4,378 Patentes de mayo de 2012 (pag. 62)

  1. 1953.-

    PROCEDIMIENTO PARA LA FABRICACION DE UN APARATO DOMESTICO Y POLEA CONDUCIDA PARA UN TAMBOR DEL APARATO DOMESTICO

    (05/2012)

    La invención se refiere a un procedimiento para la fabricación de un aparato doméstico, en especial, de una máquina lavadora o de una secadora, con una carcasa exterior y un tambor alojado de manera giratoria , el cual presenta una polea conducida unida con un motor de accionamiento , siendo fabricada en dicho procedimiento la carcasa exterior y/o el tambor a partir de al menos una pieza preformada de material de chapa, de la cual es recortada, para la conformación de un vaciado , al menos una pieza de desecho . Según la invención, la pieza...

  2. 1954.-

    APARATO PARA LA TOMA DE MUESTRAS DE LIQUIDO Y EL PROCEDIMIENTO PARA SU CONTROL

    (05/2012)

    Aparato para la toma de muestras de líquido y el procedimiento para su control. Aparato para la toma de muestras de líquido, compuesto por un cuerpo que está formado por una parte superior , una parte inferior y un elemento de transmisión cinemático que conecta dichas partes , un mecanismo de regulación de la longitud eficaz del elemento de transmisión cinemática , y primeros contenedores de muestras de líquido situados en la parte superior del cuerpo. El procedimiento para su control se caracteriza porque se coloca el aparato en el...

  3. 1955.-

    METODO PARA LA DETECCION Y CLASIFICACION DE GRUPOS DE MICROCALCIFICACION EN MAMOGRAFIAS DIGITALES

    (05/2012)
    Ver ilustración. Solicitante/s: HERNANDEZ CISNEROS, Rolando Rafael. Inventor/es: HERNANDEZ CISNEROS,Rolando Rafael. Clasificación: G06T7/00, A61B6/12, G06F19/12.

    Un método para la detección y clasificación de grupos microcalcificaciones en mamografías digitales que comprende las siguientes etapas: obtener uno o más mamografías digitales; pre-procesar la una o más mamografías digitales mediante la eliminación de ruido de cada una de la una o más mamografías digitales; detectar los puntos que son microcalcificaciones potenciales, en la una o mas mamografías digitales; identificar cada centro de masa de microcalcificaciones potenciales ya sea como microcalcificaciones o no microcalcificaciones; identificar grupos de microcalcificaciones, usando un algoritmo para localizar grupos de microcalcificaciones; y clasificar cada grupo en la clases benigno o maligno.

  4. 1956.-

    DISPOSITIVO SELLADOR PARA MINGITORIO SECO CON FACILIDAD PARA MANTENIMIENTO

    (05/2012)

    La presente invención está relacionada con la industria de la manufactura de accesorios para baño tales como llaves, regaderas, salidas, flotadores, entre otros. Más específicamente está relacionado con la manufactura de válvulas para mingitorios secos, que permiten el paso de la orina y evitan el regreso de malos olores. Estructuralmente, están caracterizados por comprender una coladera monolítica formada por una tapa superior con orificios y un cilindro hueco, abierto por su parte inferior, con una rosca en la cara...

  5. 1957.-

    APOYO DESPLAZABLE PARA LOS EXTREMOS DE LAS PAREDES MÓVILES DE PISCINAS

    (05/2012)
    Ver ilustración. Solicitante/s: METALAST, S.A. (SOCIEDAD UNIPERSONAL). Inventor/es: VILA CORTS, FRANCESC XAVIER. Clasificación: E04H4/14.

    Apoyo desplazable para los extremos de las paredes móviles de piscinas que tiene por objeto dividir las mismas en espacios separados de distintas medidas para desarrollar distintas actividades y aprovechar mejor el espacio, y que básicamente comprende cuatro ruedas accionadas mediante un mecanismo basado en un juego de poleas con dispositivos tensores y relacionadas entre sí mediante correas , el cual comprende superiormente una polea motriz que se relaciona inferiormente con un conjunto de poleas reductor , que a su vez se relaciona con sendas poleas solidarias de los ejes de las ruedas , en donde el conjunto de ruedas , poleas y dispositivos tensores está instalado en una armazón de base y la polea motriz , el conjunto de poleas reductor , y su dispositivo tensor , están instalados en un carenado acoplado sobre la armazón de base.

