24 proporciona un diagrama que muestra la asociación entre el número de marcadores elevados y el porcentaje de riesgo de progresión a cirugía. En particular, un número más alto de marcadores elevados se asoció a un porcentaje de riesgo más alto de necesidad de cirugía.

En conclusión, el presente ejemplo demuestra la utilidad pronóstica de los métodos para predecir con exactitud el riesgo (por ejemplo la probabilidad, etc.) de complicaciones de la enfermedad (por ejemplo estenosante interna y/o penetrante interna) y/o de la progresión a cirugía en pacientes con enfermedad de Crohn. Ejemplo 16. Un nuevo ensayo pronóstico para predecir el curso clínico de la enfermedad de Crohn.

I. INTRODUCCIÓN 1. Descripción general

La enfermedad intestinal inflamatoria (EII) es un trastorno inflamatorio crónico del tracto gastrointestinal. La causa exacta de la EII no se conoce con exactitud, aunque está generalmente aceptado que la susceptibilidad a la enfermedad implica factores genéticos y ambientales que conducen a la desregulación de la respuesta inmunológica (Strober et al., J. Clin. Invest. 117:514-521, 2007). La EII se presenta principalmente como enfermedad de Crohn (EC) o colitis ulcerosa (CU). La EC puede encontrarse presente en cualquier parte del tracto gastrointestinal, aunque se observa más frecuentemente en el intestino delgado distal y colon proximal y el proceso inflamatorio se extiende transmuralmente. En la CU, la inflamación se restringe al colon y se encuentra limitada a la mucosa. Aproximadamente 1,4 millones de personas en los E.E.U.U., incluyendo adultos y ñiños, sufre de EII, presentando un número igual EC y CU (Loftus, Gastroenterology 126:1504-1517, 2004). El curso de la EII no es predecible. Algunos pacientes sólo presentan unos cuantos episodios de enfermedad activa durante su vida, con periodos prolongados de remisión entre ellos; para otros, la enfermedad activa es persistente e incluso debilitante. Los estudios de historia natural de la EC han demostrado que en muchos pacientes se produce una progresión significativa del comportamiento de la enfermedad durante el tiempo (Louis et al., Gut 49:777-782, 2001). En un estudio, este cambio resultó evidente en menos de un año, y tras 10 años, el 50% de los pacientes había progresado a un fenotipo de enfermedad complicada marcado por la presencia de estenosis y perforaciones intestinales. Existe evidencia creciente de que los biomarcadores séricos proporcionen conocimientos clínicos para predecir el comportamiento agresivo de la enfermedad, en particular en pacientes con EC. Claramente la capacidad de estratificar los pacientes en pacientes de bajo o alto riesgo en el diagnóstico ayudará al méidco a desarrollar planes de control apropiados. Lo anterior resulta especialmente importante ya que los últimos datos sugieren que la utilización precoz de terapias biológicas, tales como infliximab, puede alterar la historia natural de la enfermedad, reduciendo las hospitalizaciones y la incidencia de cirugías (Schnitzler et al., Gut 58:492-500, 2009). Una decisión clave a la que con frecuencia se enfrenta el médico es cómo determinar, basándose en el pronóstico de la enfermedad, qué pacientes se beneficiarán de una utilización precoz y potencialmente crónica de estas terapias agresivas, arriesgadas y más caras.

Actualmente puede utilizarse un número limitado de factores clínicos, entre ellos la edad en el momento del diagnóstico, la presencia de enfermedad perianal y la necesidad de esteroides en la primera presentación, para predecir qué pacientes de EC experimentarán un curso de la enfermedad difícil (Beaugerie et al., Gastroenterology 130:650-656, 2006). Utilizando biomarcadores séricos y genéticos, el presente ejemplo describe el desarrollo de un ensayo basado en sangre que ayudará al médico en la predicción del curso clínico de la EC. Este ensayo ha sido desarrollado y validado utilizando muestras en bancos que han confirmado el diagnóstico de EC y también historia médica extensiva que describe el fenotipo de la enfermedad. La capacidad de poder predecir el curso probable de la EC utilizando un ensayo basado en sangre simple resulta beneficiosa tanto para el médico como para el paciente debido a que el médico podrá controlar y tratar mejor los pacientes, mientras que el paciente dispondrá de más información con la que evaluar los riesgos y beneficios de sus opciones terapéuticas.

2. Objetivo y descripción del ensayo 2.1. Ensayo de pronóstico de la enfermedad de Crohn de Prometheus El presente ejemplo describe el desarrollo y validación del ensayo pronóstico de la enfermedad de Crohn de Prometheus, un análisis de sangre que puede utilizarse para evaluar el riesgo de que la EC progrese a un tipo de enfermedad complicada. Se define la EC complicada como presentando una enfermedad estenosante o penetrante interna, mientras que "no complicada" indica una enfermedad no estenosante, no penetrante.

El ensayo pronóstico de la enfermedad de Crohn de Prometheus contiene un total de 9 marcadores, entre ellos: Analito Formato de ensayo IgA-AASC ELISA IgG-AASC ELISA Anti-OmpC ELISA Anti-CBir1 ELISA ANACp Inmunofluorescencia indirecta Anti-I2 ELISA PCR de genotipado para identificar tres mutaciones del gen NOD2: (1) R702 W; (2) NOD2 G908R; (3) 3020InsC El ensayo anti-I2 utiliza una placa de ELISA de formato estándar de tipo sándwich de 96 pocillos. Se captura sobre la placa una proteína con etiqueta de GST replegado que consiste de una secuencia de I2 de 100 aminoácidos, utilizando un anticuerpo monoclonal anti-GST que recubre la superficie de los pocillos. Las muestras de suero del paciente se diluyen 1:100 para llevar la concentración del anticuerpo al intervalo de la curva estándar. Tras la incubación de las muestras de suero en los pocillos, se llevó a cabo la detección de los anticuerpos anti-I2 utilizando reactivo de anti-IgA humana conjugado con enzima fosfatasa alcalina. La reacción se reveló utilizando una solución de sustrato quimioluminiscente.

El rendimiento analítico del ensayo de PCR de genotipado de NOD2 consiste del ensayo de tres polimorfismos de un solo nucleótido (PSN) no sinónimos. PSN8 es un 2104C-T en el exón 4 que resulta en una sustitución R702W (rs2066845); PSN12 es un 2722 G-C en el exón 8 que resulta en una sustitución G908R (rs2066844) y PSN13 es una inserción de C en el exón 11 (3020InsC) que resulta en un desplazamiento de marco (1007fs) (rs5743293). El método de PCR de discriminación alélica incluye dos secuencias oligonucleótidas específicas con dos pigmentos fluorescentes diferentes en el extremo 5' de la secuencia (es decir, una sonda fluorogénica con pigment oFAM o pigmento VIC), presentando cada uno un inhibidor no fluorescente en el extremo 3' de la secuencia unida a un ligante de surco menor (intensificador de la temperatura de fusión). Durante la amplificación por PCR, cada sonda se hibrida específicamente con su secuencia complementaria entre un cebador directo y uno inverso en el ADN diana.

Debido a que la ADN polimerasa presenta una actividad de 5'-nucleasa intrínseca, se produce un corte selectivo de las sondas que se hibridan con la secuencia genómica. Lo anterior resulta en una fluorescencia incrementada debido a la separación del pigmento informador respecto del inhibidor. Por lo tanto, el incremento selectivo de un pigmento frente a otro (FAM vs. VIC) indica los alelos que se encuentran presentes en el ADN genómico considerado. Puede determinarse un genotipo de muestra mediante el examen de la intensidad relativa de fluorescencia del pigmento de cada sonda. Utilizando el software SDS 7000 de ABI, puede generarse un gráfico de las intensidades de los dos pigmentos. El ensayo pronóstico de la enfermedad de Crohn de Prometheus incluye además un algoritmo de análisis de los datos. El resultado de ensayo final es una puntuación de probabilidad que refleja la probabilidad teórica de que el paciente progrese a un fenotipo de EC complicado. 2.2 Ventajas del ensayo pronóstico de la enfermedad de Crohn de Prometheus El ensayo pronóstico de la enfermedad de Crohn de Prometheus proporciona ventajosamente datos tanto séricos como genéticos que ayudan al médico a estratificar el riesgo (probabilidad) de que sus pacientes de Crohn desarrollen complicaciones de la enfermedad durante el tiempo. Es el primer y único ensayo en el mercado que utiliza serogenética para evaluar la probabilidad de desarrollar complicaciones de la enfermedad en pacientes de Crohn durante el tiempo. Utiliza 6 biomarcadores séricos y 3 mutaciones de NOD2/CARD5 para evaluar el perfil de riesgo del paciente. Proporciona resultados completos que ayudan al médico, en combinación con resultados clínicos adicionales, a tomar las decisiones más informadas posibles para el control de sus pacientes. Proporciona además una vista general rápida del perfil de riesgos serogenético del paciente de Crohn en un informe de ensayo de fácil lectura. II. METODOLOGÍA

1. Validez clínica Para el ensayo pronóstico de la enfermedad de Crohn de Prometheus descrito en el presente ejemplo, se utilizó un subgrupo de 619 muestras de pacientes de EC (51% mujeres y 49% hombres) en el desarrollo y validación del ensayo. Los pacientes fueron diagnosticados de EC basándose en una combinación de criterios que pueden incluir síntomas clínicos, endoscopia, histopatología, cápsula videográfica o estudios radiográficos. Se utilizó dicha cohorte debido a que se dispone de información médica extensiva para estos pacientes, incluyendo la fecha de diagnóstico, el número y tipo de cirugías relacionadas con la EC, localización de la enfermedad y fenotipo de la enfermedad. Los pacientes fueron clasificados como en enfermedad no penetrante/no estenosante (enfermedad no complicada) o estenosante o penetrante (enfermedad complicada), (1) por personal médico en origen basándose en los datos del historial médico, o (2) por personal médico de Prometheus basándose en datos sobre los procedimientos quirúrgicos realizados para tratar complicaciones específicas. Los pacientes con enfermedad penetrante perianal se clasificaron en enfermedad complicada; los pacientes con exclusivamente enfermedad perianal no complicada no fueron incluidos en la cohorte.

La totalidad de las muestras de suero fueron sometidas a ensayo mediante ELISA para anti-CBir1, anti-OmpC, anti- I2, IgA-AASC e IgG-AASC y mediante IFA para ANACp. Se aisló el ADN de 157 muestras de suero y éstas se genotiparon para NOD2.

III. PROCEDIMIENTOS DE VALIDACIÓN 1. Objetivo del ensayo de anti-I2 Se utilizó el ELISA de anti-I2 para determinar el nivel de anticuerpos anti-I2 en el suero de los pacientes. Se utilizó el ensayo de anti-I2 conjuntamente con los demás marcadores para el pronóstico de la enfermedad de Crohn. 2. Formato del ensayo de anti-I2 El ensayo anti-I2 utiliza una placa de ELISA de formato estándar de tipo sándwich de 96 pocillos. Se capturó sobre la placa una proteína con etiqueta de GST replegado que consistía de 100 aminoácidos de la secuencia de I2 utilizando un anticuerpo monoclonal anti-GST que recubría la superficie de los pocillos. Las muestras de suero del paciente se diluyeron 1:100 y/o 1:200 para llevar la concentración del anticuerpo al intervalo de la curva estándar. Tras la incubación de las muestras de suero en los pocillos, se llevó a cabo la detección de los anticuerpos anti-I2 utilizando reactivo de anti-IgA humana conjugado con enzima fosfatasa alcalina. La reacción se reveló utilizando una solución de sustrato quimioluminiscente.

El Ejemplo 19 describe la purificción del antígeno GST-I2. El Ejemplo 20 describe el procedimiento de ensayo de ELISA de anti-I2. 3. Requisitos de los especímenes

Se extrajo sangre completa del paciente en tubos separadores de suero (TSS). Los tubos se enviaron dentro de los primeros 7 días a Prometheus Laboratories, bajo condiciones de temperatura ambiente o utilizando Cold-pack. Antes de enviar los tubos se almacenaron bajo condiciones de refrigeración.

4. Rendimiento del ensayo de validación Se llevó a cabo una serie de ensayos ELISA de anti-I2 siguiendo el protocolo de validación descrito en el Ejemplo 21. El rendimiento del ensayo fue evaluado por tres analistas que llevaron a cabo el ensayo en cinco días diferentes (15 ensayos en total). La validación se llevó a cabo utilizando tres lotes de preparaciones de antígeno. El estudio distinguió entre los efectos de operador y de lote. Cada uno de los tres operadores utilizó un lote diferente por lo menos una vez durante la validación de cinco días. Los resultados del presente estudio permitieron evaluar las características de rendimiento del ELISA de anti-I2 para (i) el rendimiento de la curva de estándares, (ii) la concentración mínima detectable (CMD), (iii) el intervalo de referencia, (iv) precisión/exactitud, (v) linealidad de dilución, (vi) estudios de estabilidad e (vii) interferencia. 4.1 Curvas de estándares La curva de estándares se obtuvo a partir de siete calibradores asignados a 100 unidades de ELISA (UE), 53,3 UE, 40 UE, 20 UE, 10 UE, 2,5 UE, 0,625 UE y un estándar cero. Se utilizó el software SoftMax para ajustar una curva de 4 parámetros a los estándares. Se generaron las curvas de estándares por duplicado en una serie de 15 ensayos. Se muestran los resultados en la Tabla 29: Tabla 29: Curva de estándares 100 UE 53,3 UE 40 UE 20 UE 10 UE 2,5 UE 0,625 UE Estándar Est. 7 Est. 6 Est. 5 Est. 4 Est. 3 Est. 2 Est. 1 CV medio (%) 4,93% 3,75% 2,59% 2,95% 3,25% 7,80% 23,13% SD 0,04 0,02 0,02 0,03 0,03 0,09 0,28 El valor de R2 medio para el ajuste de curva de 4 parámetros (n=15) era de 0,999. Basándose en los criterios de aceptación de CV≤10%, el intervalo informable se fija entre el estándar 2 (2,5 UE) y el estándar 7 (100 UE) con un intervalo de CV de entre 2,59% y 7,8%. El estándar 1 (0,625 UE) no se utilizará como valor informable inferior debido al CV de 23,13%.

4.2. Límites de detección y cuantificación Se determinó la concentración mínima detectable (CMD) utilizando un total de 20 réplicas de los estándares cero (blanco) en cada uno de los 15 ensayos. Se calculó la absorbancia media más dos desviaciones estándares (+2SD) para cada ensayo y se convirtió en las concentraciones apropiadas utilizando la ecuación de la curva logística de 4 parámetros generada para cada ensayo.

Tabla 30: Límites de detección mínimos CMD n=12* media 0,57 UE SD 0,59 UE Min.

0,00 UE Max.

1,68 UE Media + 2SD 1,75 UE *Se excluyeron tres ensayos del cálculo de la CMD Conclusión: La sensibilidad analítica del ensayo, definida como la CMD, era de 1,75 UE. 4.3 Intervalo de referencia Se determinó el intervalo de referencia utilizando 40 controles sanos. Las muestras se diluyeron 1/100 para el ensayo. Los resultados muestran la concentración ajustada. Los intervalos de confianza de noventa y cinco por ciento (media +/- 1,96 desviaciones estándares) se definen como el intervalo normal.

Tabla 31: Intervalo de referencia n=40 Conc. media 185,04 UE SD 93,25 UE Media+1,96xSD 367,80 UE Media-1,96xSD 2,27 UE Conclusión: Las muestras con valores superiores a 367,80 UE se consideran positivas para anti-I2. 4.4 Precisión/Exactitud Se determinó la precisión intraensayo (precisión dentro del ensayo) utilizando 16 réplicas de tres controles diferentes (Alto, Medio y Bajo preparados a partir de una agrupación de sueros humanos) en una única placa analizada por tres analistas en cada uno de los ensayos. Las muestras se diluyeron 1/10 para el ensayo. Los resultados muestran la concentración ajustada. En la Tabla 32 se resumen la concentración media de las réplicas, la desviación estándar y el CV (%) para cada control.

Tabla 32: Precisión intraensayo Media UE SD CV (%) Analista 1 Bajo 71,68 4,34 6,1% Medio 155,02 12,18 7,9% Alto 510,56 38,78 7,6% Analista 2 Bajo 62,71 4,95 7,9% Medio 135,81 9,98 7,3% Alto 471,59 37,44 7,9% Analista 3 Bajo 58,22 9,05 15,5% Medio 107,56 9,03 8,4% Alto 311,94 25,18 8,1% Se determinó la reproducibilidad inter-ensayo (precisión entre ensayos) sometiendo a ensayo tres controles diferentes en quince placas diferentes. En la Tabla 33 se resumen la concentración media de las réplicas, la desviación estándar y el CV (%) para cada control.

Tabla 33: Reproducibilidad inter-ensayo Media UE SD CV (%) BAJO 77,50 7,95 9,85% MED.

147,82 11,98 6,73% ALTO 500,12 49,81 9,18% Conclusión: la precisión dentro del ensayo (intraensayo) se encontraba comprendida entre 6,1% y 8,4% de CV, con la excepción de la muestra de control Bajo del analista 3, con un CV (%) de 15,5%. Globalmente la precisión intraensayo se encontraba dentro de los límites aceptables. La precisión entre ensayos (reproducibilidad inter- ensayo) se encontraba comprendida entre 6,73% y 9,85% CV y también se encontraba dentro de los límites aceptables.

4.5 Linealidad de dilución Para que un ensayo sea cuantitativo, las muestras deben diluirse linealmente y en paralelo con la curva de estándares. Se evaluó la linealidad de dilución utilizando cinco diluciones de dos veces en serie de los controles alto, medio y bajo (Neat), partiendo de 1/2. Las muestras se diluyeron 1/10 para el ensayo. Los resultados muestran la concentración ajustada. Se determinó el porcentaje de recuperación. También se calculó la regresión lineal (R2) para confirmar que la dilución de la muestra se correlacionaba linealmente con las unidades de ELISA calculadas. Se sometió a ensayo la linealidad de dilución cinco veces para cada control y se representa a continuación (Tabla 34).

Tabla 34: Linealidad de dilución Control alto Media intraensayo (n=5) UE UE % de esperadas reales recuperación 1;1 567,49 97% 1;2 283,75 276,21 1;4 141,87 141,51 100% 1;8 70,94 66,01 93% 1;16 35,47 32,42 91% 1;32 17,73 18,81 106% R2= 0,9994 Control medio Media intraensayo (n=5) UE % de UE reales esperadas recuperación 1;1 158,47 1;2 79,23 74,86 94% 1;4 39,62 37,69 95% 1;8 19,81 18,79 95% 1;16 9,90 11,39 115% 1;32 4,95 6,50 131% R2 = 0,9994 Control bajo Media intraensayo (n=5) UE % de UE reales esperadas recuperación 1;1 100,63 1;2 50,31 52,16 104% 1;4 25,16 30,10 120% 1;8 12,58 14,72 117% 1;16 6,29 7,81 124% 1;32 3,14 4,37 139% R2 = 0,9946 El porcentaje de recuperación era aceptable. Los valores de UE reales para la dilución más alta del control medio y las dos diluciones más altas del control bajo eran inferiores a la concentración mínima detectable del ensayo no deberían considerarse. Todas las muestras de control presentaban valores de R2 de entre 0,993 y 0,999, y la linealidad se considera aceptable. 4.6 Estudios de estabilidad Tres analistas llevaron a cabo ensayos de estabilidad el mismo día (3 placas). Se preparó cada ensayo de muestra y se almacenó a -80ºC. Los controles alto, medio y bajo se incubaron a temperatura ambiente o a 2-8ºC durante 1, 2, 4 o 7 días. Los controles tratados se sometieron a ensayo y se compararon con los controles no tratados (Tabla 35). Los resultados se expresan como porcentaje (%) de recuperación de la concentración calculada inicial.

Tabla 35: Estabilidad a temperatura ambiente (TA) y a 2-8ºC de los controles de anti-I2 % de recuperación Bajo Medio Alto TA día 1 93% 86% 94% TA día 2 90% 88% 93% TA día 4 92% 86% 87% TA día 7 87% 96% 80% 4°C día 1 97% 107% 85% 4°C día 2 94% 104% 110% 4°C día 4 101% 97% 113% 4°C día 7 103% 93% 88% Conclusión: Basándose en el valor de % de recuperación, los anticuerpos anti-I2 son estables hasta un máximo de 7 días a temperatura ambiente o a 2-8ºC.

Los controles alto, medio y bajo se sometieron a cinco ciclos de congelación y descongelación. Los controles tratados se sometieron a ensayo y se compararon con los controles no tratados (Tabla 36). Los resultados se expresan como porcentaje (%) de recuperación de la concentración calculada inicial.

