Oligonucleótidos inmunoestimulantes.

Un oligonucleótido inmunoestimulante que comprende la secuencia de nucleótidos 5' TCGTCGTTTTTCGGTGCT TTT 3' (SEC ID Nº 1)

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/IB2009/055444.

Solicitante: Coley Pharmaceutical Group, Inc.

Inventor/es: DAVIS, HEATHER LYNN, WEERATNA,RISINI DHAMMIKA.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > A61K39/00 (Preparaciones medicinales que contienen antígenos o anticuerpos (materiales para ensayos inmunológicos G01N 33/53))
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen antígenos... > A61K39/29 (Virus de la hepatitis)

PDF original: ES-2481040_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Oligonucleótidos ¡nmunoestimulantes Campo de la invención

La invención se refiere a oligonucleótidos ¡nmunoestimulantes y procedimientos de utilización de oligonucleótidos ¡nmunoestimulantes para inducir una respuesta ¡nmunológica específica de antígeno.

Antecedente de la invención

El ADN bacteriano tiene efectos estimulantes ¡nmunitarios al activar los linfocitos B y los linfocitos citolíticos naturales, pero no es así en el ADN de vertebrados (Tokunaga, T., y col., 1988. Jpn. J. Cáncer Res. 79:682-686; Tokunaga, T., y col., 1984, JNCI 72: 955-962; Messina, J. P., y col., 1991, J. Immunol. 147:1759-1764; y revisado por Krieg, 1998, en: Applied Oligonucleotide Technology, C. A. Stein y A. M. Krieg, (Eds.), John Wiley and Sons, Inc., New York, N.Y., pp. 431-448). Se comprende ahora que estos efectos estimulantes ¡nmunitarios del ADN bacteriano son el resultado de la presencia de dinucleótidos CpG no metilados en contextos básicos particulares (motivos CpG), que son comunes en el ADN bacteriano, pero que están metilados y poco representados en el ADN de vertebrados (Krieg y col, 1995 Nature 374: 546-549; Krieg, 1999 Biochim. Biophys. Acta 1489:17-116). Los efectos estimulantes ¡nmunitarios del ADN bacteriano pueden mimetizarse con oligodesoxinucleótidos sintéticos (ODN) que contienen estos motivos CpG. Tales CpG de los ODN tienen efectos altamente estimulantes sobre los leucocitos humanos y murinos, induciendo la proliferación de células B; la secreción de citoquinas e inmunoglobulinas; la actividad de los linfocitos citolíticos naturales (NK) y la secreción de IFN-gamma; y la activación de células dendríticas (CD) y otras células presentadoras de antígenos para expresar moléculas co-estimulantes y segregar citoquinas, especialmente las citoquinas del tipo Th1 que son importantes promoviendo el desarrollo de las respuestas de los linfocitos T del tipo Th-1. Estos efectos estimulantes ¡nmunitarios de la estructura fosfodiéster nativa del CpG de los ODN son altamente específicos del CpG reduciéndose drásticamente esos efectos si el motivo CpG está metilado, ha cambiado a GpC, o se ha eliminado o alterado de alguna manera (Krieg y col, 1995 Nature 374: 546-549; Hartmann y col, 1999 Proc. Nati. Acad. Sci. EE. UU. 96:935-1).

Luganini y col., (Antimicrob Agents Chemother., 28, 52(3): 1111 -2) han informado del efecto inhibidor del CpG de los ODN sobre la replicación del HCMV por un mecanismo que es independiente del TLR9.

Se había informado anteriormente de que la actividad inmunoestimulante de los oligonucleótidos CpG depende del número de motivos CpG (Bailas y col., 1996, J. Immunol. 157(5): 184-5; Hartmann y col., 2, J. Immunol., 164(3): 1617-24; Klinman y col., 23, Clin. Exp. Immunol., 133(2): 227-32). Se desvela en el presente documento un oligonucleótido inmunoestimulante, en el que se ha eliminado el motivo CpG 3, que sorprendentemente mantiene su actividad inmunoestimulante. También se desvelan, una vacuna que comprende el oligonucleótido inmunoestimulante y un antígeno, y procedimientos para la utilización de tal vacuna.

Breve sumario de la invención

En unos aspectos de la invención, se proporciona un oligonucleótido inmunoestimulante que comprende la secuencia de nucleótidos 5 TCGTCGTTTTTCGGTGCTTTT 3 (SEC ID N° 1). En algunas realizaciones, el oligonucleótido inmunoestimulante comprende uno o más enlaces modificados. En algunas realizaciones, el oligonucleótido inmunoestimulante comprende uno o más enlaces fosforotioato. En ciertas realizaciones, todos los enlaces ¡nternucleótido de los oligonucleótidos son enlaces fosforotioato. En algunas realizaciones, el oligonucleótido inmunoestimulante comprende al menos un análogo de nucleótido sustituido lipofílico y un dinucleótido pirimidina-purina.