  6. 1958.-

    POLVO VEGETAL PARA ALIMENTACIÓN Y PROTECCIÓN VEGETAL Y MÉTODOS DE PREPARACIÓN

    (05/2012)
    Ver ilustración. Solicitante/s: CONSEJO SUPERIOR DE INVESTIGACIONES CIENTIFICAS (CSIC). Inventor/es: GARCIA VIGUERA,CRISTINA, MORENO FERNÁNDEZ,Diego A, CARVAJAL ALCARAZ,Micaela, MARTÍNEZ BALLESTA,Mª Carmen. Clasificación: A23L1/30, A23L1/212, A23P1/06.

    La presente invención se refiere a un método de producción de polvo vegetal para su uso en alimentación y protección vegetal, preferiblemente el polvo vegetal se obtiene a partir de vegetales de la familia.

  7. 1959.-

    SISTEMA DE CONFINACIÓN Y EVACUACIÓN DE AEROSOLES DE DOS O TRES FASES

    (05/2012)

    Los procesos de producción de metales que se realizan en celdas electrolíticas, liberan al ambiente gases que incorporan micro gotas de los componentes del electrolito, a partir del cual se producen los metales, uno de cuyos componentes generalmente es un ácido o una base fuerte. Las dificultades que acarrean estos gases con micro gotas son variadas y afectan a los operadores, estructuras y equipos de producción. Así, los operadores deben proteger su sistema respiratorio mediante el empleo de máscaras y proteger...

  8. 1960.-

    DISPOSITIVO DE RECOGIDA DE PELOTAS PARA RAQUETAS

    (05/2012)

    1. Dispositivo de recogida de pelotas para raquetas caracterizado por comprender: - un soporte flexible - una cinta textil , que comprende púas terminadas en forma de gancho o anzuelo configuradas para adherirse a las pelotas, dispuesta sobre el soporte flexible y fijada al soporte por medios de unión, - una cámara de aire dispuesta entre el soporte flexible y la cinta textil , y - medios de fijación del soporte flexible al extremo exterior de la cabeza de la raqueta . 2. Dispositivo de recogida de pelotas para raquetas según reivindicación 1 caracterizado porque el soporte flexible es de material seleccionado entre neopreno,...

  9. 1961.-

    ELEMENTO SANITARIO PERSONALIZABLE

    (05/2012)

    1. Elemento sanitario personalizable, tal como un plato de ducha, una bañera, un lavamanos o similar, caracterizado porque comprende: - una base de material flexible, que prefabricada en taller o realizada a medida in situ, conforma el soporte estructural del elemento sanitario determinando la forma y dimensiones del mismo; - una cobertura constituida por una o varias capas de microcemento, susceptible de incorporar elementos decorativos pintados, que queda adherida sobre la superficie superior de la base ; y - una capa protectora de barniz, dispuesta sobre la cobertura de microcemento. 2. Elemento sanitario personalizable, según la reivindicación...

  10. 1962.-

    TABLA ACUSTICA DE ZAPATEADO

    (05/2012)

    1. Tabla acústica de zapateado, que estando prevista para ser utilizada de forma personal por cualquier usuario, en cualquier lugar y momento, se caracteriza porque se constituye a partir de una armadura perimetral de pino español que se fija a una tapa-tablero macizo inferior, definiendo una cavidad en la que va dispuesta una alfombra de caucho, recubriéndola interiormente, con la interposición de una capa absorbente de lana de roca o similar, habiéndose previsto que sobre dicha alfombra de caucho vaya situada una caja de madera sobre cuya parte superior apoya y se fija un tablero marino formando interiormente una cámara de aire; habiéndose previsto...

  11. 1963.-

    Cola para pegar en frío materiales de construcción

    (05/2012)

    Cola para pegar en frío materiales de construcción, caracterizada por que la cola comprende uno o varios aceites tixotrópicos.

  12. 1964.-

    Agentes herbicidas sinérgicos

    (05/2012)

    Agentes herbicidas, caracterizados por un contenido eficaz en A) del compuesto 2-[2-cloro-3-(2,2,2-trifluoroetoximetil)-4-metilsulfonil-benzoil]ciclohexan-1,3-diona así como de sus sales usuales en agricultura (Componente A) y B) al menos un compuesto (Componente B) del grupo B5 inhibidores de la división de la célula: acetoclor, alaclor, dimetenamida, flufenacet, mefenacet, metolaclor, tenilcor, S-metolaclor; en donde estos agentes contienen el componente A o sus sales y los compuestos del grupo B5 en una relación en peso de 1:2000 a 2000:1.