Tabla 36: Estabilidad de congelación y descongelación (CD) de los controles de anti-I2 % de recuperación Alto Intermedio Bajo CD1 106% 88% 81% CD2 94% 95% 102% CD3 94% 90% 124% CD4 96% 91% 93% CD5 108% 106% 110% Conclusión: Sólo un valor caía fuera de un intervalo de porcentaje de recuperación de entre 80% y 120%: el control bajo sometido a ensayo tras tres ciclos de congelación-descongelación (124%). El análisis posterior del control bajo tras 4 y 5 ciclos de congelación/descongelación resultó en una recuperación de 93% y 110%, respectivamente.

Basándose en los valores de % de recuperación, las muestras de suero que contenían anticuerpos anti-I2 eran estables durante 1 a 5 ciclos de congelación/descongelación. Se sometieron alícuotas de antígeno GST-I2 a uno, tres y cinco ciclos de congelación-descongelación y se sometieron a ensayo y compararon con muestras que se habían mantenido congeladas. Las placas con controles de GST-I2 se sometieron a ensayo y se compararon con los GST-I2 tratados (Tabla 37). Los resultados se expresan como porcentaje (%) de recuperación de los controles alto, medio y bajo de la concentración calculada inicial.

Tabla 37: Estabilidad de congelación y descongelación (CD) del antígeno GST-I2 % de recuperación CD1 CD3 CD5 89% 105% 101% Bajo Medio Alto 107% 110% 116% 101% 97% 118% Conclusión: el antígeno GST-I2 era estable durante un máximo de 5 ciclos de congelación/descongelación. Se evaluó la estabilidad de los estándares. Se dividió la solución madre de estándares en dos alícuotas y se almacenaron a 2-8ºC durante 7 días y durante 14 días. Los estándares tratados se sometieron a ensayo y se compararon con los estándares no tratados (Tabla 38). Los resultados se expresan como porcentaje (%) de recuperación de la concentración calculada inicial.

Tabla 38: Estabilidad de los estándares a 2-8ºC % de recuperación Día 7 Día 14 Est. 7 93% 97% Est. 6 79% 88% Est. 5 110% 97% Est. 4 99% 120% Est. 3 95% 105% Est. 2 98% 92% Est. 1 85% 88% Conclusión: Los estándares pueden almacenarse a 4ºC durante 14 días.

4.7 Interferencia Para determinar si el factor reumatoide (FR) o el suero hemolizado interfiere en el ensayo, se sometieron a ensayo controles alto, medio y bajo en presencia de suero positivo para FR (muestra obtenida de Aalto Scientific) o muestra hemolizada. En primer lugar los resultados de línea base de cada uno de los compuestos analizados individualmente como dilución 1/10 en diluyente se muestran en la Tabla 39. El resultado de anti-I2 con sangre hemolizada solo se encuentra sobre el valor de control bajo. El suero positivo para FR solo mostraba una señal positiva elevada. En segundo lugar, se añadió a los controles alto, medio y bajo un volumen igual de suero hemolizado o FR. Se compararon las recuperaciones de anti-I2 de los controles con adición, con las recuperaciones de cada una de las muestras de suero solo (Tabla 39). Los resultados mostrados en la Tabla 39 se expresan como porcentaje (%) de recuperación de la concentración calculada inicial.

Tabla 39: Interferencia % de Media UE recuperación Alto 233,28 Med.

115,62 Bajo 76,21 Hemo 91,38 FR 572,39 Alto+Hemo 229,38 71% Med+Hemo 145,06 70% Bajo+Hemo 116,89 70% Alto+FR 726,35 90% Med+FR 619,55 90% Bajo+FR 582,77 90% Al someter a ensayo los controles alto, medio y bajo en presencia de suero hemolizado y suero positivo para FR, sólo el suero hemolizado mostró una reducción significativa del % de recuperación. Basándose en los resultados indicados en la presente memoria, tanto el suero hemolizado como el suero positivo para FR interfieren con la detección exacta de anti-I2. Para mitigar el efecto de dicha interferencia sobre el ensayo, se rechazarán las muestras con sangre hemolizada visible. La mitigación de la interferencia con FR no puede conseguirse mediante el rechazo de muestras específicas. Sin embargo, la literatura médica sugiere que no existe ninguna asociación entre la enfermedad de Crohn y estados de enfermedad en los que el FR se expresa en el suero (principalmente la artritis reumatoide). Por el contrario, puede esperarse que la frecuencia de artritis reumatoide en los pacientes de EC sea similar a la observada en la población general; la prevalencia mundial de AR se estima en 0,8% (Rindfleisch et al., Am. Fam. Physician 72:1037-1047, 2005). Además, sólo aproximadamente 80% de los pacientes de AR expresan FR. De esta manera, los presentes inventores estiman que sólo aproximadamente 0,64% (0,008 x 0,8=0,0064) de las muestras recibidas resultará afectado por la interferencia por FR. Se determinaron los efectos de diversas sustancias sobre el rendimiento del ensayo de anti-I2. Se añadieron a los controles alto, medio y bajo, bilirrubina (400 µg/ml), colesterol (5 mg/ml), heparina (80 U/ml), EDTA (1,8 mg/ml) o hemoglobina (5 mg/ml). Se calculó el porcentaje (%) de anti-I2 recuperado en el control con adición (Tabla 40). Los resultados se expresan como porcentaje (%) de recuperación de la concentración calculada inicial.

Tabla 40: Interferencia con el ensayo de anti-I2 de diversas sustancias % de Media UE recuperación Alto 386,11 Med.

135,78 Bajo 67,05 Alto+Bil.

345,59 90% Med+Bil.

127,38 94% Bajo+Bil.

75,39 112% Alto+Col.

344,65 89% Med+Col.

121,51 89% Bajo+Col.

95,37 142% Alto+Hep.

372,03 96% Med+Hep.

142,19 105% Bajo+Hep.

86,99 130% Alto+EDTA 469,69 122% Med+EDTA 171,01 126% Bajo+EDTA 75,44 113% Alto+Hemog.

404,38 105% Med+Hemog.

162,05 119% Bajo+Hemog.

113,08 169% Conclusión: la detección de anti-I2 se encuentra dentro de un intervalo aceptable, con la excepción de los controles bajos con adición de colesterol, heparina y hemoglobina. Estas tres sustancias incrementaron el % de recuperación (142%, 130% y 169%, respectivamente) en el caso de que la cantidad de anti-I2 en el suero fuese baja.

IV. REPRODUCIBILIDAD DE LA PREPARACIÓN DE ANTÍGENO GST-I2 Se generaron tres preparaciones de antígenos utilizando el mismo protocolo y 3 lotes diferentes de tampones. Se separaron dos (2) µg de cada preparación purificada de antígeno en un gel desnaturalizante y se tiñeron con azul brillante de Coomassie, tal como se muestra en la figura 25. Para cada preparación de antígeno I2, se detectó una única banda consistente en el peso molecular predicho (37 kDa). También se observó una banda de más peso, 70 kDa, que mostraba la presencia de dímero de antígeno en la preparación. Conclusión: el método para la preparación de antígeno I2 es reproducible.

V. ÁNÁLISIS ESTADÍSTICO El ensayo pronóstico de la enfermedad de Crohn de Prometheus predice la probabilidad de desarrollar un fenotipo de enfermedad estenosante (fibroestenosante) o penetrante (fistulizante), colectivamente denominado fenotipo de enfermedad complicada. En la práctica, el ensayo pronóstico de enfermedad de Crohn de Prometheus es un modelo de regresión logística; la variable dependiente es la probabilidad deseada de complicación. En las secciones siguientes se analizaron en primer lugar los biomarcadores de manera individual. A continuación se describe la puntuación del compuesto (PSC o puntuación de suma de cuartiles). A continuación se presenta en detalle el modelo de regresión logística completo. Finalmente, el rendimiento del modelo de regresión logística se describe en la sección siguiente, Validación del algoritmo. 1. Biomarcadores individuales

Tal como se ha indicado anteriormente, hay nueve biomarcadores: cinco ELISA, una inmunofluorescencia indirecta y tres PCR de genotipado. Para los biomarcadores de ELISA y de inmunofluorescencia, se sometieron a ensayo 619 muestras. Para los biomarcadores de genotipado, se sometió a ensayo un subgrupo de 159 muestras. 1.1 Marcadores de ELISA Para cada uno de los cinco biomarcadores de ELISA (IgA-AASC, IgG-AASC, anti-CBir1, anti-OmpC y anti-I2), la puntuación numérica de biomarcador (en unidades de ELISA estandarizadas) se convirtió en una puntuación de cuartil. Concretamente, el cuarto inferior de puntuaciones numéricas se convirtió en una puntuación de "1", el siguiente 25% de puntuaciones se convirtió en una puntuación de "2", el tercer cuartil se convirtió en "3" y el cuartil superior se convirtió en "4". La Tabla 41 muestra los valores de corte para los cuartiles de cada uno de los cinco biomarcadores de ELISA: Tabla 41: valores de corte de cuartiles Cuartil 1 Cuartil 2 Cuartil 3 Cuartil 4 IgA-AASC < 6,2 6,2 -18,0 18,1-50,9 60,0+ IgG-AASC < 11,7 11,7-29,3 29,4-71,9 72,0+ Anti-CBir1 < 17,0 17,0-35,3 35,4-69,8 69,9+ Anti-OmpC < 7,8 7,8-12,8 12,9-24,0 24,1+ Anti-I2 < 206 206 -330 331-488 489+ Las tablas siguientes muestran el número de pacientes con y sin complicaciones de enfermedad para cada biomarcador, en las que los resultados de ELISA se estratificaron según cuartil.

Tabla 42: Stratificación según Complicación vs. No complicación IgA-AASC Q1 Q2 Q3 Q4 No complicación 96 64 39 28 Complicación 59 90 116 127 IgG-AASC Q1 Q2 Q3 Q4 No complicación 83 41 33 Complicación 72 84 114 122 Anti-CBir1 Q1 Q2 Q3 Q4 No complicación 79 62 46 Complicación 76 92 109 115 Anti-OmpC Q1 Q2 Q3 Q4 No complicación 87 64 48 28 Complicación 68 90 107 127 Anti-12 Q1 Q2 Q3 Q4 No complicación 79 61 41 46 Complicación 76 93 114 109 La tabla a continuación resume las tasas de complicaciones para cada biomarcador, estratificadas según cuartil.

Tabla 43: Tasas de complicaciones % Compl.

Q1 Q2 Q3 Q4 IgA-AASC 38,1% 58,4% 74,8% 81,9% IgG-AASC 46,5% 54,5% 73,5% 78,7% Anti-CBir1 49,0% 59,7% 70,3% 74,2% Anti-OmpC 43,9% 58,4% 69,0% 81,9% Anti-I2 49,0% 60,4% 73,5% 70,3% La tabla siguiente muestra los valores de p calculados mediante la prueba de independencia Chi-cuadrado de Pearson para cada una de las tablas de contingencia (recuentos) mostradas anteriormente, en las que la hipótesis nula es que la incidencia de estos resultados es estadísticamente independiente. Todos los valores son altamente significativos, lo que demuestra una asociación entre cuadrantes de biomarcador y complicaciones. En otras palabras, para todos los marcadores, aquellos en los cuartiles más altos presentaban tasas de complicaciones más altas. (Los dos cuartiles superiores de anti-I2 son la única excepción, aunque incluso ellos son aproximadamente comparables).

Tabla 44: valores de p valor de p IgA-AASC < 0,001 IgG-AASC < 0,001 Anti-CBir1 < 0,001 Anti-OmpC < 0,001 Anti-I2 < 0,001 1.2 Inmunofluorescencia indirecta El biomarcador de inmunofluorescencia indirecta ANACp es una variable binaria y no cuantitativa, ya que adopta valor positivo o negativo. Las tablas siguientes muestran los recuentos de complicaciones (Tabla 45) y las tasas de complicaciones (Tabla 46), estratificadas según el estado de ANACp.

Tabla 45: recuentos de complicaciones ANACp Negativa Positiva No compl.

169 58 Complicación 323 69 Tabla 46: Tasas de complicaciones % Compl.

Negativa Positiva ANACp 65,7% 54,3% Para la tabla de recuentos (de contingencia) de ANACp mostrada anteriormente, el valor de p calculado mediante la prueba de Chi-cuadrado de Pearson es de 0,024 (estadísticamente significativo, p<0,05). Debido a que los datos indican que el estado de positivo para ANACp se asocia a una tasa más baja de complicaciones, la puntuación para ANACp se encuentra invertida, tal como se indica en la sección de PSC. 1.3 Genotipado de NOD2 Los tres biomarcadores de genotipado eran todos polimorfismos de un solo nucleótido de NOD2: PSN8, PSN12 y PSN13. La tabla a continuación muestra los recuentos de genotipos de pacientes: Tabla 47: genotipos de pacientes PSN8 PSN12 PSN13 Tipo salvaje homocigótico 141 146 138 Mutante heterocigótico 18 13 17 Mutante homocigótico 4 Las tablas siguientes muestran los recuentos de genotipos específicos estratificados según condición de complicación: Tabla 48: PSN8 No compl.

Complicaciones Tipo salvaje 44 97 Mutante 13 Tabla 49: PSN12 No compl.

Complicaciones Tipo salvaje 44 102 Mutante 8 Tabla 50: PSN13 No compl.

Complicaciones Tipo salvaje 48 90 Mutante 1 La tabla a continuación muestras las tasas de complicaciones estratificadas según genotipo: Tabla 51: tasas de complicaciones según genotipo PSN8 PSN12 PSN13 Tipo salvaje 68,8% 69,9% 65,2% Mut.

72,2% 61,5% 95,2% La tabla a continuación muestra los valores de p calculados mediante la prueba exacta de Fisher para cada una de las tablas de contingencia (recuentos) mostradas anteriormente, en las que la hipótesis nula es que la incidencia de estos resultados es estadísticamente independiente.

Tabla 52: valores de p valor de p PSN8 N.S.

PSN12 N.S.

PSN13 0,0044 Para mutaciones individuales, sólo PSN13 era estadísticamente significativo con p<0,05. (Se utilizó la prueba exacta de Fisher y no la prueba Chi-cuadrado de Pearson debido a la presencia de células con recuentos<5; los valores de p para las pruebas de Chi-cuadrado eran similares).

El modelo también incorpora dobles mutaciones, que pueden ser dobles mutaciones homocigóticos en un único PSN, o múltiples mutaciones heterocigóticas en tres PSN. Existe amplia evidencia (Lesage et al., Am. J. Hum. Genet. 70:845-857, 2002; Abreu et al., Gastroenterology 123:679-688, 2002; Annese et al., Am. J. Gastroenterol. 100:84-92, 2005) que demuestra que los genotipos con múltiples mutaciones presentan un riesgo significativamente elevado. Los datos presentados en la presente memoria consistían de 9 muestras que presentaban dos mutaciones de NOD2 (cuatro con dobles mutaciones PSN13, cinco con dos mutaciones entre PSN8, PSN12 y PSN13). Las nueve muestras (100%) presentaba un fenotipo de complicación. Aunque este tamaño de muestra es excesivamente pequeño para demostrar significancia estadística, es consistente con la literatura, que indica fuertemente que los genotipos con múltiples mutaciones presentan un riesgo significativamente elevado.

2. Puntuaciones de compuesto: puntuaciones de suma de cuartiles La puntuación de suma de cuartiles (PSC) es una suma de seis puntuaciones individuales de cuartiles. Debido a que cada puntuación individual de cuartil puede encontrarse comprendida entre 1 y 4, el total puede estar comprendido entre 6 y 24. Los seis biomarcadores que proporcionan las puntuaciones de cuartiles son: IgA-AASC, IgG-AASC, anti-CBir1, anti-OmpC, anti-I2 y ANACp.

El biomarcador ANACp puede ser positivo o negativo; debido a que la condición de positivo es protectora, la puntuación de cuartil para ANACp es un caso especial, en el que una condición de positivo se puntúa como "1" y una condición de negativo se puntúa como "4". Este sistema de puntuación proporciona consistencia con los otros cinco marcadores, que también se encuentran comprendidos entre 1 y 4.

La figura 26 muestra la distribución de los valores de PSC para las 619 muestras. Se muestra la puntuación de PSC en el eje X y el número de pacientes se muestra en el eje Y. La figura 27 muestra la distribución de los valores de PSC para las muestras con fenotipos no complicados. La figura 28 muestra la distribución de los valores de PSC para las muestras con fenotipos complicados.

3. Modelo completo de regresión logística 3.1 Duración de la observación Debido a que el presente estudio utiliza un diseño transversal, la totalidad de las 619 muestras presenta duraciones variables de la enfermedad, definida como el intervalo de tiempo entre el diagnóstico y la extracción de sangre. La figura 29 muestra la distribución de las duraciones en todas las muestras. Se muestra el tiempo en años en el eje X y el número de pacientes se muestra en el eje Y. La figura 30 muestra las duraciones para muestras con un fenotipo de complicación. La figura 31 muestra las duraciones para muestras con un fenotipo de no complicación.

Intuitivamente una duración mayor de la observación implica una probabilidad más alta de observar un fenotipo de complicación. Al construir un modelo de regresión logística, resulta evidente que la duración de la observación debe incorporarse como covariable. A continuación, puede utilizarse el modelo resultante para realizar predicciones en todo el abanico de duraciones, generando de esta manera un conjunto de probabilidades durante el tiempo.

3.2 Covariables de genotipo - modelos séricos y serogenéticos La incorporación de información de genotipos en el modelo de regresión logística se ve complicada por el hecho de que la condición de PSN sólo se encuentra disponible para 159 muestras, y no para la cohorte completa de 619 muestras. Se generaron dos modelos de regresión: un modelo "sólo sérico" que se construyó con la totalidad de las 619 muestras, pero que no incorpora el genotipo como covariable, y un modelo "serogenético" que se construyó con un subgrupo de 159 muestras y que no incluye los genotipos como covariable. Para muestras con mutaciones, se proporciona la probabilidad del modelo "sólo sérico", mientras que para muestras con mutaciones, se proporciona la probabilidad del modelo "serogenético".

3.3 Regresión logística sérica En el modelo de regresión logística sérico, las covariables son PSC y duración de la enfermedad. La figura siguiente muestra los parámetros, conjuntamente con sus errores estándares y valores de p.

Tanto la duración como PSC eran altamente significativas (p<0,001).

Mediante la utilización de este modelo la figura 32 muestra las probabilidades (en el eje Y) predichas por el modelo para un abanico de valores de PSC y duración (en el eje X). 3.4 Regresión logística serogenética En el modelo de regresión logística serogenético, las covariables son PSC, duración y mutaciones PSN13. La covariable mut. 13 es una variable categórica que es positiva en el caso de que se encuentre presente la mutación PSN13. La figura siguiente muestra los parámetros, conjuntamente con sus errores estándares y valores de p.

Además, la presencia de dos mutaciones (cross PSN8, 12 y 13, incluyendo tanto las heterocigóticas como las homocigóticas) se trató como un caso especial con un riesgo fijo altamente elevado (99%).

Mediante la utilización de este modelo de mutación (para muestras con mutaciones PSN13), la figura 33 muestra las probabilidades predichas por el modelo para un abanico de valores de PSC y duración. 3.5 Escala de riesgo estandarizada La escala de PSC va de 6 a 24, y no un más convencional 1 a 10. Además, la interpretación de una puntuación de PSC dada es diferente para pacientes con y sin mutaciones PSN13. Se construyó una única escala común de riesgo con valores entre 1 y 10.

La tabla a continuación muestra cómo se llevó a cabo lo anterior. La probabilidad de un fenotipo de complicación dentro de los diez años de duración se toma como referencia. El número de la escala estandarizada es simplemente el primer dígito (el situado más a la izquierda) de la probabilidad. La escala resultante presenta valores del modelo sérico comprendidos entre 1 y 9 y valores serogenéticos comprendidos entre 6 y 10. (La puntuación de 10 se reserva para las dobles mutaciones, no mostrada).

