3,107 Patentes de mayo de 2004 (pag. 20)

  1. 609.-

    1,3-OXATIOLANOS SUSTITUIDOS CON PROPIEDADES ANTIVIRALES.

    (05/2004)
    Solicitante/s: BIOCHEM PHARMA INC.. Inventor/es: BELLEAU, BERNARD, NGUYEN-BA, NGHE, BELLEAU, PIERETTE. Clasificación: C07D411/14, C07D411/04, C07D473/00, C07D327/04.

    SE EXPONEN COMPUESTOS DE LA FORMULA DONDE R 1 ES HIDROGENO; R{SUB,2} ES UNA BASE DE PURINA O PIRIMIDINA O UN ANALOGO O DERIVADO DE LA MISMAS; Z ES S, S=O SO{SUB,2}; Y DERIVADOS FARMACEUTICAMENTE ACEPTABLES DE LOS MISMOS. TAMBIEN SE DESCRIBEN EL USO DE LOS COMPUESTOS COMO AGENTES ANTIVIRALES, FORMULACIONES FARMACEUTICAS, Y METODOS PARA LA PREPARACION DE LOS COMPUESTOS.

  2. 610.-

    PROCEDIMIENTO Y DISPOSITIVO PARA EL CONTROL DE LA PARADA DE PERSIANAS O SIMILARES ACCIONADAS CON MOTOR ELECTRICO.

    (05/2004)

    EL PROCEDIMIENTO PARA EL CONTROL DE SITUACION DE PARADA DE UN ACCIONAMIENTO DE MOTOR ELECTRICO PARA PERSIANAS O SIMILARES HA PREVISTO QUE EL MOTOR ELECTRICO SE DESCONECTE TAN PRONTO COMO EL ACCIONAMIENTO REGISTRA RESISTENCIA MECANICA. COMO CRITERIO DE DESCONEXION SIRVE EL MOMENTO DE GIRO O LA MODIFICACION DEL MOMENTO DE GIRO DEL MOTOR ELECTRICO. CON ELLO SE REGISTRA EL MOMENTO DE GIRO DEL MOTOR ELECTRICO DE FORMA CONTINUA ELECTRONICA Y EL MOTOR ELECTRICO SE DESCONECTA TANTO CUANDO SE SOBREPASA UN MOMENTO DE GIRO PREVIAMENTE DADO COMO TAMBIEN CUANDO SE SOBREPASA UNA MODIFICACION DE MOMENTO DE GIRO PREVIAMENTE DADA. EN OTRA EJECUCION DE LA INVENCION SE REGISTRA TAMBIEN EL MOMENTO DE GIRO PREVIAMENTE DADA. EN OTRA EJECUCION DE LA INVENCION SE REGISTRA...

  3. 611.-

    PROCEDIMIENTO PARA DIRIGIR UN ARMA DEFENSIVA SUBMARINA.

    (05/2004)

    SE DESCRIBE UN PROCEDIMIENTO PARA LA DIRECCION DE UN ARMA DE DEFENSA BAJO EL AGUA EN LA ZONA PROXIMA DE UN ARMA DE ATAQUE QUE SE MUEVE EN EL AGUA, DONDE EL ARMA DE DEFENSA DESPUES DEL REGISTRO DE SONDEO Y DE LA DISTANCIA DEL ARMA DE ATAQUE (DATOS DE BLANCO) EFECTUA UN CONTROL PRIMERO EN UN PROCEDIMIENTO DE SEGUIMIENTO DEL BLANCO BAJO REPETICION DE NUEVO REGISTRO DE LOS DATOS DE BLANCO Y SE AVERIGUAN A CONTINUACION LOS DATOS DE BLANCO QUE HAN CAMBIADO, DE FORMA QUE EL ARMA DE ATAQUE DESARROLLA O MANIOBRA SEGUN UN CURSO CONSTANTE, DONDE ADEMAS EL PROCEDIMIENTO DE DIRECCION DEL ARMA DE DEFENSA SE SUSTITUYE EN LA DETERMINACION DE UN CURSO CONTINUO AMPLIO DEL ARMA DE ATAQUE SOBRE UN PROCESO DE COMPORTAMIENTO. EL ARMA DE DEFENSA SE CONTROLA CON RESPECTO...

  4. 612.-

    EMULSION DE ACEITE EN AGUA QUE CONTIENE LORMETAZEPAM.

    (05/2004)
    Solicitante/s: GESELLSCHAFT FUR MEDIZINISCHE FORSCHUNG UND WEITERBILDUNG E.V. GMF. Clasificación: A61K31/55, A61K9/107.