  13. 1965.-

    Panel de solado o panel de pared

    (05/2012)

    Un panel de solado o panel de pared que tiene la menos tres bordes laterales provistos de unos medios de bloqueo en forma de una lengüeta y/o una acanaladura , de tal manera que dicha acanaladura comprende un lóbulo superior , dispuesto en posición adyacente, por encima, y en, la cara superior de dicha acanaladura y que termina en un borde distal, o más alejado, de dicho lóbulo superior de la acanaladura, y un lóbulo inferior , dispuesto adyacentemente por debajo de, y en, la cara inferior de dicha acanaladura y que termina en un borde distal de dicho lóbulo inferior de dicha acanaladura, de tal manera que dicha lengüeta comprende una cara superior y una cara inferior , de modo que el...

  14. 1966.-

    Radiador tubular con masa aislante en la zona del extremo de conexión

    (05/2012)

    Dispositivo de calefacción para calentar un fluido, en particular en caso de aparatos domésticos, que incluye: un tubo envolvente , al menos un alambre calefactor por resistencia eléctrica dispuesto en el interior del tubo envolvente y embutido en una masa de aislamiento conductora del calor y aislante eléctrica, al menos un módulo de conexión dispuesto dentro del tubo envolvente y que sale del mismo para conectar el alambre calefactor por resistencia eléctrica a una fuente de energía eléctrica situada fuera del tubo envolvente , y al menos una pieza de cierre que cierra la abertura del tubo envolvente , estando el módulo de conexión también rodeado por la masa de aislamiento dentro...

  15. 1967.-

    Aparato para la distribución autónoma de alimentos y bebidas

    (05/2012)

    Dispositivo robótico móvil autónomo, que comprende una base móvil, que es capaz de desplazarse, utilizando su propio mecanismo de movimiento y que comprende una máquina para la preparación de café autónoma integrada que sirve automáticamente bebidas o comestibles líquidos, sin influencia externa, excepto el proceso de petición.

  16. 1968.-

    Dominio no histona MACROH2A como inhibidor de la actividad PARP-1 y uso del mismo

    (05/2012)

    Un inhibidor de la enzima nucleica poli(adenosina 5'-difosfo-ribosa) polimerasa ["poli(ADP-ribosa) polimerasa 1 (PARP-1)"] para uso como un medicamento en la prevención o tratamiento de una enfermedad asociada con activación PARP-1 seleccionada del grupo que comprende daño de tejido que resulta de daño o muerte celular debido a necrosis o apoptosis, daño de tejido neural que resulta de isquemia y lesión por reperfusión, trastornos neurológicos y enfermedades neurodegenerativas, apoplejía vascular, trastornos cardiovasculares, degeneración macular relacionada con la edad, SIDA, enfermedades inmunitarias relacionadas con la edad, artritis, aterosclerosis, caquexia, cáncer, enfermedades degenerativas del...

  17. 1969.-

    Determinación de la variación en el número de copias, métodos y sistemas

    (05/2012)

    Un método para determinar el número de copias relativo de una secuencia polinucleotídica diana en el genoma de un sujeto, que comprende: preamplificar una secuencia polinucleotídica diana y una secuencia polinucleotídica de referencia en una muestra que contiene ADN genómico del sujeto; ensayar la secuencia polinucleotídica diana y la secuencia polinucleotídica de referencia de la muestra preamplificada mediante una PCR digital; determinar (a) el número de moléculas polinucleotídicas amplificadas que contienen la secuencia polinucleotídica diana, y (b) el número de moléculas polinucleotídicas amplificadas que contienen la secuencia polinucleotídica de referencia, y determinar la proporción...

  18. 1970.-

    Oligonucleótidos inmunoestimuladores y sus usos

    (05/2012)

    Un oligonucleótido inmunoestimulador que tiene hasta 100 nucleótidos y que comprende un motivo de secuencia no palindrómica de ácido nucleico que tiene la siguiente fórmula: TCATCATTTTGTCATTTTGTCATT(SEQ ID Nº 2)

  19. 1971.-

    Acortamiento y perforación de códigos de comprobación de paridad de baja densidad (LDPC) para codificación y decodificación de canales

    (05/2012)

    Método para codificar canales en un sistema de comunicación usando un código de comprobación de paridad de baja densidad (LDPC) para el cual una matriz de comprobación de paridad tiene N1 columnas, donde N1 es 16200, teniendo la matriz de comprobación de paridad una parte de información y una parte de paridad, en el que la parte de información tiene K1 columnas, donde K1 es 3240, en el que la parte de paridad tiene (N1-K1) columnas, donde (N1-K1) es 12960, en el que la parte de información comprende una pluralidad de grupos de columnas, teniendo cada grupo de columnas M1 columnas, donde M1 es 360, y el número de grupos de columnas es K1/M1, donde K1/M1 es 9, en el que las secuencias de posiciones de...