Tabla 53: Escala de riesgo estandarizada PSC Escala estandarizada PSC de regresión sérica Prob. año 10 Prob. mut. año 10 serogenético 1 QSS 6 16% 1 QSS 7 19% 2 QSS 8 23% 2 QSS 9 27% 3 QSS 10 32% 3 QSS 11 36% 4 QSS 12 42% 4 QSS 13 47% QSS 14 53% QSS 15 58% 6 QSS 16 63% QSS 6 64% 6 QSS 17 68% QSS 7 69% 7 QSS 18 73% QSS 8 73% 7 QSS 19 77% QSS 9 77% 8 QSS 20 80% QSS 10 80% 8 QSS 21 84% QSS 11 84% 8 QSS 22 86% QSS 12 86% 8 QSS 23 89% QSS 13 89% 9 QSS 24 91% QSS 14 91% 9 QSS 15 92% 9 QSS 16 94% 9 QSS 17 95% 9 QSS 18 96% 9 QSS 19 97% 9 QSS 20 97% Tabla 53 (continuación) 9 QSS 21 98% 9 QSS 22 98% 9 QSS 23 98% 9 QSS 24 99% VI. VALIDACIÓN DE ALGORITMOS

1. Diseño de validación cruzada Con el fin de validar el modelo, se utilizó un procedimiento de validación cruzada dejando uno fuera para generar estimaciones no sesgadas de rendimiento y evitar el sobreajuste. En este bien conocido diseño de validación, se evaluó indirectamente el rendimiento del modelo final de regresión logística mediante la generación de 619 submodelos. Para cada una de las 619 muestras se generó un modelo separado utilizando los otros 618 muestras como conjunto de entrenamiento y evaluando después la muestra "excluida" en el submodelo generado. Para cada uno de los 619 submodelos generados de esta manera se utilizó exactamente el mismo procedimiento para generar el modelo que para generar el modelo final. De esta manera, para cada iteración, se generó tanto el modelo de tipo salvaje como el de mutación, etc. Es computacionalmente caro pero garantiza que la muestra que se utiliza para validar no se observa nunca al entrenar los modelos. 2. Evaluación de las probabilidades vs. los resultados

La tabla siguiente compara las probabilidades (predicciones) con los resultados (tasas reales de fenotipos de complicación).

Tabla 54: Probabilidades y resultados Categoría (predicción) Puntuación Recuento Predicción media Tasa de complicaciones 10-20% 1 13 16% 31% 20-30% 2 49 25% 16% 30-40% 3 54 35% 39% 40-50% 4 64 45% 44% 50-60% 74 55% 45% 60-70% 6 83 65% 67% 70-80% 7 85 76% 84% 80-90% 8 112 85% 85% 90-99% 9 76 95% 88% > 99% 9 99% 100% La correlación entre las predicciones medias y las tasas observadas de complicaciones (las dos columnas de la derecha) es de 0,964. Observar que el punto más bajo (10-20%) se basa en significativamente menos muestras (n=13), lo que podría haber conducido a un intervalo de confianza más amplio para ese resultado. La figura 34 muestra la correspondencia entre complicaciones predichas (en el eye Y) y complicaciones reales (en el eje X).

3. Evaluación de la exactitud de las predicciones binarias Aunque el presente ensayo proporciona una probabilidad como un resultado, también resulta posible convertir las probabilidades en predicciones binarias (complicación vs. no complicación). Lo anterior permite evaluar el rendimiento del ensayo en términos más típicamente asociados a ensayos diagnósticos que pronósticos, tales como la exactitud, las curvas características de operador-receptor (COR), la sensibilidad y la especificidad. La curva COR mostrada en la figura 35 se generó utilizando las probabilidades informadas mediante los cálculos de validación cruzada. Ilustra las combinaciones de sensibilidad y especificidad que resultan posibles. El ABC (área bajo la curva) era de 0,787, con un intervalo de confianza al 95% de (0,749-0,824).

El punto operativo óptimo es un valor de corte de 0,58; en este punto la exactitud es de 75% (465/619), la sensibilidad es de 79% (309/392) y la especificidad es de 69% (156/227). En el caso de que el objetivo sea una sensibilidad y especificidad equilibradas, y no la máxima exactitud, puede seleccionarse un punto operativo de 0,615, resultando en una exactitud de 73% (451/619), una sensibilidad de 73% (286/392) y una especificidad de 73% (165/227). Observar que dichos puntos de corte se seleccionan de una manera no ciega, después de realizar las predicciones: es el equivalente a seleccionar un punto en la curva COR. La figura 36 muestra la curva COR con líneas dibujadas a un 73% de sensibilidad y especificidad. VII. CONCLUSIONES El ensayo pronóstico de enfermedad de Crohn de Prometheus ha sido diseñado para asistir al médico en el control clínico de la enfermedad de Crohn proporcionando información pronóstica valiosa relacionada con los fenotipos de enfermedad estenosante y penetrante.

El ensayo se construyó y validó en un estudio robusto que incorporaba 619 muestras de diversos pacientes de EC. Además, el ensayo se diseño cuidadosamente utilizando un enfoque estadístico robusto basado en el modelado de regresión logística para maximizar tanto la facilidad de interpretación como el potencial beneficio clínico para los pacientes de enfermedad de Crohn.

Ejemplo 17. Una nueva herramienta pronóstica que combina marcadores genéticos y séricos para predecir el comportamiento de la enfermedad de Crohn complicada. El presente ejemplo ilustra aspectos adicionales relacionados con el desarrollo y validación del ensayo pronóstico de la enfermedad de Crohn descrito en el Ejemplo 16. RESUMEN Antecedentes: existe evidencia de que el tratamiento precoz con una terapia biológica puede alterar la progresión de la enfermedad y dar lugar a menos complicaciones. Sin embargo, estos medicamentos son caros y se asocian a riesgos médicos. De esta manera, resulta valioso conocer qué pacientes progresarán a enfermedad complicada y se beneficiarían de dicho tratamiento. Los estudios previos sugieren que los biomarcadores pueden predecir la gravedad o agresividad de la enfermedad en pacientes con enfermedad de Crohn (EC). El presente estudio transversal presenta como objetivo identificar un conjunto de biomarcadores que prevean el riesgo incrementado de un curso de enfermedad más agresivo. Métodos: se analizó sangre procedente de 619 pacientes bien caracterizados con EC (seguimiento medio: 13 años) para seis biomarcadores séricos (IgA-AASC, IgG-AASC, anti-CBir1, anti-OmpC, anti-I2 y ANACp). En un subconjunto de pacientes (n=159), se llevaron a cabo análisis genéticos para tres variantes de NOD2 (PSN8, PSN12 y PSN13). Las complicaciones evaluadas fueron la presencia de enfermedad estenosante interna o penetrante interna. Se evaluaron los biomarcadores individualmente y colectivamente; esta última evaluación incluyó puntuaciones de suma de cuartiles y análisis de regresión logística multivariante. Se construyó un modelo de regresión logística con submodelos séricos y serogenéticos y se evaluó mediante validación cruzada.

Resultados: para cada marcador, se estratificaron las tasas de complicación según cuartil. Todos los marcadores presentaban diferencias significativas entre cuartiles (prueba exacta de Fisher, p≤0,003). Los pacientes con mutaciones NOD2-PSN13 heterocigóticas presentaron tasas de complicación incrementadas (p=0,004). Para el modelo pronóstico de regresión logística, las predicciones medias agrupadas según categoría se correlacionaron con las tasas de complicación observadas (R=0,964). El análisis de la curva característica de operador-receptor (COR) de las predicciones demostró una clara utilidad diagnóstica (ABC=0,787; IC al 95%: 0,749-0,824). Conclusiones: la combinación de marcadores séricos y genéticos se asocia a complicaciones de enfermedad, proporcionando al médico una herramiento para optimizar las decisiones de tratamiento.

INTRODUCCIÓN La enfermedad intestinal inflamatoria (EII) es un trastorno inflamatorio crónico del tracto digestivo que consiste de colitis ulcerosa (CU) y enfermedad de Crohn (EC), que conjuntamente afectan a aproximadamente 1,4 millones de pacientes en los Estados Unidos1. Actualmente no existe cura para la EC; de esta manera, el objetivo principal del tratamiento es suprimir la respuesta inflamatoria y conseguir la remisión clínica e histológica. Aproximadamente el 50% de los pacientes con EC experimentará un curso clínico benigno2. Los pacientes restantes se enfrentarán a una enfermedad crónica, intermitente y progresiva que conduce al desarrollo de complicaciones tales como la enfermedad estenosante interna y penetrante interna, que se asocian a morbilidad y mortalidad significativas3,4. Se ha demostrado que la necesidad de corticoesteroides es un marcador de progresión de la EC; una vez se utilizan los corticoesteroides, la mayoría de los pacientes experimenta una aceleración del curso de la enfermedad, recibiendo aproximadamente 35% de los pacientes cirugía del intestino delgado dentro del año2. Además, 25% a 33% de los pacientes con enfermedad sin complicaciones se ha informado de que pasan a enfermedad estenosante interna o penetrante interna tras 5 años, sugiriendo que la mayoría de pacientes pasarán de enfermedad sin complicaciones a enfermedad complicada si se les realiza un seguimiento durante tiempo suficiente5.

Un corpus creciente de pruebas sugiere que con la terapia apropiada puede minimizarse la progresión a complicaciones de la enfermedad3. D'Haens y colegas han demostrado recientemente que los pacientes recién diagnosticados tratados precozmente con un régimen agresivo de agentes biológicos e inmunomoduladores presentaron tasas significativamente superiores de remisión que los pacientes tratados con un enfoque de control convencional de corticoesteroides6. Este régimen de tratamiento utilizó infliximab, un anticuerpo anti-factor α de necrosis tumoral (FNTα) y azatioprina, un agente inmunomodulador que funciona parcialmente mediante el bloqueo de la síntesis del ADN, y de esta manera de la proliferación de los linfocitos, y también mediante inducción de la apoptosis de las células mononucleares. Además, el mismo grupo demostró en un estudio clínico prospectivo en pacientes con EC de estadio temprano que el tratamiento de combinación también resultaba en la cicatrización mucosal7. Conjuntamente estos datos proporcionan evidencia de que la terapia precoz y agresiva (el enfoque "top down") podría beneficiar a los pacientes de EC. Sin embargo, dichas medicaciones son caras y se asocian a sucesos adversos raros aunque graves y en ocasiones fatales, incluyendo el riesgo de infecciones tales como la tuberculosis y el linfoma de células T hepatoesplénico2. Por lo tanto, con el fin de maximizar el equilibrio riesgo- beneficio inherente a la utilización de este enfoque, resultaría muy ventajoso para el médico poder identificar, en el momento del diagnóstico, aquellos pacientes adecuados para el tratamiento agresivo precoz.

Existen pruebas claras que sugieren que la respuesta inmunológica a los antígenos de microorganismos intestinales es indicativa de progresión de la enfermedad y de la necesidad de cirugía8. El riesgo de desarrollar complicaciones en la EC y/o la necesidad de cirugía del intestino delgado se asocia a una respuesta autoinmunológica frente a antígenos microbianos específicos tales como I2, OmpC, CBir1 y AASC9-11. Muchos de estos marcadores séricos ya se utilizan en la práctica clínica como herramienta diagnóstica para diferenciar entre la EC y la CU, pero su valor de predicción de la gravedad de la enfermedad sólo se ha puesto de manifiesto en los últimos años4. Múltiples estudios han demostrado que tanto la presencia como el nivel de los marcadores individuales y de combinaciones de marcadores se correlacionan con fenotipos específicos y con la presencia de cirugía8,9,11,12. En un reciente estudio pediátrico prospectivo, se ha demostrado que la magnitud de la respuesta inmunológica contra antígenos microbianos se correlacionaba estrechamente con los fenotipos de EC agresivos y progresión de la enfermedad13. Estas observaciones sugieren que las respuestas a los antígenos microbianos se encuentran estrechamente asociados a características de la enfermedad clínica y pueden utilizarse para predecir los fenotipos de la enfermedad y la progresión a enfermedad complicada.

También se ha demostrado que la genética desempeña un papel importante en la determinación del fenotipo de enfermedad en la EC. Aunque hasta el momento se han identificado varios loci de susceptibilidad a la EC, el gen de inmunidad innata NOD2 (por el inglés "Nucleotide Oligomeric Domain 2", o dominio oligomérico de nucleótidos 2) aparentemente presenta la mayor influencia sobre el fenotipo de enfermedad4,14. NOD2 es una proteína citoplasmática que se une al dipéptido muramilo (DPM), un componente conservado del peptidoglicano observado comúnmente en las bacterias Gram- y Gram+. NOD2 es responsable de la activación de diversas rutas inflamatorias y se expresa restrictivamente en macrófagos, células dendríticas y células de Paneth presentes en la cripta de la mucosa del intestino delgado14. Aunque se han caracterizado por lo menos 27 variantes de NOD2, tres polimorfismos de un solo nucleótido (PSN) mayores: PSN8, PSN19 y PSN13 se asocian al desarrollo de enfermedad complicada14,15.

Aunque se ha demostrado independientemente que marcadores séricos y variantes de NOD2 predicen la gravedad de la enfermedad, algunos estudios prevenios no han determinado si un enfoque combinatorial al análisis de estos marcadores podrá predecir el curso de la enfermedad clínica. El objetivo del presente estudio es integrar los marcadores séricos y genéticos clave que es conocido que están asociados a un fenotipo de EC complicada y desarrollar un algoritmo para la utilización clínica en la predicción del comportamiento de enfermedad complicada en pacientes con EC. MATERIALES Y MÉTODOS Población de estudio: la cohorte inicial consistía de 770 muestras. Se excluyó un conjunto de 151 muestras debido a la inadecuada documentación clínica, resultando en una cohorte final de 619 muestras de pacientes de EC (51% mujeres y 49% hombres). Las muestras de los pacientes se obtuvieron de (1) Cedars Sinai Medical Center, Los Angeles (n=298), (2) Hospital Mt. Sinai, Toronto, Canadá (n=237), y (3) un estudio multicéntrico de Prometheus (n=84). Además, se recogieron 159 muestras de ADN de los pacientes en la población del Hospital Mt. Sinai para el genotipado de NOD2. Se aprobaron protocolos de estudio para cada sitio. Los pacientes fueron diagnosticados de EC basándose en una combinación de criterios que incluyeron síntomas clínicos, endoscopia, histopatología, cápsula videográfica y/o estudios radiográficos. Se utilizó dicha cohorte debido a que se disponía de información médica extensiva para estos pacientes, incluyendo la fecha de diagnóstico, el número y tipo de cirugías relacionadas con la EC, localización de la enfermedad y fenotipo de la enfermedad. Los pacientes fueron clasificados como de enfermedad no penetrante/no estenosante (enfermedad no complicada) o enfermedad estenosante interna o penetrante interna (enfermedad complicada), por personal médico en origen basado en el historial médico, o por personal médico de Prometheus basándose en datos de procedimientos quirúrgicos realizados para tratar complicaciones específicas (Tabla 55). Los pacientes con enfermedad penetrante perianal se clasificaron como de enfermedad complicada. Los pacientes diagnosticados exclusivamente de enfermedad perianal no complicada no fueron incluidos en la cohorte.

Tabla 55. Características clínicas de la cohorte de enfermedad de Crohn Características clínicas n=619 Sexo 51% mujeres Edad media en el momento del diagnóstico 26 años (intervalo de 0 a 68) Edad media en el momento de la extracción de sangre 38 años (intervalo de 10 a 91) Duración media de la enfermedad 13 años (intervalo de 1 a 59) Comportamiento de la enfermedad Enfermedad complicada* 390 (63%) Estenosante 180 (29%) Penetrante 210 (34%) Enfermedad no complicada (inflamatoria) 229 (37%) Cirugía 223 (36%) Localización de la enfermedad Íleo 149 (24%) Colon 118 (19%) Íleo y colon 285 (46%) Tramo gastrointestinal alto 62 (10%) *Fenotipos estenosante o penetrante definido como enfermedad de Crohn complicada.

Genotipado de NOD2: el genotipado de NOD2 consistió del ensayo de tres PSN: PSN8 es un 2104C-T en el exón 4 que resulta en una sustitución R702W (rs2066845); PSN12 es un 2722 G-C en el exón 8 que resulta en una sustitución G908R (rs2066844) y PSN13 es una inserción de C en el exón 11 (3020InsC) que resulta en un desplazamiento de marco (1007fs) (rs5743293). Brevemente, el genotipado de NOD2 consistió de un método de reacción en cadena de la polimerasa (PCR) de discriminación alélica que incluyó dos secuencias oligonucleótidas específicas y dos sondas TaqMan para cada ensayo (Applied Biosystems, Foster City, CA). Los ensayos de genotipado se llevaron a cabo en un sistema de PCR en tiempo ABI 7000 (Applied Biosystems, Foster City, CA).

Detección de anti-I2: un ensayo de inmunosorción ligada a enzima (ELISA) de anti-I2 fue desarrollado originalmente por Sutton y colegas y modificado en Prometheus Laboratories para detectar concentraciones de anti-I2 en la sangre16. Brevemente, el ensayo de anti-I2 utilizó una placa estándar de formato ELISA de tipo sándwich de 96 pocillos. Se capturó sobre la placa una proteína con etiqueta de GST replegada que consistía de 100 aminoácidos de la secuencia de I2 utilizando un anticuerpo monoclonal anti-GST que recubría la superficie de los pocillos (Genscript, Piscataway, NJ). Las muestras de suero humano del paciente se diluyeron 1:100 para llevar la concentración del anticuerpo a un valor dentro del intervalo de la curva de estándares. Tras la incubación de las muestras de suero en los pocillos, se llevó a cabo la detección de los anticuerpos anti-I2 utilizando reactivo de anti- IgA humana conjugado con enzima fosfatasa alcalina (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). Las reacciones se revelaron utilizando una solución de sustrato quimioluminiscente (Applied Biosystems, Foster City, CA) y se expresaron en unidades de ELISA respecto a estándares preparados a partir de una agrupación de sueros de pacientes reactivos. Otros análisis séricos: se midieron mediante ELISA las concentraciones séricas de los anticuerpos anti-Cbir1, anti- OmpC, IgA-AASC e IgG-AASC. El ensayo para ANACp (anticuerpos anticitoplasma de neutrófilos de tinción protoplásmica) se llevó a cabo mediante tinción inmunofluorescente de los neutrófilos, con el objetivo de visualizar la localización perinuclear y un patrón de tinción alterado que se asocia al tratamiento con desoxirribonucleasa (ADNasa). Todos los ensayos se llevaron a cabo en Prometheus Laboratories utilizando un ensayo comercial (IBD- S7, Prometheus Laboratories, San Diego, CA). Para el ELISA, las mediciones se expresaron en unidades de ELISA, respecto a estándares preparados a partir de una agrupación de sueros reactivos de pacientes. El ELISA de anticuerpos anti-Saccharomyces cerevisiae (ANAC) se basó en un método diseñado por Sendid y colaboradores17. Se utilizaron dos ELISA de AASC (AASC-A y AASC-G) para medir los anticuerpos IgA e IgG, respectivamente. Se diseñó un procedimiento de ELISA anti-CBir1 para medir los anticuerpos IgG contra un antígeno flagelina bacteriano, mientras que se diseñó un procedimiento de ELISA anti-OmpC para medir anticuerpos IgA contra el antígeno porina de membrana externa (OmpC), purificada a partir de la bacteria entérica Escherichia coli. Se llevó a cabo el ensayo para ANACp utilizando inmunofluorescencia indirecta sobre leucocitos polimorfonucleares (LPMN) que no se habían tratado o que se habían digerido con ADNasa. Los LPMN tratados y no tratados se fijaron a portaobjetos de vidrio y se añadió suero diluido de paciente. Tras la incubación y el lavado, se añadió a los portaobjetos anticuerpo de cabra anti-IgG humana fluoresceinado. Se utilizó la microscopía epifluorescente para confirmar el patrón de tinión perinuclear característico de las células no tratadas. En el caso de que se presentase el patrón perinuclear, se evaluó la reactividad de las células digeridas con ADNasa. Métodos estadísticos: los resultados de ensayo de los marcadores séricos se convirtieron a una variable categórica (cuartiles). Se evaluó la independencia de las dos variables categóricas, cuartil y condición de complicación, utilizando la prueba Chi-cuadrado de Pearson. Sin embargo, debido a que los resultados variables de ANACp y genéticos ya eran binarios, no resultó necesaria ninguna transformación y se aplicó de manera similar la prueba Chi- cuadrado de Pearson. Con el fin de evaluar la respuesta de los seis marcadores séricos combinados, se aplicó la técnica de puntuación de suma de cuartiles (PSC). De esta manera, la puntuación mínima de 6 representa un paciente con cada marcador sérico en el cuartil más bajo y una puntuación máxima de 24 representa cada marcador en el cuartil más alto. Debido a que los resultados de ANACp eran de naturaleza dicotómica y estaban correlacionados negativamente con complicación de la enfermedad, los pacientes con ANACp positiva fueron asignados una puntuación de 1 y aquellos con una puntuación negativa fueron asignados una puntuación de 4.