    LA INVENCION SE REFIERE A UNA COMPOSICION TERAPEUTICA QUE CONTIENE LORAZEPAM O IORMETAZEPAM, EN PARTICULAR UN SEDANTE PARA ADMINISTRACION INTRAVENOSA, QUE SE CARACTERIZA DE TAL MODO, QUE EL LORACZEPAM O IORMETAZEPAM SE UTILIZAN EN UNA EMULSION ACEITE EN AGUA.

  5. 613.-

    ARTICULOS ESPUMADOS BIODEGRADABLES Y PROCESO PARA LA PREPARACION DE LOS MISMOS.

    (05/2004)
    Solicitante/s: NOVAMONT S.P.A.. Inventor/es: BASTIOLI, CATIA, DEL TREDICI, GIANFRANCO, BELLOTTI, VITTORIO, RALLIS, ANGELOS. Clasificación: C08L3/02, C08J9/228.

    ARTICULOS ESPUMADOS BIODEGRADABLES QUE TIENEN DENSIDAD COMPRENDIDA DESDE 5 A 300 KG/M{SUP,3} OBTENIDOS MEDIANTE AGLOMERACION DE PARTICULAS ESPUMADAS QUE TIENEN UNA COMPOSICION QUE COMPRENDE UN MATERIAL ALMIDONADO TERMOPLASTICO O UN POLIMERO NATURAL TERMOPLASTICO CAPAZ DE ABSORBER AGUA CUANDO SE CONVIERTE EN EL ESTADO TERMOPLASTICO, UN POLIMERO TERMOPLASTICO Y AGUA.

  6. 614.-

    N-HETEROAROILGUANIDINAS SUSTITUIDAS EN CALIDAD DE INHIBIDORES DEL ANTIPORTADOR CELULAR DE SODIO-PROTONES, EN CALIDAD DE ANTIRRITMICOS Y EN CALIDAD DE INHIBIDORES DE LA PROLIFERACION DE CELULAS.

    (05/2004)

    LA INVENCION SE REFIERE A HETEROARIL GUANIDINA DE LA FORMULA I DONDE LOS SUSTITUYENTES HA Y R HASTA R TIENEN EL SIGNIFICADO DADO EN LA SOLICITUD 1. ESTOS COMPUESTOS I MUESTRAN MUY BUENAS PROPIEDADES ANTIARRITMICAS, CON LO QUE SON IMPORTANTES EN EL TRATAMIENTO DE ENFERMEDADES, QUE APARECEN POR EJEMPLO EN SITUACIONES DE FALTA DE OXIGENO. LOS COMPUESTOS SON APROPIADOS COMO CONSECUENCIAS DE SUS PROPIEDADES FARMACOLOGICAS COMO MEDICAMENTOS ANTIARRITMICOS CON COMPONENTE CARDIOPROTECTOR PARA PROFILAXIS DEL INFARTO Y DEL TRATAMIENTO DEL INFARTO ASI COMO PARA TRATAMIENTO DE LA ANGINA DE PECHO DE FORMA SOBRESALIENTE. INHIBEN O REDUCEN DE FORMA INTENSA Y TAMBIEN DE FORMA PREVENTIVA LOS FENOMENOS PATOFISIOLOGICOS EN LA GENERACION DE DAÑOS INDUCIDOS ISQUEMICOS,...

  7. 615.-

    PROCEDIMIENTO PARA LA OBTENCION DE UNA BASE PARA COMBUSTIBLE PARA MOTOR DE COMBUSTION INTERNA POR HIDROTRATAMIENTO Y EXTRACCION.

    (05/2004)

    PRODUCTO PETROLIFERO Y PROCESO DE OBTENCION DE DICHO PRODUCTO PETROLIFERO QUE PUEDE EVENTUALMENTE SERVIR PARA LA FORMULACION DE UN CARBURANTE PARA MOTOR DE COMBUSTION INTERNA QUE COMPRENDE UNA ETAPA A) HIDROTRATAMIENTO EN EL QUE SE TRATA UNA CARGA HIDROCARBONADA EN CONDICIONES DE HIDROTRATAMIENTO BAJO UNA PRESION PARCIAL DE HIDROGENO EN SALIDA DE REACTOR DE APROXIMADAMENTE 0,5 MPA A APROXIMADAMENTE 6 MPA, UNA ETAPA B) DE SEPARACION DEL PRODUCTO (P) OBTENIDO EN LA ETAPA A) EN UN PRODUCTO (P1) DE PUNTO FINAL DE EBULLICION INFERIOR A APROXIMADAMENTE 300 (GRADOS) C Y UN PRODUCTO (P2) DE PUNTO INICIAL DE EBULLICION (P1) SUPERIOR AL PUNTO FINAL DE EBULLICION DEL PRODUCTO (P1), UNA ETAPA C) DE EXTRACCION LIQUIDO/LIQUIDO MEDIANTE UN SOLVENTE (S1) EN...