  20. 1972.-

    Formulaciones de solución farmacéutica estable para inhaladores de dosis medidas presurizados

    (05/2012)

    Una composición para aerosol que consiste en fumarato de formoterol como ingrediente activo, en combinación con dipropionato de beclometasona, en una solución de un propelente licuado de HFA 134ª y 12% p/p de etanol como codisolvente, y ácido clorhídrico en una cantidad tal que la solución tiene un pH aparente entre 3,0 y 3,5.

  21. 1973.-

    Procedimiento de acceso a un canal de comunicación para redes de comunicaciones

    (05/2012)

    Procedimiento para acceder a un canal de comunicación para una red de comunicaciones que comprende una pluralidad de nodos configurados para transmitir y recibir subtramas por medio de dicho canal de comunicación, comprendiendo dicho procedimiento las etapas siguientes: - definir una sucesión de tramas, estando cada trama formada por uno y el mismo primer número (N) de intervalos de tiempo, y estando cada intervalo de tiempo configurado para acoger la transmisión de una única subtrama y estando asociado a un correspondiente período de una trama de referencia formada por un número de períodos igual a dicho primer número (N) de intervalos de tiempo; y - ejecutar selectivamente, en...

  22. 1974.-

    Caja de vagón alargada para vehículos ferroviarios y tren automotor compuesto de tales cajas de vagón

    (05/2012)

    Caja de vagón (W) para un vehículo ferroviario de varias partes con dos carros giratorios extremos, respectivamente, caracterizada porque una longitud de la caja de vagón (W) tiene al menos 27,5 metros y las paredes laterales (SR, SL) de la caja del vagón (W) están configuradas de tal forma que con una anchura máxima exteriores el centro longitudinal del vagón de 2,86 metros a la altura de los respaldos de los asientos (A), se consigue una anchura interior de al menos 2,6 metros para la mayor parte de la longitud del vagón.

  23. 1975.-

    PROCEDIMIENTO MEJORADO PARA EVALUAR EL RIESGO CARDIOVASCULAR

    (05/2012)

    Procedimiento mejorado para evaluar el riesgo cardiovascular. La invención se refiere a un procedimiento que permite refinar el riesgo de un individuo de padecer un evento cardiovascular determinado inicialmente mediante la clasificación en un grupo de riesgo por la aplicación de un método que considera los factores de riesgo cardiovascular clásicos, tal como la carta de riesgo cardiovascular de las Sociedades Europeas. El procedimiento tiene en cuenta la posible influencia que puedan tener en la variación del riesgo cardiovascular los valores de homocisteinemia total, proteína Hsp70i intraleucocitaria y genotipo del gen hsp70-1, permitiendo la recalificación de su grupo de riesgo y,...

  24. 1976.-

    CICLOMOTOR ELECTRICO PLEGABLE Y PROCEDIMIENTO DE PLEGADO

    (05/2012)

    Ciclomotor eléctrico plegable y procedimiento de plegado. Del tipo que comprende dos ruedas, una delantera y otra trasera, unos discos de freno situados en sendas ruedas, un chasis central en cuyo interior se encuentra al menos una batería de alimentación de un motor alojado en la rueda trasera, un sillín sobre el cual va sentado un usuario, un manillar mediante el cual se controla la dirección, y unas estriberas destinados a recibir los pies del usuario, comprendiendo adicionalmente: un basculante delantero que vincula el chasis con la rueda delantera, y un basculante trasero que vincula el chasis con la rueda trasera del ciclomotor, mediante los cuales...

  25. 1977.-

    SISTEMA DE CONSTRUCCION DE PUENTES DE ARCO CON TABLERO SUPERIOR MEDIANTE ELEMENTOS PREFABRICADOS

    (05/2012)

    Puente de arco con tablero superior mediante elementos prefabricados, del tipo de los puentes, viaductos o pasarelas utilizados tanto para peatones como para circulación rodada, caracterizado porque utiliza un arco de soporte compuesto de dos semiarcos prefabricados que son tensados previamente mediante unos tirantes provisionales y apoyados en sus extremos superiores sobre una única torreta de soporte, hormigonando la unión de los extremos superiores, para proceder posteriormente a un destensado controlado de los semiarcos, elevándose la unión y separándose naturalmente de la parte superior de la torreta, para proceder a continuación al montaje sobre el arco de las péndolas y el piso. La...