Se construyeron dos modelos de regresión logística, ambos con funciones de enlace logit. El modelo sérico se obtuvo utilizando datos séricos y PSC incorporada y duración de la enfermedad a modo de factores predictivos. De manera similar, se obtuvo el modelo serogenético utilizando un subconjunto de pacientes con datos tanto séricos como de NOD2-PSN13, conjuntamente con PSC y duración de la enfermedad como factores predictivos. Los parámetros de los múltiples modelos de regresión logística se evaluaron utilizando una prueba de Wald. Las predicciones del modelo de regresión logística se evaluaron utilizando una validación cruzada dejando uno fuera, con dos evaluaciones estadísticas complementarias. El resultado del modelo de regresión logística se transformó en una variable categórica, mediante una discretización simple, en 10 categorías. Dentro de cada categoría se computó la tasa de complicación verdadera y se evaluó la concordancia entre las tasas de complicación predichas y observadas mediante la correlación de Pearson. Además, se evaluó la exactitud de las predicciones utilizando una curva característica de operador-receptor (COR). Bajo esta evaluación, se informó del rendimiento del ensayo mediante el estadístico ABC (área bajo la curva) con intervalos de confianza. Todos los resultados estadísticos se computaron utilizando el paquete de código abierto R, versión 2.8.1 (R Development Core Team, 2008). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3- 900051-07-0, URL http://www.R-project.org). RESULTADOS: El cincuenta y un por ciento de los pacientes eran mujeres y la edad media en el momento de la extracción de sangre era de 38 años. La duración media de la enfermedad era de 13 años y el intervalo de seguimiento era de 1 a 59 años. El sesenta y tres por ciento de los pacientes presentaba complicaciones en el momento de la extracción de sangre. Las características clínicas de la cohorte de pacientes se muestran en la Tabla 55. Correlación entre marcadores séricos y genéticos y el comportamiento de la enfermedad En la Tabla 56 se muestra un resumen de la condición del marcador sérico de los pacientes. Se calcularon las puntuaciones de cuartiles de la población de estudio de 619 pacientes de EC basándose en intervalos de referencia derivados de las poblaciones sanas. La proporción de pacientes con complicaciones de la enfermedad se incrementaba significativamente con cada cuartil más grande (Tabla 57A) (prueba exacta de Fisher, p≤0,003).

Resulta interesante que se observase diferencias significativas entre la enfermedad complicada y no complicada para cada marcador en el cuartil más alto (p<0,001). El resultado de ANACp fue diferente del de los otros marcadores séricos en el aspecto de que la presencia de ANACp se encontraba negativamente correlacionada con las complicaciones de la EC (Tabla 57B) (p=0,004).

Tabla 56. Pacientes con marcadores séricos elevados Marcador Número total de pacientes con marcadores séricos elevados IgA-AASC 291 (47%) IgG-AASC 254 (41%) OmpC 235 (38%) CBir1 415 (67%) I2 260 (42%) 0 marcadores 66(11%) 1 marcador 137 (22%) 2 marcadores 132 (21%) 3 marcadores 137 (22%) 4 marcadores 86 (14%) 5 marcadores 61 (10%) Se definieron los marcadores séricos elevados como aquellos con valores superiores a las concentraciones del intervalo de referencia sano.

Tabla 57A. Porcentaje de enfermedad complicada dentro de cada cuartil de marcador sérico Q1 Q2 Q3 Q4 Marcador Comportamiento de la % % % % sérico enfermedad n n n n comp.

comp.

comp.

comp.

Complicada 59 90 116 127 ASCA-IgA 38,1 58,4 74,8 81,9* No complicada 96 64 39 28 Complicada 72 84 114 122 ASCA-IgG 46,5 54,5 73,5 78,7* No complicada 83 41 33 Complicada 76 92 109 115 Anti-CBir1 49,0 59,7 70,3 74,2* No complicada 79 62 46 Complicada 68 90 107 127 Anti-OmpC 43,9 58,4 69,0 81,9* No complicada 87 64 48 28 Complicada 76 93 114 109 Anti-I2 49,0 60,4 73,5 70,3* No complicada 79 61 41 46 *p<0,001 enfermedad de Crohn complicada vs. no complicada Tabla 57B. Correlación de marcador pANAC negativo e incidencia de enfermedad complicada.

Negativo Positivo pANAC n % comp.

n % comp.

Complicada 323 69 65,7* 54,3 No complicada 169 58 *p=0,004 enfermedad de Crohn complicada vs. no complicada.

Debido a que cada marcador sérico individual era significativo en la predicción de la enfermedad mediante la diferenciación de complicaciones de enfermedad basada en el análisis de cuartiles, se utilizaron las puntuaciones de suma de cuartiles (PSC) para evaluar la respuesta de los seis marcadores séricos agrupados (intervalo: 6-24) como enfermedad complicada y no complicada. La PSC más común de 19 fue obtenida por 46 pacientes con enfermedad complicada, estando la PSC comprendida entre 10 y 22 en la mayoría de pacientes (figura 37). En comparación, la PSC bimodal más común de 11 y 16 fue obtenida por 27 pacientes con enfermedad no complicada (cada uno), en una distribución más uniforme en la que la mayoría de pacientes presentó una PSC de entre 9 y 17 (figura 37). La mediana de PSC de pacientes con enfermedad complicada era de 17, en comparación con una PSC de 14 para pacientes con enfermedad no complicada. La mediana de tiempo de seguimiento de diagnóstico a extracción de sangre para pacientes sin complicaciones fue de 5 años, comparado con 13 años para los pacientes con complicaciones.

Asociación entre marcadores NOD2 y enfermedad complicada y no complicada. Se evaluaron tres variantes de NOD2 para su asociación con la incidencia de complicaciones de enfermedad (Tabla 58). Se observó un total de 18 mutaciones (heterocigóticas), 13 (heterocigóticas) y 21 (17 heterocigóticas, 4 homocigóticas) para los polimorfismos PSN8, PSN12 y PSN13 en estos pacientes, respectivamente. Las complicaciones de enfermedad de Crohn estaban fuertemente asociadas a pacientes con mutaciones homocigóticas o mutaciones heterocigóticas de compuesto. Aunque el número de pacientes con mutaciones de NOD2 era pequeño, se observó una inesperada asociación entre complicaciones de enfermedad y la presencia de una mutación para PSC13; 20/21 pacientes que eran heterocigóticos u homocigóticos presentaban enfermedad complicada (95%, p=0,004) (Tabla 58). Aunque no se demostró significancia con las mutaciones heterocigóticas en la cohorte, se demostró independientemente que eran significativas en los casos de mutaciones homocigóticas o mutaciones heterocigóticas de compuesto en múltiples PSN de NOD2. En dicha cohorte sólo se observaron nueve muestras en el modelo serogenético con dobles mutaciones entre las tres PSN. Se observó que la totalidad de estas nueve muestras presentaba complicaciones. Este tamaño de muestra era excesivamente pequeño para evaluar la significancia estadística, aunque significativas investigaciones anteriores han demostrado una fuerte asociación entre múltiples mutaciones y un fenotipo de enfermedad complicada14,15. Por lo tanto, en este modelo, los pacientes con múltiples mutaciones PSN de NOD2 fueron asignados a una probabilidad elevada (>99%) de complicaciones. No se observó una asociación significativa entre una única mutación heterocigótica para PSN8 o PSN12 y enfermedad complicada.

Tabla 58. Porcentaje de enfermedad complicada y no complicada según el estatus de PSN de NOD2 No complicada Complicada PSN NOD2 Estatus n % n % Sin mutación 44 31 97 69 PSN8 mutación 27 13 72 Sin mutación 44 102 PSN12 mutación 38 8 62 Sin mutación 48 90 PSN13 mutación 1 95* *p=0,004 enfermedad de Crohn complicada vs no complicada.

Modelado de regresión logística Los parámetros y predicciones para los modelos sérico y serogenético se muestran en la Tabla 59 y se ilustran en las figuras 38A y 38B, en las que se muestran para diversas PSC la probabilidad acumulada de complicaciones durante el tiempo. En ambos modelos se presenta la condición de complicación como la variable de resultado.

Existe una gran variabilidad en términos de complicaciones precoces al utilizar sólo la serología (figura 38A) y la probabilidad de complicación se incrementa más rápidamente durante el tiempo en aquellos con PSC más baja. A título de ejemplo, la curva más baja en la figura 38A corresponde a PSC 6, que predice que las complicaciones se producirían a una tasa de aproximadamente 10% el año 1, 16% el año 10 y 26% el año 20. En contraste, para un paciente con PSC 20, las complicaciones se producirían a una tasa de aproximadamente 70% el año 1, 80% el año y 88% el año 20. Al aplicar genética de NOD2, se produce una transformación significativa a una probabilidad más alta de complicación en todos los pacientes, incluso en estadios tempranos del curso de la enfermedad (figura 38B).

Tabla 59. Modelos de regresión sérico y serogenético - Predicción del riesgo de enfermedad de Crohn complicada Modelo de regresión sérico (n=619) Estimación Error est. Valor de z valor de p Cociente de probabilidades Corte con el eje -3,567 0,428 -8,333 <0,001 - Duración 0,060 0,010 5,788 <0,001 1,06 (1,04 -1,08)/año PSC 0,219 0,027 8,143 <0,001 1,24 (1,18 -1,31)/punto PSN13 - - - - - Modelo de regresión serogenético (n=159) Estimación Error est.

Valor de z valor de p Cociente de probabilidades Corte con el eje -3,100 0,893 -3,473 0.001 Duración 0,035 0,024 1,468 0.142 1,04 (0,99 -1,09)/año PSC 0,212 0,056 3,757 <0.001 1,24 (1,11 -1,39)/punto PSN13 2,047 1,063 1,925 0.054 7,74 (1,43 -1,44) si mutación Utilización de modelos de regresión sérico y serogenético estratificados para predecir el desarrollo de enfermedad de Crohn complicada La exactitud del ensayo global se demuestra por la correlación de esta comparación (R=0,964), que indica que el modelo predice con exactitud la tasa de complicaciones de la enfermedad en cada categoría (figura 39). También se evaluaron mediante análisis COR las probabilidades de validación cruzada. En este análisis, el área bajo la curva COR era de 0,787 (IC al 95%: 0,749-0,824), confirmando de esta manera la exactitud del modelo en la discriminación entre EC complicada y no complicada (figura 40).

COMENTARIO El presente ejemplo presenta datos en apoyo de un nuevo ensayo pronóstico, diseñado para asistir al médico en el control clínico de la enfermedad Crohn mediante la integración de datos de siete biomarcadores, con el objetivo de predecir las poblaciones de pacientes que es probable que sufran formas complicadas de EC, tales como los fenotipos de enfermedad estenosante interna y penetrante interna. El ensayo ha sido diseñado utilizando el modelaje de regresión logística y ha sido validado en un estudio que incorporaba 619 muestras de diversos pacientes de EC. Incluye siete biomarcadores: IgA-AASC, IgG-AASC, anti- OmpC, anti-CBir1, anti-I2 y ANACp, y mutaciones del gen NOD2. Varios estudios han establecido una relación entre las variantes de NOD2 y la serorreactividad frente a antígenos de microorganismos. Se han descrito más de 27 mutaciones del gen NOD2, aunque la susceptibilidad a la EC se ha atribuido consistentemente a tres mutaciones principales14. Concretamente estas son dos PSN no sinónimas (en el exón 4, que resultan en la sustitución de aminoácido R702W y en el exón 8, resultante en la sustitución de aminoácido G908R). La tercera mutación es una inserción de nucleótido (3020InsC) en el exón 11 que resulta en el desplazamiento de marco 1007fs. Los pacientes que portan la sustitución de desplazamiento de marco o dos alelos de riesgo tanto homocigóticos como heterocigóticos presentan un riesgo incrementado de desarrollar EC18,19. Los pacientes que portan variantes de NOD2 presentan una respuesta inmunológica adaptativa incrementada y varios estudios han demostrado la asociación entre variantes de NOD2 y la concentración sérica de AASC14,15,18. I2 es una clase de super-antígeno de células T asociado a la EC y algunos informes han demostrado que I2, derivado del gen pfiT de Pseudomonas fluorescens, explica la actividad antigénica detectada en la EC20,21. Se ha informado de que la seroprevalencia de anti-I2 es de 50% en la EC22. Resulta interesante que el nivel sérico elevado de anti-I2 se haya asociado a una prevalencia incrementada de enfermedad estenosante y cirugía del intestino delgado9. Los pacientes que presentan niveles elevados de reactividad sérica hacia AASC, I2 y OmpC presentan significativamente más complicaciones, tales como enfermedad estenosante y penetrante, con una mayor probabilidad de cirugía del intestino delgado9,10.

Un aspecto de un estudio transversal que podría ser relevante es la estabilidad de la respuesta sérica en la EC. En el caso de que el patrón de marcadores cambie drásticamente durante el curso de la enfermedad, las muestras obtenidas posteriormente en el estado de enfermedad podrían no ser representativas de las muestras tomadas en el momento del diagnóstico. Aunque aparentemente no existe ninguna asociación entre presencia de marcador y nivel de respuesta respecto a la duración de la enfermedad8, varios estudios sugieren que existe una estabilidad básica en la condición del marcador a pesar de los cambios en la actividad de la enfermedad22, o durante el curso de la enfermedad23,24. En el presente estudio se tomaron muestras de suero después del diagnóstico y en algunos casos después de producirse las complicaciones. Lo anterior es similar a otros estudios transversales que han demostrado una correlación entre marcadores séricos y el fenotipo de la enfermedad9,11,12. Resulta especialmente importante observar que los datos de recientes estudios prospectivos han demostrado que los marcadores séricos evaluados en el diagnóstico o en un momento próximo son capaces de identificar los pacientes que es más probable que presenten complicaciones, apoyando de esta manera las conclusiones basadas en datos transversales13,23.

El control de la enfermedad de Crohn está controlado clínicamente y el curso de la enfermedad es prácticamente impredecible. Algunos pacientes sólo presentan unos cuantos episodios de enfermedad activa durante su vida, con periodos prolongados de remisión entre ellos; para otros, la enfermedad activa es persistente. Para muchos pacientes de EC, se produce una progresión significativa del comportamiento de la enfermedad durante el tiempo. El cambio con frecuencia es evidente dentro del año y a los 10 años más de 50% de los pacientes progresó a fenotipo de enfermedad complicada4,25.

El control de la EC genera un debate clínico intenso, ya que se encuentran disponibles los dos enfoques terapéuticos principales, las estrategias en pauta ascendente ("step up") y descendente ("top down"). La estrategia "step up" es el enfoque terapéutico clásico, consistente en incrementar la intensidad del tratamiento a medida que progresa la enfermedad. Con frecuencia, el paciente iniciará el tratamiento con corticosteroides; un aspecto negativo de esta estrategia es que la exposición prolongada a corticoesteroides puede generar dependencia y otras complicaciones graves26,27. El tratamiento "top down" se refiere a un enfoque terapéutico más agresivo, en el que se introduce una terapia intensiva, tal como agentes biológicos e inmunosupresores, precozmente durante el curso de la enfermedad. Recientemente se ha demostrado que una combinación precoz de infliximab e inmunosupresor resultó más beneficiosa para el paciente que el tratamiento clásico, apoyando los corticoesteroides como terapia de primera línea6. Sin embargo, los estudios epidemiológicos sugieren que el 50% de los pacientes de EC no desarrollan enfermedad grave28, y en consecuencia no requerirán terapia agresiva. Además, inquieta la seguridad a largo plazo y el coste de los agentes biológicos como tratamientos de primera línea. A la luz de dichas observaciones, existe una clara necesidad clínica de herramientas pronósticas que puedan ayudar a predecir el comportamiento de la EC y por lo tanto ayudar a clasificar los pacientes que presentan un riesgo alto y bajo de desarrollar enfermedad complicada. El cumplimiento del paciente con la medicación de tratamiento generalmente es pobre. Por lo tanto, mediante la identificación de los pacientes con un mal pronóstico precozmente otra utilidad clínica potencial del ensayo pronóstico descrito en la presente memoria es mejorar el cumplimiento del paciente al enfatizar los beneficios de la terapia óptima en la prevención de la progresión de la enfermedad. El modelo utilizado en el presente estudio demuestra tasas incrementadas de complicaciones al estratificar en cuartiles. El análisis de cuartiles implica la clasificación de los niveles de marcador en puntuaciones de cuartiles individuales, que seguidamente se combinaron en una puntuación de suma de cuartiles (PSC). En particular, la predicción de la puntuación de PSC agregada presentó un rendimiento sustancialmente superior a modelos equivalentes con marcadores individuales (comparando ABC de las curvas COR), reflejando la superioridad de una puntuación agregada. Finalmente, las PSC son informativas por sí mismas, aunque al utilizarlas como factor predictivo en un modelo de regresión logística, resulta posible cuantificar más concretamente, en términos probabilísticos, el riesgo esperado de complicaciones para un intervalo de tiempos de observación. El modelo ajustado incorporaba duración de la enfermedad como factor predictivo explícito. El presente ejemplo demuestra que los presentes datos transversales constituyen un modelo válido para predecir la progresión de la EC. Durante el tiempo, pueden añadirse covariables clínicas tales como la localización de la enfermedad, el tabaquismo, la estabilidad de los biomarcadores durante el tiempo, la abundancia relativa de los biomarcadores en el momento del diagnóstico, así como otros marcadores serogenéticos adicionales, con el fin de refinar adicionalmente el modelo. El presente ejemplo demuestra además que la utilización combinatorial de marcadores séricos y genéticos proporciona un potente ensayo pronóstico para predecir el curso clínico de la enfermedad de Crohn. El presente concepto genera una nueva plataforma de pronóstico para ayudar en la identificación precoz de los pacientes en riesgo de fenotipos de enfermedad complicada, proporcionando al médico y al paciente la opción de iniciar una terapia agresiva precoz.

REFERENCIAS 1. Voices of Progress Annual Report 2008 [CCFA web site]. 31 de agosto de 2008. Disponible en: http://www.ccfa.org/im-ages/ar09/fullannualrep09.pdf. 2. Loftus EV, Schoenfeld P, Sandborn WJ. The epidemiology and natural history of Crohn’s disease in population- based patient cohorts from North America: a systematic review. Aliment Pharmacol Ther. 2002;16:51-60. 3. Hanauer SB. Positioning biologic agents in the treatment of Crohn’s disease. Inflamm Bowel Dis. 2009;15:1570-1582. 4. Lichtenstein GR. Emerging prognostic markers to determine Crohn’s disease natural history and improve man- agement strategies: a review of recent literature. Gastroenterol & Hepatol. 2010;6:99-107.

5. Cosnes J, Nion-Larmurier I, Beaugerie L, et al. Impact of the increasing use of immunosuppressants in Crohn’s disease on the need for intestinal surgery. Gut. 2005;54:237-241. 6. D’Haens G, Baert F, Van AG, et al. Early combined immunosuppression or conventional management in patients with newly diagnosed Crohn’s disease: an open randomised trial. Lancet. 2008;371:660-667. 7. Baert F, Moortgat L, Van AG, et al. Mucosal healing predicts sustained clinical remission in patients with early- stage Crohn’s Disease. Gastroenterology. 2010;138:463-468. 8. Arnott ID, Landers CJ, Nimmo EJ, et al. Sero-reactivity to microbial components in Crohn’s disease is associated with disease severity and progression, but not NOD2/CARD15 genotype. Am J Gastroenterol. 2004;99:2376-2384. 9. Mow WS, Vasiliauskas EA, Lin YC, et al. Association of antibody responses to microbial antigens and complications of small bowel Crohn’s disease. Gastroenterology. 2004;126:414-424.

10. Vasiliauskas EA, Kam LY, Karp LC, et al. Marker antibody expression stratifies Crohn’s disease into immuno- logically homogeneous subgroups with distinct clinical characteristics. Gut. 2000;47:487-496. 11. Targan SR, Landers CJ, Yang H, et al. Antibodies to CBir1 flagellin define a unique response that is associated independently with complicated Crohn’s disease. Gastroenterology. 2005;128:2020-2028.

12. Ferrante M, Vermeire S, Katsanos KH, et al. Predictors of early response to infliximab in patients with ulcerative colitis. Inflamm Bowel Dis. 2007;13:123-128. 13. Dubinsky MC, Lin YC, Dutridge D, et al. Serum immune responses predict rapid disease progression among children with Crohn’s disease: immune responses predict disease progression. Am JGastroenterol. 2006;101:360-367.