  8. 616.-

    COMPOSICION LUBRICANTE DE BAJA EMISION DE HUMOS PARA MOTORES DE DOS TIEMPOS.

    (05/2004)
    Solicitante/s: EURON S.P.A. ENICHEM S.P.A. Inventor/es: RIVETTI, FRANCO, BERTI, FRANCO, ROMANO, UGO, SGAMBATO, UMBERTO. Clasificación: C07C69/96, C10M169/04, C10M105/48.

    UN ESTER DE CARBONATO DE UN TRIOL O TETRAOL ALIFATICO, QUE PUEDE DEFINIRSE POR LA SIGUIENTE FORMULA: EN LA QUE R1, R2, R' Y P SON CONFORME A LO DEFINIDO EN LA DESCRIPCION, SE USA COMO BASE DE LUBRICACION CON ESCASA CANTIDAD DE HUMO PARA MOTORES DE DOS TIEMPOS, DE COMBUSTION INTERNA. SE DESCRIBEN COMPOSICIONES LUBRICANTES QUE CONTIENEN UN ESTER DE CARBONATO, JUNTAMENTE CON UNO O MAS PRODUCTOS SELECCIONADOS ENTRE DISOLVENTES, LUBRICANTE DE PETROLEO RESIDUAL U OTROS ADITIVOS ANTIAGARROTADORES, MAS ADITIVOS NORMALES.

  9. 617.-

    PROMOTOR AOX2 MUTANTE.

    (05/2004)
    Solicitante/s: YOSHITOMI PHARMACEUTICAL INDUSTRIES, LTD.. Inventor/es: OHMURA, TAKAO, OHI, HIDEYUKI, MIURA, MASAMI, HIRAMATSU, RYUJI. Clasificación: C12N1/19, C12P21/00, C12N15/81.

    SE PRESENTA UN PROMOTOR DEL AOX2 MUTANTE EN EL QUE ENTRE 1 Y 3 OLIGONUCLEOTIDOS GATAGGCTATTTTTGTCGCATAAAT SE AÑADEN EN LA DIRECCION NORMAL, EN LA DIRECCION INVERSA O AMBAS DIRECCIONES NORMAL E INVERSA EN EL EXTREMO 5'DEL FRAGMENTO DE DNA PARCIAL DE UN PROMOTOR DEL AOX2 DE TIPO NATURAL, UN VECTOR QUE LLEVA DICHO PROMOTOR, UN TRANSFORMANTE EN EL CUAL SE HA INTRODUCIDO DICHO VECTOR Y UN METODO PARA PRODUCIR UNA PROTEINA HETEROLOGA, QUE COMPRENDE EL CULTIVO DE DICHO TRANSFORMANTE. EL PROMOTOR DEL AOX2 MUTANTE DE LA INVENCION TIENE UNA ACTIVIDAD PROMOTORA MARCADAMENTE REFORZADA COMPARADO CON LOS PROMOTORES AOX2 DE TIPO NATURAL. DE ESTA FORMA, EL PROMOTOR DE LA INVENCION ES ALTAMENTE UTILIZABLE COMO PROMOTOR PARA SER LLEVADO POR UN VECTOR CAPAZ DE EXPRESAR UNA PROTEINA HETEROLOGA. EL VECTOR DE LA INVENCION PUEDE EXPRESAR Y PRODUCIR EFICIENTEMENTE DIFERENTES PROTEINAS, UTILES, HETEROLOGAS EN ANFITRIONES.

  10. 618.-

    PROCEDIMIENTO PARA LA COORDINACION DE ACCESOS PARALELOS DE VARIOS PROCESADORES A CONFIGURACIONES DE RECURSOS.

    (05/2004)
    Solicitante/s: SIEMENS AG. Inventor/es: LIEBL, ROBERT, PFAEHLER, WOLFGANG, DIPL.-PHYS. Clasificación: G06F9/46, G06F15/16.

    EN LOS SISTEMAS MULTIPROCESADORES EXISTEN CON FRECUENCIA CONFIGURACIONES DE FUENTE COMPLEJAS. CON ELLO RESULTAN PROBLEMAS DE COORDINACION EN INTERVENCIONES CONCURRENTES SOBRE UNA CONFIGURACION DE FUENTE DETERMINADA A TRAVES DE MULTIPLES PROCESADORES. LA INVENCION RESUELVE EL PROBLEMA DE TAL MODO, QUE SE INTRODUCE UNA TABLA DE SEGURIDAD CENTRAL Y DE FORMA QUE UN PROCESADOR FIJA SU SITUACION DE ACUERDO CON SU NUMERO DE PROCESADOR Y CON RESPECTO UN NUMERO DE SEGURIDAD DETERMINADA, CUANDO RECIBE EL CONTROL A TRAVES DE LA CONFIGURACION DE FUENTE PERTENECIENTE A SU NUMERO DE SEGURIDAD.