  26. 1978.-

    TRANSDUCTOR ULTRASÓNICO

    (05/2012)

    Transductor ultrasónico, caracterizado porque comprende: cuatro bobinas formando un par de bobinas de Helmholtz, una membrana flexible multicapa situada en el centro del par de bobinas de Helmholtz, comprendiendo la membrana flexible al menos una capa de un material con propiedades piezoeléctricas y otra capa de un material de propiedades magnetoeléctricas, y un encapsulado para mantener las bobinas de Helmholtz y la membrana unidas.

  27. 1979.-

    Procedimiento de recorte de las piezas de un puzle

    (05/2012)

    Procedimiento de recorte de las piezas de un puzle sobre un conjunto constituido por una hoja de espuma de etileno acetato de vinilo (EVA), estando cada una de cuyas caras recubierta de una hoja de papel o de cartón, presentando al menos una de ellas una imagen impresa para recortar, caracterizado porque el recorte de las piezas del puzle (3, 4, y 5) se efectúa en una matriz de recorte en la que se presenta el conjunto bien sea con la hoja de espuma EVA girada hacia arriba, bien sea con la hoja de papel o de cartón girada hacia arriba, en función de los materiales utilizados, pegándose a continuación una segunda hoja de papel o de cartón sobre la cara opuesta...

  28. 1980.-

    Sistema y método para detectar al menos una tensión mecánica en al menos una parte de un riel

    (05/2012)

    Un sistema para detectar al menos una tensión mecánica en al menos una parte (R) de un riel, por ejemplo un riel para guiar medios de transporte sobre la base de la magnetización de la parte respectiva de un riel, en donde el sistema se suministra con un generador de campo magnético (MFP) para generar al menos un campo magnético cambiante predeterminado de tal manera que la parte respectiva del riel se localiza en ese campo, y se suministra con un sistema de medición (MS) para medir una respuesta de la respectiva parte del riel para estar localizado en...

  29. 1981.-

    Pirimidinas sustituidas en posición 5 inhibidoras de VIH

    (05/2012)

    Un compuesto de fórmula **Fórmula** un N-óxido, una sal de adición farmacétuicamente aceptable, una amina cuaternaria o formas estereoquímicamente isómeras del mismo, en la que A es -CH2-CH2-, -CH=CH-, -C≡C-; cada R1 es independientemente hidrógeno, arilo, formilo, alquil C1-6-carbonilo, alquilo de C1-6, alquil C1-6- oxicarbonilo; R2 es hidroxi, halo, alquilo de C1-6, carboxilo, ciano, -C(=O)R6, nitro, amino, mono- o di(alquil C1-6)amino, polihalometilo; X1 es -NR1-, -O-, -S-, -S(=O)p-; R3 es H, alquilo de C1-6,...

  30. 1982.-

    Muestreador automatizado de semillas y procedimiento de muestreo, ensayo y aumento de semillas

    (05/2012)

    Un procedimiento automatizado para analizar semillas en una población de semillas que tienen diferencias genéticas, comprendiendo el procedimiento: aislar semillas individuales de la población de semillas; colocar las semillas individuales aisladas en un portasemillas; cortar muestras de tejido que comprendan células con ADN de las semillas individuales asiladas y colocadas en el portasemillas usando un muestreador de semillas automatizado mientras se mantiene la viabilidad de germinación de las semillas; cribar...

  31. 1983.-

    Sistema de medición de la conductancia/resistencia laminar

    (05/2012)

    Un sistema para medir la conductancia de una muestra de material que comprende: una bobina para crear un campo magnético adyacente a una muestra sometida a ensayo; un oscilador conectado a la bobina para aplicar una tensión a la bobina ; y un circuito de control automático de ganancia conectado al oscilador para detectar un cambio de tensión causado por la muestra cuando la muestra es colocada adyacente a la bobina y expuesta al campo magnético; en el que el cambio de tensión es proporcional...

  32. 1984.-

    Procedimiento y sistema para evaluar el rendimiento de aceites crudos

    (05/2012)

    Un sistema para evaluar el riesgo de procesar crudos o mezclas de crudos de calidad inferior en operaciones de refinería, incluyendo dicho riesgo la propensión al ensuciamiento de los crudos o mezclas de rudos , comprendiendo dicho sistema: Una base de datos que almacena datos relativos a al menos un crudo o mezcla de crudos; y Un motor predictivo que comprende un modelo de propensión al ensuciamiento para ejecutar al menos una predicción de la propensión al ensuciamiento de un intercambiador de calor en una...

<< · 31 · 46 · 54 · 58 · 60 · < · 62 · > · 64 · 66 · 71 · 80 · 99 · >>