14. Devlin SM, Yang H, Ippoliti A, et al. NOD2 variants and antibody response to microbial antigens in Crohn’s disease patients and their unaffected relatives. Gastroenterology. 2007;132:576-586. 15. Abreu MT, Taylor KD, Lin YC, et al. Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn’s disease. Gastroenterology. 2002;123:679-688. 16. Sutton CL, Kim J, Yamane A, et al. Identification of a novel bacterial sequence associated with Crohn’s disease. Gastroenterology. 2000;119:23-31. 17. Sendid B, Colombel JF, Jacquinot PM, et al. Specific antibody response to oligomannosidic epitopes in Crohn’s disease. Clin Diagn Lab Immunol. 1996;3:219-226. 18. Cruyssen BV, Peeters H, Hoffman IE, et al. CARD 15 polymorphisms are associated with anti- Saccharomyces cerevisiae antibodies in caucasian Crohn’s disease patients. Clin Exp Immunol. 2005;140:354- 359. 19. Annese V, Lombardi G, Perri F, et al. Variants of CARD 15 are associated with an aggressive clinical course of Crohn’s disease -an IG-IBD study. Am J Gastroenterol. 2005;100:84-92. 20. Wei B, Huang T, Dalwadi H, et al. Pseudomonas fluorescens encodes the Crohn’s disease-associated I2 sequence and T-cell superantigen. Infect Immun. 2002;70:6567-6575.

21. Dalwadi H, Wei B, Kronenberg M, et al. The Crohn’s disease-associated bacterial PROTEÍNA I2 is a novel enteric t cell superantigen. Immunity. 2001;15:149-158. 22. Landers CJ, Cohavy O, Misra R, et al. Selected loss of tolerance evidenced by Crohn’s disease-associated immune responses to auto-and microbial antigens. Gastroenterology. 2002;123:689-699. 23. Rieder F, Schleder S, Wolf A, et al. Serum anti-glycan antibodies predict complicated Crohn’s disease behavior: A cohort study. Inflamm Bowel Dis. 2009. 24. Desir B, Amre DK, Lu S-E, et al. Utility of serum antibodies in determining clinical course in pediatric Crohn’s 20 Disease. Clin Gastroenterol and Hepatol. 2004;2:139-146. 25. Louis E, Collard A, Oger AF, et al. Behaviour of Crohn’s disease according to the Vienna classification: changing pattern over the course of the disease. Gut. 2001;49:777-782.

26. Munkholm P, Langholz E, Davidsen M, et al. Frequency of glucocorticoid resistance and dependency in Crohn’s disease. Gut. 1994;35:360-362. 27. Faubion WA, Jr., Loftus EV, Jr., Harmsen WS, et al. The natural history of corticosteroid therapy for inflammatory bowel disease: a population-based study. Gastroenterology. 2001;121:255-260. 28. Baert F, Caprilli R, Angelucci E. Medical therapy for Crohn’s disease: top-down or step-up? Dig Dis.

2007;25:260-266.

Ejemplo 18. Análisis de puntuaciones de suma de cuartiles de marcadores de la enfermedad de Crohn durante el tiempo.

El presente ejemplo muestra un análisis de puntuaciones de suma de cuartiles (PSC) de 6 marcadores durante el tiempo. Un cuartil es cualquiera de las cuatro categorías que dividen el grupo de datos en cuatro partes iguales, de manera que cada parte representa un cuarto de la población muestreada. Para cada marcador resulta posible presentar un valor de 0 a 4 (es decir, cero en el caso de no hallarse presente el marcador). Para seis marcadores la puntuación de suma de cuartiles puede ser de entre 0 y 24. La figura 41 muestra la puntuación de suma de cuartiles durante 40 años de la velocidad agregada de 6 marcadores en 619 individuos con enfermedad de Crohn. Ejemplo 19. Protocolo para la purificación y replegamiento de GST-I2. 1.0 OBJETIVO

El presente ejemplo describe un procedimiento para la purificación y replegamiento del antígeno GST-I2 a partir de una solución estándar bacteriana en glicerol congelada. Este procedimiento tarda ocho días en completarse. 2.0 ÁMBITO La prep. de antígeno rGST-I2 es el antígeno utilizado para capturar anticuerpos de péptido relacionado con Pseudomonas fluorescens en el suero de pacientes con enfermedad de Crohn (EC), tal como se indica en el Ejemplo 20.

3.0 PRINCIPIO El objetivo del procedimiento de la prep. de antígeno rGST-I2 es purificar y replegar GST-I2 de manera que pueda purificarse adicionalmente a partir de contaminantes bacterianos. El procedimiento de replegado permite purificar el antígeno y permite que interactúe correctamente con anticuerpos anti-GST en el ELISA de I2.

4.0 DEFINICIONES GST-I2. Glutatión-S-transferasa fusionada con péptido relacionado con Pseudomonas fluorescens. 5.0 PROCEDIMIENTO 5.1. DÍA 1 5.1.1. Preparar el cultivo durante la noche. Se inicia con 60 ml de medio LB que ha sido esterilizado mediante autoclavado en un matraz Erlenmeyer de 250 ml. Marcar dicho matraz con "cultivo de durante la noche de antígeno I2" y la fecha actual. 5.1.2. Precalentar dicho medio en el agitador-incubador configurado a 37ºC. Se calentó el medio durante 30 minutos. 5.1.3. Mientras se incuba el medio, sacar una alícuota de ampicilina (50 mg/ml) del congelador a -70ºC y descongelarla a temperatura ambiente.

5.1.4. Añadir 60 µl de ampicilina 50 mg/ml al medio precalentado. Dejar mezclando el medio en el incubador durante 5 minutos a 200 rpm. 5.1.5. Sacar la solución estándar de GST-I2 en glicerol del congelador a -70ºC e introducirla directamente en un cubo de hielo seco. No dejar que se descongele la solución estándar de glicerol. 5.1.6. Inocular en el medio de LB/ampicilina la solución estándar congelada de GST-I2 en glicerol. Desactivar el incubador/agitador. Mientras se mantiene todavía la solución estándar de glicerol sobre hielo seco, abrir la tapa del tubo de solución estándar de glicerol. Utilizando un asa de inoculación raspar la superficie de la solución estándar congelada de GST-I2 en glicerol. Destapar ligeramente la hoja de aluminio de la parte superior del matraz de 250 ml que contiene el medio de LB/ampicilina. Sólo abrir la hoja de aluminio suficiente para que pueda introducirse el asa de inoculación en el interior. Introducir el asa de inoculación (con raspados de glicerol) en el matraz y remover lentamente durante unos cuantos segundos. Retirar el asa de inoculación y fijar la hoja de aluminio sobre el matraz. 5.1.7. Activar el agitador y dejar el cultivo en incubación durante la noche a 200 rpm y a 37ºC. 5.1.8. Utilizar este tiempo para preparar el medio LB que se utilizará el día siguiente. Extraer dos volúmenes de 500 ml de medio LB que ha sido esterilizado mediante autoclavado en matraces Erlenmeyer de 2 l e introducirlos en un incubador a 37ºC durante la noche sin agitación. Asegurarse de que se introducen en un incubador que no se está utilizando para el cultivo durante la noche de la solución estándar de glicerol. Lo anterior se lleva a cabo para garantizar que el medio precalentado estará listo para la utilización al día siguiente.

5.2. DÍA 2 5.2.1. Comprobar los dos volúmenes de 500 ml de medio LB que han estado bajo calentamiento durante la noche. Debería seguir transparentes, sin crecimiento visible. 5.2.2. A continuación, comprobar la DO 600 del cultivo de durante la noche utilizando el espectrofotómetro Nanospec. Utilizar 1 ml de medio LB como el blanco. Utilizar 1 ml de cultivo de durante la noche para comprobar la DO 600. La DO 600 del cultivo de durante la noche debe ser de aproximadamente 1,9 a 2,3. En el caso de que no se encuentre dentro de dicho intervalo, descartar el cultivo y empezar nuevamente. 5.2.3. Introducir los dos volúmenes de 00 ml de medio LB precalentado en el mismo incubador-agitador que contiene el cultivo de durante la noche. A continuación, extraer dos alícuotas de ampicilina (50 mg/ml) del congelador a -70ºC y descongelarlas a temperatura ambiente.

5.2.4. Añadir 500 ml de ampicilina a cada uno de los volúmenes de 500 ml de medio LB. Dejar bajo agitación estos matraces en el incubador durante 5 minutos a 37ºC y 200 rpm. 5.2.5. A continuación, realizar una dilución 1:20 del cultivo de durante la noche en ambos volúmenes de 500 ml de medio LB/Amp. Lo anterior se lleva a cabo añadiendo 25 ml del cultivo de durante la noche a 500 ml del medio LB/Amp. En este punto cada cultivo de 500 ml se denominará cultivo A o B. Etiquetar ambos cultivos con la fecha actual. Además, etiquetar cada cultivo como "cultivo A de GST-I2" o "cultivo B de GST-I2". 5.2.6. Incubar dichos cultivos durante 1 h a 37ºC y 200 rpm. 5.2.7. Tras 1 hora de incubación, comprobar la DO 600 de ambos cultivos. La DO 600 de los cultivos debe alcanzar un valor de 0,6 a 0,9 antes de poder inducir la expresión de proteínas con isopropil-β-D-1- tiogalactopiranósido (IPTG). En el caso de que la lectura inicial a 1 hora de DO 600 sea inferior a 0,6, continuar comprobando la DO 600 del cultivo cada 15 min. hasta que la DO 600 alcance el intervalo de 0,6 a 0,9. Registrar la DO 600 de cada cultivo en este punto. 5.2.8. Tras alcanzar la DO 600 de los cultivos el intervalo aceptado para la inducción con IPTG, se extrae una alícuota de 1 ml de cada cultivo y se introduce en un tubo de microcentrífuga de 1,5 ml. Se etiqueta cada tubo con la fecha actual, "cultivo A/B de GST-I2" y T=0. Dejar estas dos alícuotas T=0 sobre hielo. Es importante extraer estas alícuotas antes de la inducción con IPTG ya que se utilizarán para el posterior análisis del gel.

5.2.9. Inducir expresión del antígeno GST-I2 utilizando IPTG 1 mM. Añadir 500 ml de solución 1 M de IPTG a cada cultivo de 500 ml. Anotar el tiempo en que se indujeron los cultivos. 5.2.10. Incubar dichos cultivos durante 4 h a 37ºC y 200 rpm. Los procedimientos 5.2.11-5.2.14 siguientes deben llevarse a cabo durante dicho procedimiento de incubación.

5.2.11. Extraer las alícuotas de cultivo T=0 de 1 ml que estaban sobre hielo e introducirlas en una centrífuga (centrífuga Eppendorf 5402). Centrifugar las alícuotas a 5.000xg durante 10 min. a 4ºC. Separar el sobrenadante cuidadosamente sin perturbar el pellet bacteriano. Almacenar los pelletes a -70ºC. 5.2.12. Etiquetar dos botellas de centrífuga de 500 ml con la fecha actual y "Pellet bacteriano A/B de GST-I2". Pesar cada botella y registrar su masa en gramos.

5.2.13. Dejar las botellas pesadas sobre hielo inmediatamente antes de finalizar el periodo de incubación de 4 horas. 5.2.14. Etiquetar dos tubos de microcentrífuga con la fecha actual y "Cultivo A/B de GST-I2" y T=4 h. Dejar estos dos tubos T=4 h sobre hielo. 5.2.15. Alcanzado el punto temporal de 4 h, desactivar el incubador. Registrar la DO 600 de cada cultivo.

5.2.16. Extraer una alícuota de 1 ml de cada cultivo e introducirla en un tubo de microcentrífuga correctamente etiquetado. Dejar las alícuotas sobre hielo. 5.2.17. Verter el volumen restante de cada cultivo en una botella de centrífuga de 500 ml correctamente etiquetada. Introducir dichas botellas en la centrífuga Sorvall RC-3B con rotor H-6000. 5.2.18. Centrifugar los cultivos durante 10 minutos a 5.000xg y 4ºC.

5.2.19. Extraer las botellas de la centrífuga y dejarlas sobre hielo. Vaciar el sobrenadante en los matraces Erlenmeyer de 2 l que se utilizaron para el cultivo. Estos serán utilizados como recipientes para los desechos. Separar todo el sobrenadante manteniendo el pellet bacteriano intacto en el fondo de la botella. Dejar las botellas nuevamente sobre hielo. 5.2.20. Pesar las botellas para determinar la masa de las botellas más los pellets bacterianos. Utilizar un Kimwipe para limpiar el exceso de humedad de la superficie externa de las botellas. Lo anterior permitirá una determinación más exacta de la masa. 5.2.21. Determinar el peso del pellet bacteriano mediante la resta de los valores determinados en la etapa 5.2.12 de los valores en la etapa 5.2.20. 5.2.22. Escribir el peso del pellet sobre cada una de las botellas y almacenarlas a -70ºC.

5.2.23. Introducir las alícuotas de 1 ml de la etapa 5.2.16 en una centrífuga (centrífuga Eppendorf 5402). Centrifugar las alícuotas a 5.000xg durante 10 min. a 4ºC. Separar el sobrenadante cuidadosamente sin perturbar el pellet bacteriano. Almacenar los pellets a -70ºC.

5.3. DÍA 3 5.3.1. Las etapas 5.3.9 a 5.3.51 requerirán la preparación de reactivos nuevos y requerirán aproximadamente 6 horas para completarse. 5.3.2. Debe activarse un gel de proteínas SDS-PAGE para confirmar que la expresión de proteínas del antígeno GST-I2 ha sido inducida. Lo anterior debe llevarse a cabo antes de que pueda realizarse ninguna etapa más.

5.3.2.1. Sacar los pellets bacteriano de 1 ml de los puntos temporales (T=0, 4 h) del congelador de -70ºC y dejarlos sobre hielo. 5.3.2.2. Suspender los pellets en H2O destilada Nanopure, de la manera siguiente: La cantidad de H2O que se utilizará para la suspensión se basa en la DO 600 de cada punto temporal. 5.3.2.3. Para determinar la cantidad de H2O que debe añadirse al pellet en cada punto temporal, introducir el valor de DO 600 de cada punto temporal en la ecuación siguiente: Anotar el volumen de H2O añadido para suspender cada pellet bacteriano de cada punto temporal.

5.3.3. Etiquetar 4 nuevos tubos de microcentrífuga de 1,5 ml con los puntos temporales mostrados anteriormente, en 10.3.2.3. Estos nuevos tubos se utilizarán para preparar las muestras para el análisis de gel. 5.3.4. En cada nuevo tubo de microcentrifuga introducir 29 µl de su suspensión de pellet bacteriano respectiva. A continuación, introducir 10 µl de 4x tampón para muestras en cada tubo de microcentrifuga. Seguidamente introducir 1 µl de beta-mercaptoetanol al 2,5%. Mezclar cada tubo y después incubarlos en un bloque térmico a 90ºC durante 5 minutos. 5.3.5. Preparar el gel de Bis-Tris al 4-12%. Consultar las instrucciones de la minicelda XCell SureLock™ (Invitrogen -Part número EI0001) para preparar el gel. http://tools.invitrogen.com/content/sfs/manuals/surelock_man.pdf 5.3.5.1. Manual págs. 9 a 13, 17. El tampón de migración que se utiliza en este procedimiento es tampón de migración MES SDS.

5.3.6. Introducir 30 µl de cada muestra en pocillos separados. Introducir 10 µl de la escalera de proteínas en un pocillo separado. Activar el gel durante 35 minutos a 200 voltios.

5.3.7. Sacar el gel de su molde e introducirlo en un recipiente de fondo plano. Vaciar la caja de puntas de pipeta utilizadas también. Lavar brevemente el gel durante 15 segundos con 50 ml de H2O destilada Nanopure. A continuación añadir 100 ml de tinción Simply Blue SafeStain e incubar el gel en un agitador oscilante durante 50 min.

5.3.8. Decantar la tinción Simply Blue SafeStain y añadir 100 ml de H2O destilada Nanopure. Introducir el gel nuevamente en un agitador oscilante e incubarlo durante 1 hora. Dentro de los 10 minutos iniciales de esta etapa de incubación podrá confirmar que se había expresado el antígeno GST-I2 (figura 42A). Tras confirmar las bandas pasar a la etapa siguiente. 5.3.9. Utilizar este tiempo para preparar 50 ml de tampón A de I2-Tris-Cl 50 mM, EDTA 0,5 mM, glicerol al 5%, DTT 5 mM, pH 8,0. 5.3.10. Utilizar este tiempo para preparar 50 ml de tampón desnaturalizante de I2 - TrisCl 10 mM, NaH2PO4 0,1 M, urea 8 M, DTT 5 mM, pH 8,0. Esta solución se almacena a temperatura ambiente hasta la utilización. 5.3.11. Utilizar este tiempo para preparar 400 ml de tampón de replegamiento de I2 -Tris-Cl 25 mM, NaCl 100 mM, glicerol al 10%, urea 0,2 M, glutatión oxidado 0,5 mM (GSSG), glutatión reducido 1 mM (GSH), pH 9,0.

Dicha solución se enfrió en un vaso de 1 l sobre hielo húmedo hasta la utilización. Colocar parafilm sobre el vaso para impedir que se contamine. 5.3.12. Preparar 20 ml de tampón de lisis bacteriana en un tubo cónico de 50 ml de plástico. Etiquetar el tubo como "Tampón de lisis bacteriana de I2" (etapas 5.3.13 a 5.3.16). 5.3.13. Añadir 20 ml de tampón A de I2 al tubo cónico de 50 ml.

5.3.14. Añadir 20 mg de lisozima al tubo cónico de 50 ml (concentración final: 1 mg/ml). 5.3.15. Añadir una tableta de inhibidor de proteasa completo (Roche) al tubo cónico de 50 ml. 5.3.16. Agitar con vórtex el contenido del tubo cónico de 50 ml hasta que la lisozima y tableta de inhibidor de proteasa se encuentren en solución. A continuación, dejar dicho tubo sobre hielo húmedo hasta que se necesite. Debe refrigerarse antes de ser utilizado.

5.3.17. Sacar el pellet o pellets bacterianos de I2 del congelador de -70ºC y dejarlos sobre hielo. El peso húmedo del pellet o pellets bacterianos de I2 debe ser de entre 3 y 5 g. Pueden requerirse múltiples pellets para conseguir el intervalo de masa de 3 a 5 g. Descongelar el pellet o pellets sobre hielo durante 15 minutos. 5.3.18. Mientras se descongela el pellet bacteriano, preparar los 20 ml de reactivo de desoxicolato (DOC) al 2%. Etiquetar un tubo cónico de plástico de 50 ml con "Reactivo DOC al 2% de I2". Añadir lo siguiente al tubo cónico de 50 ml. 5.3.19. Añadir 20 ml de tampón A de I2. 5.3.20. Añadir 400 mg de desoxicolato sódico (DOC). 5.3.21. Agitar con vórtex la solución brevemente y después mezclar los componentes por inversión hasta la completa disolución del DOC. Dicha solución debe mantenerse a temperatura ambiente hasta la utilización.

5.3.22. Añadir 20 ml de tampón de lisis bacteriana de I2 al pellet bacteriano sobre hielo. Suspender el pellet uniformemente sobre hielo con una pipeta sérica de 10 ml. La suspensión se lleva a cabo en la botella de centrífuga de 500 ml y se finaliza cuando ya no hay indicios de partículas visibles. 5.3.23. Incubar la suspensión sobre hielo durante 30 min. 5.3.24. Transferir la suspensión a un tubo cónico de 50 ml. Etiquetar dicho tubo con "Sonicado de lisado total de I2" y la fecha actual. Dejar dicho tubo sobre hielo. 5.3.25. Sonicar la preparación en suspensión sobre hielo. 5.3.26. Ajustar la amplitud a 40%. 5.3.27. Apretar el botón Recuperar y seleccionar el Programa ID nº 1. Después apretar Entrar. Este programa se configura para llevar a cabo pulsos de 1 segundo en un ciclo de 10 s.

5.3.28. Insertar la sonda de punta pequeña en el tubo cónico de 50 ml. Asegurarse de que la sonda está bien insertada en la suspensión de lisado. Asegurarse de que la punta no toca la superficie del tubo cónico de 50 ml. 5.3.29. Apretar Inicio para someter la suspensión a un ciclo de sonicación. A continuación dejar en reposo la suspensión durante 15 segundos para evitar el sobrecalentamiento de la muestra. 5.3.30. Repetir la etapa 5.3.29 cinco veces. A continuación comprobar la suspensión con una pipeta sérica de 10 ml. Hacer pasar la suspensión por la pipeta varias veces. La suspensión debe salir fluidamente de la punta de la pipeta sin cambios visibles de viscosidad o pegajosidad. En el caso de que la muestra presente una apariencia pegajosa, el ADN genómico no habrá sido fragmentado suficientemente. En este caso, repetir la etapa 5.3.29 hasta que desaparezca este problema. 5.3.31. Transferir ∼20 ml de la muestra sonicada a un tubo de centrífuga de 50 ml (Nalgene). Tras la transferencia, reservar 50 ml del sonicado para el posterior análisis del gel. Éste debe mantenerse en el tubo de centrífuga de 50 ml original etiquetado con "Sonicado de lisado total de I2" hasta que se necesite. Almacenar la alícuota de 50 µl a 4ºC. 5.3.32. Introducir la suspensión sonicada en la centrífuga Beckman J2-21 y centrifugar la muestra a 12.000xg (12.400 rpm en rotor JA-20) a 4ºC durante 10 minutos.