  11. 619.-

    METODO Y APARATO PARA REALIZAR LA TRANSFORMACION DISCRETA DE COSENO Y SU INVERSA.

    (05/2004)

    UN APARATO DE TRANSFORMACION DISCRETA DE COSENO (DCT), CAPAZ DE GENERAR DCT UNI-DIMENSIONAL Y BI-DIMENSIONAL Y RESULTADOS DE DCT INVERTIDOS, USA ALGORITMOS RAPIDOS DCT/IDCT DE SEIS ETAPAS PARA PROCESAR UNA SECUENCIA DE DATOS DE ENTRADA (DIN) DE UN BLOQUE DE DATOS DE 8X8. CADA UNA DE LAS ETAPAS DIFERENTES DE LOS ALGORITMOS RAPIDOS DCT/IDCT DE SEIS ETAPAS INCLUYE UN NUMERO DE OPERACIONES FLOTANTES, QUE PUEDEN SER DESARROLLADAS POR UNA UNIDAD DE OPERACION FLOTANTE DEL APARATO DCT, O UN NUMERO DE MULTIPLICACIONES INTRINSECAS, UN NUMERO DE OPERACIONES DE MULTIPLICACION POST-SUMA, O UN NUMERO DE OPERACIONES DE SUSTRACCION POST-MULTIPLICACION, LA TOTALIDAD DE LAS CUALES PUEDEN SER REALIZADAS POR UNA UNIDAD DE OPERACION DE MULTIPLICACION. UNA...

  12. 620.-

    APARATO PARA UTILIZARLO EN UN SISTEMA PARA INTERCONECTAR APARATOS.

    (05/2004)

    EL APARATO COMPRENDE PRIMERO, SEGUNDO Y TERCER MEDIO DE CONEXION, UNOS MEDIOS GENERADORES DE SEÑAL DE CONTROL Y PRIMERO Y SEGUNDO MEDIOS DE CONMUTACION. EL PRIMER Y SEGUNDO MEDIO DE CONEXION TIENEN CADA UNO UN TERMINAL DE ENTRADA DE SEÑAL, UN TERMINAL DE SALIDA DE SEÑAL Y UN TERMINAL DE SEÑAL DE CONTROL. EL TERCER MEDIO DE CONEXION TIENE UN TERMINAL DE ENTRADA DE SEÑAL Y EVENTUALMENTE UN TERMINAL DE SEÑAL DE CONTROL. EL PRIMERO Y SEGUNDO MEDIO DE CONMUTACION TIENEN CADA UNO PRIMERO (A), SEGUNDO (B) Y TERCER (C) TERMINALES, ESTANDO ACOPLADO EL PRIMER MEDIO DE CONMUTACION AL TERMINAL DE SALIDA DE SEÑAL DEL SEGUNDO MEDIO DE CONEXION, ESTANDO ACOPLADO EL SEGUNDO TERMINAL (B) DEL PRIMER MEDIO DE CONMUTACION AL TERMINAL ...

  13. 621.-

    PRODUCCION DE UNA PROTEINA DE INTERES EN LA LECHE DE UN MAMIFERO TRANSGENICO.

    (05/2004)
    Solicitante/s: INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE. Inventor/es: HOUDEBINE, LOUIS-MARIE, DEVINOY, EVE, THEPOT, DOMINIQUE. Clasificación: C07K14/00, C12N15/12, C12N15/85, C12N5/10, A01K67/027, C12N15/00, C12N15/18.

    LA PRESENTE INVENCION SE REFIERE A UN PROCESO DE PREPARACION DE UNA PROTEINA HETEROLOGA DE INTERES EN FORMA DE ARBOLADURA O EN FORMA FUSIONADA EN LA LECHE DE UNA HEMBRA DE MAMIFERO, PROCESO EN EL QUE: ECHE DE DONDE SE RECUPERA DICHA PROTEINA QUE SE SEPARA SI ES NECESARIO, CARACTERIZADO EN QUE DICHA HEMBRA ES UN ANIMAL TRANSGENICO EN EL GENOMA DEL CUAL A SIDO INTEGRADA UNA SECUENCIA QUE CODIFICA DICHA PROTEINA DE INTERES BAJO EL CONTROL DE AL MENOS UNA SECUENCIA QUE FIGURA ENTRE LOS ELEMENTOS DE EXPRESION DE LA PROTEINA WAP DE CONEJO Y QUE SE ENCUENTRA EN EL FRAGMENTO DE UNA LONGITUD DE AL MENOS 3 KB A PARTIR DEL EXTREMO 3' DEL PROMOTOR WAP COMPLETO. TAMBIEN SE REFIERE AL PRODUCTO DE LA LECHE OBTENIDA Y A UNA CELULA EUCARIOTA QUE HA INTEGRADO LAS SECUENCIAS DESCRITAS.