En unos aspectos de la invención, se proporciona una vacuna que comprende un antígeno y un oligonucleótido inmunoestimulante que comprende la secuencia de nucleótidos SEC ID N° 1, comprende además un vehículo farmacéuticamente aceptable. En algunas realizaciones, el oligonucleótido inmunoestimulante está en una cantidad eficaz para inducir una respuesta ¡nmunitaria específica de antígeno. En otras realizaciones, la respuesta inmunitaria específica de antígeno inducida es una respuesta ¡nmunitaria Th1. En algunas realizaciones, el antígeno es un antígeno microbiano, un autoantígeno o una sustancia adictiva. En otras realizaciones, el antígeno bacteriano se asocia con Staphylococcus aureus, o el antígeno bacteriano se asocia con una bacteria que produce caries dental. En más realizaciones, la bacteria es Streptococcus mutans, Streptococcus sobrinas, Streptococcus sanguis, Lactobacillus acidophilus, o Actinomyces viscosus. En otras realizaciones, el antígeno bacteriano se asocia con una bacteria que produce enfermedad periodontal. En más realizaciones, la bacteria es Porphyromonas gingivalis o Actinobacillus actinomycetemcomitans. En algunas realizaciones, el antígeno vírico se asocia con virus Respiratorio Sincitial (VRS), virus del Herpes simple 1, virus del Herpes Simple 2, Virus de Inmunodeficiencia Humana-1 (VIH-1) o VIH-2. En otras realizaciones, el antígeno parasitario se asocia con un parásito que causa la malaria. En algunas realizaciones, el autoantígeno es un antígeno tumoral, un antígeno asociado con la Enfermedad de Alzheimer, un antígeno contra un anticuerpo humano, o un antígeno que se expresa partir de elementos retrovirales endógenos humanos. En más realizaciones, el antígeno tumoral es HER2, MAGE, NY-ESO, PSA, CEA o una forma vahante de EGFR. En otras realizaciones, en las que el antígeno está asociado con la Enfermedad de Alzheimer, el antígeno es tau o p amiloide. En algunas realizaciones, el antígeno es IgE. En algunas realizaciones, el antígeno es un hapteno

de nicotina conjugado con un portador. En más realizaciones, el portador al que se conjuga el hapteno de nicotina es la toxina diftérica (TD). En otras realizaciones, el antigeno es un péptido, una protema recombinante, una proteína purificada, todo el agente patógeno destruido, un virus vivo atenuado o un vector vírico, bacterias vivas atenuadas o un vector bacteriano, un polisacárido, un hapteno, o está codificado por un plásmido ADN.

En algunas realizaciones, el antígeno está conjugado con un portador. En más realizaciones el portador es la toxina diftérica (TD). En otras realizaciones, el portador es una partícula similar a un virus. En más realizaciones, la partícula similar a un virus en el fago ARN Q-p, un antígeno de superficie de hepatitis B (HBsAg), o un antígeno del core de hepatitis B (HBcAg). En algunas realizaciones, la vacuna comprende además uno o más adyuvantes. En algunas realizaciones, el adyuvante es un agonista del receptor tipo Toll (TLR) que no es el TLR 9. En otras realizaciones, el agonista es del TLR 3. En más realizaciones, el agonista del TLR 3 es poli I: C estabilizado. En algunas realizaciones, el agonista es del TLR 4. En más realizaciones, el agonista del TLR 4 es un derivado de lipopolisacárido (LPS). En otras realizaciones más, el derivado LPS es MPL o GLA. En otras realizaciones, el agonista es del TLR 5. En más realizaciones, el agonista del TLR 5 es la flagelina. En algunas realizaciones el agonista es de TLR 7 u 8. En más realizaciones, el agonista de TLR 7 u 8 es una molécula pequeña de la familia de imidazoquinolinas. En otras realizaciones, el adyuvante es una sal de aluminio. En más realizaciones, la sal de aluminio es el hidróxido de aluminio. En algunas realizaciones, el adyuvante es un complejo estimulante inmunitario (ISCOM). En otras realizaciones, el adyuvante es una emulsión de aceite en agua o agua en aceite. En algunas realizaciones, el adyuvante es un liposoma. En otras realizaciones, el adyuvante es un sistema de... [Seguir leyendo]

 


Reivindicaciones:

1. Un oligonucleótido inmunoestimulante que comprende la secuencia de nucleótidos 5 TCGTCGTTTTTCGGTGCT TTT 3 (SEC ID N° 1).

2. El oligonucleótido inmunoestimulante de la reivindicación 1, en el que el oligonucleótido comprende uno o más enlaces modificados.

3. El oligonucleótido inmunoestimulante de la reivindicación 2, en el que el oligonucleótido comprende uno o más enlaces fosforotioato.