5.3.33. Tras la centrifugación, decantar el sobrenadante en un tubo cónico de 50 ml etiquetado con "Sobrenadante sonicado S1" y la fecha actual. Este sobrenadante se utilizará para el posterior análisis del gel. Almacenarlo a 4ºC hasta que se necesite. En este punto el pellet insoluble se someterá a un procesamiento posterior. 5.3.34. Suspender el pellet insoluble en 20 ml de reactivo DOC al 2% de I2 en el tubo de centrífuga de 50 ml.

Suspender el pellet uniformemente a temperatura ambiente con una pipeta sérica de 10 ml. La suspensión no se ha finalizado hasta desparecer cualquier signo de partículas. Esta etapa tardará aproximadamente 10 minutos.

5.3.35. Incubar la suspensión de DOC al 2% durante 30 minutos a temperatura ambiente. 5.3.36. Introducir la suspensión de DOC al 2% en la centrífuga Beckman J2-21 y centrifugar la muestra a 12.000xg (12.400 rpm en rotor JA-20) a 4ºC durante 10 minutos. 5.3.37. Tras la centrifugación, decantar el sobrenadante en un tubo cónico de 50 ml etiquetado con "Sobrenadante de lavado de DOC S2" y la fecha actual. Este sobrenadante se utilizará para el posterior análisis del gel. Almacenarlo a 4ºC hasta que se necesite. En este punto el pellet insoluble se someterá a un procesamiento posterior. 5.3.38. Lavar suavemente el pellet insoluble con 20 ml de 1xPBS, pH 7,4. Lo anterior se llevará a cabo dos veces con incrementos de 10 ml de 1xPBS, pH 7,4.

5.3.39. Añadir lentamente 10 ml de 1xPBS, pH 7,4 a la botella de centrífuga de 50 ml. No perturbar el pellet. Tapar la botella y dejar la botella volcada. Hacer girar lentamente la botella varias veces. 5.3.40. Decantar el lavado de 1xPBS. 5.3.41. Repetir la etapa 5.3.39. 5.3.42. Decantar el lavado de 1xPBS.

5.3.43. Utilizar una pipeta de 1 ml (P1000) para eliminar cualquier líquido residual. 5.3.44. A continuación se solubiliza el pellet con 20 ml de tampón desnaturalizante de I2 en el tubo de centrífuga de 50 ml. Suspender el pellet uniformemente a temperatura ambiente con una pipeta sérica de 10 ml. Esta etapa de solubilización tardará aproximadamente 15 minutos. Para solubilizar suficientemente dicho pellet, asegurarse de que la punta de la pipeta se aprieta firmemente contra la pared del tubo de centrífuga durante la mezcla. Lo anterior creará una gran fuerza de cizalla para fragmentar adicionalmente y solubilizar el pellet. No se podrá solubilizar por completo el pellet pero las partículas deberían romperse hasta el punto en que sus diámetros no sean superiores a 1 milímetro. 5.3.45. A continuación, dicha mezcla se agita a temperatura ambiente durante 30 minutos. 5.3.46. Introducir la mezcla solubilizada en la centrífuga Beckman J2-21 y centrifugar la muestra a 12.000xg (12.400 rpm en rotor JA-20) a 4ºC durante 15 minutos. 5.3.47. Decantar el sobrenadante en un tubo cónico de 50 ml etiquetado con "GST-I2 desnaturalizado" y la fecha actual. Reservar 50 µl de dicha solución en un tubo de microcentrífuga de 1,5 ml para el posterior análisis del gel (almacenar a 4ºC). Descartar el pellet. Los ∼20 ml de GST-I2 desnaturalizado pueden mantenerse a temperatura ambiente hasta que se necesiten para la etapa siguiente.

5.3.48. Diluir el GST-I2 desnaturalizado 20 veces lentamente en tampón de replegamiento de I2 helado. Las etapas siguientes se llevan a cabo a 4ºC en una nevera. Se utiliza una bomba peristáltica para añadir lentamente el sobrenadante al tampón de replegamiento helado que se está agitando en una placa de agitación magnética. La tasa de flujo de la adición del sobrenadante es de aproximadamente 0,5 ml/min. La tasa de flujo puede cambiar con la condición de que la gota de sobrenadante se disuelva totalmente en la solución de replegamiento antes de la adición de la gota siguiente. Lo anterior se lleva a cabo para optimizar la dilución de GST-I2 y para evitar cualquier impedimento estérico que podría producirse durante el replegamiento debido a que las moléculas de GST-I2 se encuentran excesivamente próximas entre sí. 5.3.49. Cebar la bomba (el cebado puede llevarse a cabo durante las etapas de incubación de 30 min. en 5.3.35 y 5.3.45 para aprovechar el tiempo).

5.3.49.1. Introducir la bomba peristáltica con tubos de Tygon conectados en la nevera. Dejar la placa de agitación magnética al lado de la bomba. Utilizar una placa de agitación con una pantalla electrónica de manera que se pueda determinar con exactitud las rpm durante la etapa de dilución. 5.3.49.2. Cebar la bomba con 40 ml de H2O destilada Nanopure. Introducir los tubos conectados al conector "in" en un tubo cónico de 50 ml que contiene 40 ml de H2O. Asegurarse de que los tubos se encuentran al fondo del tubo cónico. Introducir los tubos conectados al conector "out" en un vaso de 250 ml. Este vaso es un recipiente de desechos para el procedimiento de cebado. Fijar el dial de la bomba peristáltica en 10 y configurar la bomba en los ajustes de cebado. Apretar el botón "Forward" para iniciar el cebado. 5.3.49.3. Tras finalizar el cebado con agua, cebar los tubos con 20 ml de tampón desnaturalizante. Repetir las instrucciones proporcionadas en la etapa 5.3.49.2, excepto en que se deben utilizar 20 ml de tampón desnaturalizante de I2 en lugar de agua. Después de esta etapa la bomba está lista para la introducción de GST-I2 desnaturalizado.

5.3.50. Introducir GST-I2 desnaturalizado en la bomba y diluir posteriormente en tampón de replegamiento de I2.

5.3.50.1. Asegurarse de que la bomba se encuentra desactivada. 5.3.50.2. Introducir el tubo cónico de 50 ml que contiene GST-I2 desnaturalizado en la nevera al lado de la bomba peristáltica. Insertar los tubos conectados al conector "in" de la bomba peristáltica. Asegurarse de que los tubos alcanzan el fondo del tubo cónico de 50 ml. 5.3.50.3. Introducir una barra de agitación magnética en el vaso de 1 l que contiene el tampón de replegamiento de I2. Retirar el vaso del hielo húmedo e colocarlo sobre la placa de agitación magnética en la nevera. Activar la placa de agitación y ajustar las rpm a 120.

5.3.50.4. Insertar los tubos conectados al conector "out" de la bomba en el vaso de 1 l. No insertar el tubo en el tampón de replegamiento. Es necesario dejar un espacio (6 a 7 cm) entre el final del tubo y la superficie del tampón de replegamiento. Lo anterior permitirá una formación correcta de la gota al introducir la muestra en el tampón de replegamiento. Asegurarse de que se ha sellado el vaso con parafilm. 5.3.50.5. Activar la bomba en configuración lenta y después ajustar el dial a 0. Apretar el botón "Forward" para iniciar la carga de GST-I2 desnaturalizado.

5.3.50.6. El tiempo de inicio del procedimiento de dilución se inicia cuando la muestra alcanza el final del tubo y empieza a caer en el tampón de replegamiento. En este punto comprobar que las gotas se están disolviendo en la solución antes de añadir la gota siguiente. En el caso de que las gotas no se disuelvan suficientemente rápido, acelerar la velocidad de la barra de agitación a 140 rpm. 5.3.50.7. Tras cargar todo el GST-I2 desnaturalizado en el vaso, desactivar la bomba peristáltica. Marcar dicho vaso con "GST-I2 replegado" y la fecha actual. Reducir la velocidad de la placa de agitación a 100 rpm y dejar la mezcla de dilución bajo incubación durante la noche a 4ºC.

5.3.51. Preparar 10 litros de 1xPBS, pH 7,4 (2 volúmenes de 5 litros).

5.3.51.1. Obtener dos vasos de 5 litros. Enjuagarlos con 200 ml de H2O destilada Nanopure antes de utilizar. Etiquetar dicho vaso con "1xPBS, pH 7,4" y la fecha actual. 5.3.51.2. Añadir 250 ml de 20xPBS, pH 7,4, a cada vaso de 5 litros. 5.3.51.3. Añadir 4,75 l de H2O destilada Nanopure a cada vaso de 5 litros. 5.3.51.4. Mezclar cada solución y cubrir cada vaso con hoja de aluminio. Almacenar cada solución en una nevera a 4ºC durante la noche.

5.4. DÍA 4 5.4.1. Activar un gel de proteínas para determinar si GST-I2 ha sido procesado correctamente hasta el punto en que el GST-I2 ha sido desnaturalizado en el tampón desnaturalizante. 5.4.2. En este gel se aplicaron las muestras siguientes: 5.4.2.1. Sonicado de listado total de I2, etapa 5.3.31. -TLS 5.4.2.2. Sobrenadante sonicado S1, etapa 5.3.33. -S1 5.4.2.3. Sobrenadante de lavado de DOC S2, etapa 5.3.37. -S2 5.4.2.4. GST-I2 desnaturalizado, etapa 5.3.47. -DEN 5.4.3. Preparación de muestras: etiquetar cuatro tubos de microcentrífuga con TLS, S1, S2 y DEN. Añadir lo siguiente a cada tubo: 5.4.3.1. 1 µl de muestra 5.4.3.2. 10 µl de 4X tampón para muestras 5.4.3.3. 1 µl de beta-mercaptoetanol al 2,5% 5.4.3.4 4. 28 µl de H2O destilada Nanopure 5.4.4 Mezclar las muestras y después incubarlas en un bloque térmico a 90ºC durante 5 minutos. Repetir las etapas 5.3.5 a 5.3.7 para prepara y procesar el gel. 5.4.5. Decantar la tinción Simply Blue SafeStain y añadir 100 ml de H2O destilada Nanopure. Introducir el gel nuevamente en un agitador oscilante e incubarlo durante 1 hora. Dentro de los 10 minutos iniciales de esta etapa de incubación podrá confirmar que se encuentra presente el antígeno GST-I2 en la muestra desnaturalizada (DEN) (figura 42B). Tras confirmar las bandas pasar a la etapa siguiente. 5.4.6. Coger tres trozos de tubo de diálisis (6-8mwco) precortados a 36 cm de longitud y sumergirlos en 500 ml de H2O destilada Nanopure. Dejar en remojo los tubos de diálisis durante 30 minutos.

5.4.7. Sacar el vaso "GST-I2 replegado" de la nevera y dejarlo sobre hielo. La solución en el vaso será transparente, sin precipitados visibles. Extraer una muestra de 50 µl de esta solución para el análisis en gel. Etiquetar esta muestra con "rGST-I2 diluido" y la fecha actual. 5.4.8. Sacar uno de los vasos que contiene 5 litros de 1xPBS frío, pH 7,4, de la nevera. Asegurarse de que esta solución se mezcla antes de dejarla sobre hielo. Etiquetar este vaso con "Primer intercambio".

5.4.9. Dejar tres tubos cónicos de 50 ml sobre hielo. Estos tubos cónicos se utilizarán para transferir el GST-I2 replegado a los tubos de diálisis. Utilizando una pipeta sérica de 25 ml, transferir aproximadamente 47 ml de GST-I2 replegado a cada tubo cónico de 50 ml. 5.4.10. Retirar uno de los trozos de tubo de diálisis del agua destilada y colocar una pinza en el fondo del tubo. Asegurarse de que la pinza está cerrada y cubre la anchura del tubo para garantizar un sellado firme.

5.4.11. Insertar un embudo de vidrio en el extremo abierto del tubo de diálisis. Asegurarse de que el embudo está insertado y de que la parte insertada está sujeta firmemente al tubo de diálisis. Es importante llevar a cabo lo anterior para evitar que resbale el tubo mientras se carga. Debido a la naturaleza resbaladiza de la muestra que se carga, los tubos deben sujetarse firmemente desde la parte superior en todo momento. 5.4.12. Con el embudo sujeto en posición, cargar con cuidado el GST-I2 replegado en el embudo. Tras vaciar cada tubo cónico dejarlo nuevamente sobre hielo. 5.4.13. Tras cargar el último tubo cónico de GST-I2 replegado, dejar el tubo cónico vacío sobre hielo. Con ambas manos sujetar firmemente la parte superior del tubo de diálisis. Forzar la salida de todas las burbujas de aire del tubo, utilizando un trapo Kimwipe para eliminar las burbujas. Asegurarse de que no queda aire en los tubos antes de cerrar la pinza en la parte superior.

5.4.14. Cerrar la pinza en la parte superior del tubo. Este tubo se expandirá después de finalizar la diálisis de manera que asegurarse de que queda suficiente espacio en el tubo para la expansión. Dejar 6 cm de espacio entre la pinza y la superficie de la muestra. Lo anterior permitirá que se produzca la expansión. Nuevamente no debería quedar aire en el tubo. Asegurarse de que no hay fugas. 5.4.15. Introducir lentamente el tubo de diálisis lleno en el vaso de 5 litros de 1xPBS frío, pH 7,4.

5.4.16. Repetir las etapas 5.4.9 a 5.4.15 dos veces más. Utilizar los mismos tres tubos cónicos de 50 ml utilizados previamente. Al final de esta etapa habrá un total de tres tubos de diálisis llenos en el vaso de 5 litros.

5.4.17. Colocar el vaso sobre una placa de agitación magnética en una nevera a 4ºC. Introducir una barra de agitación magnética en el vaso. Configurar la placa de agitación para mezclar a 100 rpm. Asegurarse de que la barra de agitación no toca ninguno de los tubos de diálisis. Incubar dichos tubos de diálisis durante 4 h a 4ºC. 5.4.18. Retirar lentamente los tubos de diálisis del vaso de 5 litros e introducirlos en el otro vaso de 5 litros de 1xPBS, pH 7,4, que ha sido almacenado a 4ºC. Asegurarse de no mezclar o agitar la solución en el interior del tubo de diálisis. Introducir una barra de agitación magnética en el vaso. Configurar la placa de agitación para mezclar a 100 rpm. Etiquetar este vaso con "Segundo intercambio". Incubar dichos tubos de diálisis durante la noche a 4ºC. 5.4.19. Preparar 10 litros de 1xPBS, pH 7,4 (2 volúmenes de 5 litros).

5.4.20. Obtener dos vasos de 5 litros. Enjuagarlos con 200 ml de H2O destilada Nanopure antes de utilizar. Etiquetar dicho vaso con "1xPBS, pH 7,4" y la fecha actual. 5.4.21. Añadir 250 ml de 20xPBS, pH 7,4, a cada vaso de 5 litros. 5.4.22. Añadir 4,75 l de H2O destilada Nanopure a cada vaso de 5 litros. 5.4.23. Mezclar cada solución y cubrir cada vaso con hoja de aluminio. Almacenar cada solución en una nevera a 4ºC durante la noche.

5.5. DÍA 5 5.5.1. Retirar lentamente los tubos de diálisis del vaso de 5 litros e introducirlos en el otro vaso de 5 litros de 1xPBS, pH 7,4, que ha sido almacenado a 4ºC. Asegurarse de no mezclar o agitar la solución en el interior del tubo de diálisis. Pueden formarse algunos precipitados en este punto. Introducir una barra de agitación magnética en el vaso. Configurar la placa de agitación para mezclar a 100 rpm. Etiquetar este vaso con "Tercer intercambio". Incubar dichos tubos de diálisis durante cuatro horas a 4ºC. 5.5.2. Retirar lentamente los tubos de diálisis del vaso de 5 litros e introducirlos en el otro vaso de 5 litros de 1xPBS, pH 7,4, que ha sido almacenado a 4ºC. Asegurarse de no mezclar o agitar la solución en el interior del tubo de diálisis. Pueden formarse algunos precipitados en este punto. Introducir una barra de agitación magnética en el vaso. Configurar la placa de agitación para mezclar a 100 rpm. Etiquetar este vaso con "Cuarto intercambio". Incubar dichos tubos de diálisis durante cuatro horas a 4ºC. 5.5.3. Acoplar una botella de sistema de filtración de 1 litro a una bomba de vacío. Sacar el vaso de 5 litros que contiene los tubos de diálisis de la nevera. De uno en uno vaciar cuidadosamente el contenido de los tubos de diálisis en la parte superior del sistema de filtración. Tras vaciar todos los tubos de diálisis en el reservorio superior del filtro, asegurarse de que se reserva una alícuota de 50 µl de la solución para el análisis en gel. Etiquetar la alícuota como "rGST-I2 dializado prefiltrado" y almacenarla a 4ºC hasta que se necesite. 5.5.4. Filtrar la solución al interior de una botella del sistema de 1 litro. Tras completar la filtración, reservar una alícuota de 50 l de la solución para el análisis en gel. Etiquetar la alícuota como "rGST-I2 dializado filtrado" y almacenarla a 4ºC hasta que se necesite. 5.5.5. El volumen de la solución filtrada debería ser de aproximadamente 550 ml después de la diálisis. Etiquetar la botella con "rGST-I2 dializado filtrado-Primera incubación en agarosa" y la fecha actual. Introducir dicha botella en la nevera a 4ºC mientras se prepara la agarosa con glutatión inmovilizado.

5.5.6. Añadir la agarosa con glutatión inmovilizado a la botella de rGST-I2 de la manera indicada en las etapas siguientes 5.5.7 a 5.5.10. 5.5.7. Medir y equilibrar la agarosa con glutatión inmovilizado (resina). 5.5.8. Colocar una columna cromatográfica de 20 ml con una pinza en un soporte de anillo. Colocar un vaso de 250 ml bajo la columna para que haga de recipiente de desechos.

5.5.9. Mezclar la botella de agarosa previamente preparada y mezclar hasta que la agarosa se haya suspendido uniformemente en la solución de almacenamiento. 5.5.10. Utilizando una pipeta sérica de 10 ml, cargar dicha agarosa mezclada en la columna. Continuar cargando la mezcla hasta sedimentar un lecho de 6 ml de la agarosa sobre el fondo de la columna. Dejar que la solución en la columna salga hasta que la superficie superior de la solución de almacenamiento se encuentre 1 ml sobre el lecho de agarosa. En este punto, tapar el fondo de la columna. (Mientras se trabaja con esta agarosa, no dejar que se seque. Mantenerla húmeda en todo momento).

5.5.10.1. Destapar la columna. Lavar la agarosa con 60 ml de 1xPBS desgasificado, pH 7,4. Tapar la columna. 5.5.10.2. Sacar la botella de 1 litro que contiene los ∼550 ml de solución de rGST-I2 de la nevera.

5.5.10.3. Cargar 10 ml de 1xPBS desgasificado, pH 7,4, en la columna. Utilizando una pipeta sérica de 10 ml, suspender la agarosa uniformemente y añadirla a la botella de 1 litro de solución de rGST-I2. 5.5.10.4. Cargar 10 ml de 1xPBS desgasificado, pH 7,4, en la columna. Mezclar dicho volumen de 10 ml para recuperar la agarosa residual que se ha adherido a la columna. Añadir dicho volumen de 10 ml a la botella de 1 litro de solución de rGST-I2.

5.5.10.5. Tapar la botella y hacer girar lentamente la botella manualmente para mezclar la agarosa uniformemente en la solución. 5.5.10.6. Introducir la botella en la nevera a 4ºC e incubar durante la noche.

5.6. DÍA 6 5.6.1. Activar un gel de proteínas para determinar si GST-I2 ha sido procesado correctamente hasta el punto en que el GST-I2 ha filtrado en 1xPBS, pH 7,4. 5.6.2. En este gel se aplicaron las muestras siguientes: 5.6.2.1. GST-I2 desnaturalizado, etapa 5.3.47. -DEN 5.6.2.2. GST-I2 replegad diluido, etapa 5.4.7. -DIL 5.6.2.3. rGST-I2 prefiltrado en 1xPBS, pH 7,4, etapa 5.5.3. -PRE 5.6.2.4. rGST-I2 filtrado, etapa 5.5.4. -FIL 5.6.3. Preparación de muestras: etiquetar cuatro tubos de microcentrífuga con DEN, DIL, PRE y FIL. 5.6.4. Para preparar la muestra DEN, añadir lo siguiente al tubo: 5.6.4.1.1 µl de muestra 5.6.4.2.10 µl de 4X tampón para muestras 5.6.4.3.1 µl de beta-mercaptoetanol al 2,5% 5.6.4.4. 28 µl H2O destilada Nanopure 5.6.5. Para preparar las muestras DIL, PRE y FIL, añadir lo siguiente a cada tubo: 5.6.5.1. 20 µl de muestra 5.6.5.2. 10 µl de 4X tampón para muestras 5.6.5.3. 1 µl de beta-mercaptoetanol al 2,5% 5.6.5.4. 9 µl de H2O destilada Nanopure 5.6.6. Mezclar las muestras y después incubarlas en un bloque térmico a 90ºC durante 5 minutos. Repetir las etapas 5.3.5 a 5.3.7 para prepara y procesar el gel. 5.6.7. Decantar la tinción Simply Blue SafeStain y añadir 100 ml de H2O destilada Nanopure. Introducir el gel nuevamente en un agitador oscilante e incubarlo durante 1 hora. Dentro de los 10 minutos iniciales de esta etapa de incubación se podrá confirmar que se encuentra presente el antígeno GST-I2 en la muestra filtrada (FIL) (figura 42C). Tras confirmar las bandas pasar a la etapa siguiente.