  14. 622.-

    PROCEDIMIENTO PARA PRODUCIR PEPTIDOS.

    (05/2004)

    UN PROCESO PARA LA PRODUCCION DE UN PEPTIDO (PEPTIDO OBJETO) QUE COMPRENDE: A) EL CULTIVO DE CELULAS HUESPED TRANSFORMADAS CON UN PLASMIDO CAPAZ DE EXPRESAR UN GEN QUE CODIFICA PARA UNA PROTEINA DE FUSION REPRESENTADA EN LA SIGUIENTE FORMULA: A-L-B EN DONDE, B ES UN PEPTIDO OBJETO, A ES UN PEPTIDO PROTECTOR FORMADO POR DE 90 A 200 RESIDUOS DE AMINOACIDOS Y L ES UN PEPTIDO DE ENLACE SITUADO ENTRE EL C TERMINAL DE DICHO PEPTIDO PROTECTOR Y EL N TERMINAL DE DICHO PEPTIDO OBJETO Y SELECCIONADO DE TAL FORMA QUE SE TRATE LA PROTEINA DE FUSION CON UN ENZIMA O UNA SUBSTANCIA QUIMICA, SE SEPARA EL PEPTIDO OBJETO MENCIONADO ANTERIORMENTE Y SE SELECCIONAN DICHOS PEPTIDOS PROTECTOR Y DE ENLACE PARA QUE EL PUNTO ISOELECTRICO DE LA PROTEINA DE FUSION...

  15. 623.-

    METODO Y APARATO PARA CODIFICAR Y DECODIFICAR DE FORMA ENTREMEZCLADA SEÑALES DE VIDEO CON LLENADO DE BORDES.

    (05/2004)

    SE PRESENTA UN SISTEMA CODIFICADOR DE VIDEO QUE INDUCE UNA FLUCTUACION ALEATORIA POR EJEMPLO, UN DESPLAZAMIENTO DE TIEMPO, EN LA SITUACION DE UNA PARTE ACTIVA DE LA TOMA DE VIDEO, SIN AFECTAR LA SEÑAL DE SINCRONIZACION HORIZONTAL Y EL BARRIDO DE COLOR EN CADA LINEA DE VIDEO, SUMINISTRANDO DE ESTA FORMA TANTO SEGURIDAD COMO SECRETO. LA SEGURIDAD SE MEJORA LLENANDO EL HUECO ENTRE EL PRINCIPIO NOMINAL DEL VIDEO ACTIVO Y EL PRINCIPIO ACTUAL DEL VIDEO ACTIVO CON UNA SEÑAL DE VIDEO SINTETIZADA QUE DUPLICA EL VIDEO ACTIVO ADYACENTE USANDO UN DISEÑO DE RELLENO GENERADO DIGITALMENTE. TAMBIEN, LA SUPERPOSICION DE UN RUIDO ALEATORIO OCULTA LA SITUACION DEL HUECO. SE REALIZA UN OCULTAMIENTO ADICIONAL MEDIANTE LA ONDULACION EN EL TIEMPO DE LA...

  16. 624.-

    PRODUCTO DE MASA REFRIGERADA A BAJA PRESION.

    (05/2004)
    Ver ilustración. Solicitante/s: THE PILLSBURY COMPANY. Inventor/es: HANKERSON, STEPHANIE, C., K., ATWELL, WILLIAM, A. Clasificación: A21D10/02, A21D6/00.

    ESTA INVENCION SE REFIERE A UN SISTEMA REFRIGERADO DE PASTA QUE COMPRENDE UNA PASTA EN UN RECIPIENTE QUE CONTIENE UN GAS. ESTA PASTA CONTIENE UN AGENTE DE LEVADURA CAPAZ DE GENERAR GAS EN LA PASTA DESPUES DE QUE ESTA ESTE HERMETICAMENTE CERRADA EN EL RECIPIENTE. ESTE RECIPIENTE TIENE UN MECANISMO DE LIBERACION DE PRESION PARA LIBERAR LA PRESION EXCESIVA GENERADA DENTRO DEL RECIPIENTE A MEDIDA QUE LA PASTA SE ELEVA Y DURANTE EL ALMACENAMIENTO. EL SISTEMA DE LA PASTA PUEDE SOSTENER UNA ESTRUCTURA DE PASTA QUE SE ELEVA DURANTE EL ALMACENAMIENTO DE FORMA QUE CUANDO SE CUECE LA PASTA, EL PRODUCTO COCIDO RESULTANTE SE PARECE A UNA PASTA RECIEN PREPARADA Y COCIDA.

  17. 625.-

    PIPERACINAS SUSTITUIDAS CON ARILO UTILES EN EL TRATAMIENTO DE LA HIPERPLASIA BENIGNA DE PROSTATA.