4. El oligonucleótido inmunoestimulante de la reivindicación 3 en el que todos los enlaces internucleótido del oligonucleótido son enlaces fosforotioato.

5. El oligonucleótido inmunoestimulante de cualquiera de las reivindicaciones 1 a 4, en el que el oligonucleótido comprende al menos un análogo de nucleótido sustituido lipofílico y un dinucleótido pirimidina-purina.

6. Un oligonucleótido inmunoestimulante que consiste en la secuencia de nucleótidos 5 TCGTCGTTTTTCGGTGCT TTT 3 (SEC ID N° 1).

7. Un oligonucleótido inmunoestimulante que consiste en

5 T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3 en el que * indica un enlace fosforotioato

8. Una vacuna que comprende

un antígeno y un oligonucleótido inmunoestimulante de cualquiera de las reivindicaciones 1 a 7, que comprende además un vehículo farmacéuticamente aceptable.

9. La vacuna de la reivindicación 8, en la que el oligonucleótido inmunoestimulante está en una cantidad eficaz para inducir una respuesta inmunitaria específica de antígeno.

1. La vacuna de la reivindicación 9, en la que la respuesta inmunitaria específica de antígeno que induce es una respuesta inmunitaria Th1.

11. La vacuna de una cualquiera de las reivindicaciones 8 a 1, en la que el antígeno es un antígeno microbiano, un autoantígeno o una sustancia adictiva.

12. La vacuna de la reivindicación 11, en la que el agente microbiano es un antígeno bacteriano, un antígeno vírico o un antígeno parasitario.

13. La vacuna de la reivindicación 12, en la que

a) el antígeno bacteriano está asociado con Staphylococcus aureus, una bacteria que produce caries dental, o una bacteria que produce enfermedad periodontal;

b) el antígeno vírico está asociado con el Virus Respiratorio Sincitial (VRS), virus del Herpes Simple 1, virus del Herpes Simple 2, Virus de la Inmunodeficiencia Humana-1 (VIH-1) o VIH-2, o

c) el antígeno parasitario está asociado con un parásito que causa la malaria.

14. La vacuna de la reivindicación 11, en la que el autoantígeno es un antígeno tumoral, un antígeno asociado con la Enfermedad de Alzheimer, un antígeno contra un anticuerpo humano, un antígeno que se expresa a partir de elementos retrovirales endógenos o un hapteno de nicotina conjugado con un portador.

15. La vacuna de la reivindicación 14, en la que

a) el antígeno tumoral es HER2, MAGE, NY-ESO, PSA, CEA o una forma variante de EGFR;

b) el antígeno con la Enfermedad de Alzheimer es tau o p-amiloide;

c) el antígeno es IgE; o

d) el portador al cual está conjugado el hapteno de nicotina es la toxina diftérica (TD).

16. La vacuna de la reivindicación 8, en la que el antígeno es un péptido, una proteína recombinante, una proteína purificada, un patógeno entero exterminado, un virus vivo atenuado o un vector vírico, una bacteria viva atenuada o un vector bacteriano, un polisacárido, un hapteno, o codificado por un plásmido ADN.

17. La vacuna de una cualquiera de las reivindicaciones 8 a 16, en la que el antígeno está conjugado con un portador.

18. La vacuna de la reivindicación 17, en la que el portador es la toxina diftérica (TD) o una partícula similar a un virus, en la que la partícula similar al virus es un fago ARN Q-p, antígeno de superficie de hepatitis B (HBsAg), o antígeno de núcleo de hepatitis B (HBcAg).

19. La vacuna de una cualquiera de las reivindicaciones 8 a 18, que comprende además uno o más adyuvantes.

2. La vacuna de la reivindicación 19, en la que el adyuvante es una sal de aluminio, un complejo inmunoestimulante (ISCOM), una emulsión de aceite en agua o de agua en aceite, un liposoma o un sistema de administración.

21. La vacuna de la reivindicación 2, en la que la sal de aluminio es hidróxido de aluminio.

22. La vacuna de una cualquiera de las reivindicaciones 8 a 21, en la que

a) la vacuna está formulada para su administración por vía parenteral, en la que la vía parenteral es

Intramuscular, subcutánea, intradérmlca, Intravenosa o intraperitoneal; o

b) la vacuna está formulada para su administración por vía tópica, en la que la vía tópica es la piel, transdérmica o una superficie mucosa.

23. La vacuna de la reivindicación 22, en la que la vía mucosa es oral, intranasal, ¡ntravaglnal, ¡ntrarrectal, ¡ntra-bucal 1 o infraocular.

24. El oligonucleótldo inmunoestimulante de una cualquiera de las reivindicaciones 1 a 7 para su uso como un medicamento.

25. El oligonucleótldo inmunoestimulante de una cualquiera de las reivindicaciones 1 a 7 para su uso como adyuvante en una vacuna.