5.6.8. Primera ronda de purificación del antígeno rGST-I2. 5.6.9. Montar dos columna en un soporte de anillo. Etiquetar cada columna con nº 1 o nº 2. Bajo cada columna colocar un vaso de 250 ml que haga de recipiente de desechos. Romper el sello en el fondo de la columna para abrirla. Preenjuagar cada columna con 50 ml de H2O destilada Nanopure. Colocar una botella estéril desechable de 1 l bajo cada columna. Sacar la botella "rGST-I2 dializado filtrado -Primera incubación de agarosa" de la nevera y mezclar lentamente la botella. 5.6.10. La mezcla dentro de la botella ahora se dividirá uniformemente en dos columnas separadas. La solución se divide en las dos columnas debido a que los lechos de mayor volumen reducen el caudal. La división del trabajo en la columna permite llevar a cabo este procedimiento de purificación en aproximadamente dos horas. 5.6.11. Utilizando una pipeta sérica de 25 ml, empezar a cargar cada columna con la suspensión de agarosa.

Llenar la columna hasta el tope con la suspensión. A continuación, dejar que caiga el volumen hasta la marca de 15 ml en la columna y en ese punto llenar la columna nuevamente hasta el tope. No es deseable dejar que el volumen de suspensión de agarosa caiga en exceso. Si ello ocurre, la adición de la siguiente suspensión de agarosa podría perturbar la formación del lecho de agarosa. Asegurarse de que se añade la suspensión lentamente, a fin de reducir las perturbaciones al lecho de agarosa en formación.

5.6.12. Continuar cargando la columna con la suspensión de agarosa. Tras cargar toda la suspensión de agarosa en la columna, debe taparse. Se tapa cuando la fase líquida en la columna alcanza la marca de 10 ml en la columna. Cada volumen de lecho será de aproximadamente 3 ml. Utilizar este tiempo para preparar 1xPBS, pH 7,4 (1 litro). Desgasificar el PBS con argón durante 5 minutos antes de utilizar. 5.6.13. En este punto, retirar cada botella de 1 litro de debajo de la columna. Combinar los volúmenes eluidos de cada botella en una sola botella. Etiquetar esta botella como "rGST-I2 dializado filtrado-Segunda incubación de agarosa" con la fecha actual y almacenarla en la nevera hasta que se necesite. 5.6.14. Colocar vasos de 250 ml bajo cada columna para que hagan de recipientes de desechos. 5.6.15. Iniciar el lavado del lecho con 60 ml de 1xPBS desgasificado, pH 7,4, en incrementos de 2x30 ml en cada columna. El PBS debería desgasificarse durante 5 min. con argón inmediatamente antes de ser utilizado.

Asegurarse de que se carga el tampón de lavado muy lentamente. 5.6.16. Tras añadir el último lavado, dejar que el volumen caiga hasta que el menisco se encuentre 1-2 mm sobre el lecho. Tapar la columna en este punto. Ahora se desgasifica el tampón de elución (1xPBS, pH 7,4 con glutatión reducido 100 mM). Este tampón de elución se desgasifica con argón durante 2 minutos antes de utilizar. 5.6.17. Cargar 1,5 ml de tampón de elución en cada columna tapada y dejar en reposo durante 5 minutos.

Destapar las columnas y recoger las eluciones en un tubo de microcentrífuga de 1,5 ml. Recoger la elución hasta que el volumen alcance aproximadamente 1,2 ml. Tapar las columnas. Éstas son las primeras eluciones. Etiquetar cada tubo con "nº de elución, nº de columna" y la fecha actual. 5.6.18. El seguimiento de las eluciones se realiza en paralelo a este procedimiento de elución con reactivo de Bradford. Añadir 5 µl de cada elución a pocillos separados de una placa de 96 pocillos. A continuación, añadir 250 µl de reactivo de Bradford a cada pocillo. La presencia de proteína se identifica en este procedimiento mediante el cambio del color del reactivo de marrón a azul. En el caso de que la elución presente un color azul Bradford, etiquetar el tubo de microcentrífuga respectivo con una "B". 5.6.19. Repetir las etapas 5.6.17 a 5.6.18 tres veces más para recoger las eluciones 2 a 4. En este punto debería observarse que desaparece el color azul de la elución nº 4 en la placa de 96 pocillos. En este punto habrá un total de 8 tubos de microcentrífuga. 5.6.20. Almacenar las eluciones a 4ºC. Se utilizarán posteriormente al agrupar las eluciones.

5.6.21. Lavar cada lecho de resina con 80 ml de 1xPBS desgasificado, pH 7,4. 5.6.22. Utilizando una pipeta sérica de 10 ml, suspender cada lecho en 10 ml de 1xPBS, pH 7,4, y añadirlo a la botella etiquetada con "rGST-I2 dializado filtrado -Segunda incubación de agarosa". 5.6.23. Añadir 10 ml adicionales de 1xPBS desgasificado, pH 7,4, a cada columna y mezclar la solución bien para recuperar cualquier agarosa residual. Añadir dicho volumen a la botella etiqueta con "rGST-I2 dializada filtrada- Segunda incubación de agarosa". Hacer girar esta botella lentamente para mezclar la resina. Almacenar la botella durante la noche a 4ºC.

5.7. DÍA 7 5.7.1. Repetir las etapas 5.6.9 a 5.6.23. Lo anterior generar una botella de eluido etiquetada como "rGST-I2 dializado filtrado -Tercera incubación de agarosa" y produce un nuevo conjunto de 8 eluciones que se almacenan durante la noche a 4ºC.

5.8. DÍA 8 5.8.1. Repetir las etapas 5.6.9 a 5.6.23. Lo anterior generar una botella de eluido etiquetada como "rGST-I2 dializado filtrado -Elución final" y produce un nuevo conjunto de 8 eluciones que se almacenan a 4ºC. 5.8.2. Agrupar las eluciones etiquetadas con una "B" en un volumen final. Sólo agrupar las eluciones que muestran un color azul en el ensayo de Bradford.

5.8.2.1. Centrifugar los tubos de elución en una microcentrífuga durante 1 minuto a 5.000xg para eliminar cualquier precipitado. 5.8.2.2. Combinar las eluciones en un tubo cónico de 15 ml. Etiquetar el tubo como "rGST-I2 eluciones agrupadas".

5.8.3. Realizar un ensayo de Bradford para determinar la concentración de la proteína utilizando el pigmento de Bradford y un estándar de albúmina preparado previamente. 5.8.3.1. El Estándar A viene en una ampolla sellada y se utiliza como solución estándar. El diluyente estándar es 1xPBS, pH 7,4, con glutatión reducido 100 mM. 5.8.3.2. Seguir la tabla a continuación para preparar la curva de estándares.

Preparación de estándares de albúmina diluida (BSA) Volumen de Vial Volumen y origen de BSA Concentración final de BSA diluyente A 300 µl de solución estándar 2.000 µg/ml B 125 µl 375 µl de solución estándar 1.500 µg/ml C 325 µl 325 µl de solución estándar 1.000 µg/ml D 175 µl 175 µl de dilución vial B 750 µg/ml E 325 µl 325 µl de dilución vial C 500 µg/ml F 325 µl 325 µl de dilución vial E 250 µg/ml G 325 µl 325 µl de dilución vial F 125 µg/ml H 400 µl 100 µl de dilución vial G 25 µg/ml I 400 µl 0 µg/ml = Blanco 5.8.3.3. Cargar 5 µl de los estándares y la muestra de rGST-I2 agrupada en una placa de 96 pocillos. Cargarlas por duplicado. 5.8.3.4. Añadir 250 µl de reactivo de Bradford a cada pocillo. Golpear suavemente la placa para mezclar las muestras. Incubar la placa durante 5 min. y después leer la placa a 595 nm en un lector de microplacas. No sobreincubar la placa. 5.8.3.5. Dibujar el gráfico de los datos en Excel. Dibujar el gráfico de absorbancia a 595 nm (eje x) vs. concentración en mg/ml (eje y). Sólo un gráfico en el intervalo de 1.000 mg/ml a 25 mg/ml, ya que ésta es la parte lineal de la curva. Determinar la fórmula de la curva mediante regresión lineal. Presentará el formato y=mx+b. Utilizar esta fórmula para determinar la concentración de la muestra. 5.8.4. Tras determinar la concentración, preparar alícuotas del antígeno y congelarlas en nitrógeno líquido. Etiquetar las alícuotas. A continuación, almacenar el antígeno a -70ºC. Reservar una alícuota para el análisis en gel. 5.8.5. Activar un gel para determinar que GST-I2 ha sido purificado.

5.8.5.1. Preparación de muestras: Etiquetar tubos de microcentrifuga con GST-I2 replegado. Añadir lo siguiente al tubo: cargar 2 µg de proteína en el pocillo. X=2,7 µg de GST-I2, en donde se cargarán 30 µl de prep. de muestra de un volumen total de prep. de muestra de 40 µl.

5.8.5.1.1. X µl de muestra 5.8.5.1.2. 10 µl de 4X tampón para muestras 5.8.5.1.3. 1 µl de beta-mercaptoetanol al 2,5%. 5.8.5.1.4. 29-X µl de H2O destilada Nanopure.

5.8.6. Mezclar las muestras y después incubarlas en un bloque térmico a 90ºC durante 5 minutos. Repetir las etapas 5.3.5 a 5.3.7 para preparar y procesar el gel. 5.8.7. Decantar la tinción Simply Blue SafeStain y añadir 100 ml de H2O destilada Nanopure. Introducir el gel nuevamente en un agitador oscilante e incubarlo durante 1 hora.

6.0 CONTROL DE CALIDAD Cada lote de antígeno rGST-I2 purificado se compara con dos lotes anteriores para garantizar la reproducibilidad de la purificación, tal como se muestra en la figura 23.

7.0 ANÁLISIS Cada lote de antígeno rGST-I2 purificado se compara con estándares de BSA para determinar la concentración utilizando el ensayo de Bradford y regresión lineal.

8.0 REFERENCIAS "Purification and characterization of recombinant extraxellular domain of human HER2 from Escherichia coli" PROTEÍNA Expression and Purification X. Liu et al. 2007, páginas 247 a 254.

Ejemplo 20. Protocolo para la realización de inmunoensayos de anti-I2. 1.0 OBJETIVO El presente procedimiento de ELISA de tipo sándwich indirecto de anti-I2 detalla las etapas necesarias para la determinación cuantitativa de anticuerpos séricos IgA humanos contra I2. 2.0 ÁMBITO El inmunoensayo de I2 se utiliza para detectar concentraciones séricas de anti-I2 en muestras de pacientes. 3.0 PRINCIPIO El ensayo utiliza un formato de inmunoensayo de tipo sándwich indirecto en el que se utilizan anticuerpos de captura para recubrir el fondo de los pocillos de una microplaca de 96 pocillos. A continuación se bloquea la placa para minimizar la unión no específica y los niveles altos de ruido. Se añade antígeno a la placa, que se une al anticuerpo de captura. El exceso de antígeno se elimina mediante lavado tras la incubación. Los calibradores, controles y muestras de los pacientes se incuban en los pocillos apropiados y el biomarcador se une al antígeno. A continuación, se elimina mediante lavado el biomarcador no unido y el anticuerpo de detección marcado con fosfatasa alcalina se incuba en los pocillos. La placa se lava nuevamente y se añade una solución de sustrato quimioluminiscente. La placa se lee en un Spectramax M5e de Molecular Devices utilizando la detección luminiscente.

4.0 DEFINICIONES 4.1.12: Péptido relacionado con Pseudomonas fluorescens. 4.2. ELISA: ensayo de inmunosorción ligada a enzima 5.0 REQUISITOS DE LAS MUESTRAS Se extrae sangre completa del paciente en tubos separadores de suero (TSS) y tubo Top EDTA/Lavender. Los tubos se enviaron dentro de los primeros 7 días a Prometheus Laboratories, bajo condiciones de temperatura ambiente o utilizando Cold-pack. Antes de enviar los tubos se almacenaron bajo condiciones de refrigeración.

6.0 PROCEDIMIENTO 6.1. Preparar tampón de recubrimiento mediante la dilución 20X de PBS a 1X con agua nanopura. 6.2. Diluir mAb α-GST de ratón a 5 mg/ml en 1X PBS. Recubrir las placas con 100 µl/pocillo. Almacenar durante la noche a 4ºC. 6.3. Añadir suero de ratón al 5% a un volumen de tampón de dilución de I2 (1xPBS+BSA al 1%+PVA al 0,5%+PVP al 0,8%) necesario para la 1º y 2º diluciones para el día a fin de crear el tampón de trabajo de I2. [por ejemplo 2 ml de suero de ratón a 38 ml de tampón de dilución de I2]. 6.4. Llevar las placas, el tampón de bloqueo de histidina (histidina 20 mM + NaCl 0,5 M + BSA al 1%) y tampón de trabajo de I2 a la temperatura ambiente antes de utilizarlos. Todos los demás reactivos, controles, estándares y muestras deben mantenerse sobre hielo o a 4ºC antes de utilizarlos.

6.5. Preparar la curva de estándares mediante la dilución de suero de conejo anti-His-I2 en tampón de trabajo de I2; la curva de estándares se dibuja por duplicado. Diluciones propuestas para la curva de estándares (2 placas): Dilución Añadir a Tampón de trabajo de I2 Solución estándar 1:500 2 µl de suero de conejo anti-His-I2 998 µl 1 1:2.000 163 µl de Solución estándar 1:500 489 µl 2 1:3.750 85 µl de Solución estándar 1:500 555 µl 3 1:5.000 65 µl de Solución estándar 1:500 585 µl 4 1:10.000 32 µl de Solución estándar 1:500 608 µl 1:20.000 16 µl de Solución estándar 1:500 624 µl 6 1:80.000 160 µl de 1:20.000 480 µl 7 1:320.000 160 µl de 1:80.000 480 µl 8 Blanco Nada 480 µl 6.6. Preparar tampón de lavado mediante la dilución 20X de PBS-Tween a 1X con H2O dil. 6.7. Lavar pocillos 3 veces con 300 µl/pocillo de 1X PBS-Tween. 6.8. Durante la etapa de bloqueo, prepara la dilución de cada control positivo que debe someterse a ensayo [por ejemplo 25 µl de muestra de control en 225 µl] de tampón de trabajo de I2 para una dilución 1:10; el control negativo es una dilución 1:100 [por ejemplo 2,5 µl de suero estabilizado en 250 µl de diluyente]; todas las muestras de control se sembraron en placa por duplicado. Las muestras de diluyen 1:100 y 1:200 [por ejemplo 10 µl de muestra + 90 µl de tampón de trabajo de I2 para 1:10; 25 µl de 1:10 en 225 µl de tampón de trabajo de I2 para 1:100; 15 µl de 1:10 en 285 µl de tampón de trabajo de I2 para 1:200]. Todas las muestras se sembraron en placa por duplicado. NOTA: incubar las muestras diluidas y los estándares en la mesa de laboratorio durante toda la etapa del antígeno. 6.9. Bloquear los pocillos con 300 µl/pocillo de tampón de bloqueo de histidina. Incubar durante 1 hora a temperatura ambiente bajo agitación (aprox. 300 rpm). 6.10. Desechar la solución de bloqueo. No lavar la placa. 6.11. Diluir el rGST-I2 en 1X PBS (según la fórmula a continuación) inmediatamente antes del recubrimiento de las placas a 5 µg/ml, 100 µl/pocillo. [VF = volumen total requerido, es decir, 11 ml de volumen total = una placa] VF/DF = volumen de solución estándar (VS) necesaria para añadir a 1XPBS VF- (VF/DF) = Volumen de 1X PBS (VP); VS+ VP= VF a conc. de 5 mg/ml de antígeno, por ejemplo en el caso de que la solución de antígeno presenta una concentración de 1.788 mg/ml, 1.788 mg/ml/5 mg/ml=357,6 (DF); para una placa VF =11 ml. 11 ml/357,6=0,031 ml de solución de antígeno (es decir, 31 ml) 11 ml -0,031 ml=10,969 ml de 1X PBS 0,031 ml de solución de antígeno + 10,969 ml de 1X PBS =11 ml a una concentración de 5 mg/ml Incubar 1 hora bajo agitación.

6.12. Lavar los pocillos 3 veces con 300 µl/pocillo de 1X PBS-Tween. 6.13. Diluir el tampón de ensayo Tropix (10X) a 1X con H2O DDl para la utilización en la etapa 10.19. Mantener el tampón a 4ºC antes de utilizar y utilizar frío. 6.14. Añadir 100 µl/pocillo de calibradores y muestras por placa por duplicado. Incubar durante 1 hora a temperatura ambiente en agitador orbital (aprox. 300 a 700 rpm). 6.15. Lavar los pocillos 3 veces con 300 µl/pocillo de 1X PBS-Tween. 6.16. Añadir 100 µl/pocillo de anticuerpo secundario 1:5.000 diluido en tampón de trabajo de I2. [por ejemplo 1,2 µl de IgG de cabra anticonejo a 6 ml de tampón de trabajo de I2 para la curva de estándares; 2 µl de IgA de cabra antihumano a 10 ml de tampón de trabajo de I2 para todas las muestras de pacientes y de control]. Incubar 1 hora a temperatura ambiente bajo agitación. 6.17. Lavar los pocillos 3 veces con 300 µl/pocillo de 1X PBS-Tween. 6.18. Lavar pocillos 2 veces con 200 µl/pocillo de tampón de ensayo Tropix (1X). 6.19. Añadir 100 µl/pocillo de la solución de sustrato quimioluminiscente [10 ml para una placa]. El sustrato debe mantenerse a 4ºC antes de utilizar y utilizar frío. Incubar durante 20 minutos, protegido de la luz, bajo agitación.

6.20. Leer las placas inmediatamente en Spectramax M5e utilizando el protocolo de luminiscencia, placa de 96 pocillos opaca de lectura superior, con juego de integración a 500.

7,0 CONTROL DE CALIDAD 7.1. El blanco para cada placa se determina dibujando la curva de estándares. 7.2. Pueden evaluarse los valores de control superior, medio y bajo generados en el ensayo. 7.3. La figura 43 muestra un gráfico de una curva de estándares para las muestras con controles. Los datos de estándares y de los controles se evaluaron y se graficaron utilizando Softmax.

8.0 ANÁLISIS 8.1. El ensayo se mide en UE.

8.1.1. Intervalo de referencia: 367,80 UE. Las muestras con valores superiores a 367,80 UE se consideran positivas para anti-I2. 8.1.2. Concentración mínima detectable (CMD): 1,81 UE. 8.1.3. Intervalo informable: 2,5 UE a 100 UE. 8.1.4. Un valor del paciente inferior a 2,5 UE se informa como < 2,5 UE.

8.1.5. Un valor del paciente superior a 100 UE se informa como > 100 UE.

8.2. El ensayo debe repetirse en muestras con CV >15% entre las dos réplicas o si ambas réplicas son inferiores al límite inferior del intervalo informable.

9.0 CALIBRACIÓN Se generó una curva de calibración de 7 puntos con cada ensayo que debe cumplir los criterios esperados: cada curva se compara con un conjunto de referencia de 30 ensayos anteriores con el fin de determinar su aceptabilidad. 10.0 LINEALIDAD La linealidad del ensayo y el intervalo informable se verifican semestralmente utilizando los materiales de ensayo y análisis estadísticos apropiados. 11.0 INTERFERENCIA El presente ensayo se sometió a ensayo para interferencia con el factor reumatoide, hemolisis y diversas sustancias bilirrubina (400 µg/ml), colesterol (5 mg/ml), heparina (80 U/ml), EDTA (1,8 mg/ml) y hemoglobina (5 mg/ml). Se observó que la detección de anti-I2 se encontraba dentro de un intervalo aceptable tras las adiciones de todas las sustancias indicadas.