    (05/2004)
    Solicitante/s: ORTHO-MCNEIL PHARMACEUTICAL, INC.. Inventor/es: LI, XIAOBING, MARYANOFF, CYNTHIA, VILLANI, FRANK, MULCAHY, LINDA, JOLLIFFE, LINDA, MURRAY, WILLIAM, PULITO, VIRGINIA, REITZ, ALAN. Clasificación: A61K31/495, C07D209/48, C07D295/12, C07D207/28, C07D223/10, C07D211/76.

    La invención se refiere a una serie de piperacinas de sustitución arilo de la fórmula (I), a composiciones farmacéuticas que las contienen y a los productos intermedios utilizados en su fabricación. Los compuestos de la invención inhiben selectivamente la fijación al receptor andrenérgico a-1a, un receptor que se ha implicado en la hiperplasia prostática benigna. Por lo tanto los compuestos son potencialmente útiles en el tratamiento de esta y de otras enfermedades.

  18. 626.-

    ARMA DE FUEGO PROVISTA DE UN DISPOSITIVO DE SEGURIDAD RAPIDO Y DISPOSITIVO DE SEGURIDAD EN KIT.

    (05/2004)
    Solicitante/s: R.D.I.H. SPRL. Inventor/es: HUBERT, LEON, HUBERT, ROBERT. Clasificación: F41A17/74, F41A17/56.

    La invención se refiere a un arma de fuego semiautomática de accionamiento simple con un sistema de disparo por percutor insertado tal como una pistola y opcionalmente un revólver que, por medio de un disparador accionado por el muelle de liberación, distribuye el cartucho bien en la corredera en el caso de una pistola o bien en el tambor en el caso de un revólver. La invención se caracteriza en que el arma de fuego tiene medios para bloquear el percutor cuando éste último se dispone en su posición delantera.

  19. 627.-

    SISTEMA DE EXTINCION DE FUEGO.

    (05/2004)

    Sistema de extinción de fuego para apagar un fuego que incluye un conducto para extender en el espacio y para enviar un líquido de extinción de fuego al espacio, una vía que se extiende en una dirección longitudinal del conducto , un medio de bombeo adaptado para desplazarse sobre la vía y adaptado al líquido de bombeo enviado al conducto , un medio impulsor adaptado para desplazar el medio de bombeo a lo largo de la vía , un medio de control para controlar el movimiento del medio de bombeo en relación a la vía , caracterizado porque se proporciona...

  20. 628.-

    MAQUINA PARA ELMOVIMIENTO DE MONTONES DE ABONO COMPUESTO.

    (05/2004)

    Máquina para la manipulación de montones de abono compuesto para mejorar el proceso de fermentación bacteriana, que comprende un armazón de soporte que descansa sobre medios de impulsión de dicha máquina, medios de desensilado para el montón de abono, medios de recogida para el material desensilado y medios para desplazar dicho material a una zona próxima al montón, caracterizada porque los medios de desensilado consisten en un grupo de herramientas de mano izquierda y un grupo de herramientas de mano derecha, que giran en direcciones contrarias entre sí, dotadas...

  21. 629.-

    METODO DE REDUCCION DE LA DENSIDAD DEL NITRATO AMONICO POR MEDIO DE UN AGENTE GENERADOR DE GAS.

    (05/2004)
    Solicitante/s: SASOL CHEMICAL INDUSTRIES LIMITED. Inventor/es: BREEDT, JACOBUS, STEPHENS, HUGH, ALBERT, SANDRY, SPITERI, WILLIAM, LUCIANO, BALS, EDWIN. Clasificación: C06B23/00, C01C1/18, C06B31/28.

    Método de reducción de la densidad de un producto de nitrato amónico que comprende: - proporcionar un agente generador de gas en la forma de un compuesto de carbonato sólido, insoluble en agua que puede generar gas mediante reacción química y en el que el tamaño de partícula diametral medio del agente generador de gas es inferior a 40 micram; - proporcionar un producto de nitrato amónico; - introducir el agente generador de gas sólido, insoluble en agua en el producto de nitrato amónico en condiciones que produzcan la generación de gas por el agente generador de gas en el producto de nitrato amónico; y - formar partículas del producto de nitrato amónico para formar un producto particulado de nitrato amónico con densidad reducida.

  22. 630.-

    PROCEDIMIENTO Y DISPOSITIVO PARA ENFRIAR Y CALIBRAR UN PERFIL.

    (05/2004)
    Ver ilustración. Solicitante/s: TOPF KUNSTSTOFFTECHNIK GMBH. Inventor/es: TOPF, SIEGFRIED. Clasificación: B29C47/88, B29C47/90.

    Procedimiento para enfriar y calibrar un perfil de plástico, conduciéndose el perfil a través de varios diafragmas, con una abertura correspondiente al perfil, dispuestos unos detrás de los otros y en una carcasa que está preferiblemente bajo presión negativa, como un tanque o una cubeta, y sometiéndose a presión por medio de toberas con fluido refrigerante, tal como un líquido, dispuestas de forma periférica alrededor del, caracterizado porque el fluido refrigerante se alimenta con una presión p de p 5 bares a la tobera que presenta en cada caso una abertura de paso para el fluido con un diámetro d de d 0, 7 mm.

  23. 631.-

    SISTEMA DE FRENO PARA VEHICULOS CON UN DEPOSITO DE GAS A PRESION.

    (05/2004)

    Sistema de freno para vehículos, con un depósito de gas a presión que presenta una carcasa , cuyo interior está dividido mediante un fuelle metálico en una cámara de gas, llena de gas, y una cámara de fluido, pudiéndose alimentar a la cámara de fluido y extraer de ésta un fluido a presión a través de un conducto de alimentación y estando prevista entre la cámara de fluido y el conducto de alimentación una disposición de válvula que cierra cuando la presión en el conducto de alimentación no alcanza un valor mínimo y que abre cuando la presión...

  24. 632.-

    VENTANA DE BARCO U OJO DE BUEY Y SU PROCEDIMIENTO DE FABRICACION.

    (05/2004)

    Ojo de buey del tipo que incluye un marco delimitando una ventana, un vidrio alojado en este marco y cerrando la citada ventana y una pinzacristal fijada sobre el marco visto desde el borde anterior al vidrio con objeto de sujetar a este último en el marco, estando formada esta pinza-cristal de varios elementos o partes (4a, 4b, 4c, 4d, ...) encastradas, por medio de su borde externo (4’) en una ranura practicada en la superficie interior (1a) del marco , y mantenidas en esta ranura por medio de una fijación , caracterizado porque los elementos (4a, 4b, 4c,...

  25. 633.-

    SISTEMAS DE TERMOCONFORMACION DE MATERIALES LAMINARES PARA OBTENER RECIPIENTES.

    (05/2004)

    Dispositivo, que comprende medios de indexación dispuestos para indexar material laminar a lo largo de una dirección de avance (F) a través de una estación de conformación de dicho material laminar en el que se proporcionan medios de conformación , estando dichos medios de conformación dispuestos para deformar partes de dicho material laminar de modo que se obtengan forros laminares (50, 50a, 50b) de recipientes unidos por partes no deformadas de dicho material laminar , una estación de cizallamiento en la que dichos forros laminares (50, 50a, 50b) son...

  26. 634.-

    APARATO PUNZONADOR GIRATORIO.

    (05/2004)

    Aparato punzonador giratorio para punzonar aberturas alargadas en una pieza de trabajo (W) de banda continua, teniendo las aberturas alargadas una longitud predeterminada a lo largo del eje longitudinal de dicha pieza de trabajo (W) de banda continua, y estando caracterizado por: dos conjuntos de troqueles situados en lados opuestos de la trayectoria de dicha pieza de trabajo (W) de banda continua, y un medio de energía para hacer rotar dichos conjuntos ; un troquel anterior montado en dicho conjunto de dichos conjuntos , y un medio de movimiento para mover...

  27. 635.-

    PROCEDIMIENTO PARA LA FABRICACION DE UNA SULFENIMIDA.

    (05/2004)

    Un procedimiento para la fabricación de una sulfenimida de la fórmula (R1S-)-(R2S-)N-R hacinedo reaccionar una sulfenamida que tiene la fórmula R1S-NH-R, en la que R se selecciona del grupo que comprende t-butilo, ciclohexilo, o alquilo C1-C20, R1 se selecciona de heterociclos sustituidos o no sustituidos que contienen uno o más átomos de N, S, O y P, dichos heterociclos pueden estar sustituidos con grupos alquilo C1-C20, y R2 se selecciona del mismo grupo que R1 y puede ser el mismo o diferente que R1, en suspensión con disolvente orgánico inmiscible en agua con un...

  28. 636.-

    PROCEDIMIENTO PARA CONSERVAR LA NIEVE.

    (05/2004)
    Ver ilustración. Solicitante/s: SCHOLL, KLAUS DIETER MORENT, RALF. Inventor/es: MORENT, RALF. Clasificación: E01H4/02, A63C19/10, F25C3/00.

    Procedimiento para conservar nieve sobre zonas predeterminadas de un suelo natural , tendiéndose sobre estas zonas una instalación de esteras refrigerantes , a la que se alimenta un refrigerante a través de una línea de alimentación de refrigerante y de la que se extrae el refrigerante a través de una línea de retroalimentación de refrigerante , caracterizado porque la instalación de esteras refrigerantes se tiende sobre una capa de nieve, que ya se encuentra sobre el suelo natural y anteriormente se ha aplanado con un rodillo o similar, y porque después se aplica otra capa de nieve sobre la instalación de esteras refrigerantes y ésta se refrigera.