Ejemplo 21. Protocolo para la validación de inmunoensayos de anti-I2. El presente ejemplo proporciona un protocolo para la validación del ELISA de anti-I2 humano.

A. Intervalo de referencia El intervalo de referencia es fijado por un analista que realiza el ensayo en un día (dos placas). Se someten a ensayo por duplicado cuarenta muestras de control sano. El intervalo de referencia se determina a partir de la concentración de anti-I2. Se calculan el valor medio, la desviación estándar, el valor mínimo y el valor máximo. Los intervalos de confianza al 95% (media ± 1,96 desviaciones estándares) se consideran el intervalo normal. B. Validación El rendimiento del ensayo es analizado por 3 analistas que llevan a cabo el ensayo en cinco días diferentes (total de 15 ensayos). La validación se lleva a cabo utilizando 3 lotes de preparaciones de antígeno. El estudio distingue entre los efectos de operador y de lote. Cada uno de los tres operadores utiliza un lote diferente por lo menos una vez durante la validación de cinco días. B.1. Curva de estándares La curva se obtiene de 7 estándares con diluciones comprendidas entre 1:2.000 y 1:320.000 y un blanco. La dilución en serie se lleva a cabo a partir de una solución madre 1:500. La dilución 1:500 de la solución madre se prepara mediante la adición de 2 ml de suero de conejo anti-His a 998 ml de diluyente de ensayo. Para preparar la dilución inicial 1:2.000, se añaden 163 ml de la solución madre a un tubo que contiene 489 ml de diluyente de ensayo. La dilución posterior se lleva a cabo tal como se indica en la tabla a continuación. Diluciones propuestas para la curva de estándares (2 placas): Dilución Añadir a Diluyente de ensayo Solución estándar 1:500 2 µl de suero de conejo anti-His 998 µl 1 1:2.000 163 µl de solución madre 1:500 489 µl 2 1:3.750 85 µl de solución madre 1:500 555 µl 3 1:5.000 65 µl de solución madre 1:500 585 µl 4 1:10,000 32 µl de solución madre 1:500 608 µl 1:20.000 16 µl de solución madre 1:500 624 µl 6 1:80.000 4 µl de solución madre 1:500 636 µl 7 1:320.000 1 µl de solución madre 1:500 639 µl 8 Blanco Nada 640 µl Cada estándar se somete a ensayo por duplicado. La reproducibilidad de la curva de estándares se evalúa comparando para cada lote el valor esperado con el valor observado/calculado medio, la desviación estándar y el CV (%). El análisis muestra la comparación por parejas entre múltiples lotes estándares. La reproducibilidad de señales aceptable para los estándares 1 a 7 se define como una precisión (CV(%) inferior a 10%. B.2. Sensibilidad Se determinó la concentración mínima detectable (CMD) utilizando un total de 20 réplicas de los estándares cero (blancos). Se utilizó la media y la desviación estándar para calcular la CMD. La CMD se determinó mediante la adición de dos desviaciones estándares al valor medio de densidad óptica de las 20 réplicas de estándares cero. B.3. Precisión/Exactitud La precisión intra- e inter-ensayo se determinó para los controles positivos alto, medio y bajo. Para la precisión intraensayo (precisión dentro del ensayo), los controles positivos alto, medio y bajo se someten a ensayo en 16 réplicas en una única placa. Para la precisión inter-ensayo (precisión entre ensayos), los controles positivos alto, medio y bajo se someten a ensayo en quince placas separadas. Cada muestra se evalúa para cada ensayo. Se calculan los valores asignados, medias, desviaciones estándares y CV (%). La precisión analítica aceptable para las muestras comprendidas en el intervalo dinámico de la curva de estándares se define como la precisión (CV (%)) inferior a 10%. B.4. Intervalo/linealidad informable Se evaluó la linealidad de dilución utilizando cinco diluciones de dos veces en serie de los controles alto, medio y bajo (Neat), partiendo de 1/2. Se evaluó cada uno por duplicado. El rendimiento de concentración de anti-I2 se obtuvo multiplicando por el factor de dilución. Se determinó el porcentaje de recuperación. El rendimiento se considera aceptable en el caso de que los resultados sean de entre 80% y 120% la concentración esperada. También se calculó la regresión lineal (R2) para confirmar que la dilución de las muestras se correlacionaba linealmente con las unidades de ELISA calculadas. C. Estudios de estabilidad Tres analistas llevaron a cabo ensayos de estabilidad el mismo día (3 placas). Cada ensayo de muestra se había preparado previamente y almacenado a -80ºC. C.1. Estabilidad a temperatura ambiente (TA) Se incubaron controles alto, medio y bajo a temperatura ambiente durante 1, 2, 4 o 7 días. Los controles tratados se sometieron a ensayo y se compararon con los controles no tratados. Criterios de aceptabilidad 80% a 120% de la concentración de I2 calculada inicial. C.2. Estabilidad a la temperatura de 4ºC (4ºC) Se incubaron controles alto, medio y bajo a una temperatura de entre 2ºC y 8ºC durante 1, 2, 4 o 7 días. Los controles tratados se sometieron a ensayo y se compararon con los controles no tratados. Criterios de aceptabilidad 80% a 120% de la concentración de I2 calculada inicial. C.3. Preparaciones y muestras de antígeno GST-I2 purificadas mediante congelación y descongelación (C/D) Los controles alto, medio y bajo se sometieron a 5 ciclos de congelación y descongelación. Los controles tratados se sometieron a ensayo y se compararon con los controles no tratados. Criterios de aceptabilidad 80% a 120% de cero congelación-descongelación.

Se sometieron alícuotas de antígeno GST-I2 a 1-5 ciclos (IS-CD0, 1, 2, 3, 4, 5) de congelación-descongelación y se sometieron a ensayo y compararon con muestras que se habían mantenido congeladas. Criterios de aceptabilidad 80% a 120% de cero congelación-descongelación. C.4. Estabilidad de los estándares Para la evaluación de la estabilidad de los estándares, se dividió la solución madre de estándares en dos alícuotas y se almacenaron a 4ºC durante 7 días y durante 14 días. El ensayo se llevó a cabo utilizando controles altos, medio y bajos. Criterios de aceptabilidad 80% a 120% de cero congelación-descongelación.

D. Interferencia/Especificidad Tres analistas llevaron a cabo ensayos de interferencia el mismo día (3 placas). D.1. Suero hemolizado Se sometió a ensayo suero hemolizado para la interferencia de ensayo de anti-I2. Se recogió sangre completa de tres donantes sanos con su consentimiento. La sangre se agitó con vórtex vigorosamente para provocar una hemólisis severa y después se dejó que coagulasen. Se recogió el suero. Los controles alto, medio y bajo se diluyeron por duplicado con un volumen igual de NHS o muestra normal hemolizada. Criterios de aceptabilidad 80% a 120% de la concentración de anti-I2 calculada inicial. D.2. Suero de FR Para determinar si el factor reumatoide (FR) interfería con el ensayo, se diluyeron por duplicado controles alto, medio y bajo con un volumen igual de suero humano normal (NHS) o suero positivo para factor reumatoide (RF) (muestra clínica obtenida de Aalto Scientific). La recuperación de anti-I2 de la adición a controles de NHS se comparó con los controles con adición de suero positivo para FR. Criterios de aceptabilidad 80% a 120% de la concentración de anti- I2 calculada inicial.

D.3. Especificidad Se determinaron los efectos de diversas sustancias sobre el rendimiento del ensayo de anti-I2. Se añadieron a los controles alto, medio y bajo, bilirrubina (400 µg/ml), colesterol (5 mg/ml), heparina (80 U/ml), EDTA (1,8 mg/ml) o hemoglobina (5 mg/ml). Se calculó el % de I2 recuperado en el control con adición. Criterios de aceptabilidad 80% a 120% de la concentración de anti-I2 calculada inicial. Ejemplo 22. Inmunoensayos de anti-I2 ejemplares que utilizan antígeno GST-I2 replegado. El presente ejemplo describe dos inmunoensayos de anti-I2 que utilizan antígeno GST-I2 replegado (ver el Ejemplo 19) para detectar anticuerpos anti-I2 en una muestra biológica. Ambos ensayos se llevaron a cabo en una placa de microtitulación de 96 pocillos con una proteína etiqueta con GST replegada que consistía de 100 aminoácidos de la secuencia de I2. Sin embargo, el experto ordinario en la materia apreciará que un fragmento del polipéptido I2 que es inmunorreactivo con un anticuerpo anti-I2 resulta adecuado para la utilización en los inmunoensayos descritos en la presente memoria.

El ensayo de anti-I2 puede ser el ELISA ilustrado en la figura 44A y descrito en el Ejemplo 20. En particular, se captura antígeno GST-I2 replegado sobre la placa utilizando un anticuerpo monoclonal anti-GST recubriendo la superficie de los pocillos. Tras la incubación de las muestras de suero de los pacientes en los pocillos, se llevó a cabo la detección de los anticuerpos IgA/IgG anti-I2 utilizando reactivo de anti-IgA/G humana conjugado con enzima fosfatasa alcalina. A continuación, la reacción se reveló utilizando una solución de sustrato quimioluminiscente. Para evaluar el valor pronóstico del presente ensayo, se analizaron los valores séricos de anti-I2 para los pacientes con complicaciones de la EC (por ejemplo enfermedad penetrante o fibroestenosante) y los pacientes de EC que habían sido sometidos a un procedimiento quirúrgico. Los resultados mostraron que 64,6% de los pacientes con niveles elevados de anti-I2 (por ejemplo niveles superiores al nivel de concentración de referencia) experimentan comportamiento de enfermedad complicada, comparado con 52,5% de los pacientes con niveles bajos de anti-I2 (p=0,002). De esta manera, la detección de anti-I2 utilizando el presente ensayo robusto encuentra utilidad en la predicción de posibles resultados de comportamiento de la enfermedad para los pacientes de EC.

El ensayo de anti-I2 puede ser el ELISA ilustrado en la figura 44B. En particular, la placa se recubrió con 100 µl/pocillo de neutravidina en tampón de carbonato sódico, pH 9,5, a 4ºC durante la noche. Tras lavar con PBST, la placa se bloqueó son SuperBlock durante 30 minutos. Tras lavar con PBST, la mitad de la placa se incubó con 100 µ de GST-I2 replegado biotinilado (Bio-GST-I2; 100 µg/ml en SuperBlock), mientras que la otra mitad se incubó con 100 µl de SuperBlock (fondo) durante 1 hora a temperatura ambiente (TA) bajo agitación suave. Como estándar se utilizó suero agrupado de pacientes de EII. La unidad arbitraria de los estándares se fijó en 160 U/ml para IgA GST- I2 y 146 U/ml para IgG GST-I2. Se llevaron a cabo diluciones en serie de los estándares para generar la curva de estándares (3 U/ml y después diluciones 1:3). Se añadieron a cada pocillo 100 µl/pocillo de los estándares y de las muestras (dilución 1:300 en SuperBlock) tras el lavado con PBST. Tras incubar a TA durante 1,5 horas bajo agitación suave, la placa se lavó y se incubó con 100 µl de anti-IgA humano marcado con PRP o 2º anticuerpo IgG durante 1 hora a TA bajo agitación. Se añadió sustrato TMB a cada pocillo tras el lavado. La placa se incubó en la oscuridad bajo agitación durante 15 minutos y se detuvo la reacción con 50 µl/pocillo de ácido fosfórico 1 M. Se utilizó un lector de placas SpectraMax para leer la DO450. Para analizar la unión específica, se restó la DO450 de fondo de los estándares y de las muestras de la DO450 correspondiente de los pocillos que contenían Bio-GST-I2. Los valores de IgA o IgG de GST-I2 se calcularon a partir de la curva de estándares utilizando el programa Prism graphPad.

LISTADO DE SECUENCIAS INFORMAL SEC ID nº 1 Nº DE ACCESO DE GENBANK NP_000591 PRECURSOR DE INTERLEUQINA 6 DE HOMO SAPIENS (PROTEÍNA) SEC ID nº 2 Nº DE ACCESO DE GENBANK NM_000600 INTERLEUQUINA 6 (IL-6) DE HOMO SAPIENS (ARNm) SEC ID nº 3, Nº DE ACCESO DE GENBANK NP_000567 PROPROTEÍNA INTERLEUQUINA 1, BETA DE HOMO SAPIENS (PROTEÍNA) SEC ID nº 4 Nº DE ACCESO DE GENBANK NM_000576 INTERLEUQUINA 1, BETA DE HOMO SAPIENS (ARNm) SEC ID nº 5 Nº DE ACCESO DE GENBANK NP_003800 INDUCTOR DÉBIL DE APOPTOSIS RELACIONADO CON FNT DE HOMO SAPIENS (TWEAK) (PROTEÍNA) SEC ID nº 6 Nº DE ACCESO DE GENBANK NM_003809 INDUCTOR DÉBIL DE APOPTOSIS RELACIONADO CON FNT DE HOMO SAPIENS (TWEAK) (ARNm)

SEC ID nº 7 Nº DE ACCESO DE GENBANK NP_001954 FACTOR DE CRECIMIENTO EPIDÉRMICO DE HOMO SAPIENS (FCE)(PROTEÍNA) SEC ID nº 8 Nº DE ACCESO DE GENBANK NM_001963 FACTOR DE CRECIMIENTO EPIDÉRMICO DE HOMO SAPIENS (FCE)(ARNm) SEC ID nº 9 Nº DE ACCESO DE GENBANK NP_000558 PROTEÍNA C REACTIVA DE HOMO SAPIENS (PCR) (PROTEÍNA) SEC ID nº 10 Nº DE ACCESO DE GENBANK NM_000567 PROTEÍNA C REACTIVA DE HOMO SAPIENS (PCR) (ARNm) SEC ID nº 11 Nº DE ACCESO DE GENBANK NP_000322 AMILOIDE A1 SÉRICO DE HOMO SAPIENS (PROTEÍNA) SEC ID nº 12 Nº DE ACCESO DE GENBANK NM_000331 AMILOIDE A1 SÉRICO DE HOMO SAPIENS (ARNm) SEC ID nº 13 Nº DE ACCESO DE GENBANK NP_005209 DEFENSINA, BETA 1, DE HOMO SAPIENS (DEFB1) (PROTEÍNA) SEC ID nº 14 Nº DE ACCESO DE GENBANK NM_005218 DEFENSINA, BETA 1, DE HOMO SAPIENS (DEFB1) (ARNm) SEC ID nº 15 Nº DE ACCESO DE GENBANK NP_004933 DEFENSINA, BETA 2, DE HOMO SAPIENS (DEFB2) (PROTEÍNA) SEC ID nº 16 Nº DE ACCESO DE GENBANK NM_004942 DEFENSINA, BETA 2, DE HOMO SAPIENS (DEFB2) (ARNm) SEC ID nº 17 Nº DE ACCESO DE GENBANK NP_004351 CADHERINA-E DE HOMO SAPIENS (CDH1) (PROTEÍNA) SEC ID nº 18 Nº DE ACCESO DE GENBANK NM_004360 CADHERINA-E DE HOMO SAPIENS (CDH1) (ARNm) SEC ID nº 19 Nº DE ACCESO DE GENBANK NM_000201 Molécula de adhesión intercelular 1 de Homo sapiens (MAIC1) (ARNm) SEC ID nº 20 Nº DE ACCESO DE GENBANK NP_000192 Precursor de la molécula de adhesión intercelular 1 de Homo sapiens (MAIC1) (PROTEÍNA) SEC ID nº 21 Nº DE ACCESO DE GENBANK NM_001078 Molécula de adhesión celular vascular 1 de Homo sapiens (MACV1), transcrito variante 1 (ARNm) SEC ID nº 22 Nº DE ACCESO DE GENBANK NP_001069 precursor de isforoma a de la proteína de adhesión celular vascular 1 de Homo sapiens (PROTEÍNA) SEC ID nº 23 Nº DE ACCESO DE GENBANK NM_022162 Dominio de oligomerización de unión a nucleótidos 2 de Homo sapiens (NOD2) (ARNm) SEC ID nº 24 Nº DE ACCESO DE GENBANK NP_071445 Dominio de oligomerización de unión a nucleótidos 2 de Homo sapiens (NOD2) (PROTEÍNA)

REIVINDICACIONES

1- Método para ayudar en el pronóstico de la enfermedad de Crohn (EC) en un individuo diagnosticado de EC, comprendiendo dicho método: (a) analizar una muestra obtenida de dicho individuo para determinar la presencia, el nivel o el genotipo de una combinación de marcadores séricos y marcadores genéticos, en el que dichos marcadores séricos comprenden inmunoglobulina A anti-Saccharomyces cerevisiae (IgA- AASC), inmunoglobulina G anti-Saccharomyces cerevisiae (IgG-AASC), un anticuerpo anti-proteína C de la membrana externa (anti-OmpC), un anticuerpo anti-CBir-1, un anticuerpo anti-I2 y un anticuerpo perinuclear anti-neutrófilo citoplasmático (ANACp) y en el que dichos marcadores genéticos comprenden PSN8 (R702W), PSN12 (G908R) y PSN13 (3020InsC) en el gen NOD2, (b) aplicar un análisis de cuartiles a dichos marcadores séricos con el fin de obtener una puntuación de suma de cuartiles (PSC) para dicho individuo mediante: (b1) la conversión del nivel de los marcadores séricos IgA-AASC, IgG-AASC, anti-OmpC, un anticuerpo anti- CBir-1 y un anticuerpo anti-I2 en una puntuación de cuartil, (b2) la conversión del estado del marcador sérico ANACp en una puntuación de cuartil invertida, en la que un estatus positivo de este marcador se convierte en un "1" y un estatus negativo de este marcador se convierte en un "4", y (b3) sumar dicha puntuación de cuartiles para cada uno de dichos marcadores séricos, y (c) ayudar en el pronóstico de la EC mediante la determinación del riesgo de que dicho individuo desarrolle una complicación de EC durante el tiempo, seleccionando dicha complicación de EC de entre el grupo que consiste de enfermedad estenosante interna, enfermedad penetrante interna y una combinación de las mismas, en la que dicho riesgo se determina comparando dicho PSC y el genotipo de dichos marcadores genéticos para dicho individuo con un modelo serogenético que proporciona una probabilidad acumulada de desarrollo de una complicación de EC durante el tiempo, en el que dicho modelo serogenético se deriva mediante la aplicación de un análisis de regresión logística a las puntuaciones de suma de cuartiles obtenidas de la presencia o nivel de dichos marcadores séricos y el genotipo de dichos marcadores genéticos determinado en una cohorte retrospectiva con resultados conocidos de EC.

2.

Método según la reivindicación 1, en el que la muestra se selecciona de entre el grupo que consiste de suero, plasma, sangre completa y heces.

3.

Método según la reivindicación 1, en el que dichos marcadores séricos comprenden además un anticuerpo, una proteína de fase aguda, una apolipoproteína, una defensina, un factor de crecimiento, una citoquina, una cadherina y una combinación de las mismas. 4.

Método según la reivindicación 3, en el que dicho anticuerpo antimicrobiano comprende un anticuerpo antiflagelina. 5.

Método según la reivindicación 1, en el que la presencia o el nivel de cada uno de dichos marcadores séricos se detecta con un ensayo de hibridación, un ensayo basado en la amplificación, un inmunoensayo o un ensayo inmunohistoquímico.

6.

Método según la reivindicación 1, en el que dicho marcador genético comprende además por lo menos uno de los genes indicados en las Tablas 1A-1E. 7.

Método según la reivindicación 1, en el que el genotipo de dichos marcadores genéticos puede detectarse mediante genotipado para la presencia o la ausencia de dicho polimorfismo de un solo nucleótido (PSN). 8.

Método según la reivindicación 1, en el que dicho modelo serogenético se construye con PSC, duración de la enfermedad y la mutación PSN13 como factores predictivos y estado de complicación como el resultado, en el que dicho modelo serogenético preferentemente se ilustra en la figura 38b.

9.

Método según la reivindicación 1, en el que dicho modelo serogenético comprende una tabla de consulta o gráfico. 10.

Método según la reivindicación 9, en el que dicha tabla de consulta o gráfico proporciona una probabilidad acumulada de que dicho individuo desarrolle o no dicha complicación de EC durante el tiempo. 11.

Método según la reivindicación 9, en el que dicha tabla de consulta o gráfico proporciona una probabilidad acumulada de que dicho individuo requiera cirugía o no requiera cirugía durante el tiempo, en el que dicha cirugía preferentemente es cirugía del intestino delgado.

12.

Método según la reivindicación 1, que comprende además la recomendación de un curso de terapia para dicho individuo basada en dicha comparación de dicho PSC y el genotipo de dichos marcadores genéticos de dicho individuo con dicho modelo serogenético.