  29. 637.-

    PROCEDIMIENTO PARA LA PREPARACION DE ESTIRENOS.

    (05/2004)
    Solicitante/s: SHELL INTERNATIONALE RESEARCH MAATSCHAPPIJ B.V.. Inventor/es: VAN ZWIENEN, MARINUS, DIRKZWAGER, HENDRIK. Clasificación: B01J21/04, C07C1/24, C07C15/46.

    Proceso para la preparación de estireno que comprende la deshidratación en fase gaseosa de 1-feniletanol a temperatura elevada en presencia de un catalizador de deshidratación, en el que el catalizador de deshidratación consiste en partículas de catalizador de alúmina conformadas que tienen una superficie específica (BET) en el intervalo de 80 a 140 m2/g y un volumen de poro (Hg) en el intervalo de 0, 35 a 0, 65 ml/g, del cual 0, 03 a 0, 15 ml/g es en poros que tienen un diámetro de al menos 1000 nm.

  30. 638.-

    SISTEMA DE CELULAS DE COMBUSTIBLE Y COCHE ELECTRICO EN EL QUE SE MONTA Y METODO DE CONTROL DE ARRANQUE PARA SISTEMA DE CELULAS DE COMBUSTIBLE.

    (05/2004)
    Ver ilustración. Solicitante/s: TOYOTA JIDOSHA KABUSHIKI KAISHA. Inventor/es: ISHIKAWA, SEIJI TOYOTA JIDOSHA KABUSHI KAISHA. Clasificación: B60L11/18, H01M8/00, H01M8/04.

    Un sistema de células de combustible que puede montarse en un vehículo eléctrico, que tiene células de combustible que reciben un suministro de combustible gaseoso y generan energía eléctrica, comprendiendo dicho sistema de células de combustible: un motor que es accionado con la salida de energía eléctrica procedente de dichas células de combustible ; y una unidad de control del motor que controla el accionamiento del citado motor , caracterizado porque dicha unidad de control del motor controla el accionamiento del mencionado motor , con el fin de hacer que dicho motor consuma la energía eléctrica procedente de dichas células de combustible sin generar par alguno en el árbol de accionamiento de dicho motor en el momento de activarse dichas células de combustible.

  31. 639.-

    SISTEMA DE SUSTANCIAS.

    (05/2004)
    Solicitante/s: JOWAT LOBERS & FRANK GMBH. Inventor/es: TERFLOTH, CHRISTIAN, DR., GUSE, DIETER, DR., HIPPOLD, THEODOR. Clasificación: C08G18/80, C08G18/70, C09J175/02.

    Dispersión acuosa de 1 componente, reticulable, estable al almacenamiento, que contiene a) isocianatos superficialmente desactivados o encapsulados, con reactividad retardada, escogidos de TDI-uret-diona y TDI-urea, en una cantidad de 0, 1 y a 10% en peso, en los que el grado de desactivación, calculado como la relación de equivalentes de los grupos amino del desactivador a los grupos isocianato de los isocianatos asciende, en el caso de la TDI- urea, a 0, 008:1, y en el caso de TDI-uret-diona, a 0, 009:1; y b) un adhesivo de dispersión adecuado como componente del polímero. en donde las películas formadas a partir de esta dispersión son reticulables ya a temperatura ambiente (20ºC, humedad relativa del 65%).

  32. 640.-

    NUEVOS ANALOGOS DE ACIDOS GRASOS PARA EL TRATAMIENTO DE LA OBESIDAD.

    (05/2004)
    Ver ilustración. Solicitante/s: THIA MEDICA AS. Inventor/es: BERGE, ROLF. Clasificación: A61P3/04, A61K31/19, A23L1/29, A61K31/20, C07C327/06, C07C391/00.

    Uso de análogos de ácidos grasos de la **fórmula** CH3-[CH2]m-[xi-CH2]n-COOR- en la que n es un entero entre 1 y 12, y - en la que m es un entero entre 0 y 23, y - en la que i es un número impar e indica la posición relativa al COOR, y - en la que Xi se selecciona de forma independiente entre sí entre el grupo que comprende O, S, SO, SO2 Se y CH2, y - en la que R representa hidrógeno o alquilo C1-C4, y - con la condicion de que al menos uno de los Xi no sea CH2, o una sal, profármaco y complejo de los mismos, para la preparación de una composición farmacéutica para el tratamiento y/o prevención de la obesidad en un animal.

<< · 10 · 15 · 17 · 18 · < · 20 · > · 22 · 24 · 29 · 39 · 59 · >>