Método para determinar en un rosal silvestre la presencia de cruzamiento con un rosal cultivado.

Un método para determinar si una rosa silvestre de interés está cruzada o no con una rosa cultivada

, comprendiendo dicho método la investigación de la presencia de un gen KSN que contiene un transposón indicador,

en donde se determina que la rosa silvestre de interés no está cruzada con una rosa cultivada cuando no está presente un gen KSN que contiene un transposón indicador en dicha rosa silvestre de interés; o en donde se determina que la rosa silvestre de interés está cruzada con una rosa cultivada cuando está presente un gen KSN que contiene un transposón indicador en dicha rosa silvestre de interés.

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/JP2008/056000.

Solicitante: SUNTORY HOLDINGS LIMITED.

Nacionalidad solicitante: Japón.

Dirección: 1-40, Dojimahama 2-chome Kita-ku Osaka-shi Osaka 530-8203 JAPON.

Inventor/es: TANAKA, YOSHIKAZU, MIZUTANI, MASAKO, NAKAMURA,Noriko.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Técnicas de mutación o de ingeniería genética;... > C12N15/09 (Tecnología del ADN recombinante)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/68 (en los que intervienen ácidos nucleicos)

PDF original: ES-2462944_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Método para determinar en un rosal silvestre la presencia de cruzamiento con un rosal cultivado Campo de la invención La presente invención se refiere a un método para determinar la presencia de cruzamiento con una rosa cultivada en una rosa silvestre.

Técnica anterior

Puesto que siempre se favorecen las flores que tienen nuevos rasgos de la industria de las flores, el desarrollo de tal tipo de plantas con flores es industrialmente importante. La mejora de la raza basada principalmente en cruzamiento ha producido especies con una variedad de rasgos. Sin embargo, en la mejora de la raza basada en el cruzamiento, los recursos genéticos disponibles se limitan a plantas susceptibles de cruzamiento estrechamente relacionadas, y de este modo los colores y los rasgos que se pueden introducir son limitados en la mayoría de los casos, y además es raro que las especies de plantas individuales tengan diversos colores y rasgos. En términos de color, por ejemplo, era imposible producir rosas y claveles de color azul, campanillas o geranios de color amarillo mediante mejora de la raza basada en el cruzamiento.

Sin embargo, el uso de la tecnología recombinante de genes puede conseguir el desarrollo de una variedad de rasgos mediante la introducción de varios genes en las plantas que superen la barrera de la especie y mediante la alteración artificial de los metabolismos de plantas, etc. Por ejemplo, hay un ejemplo en el que en las rosas y los claveles que no pueden producir delfinidina en el pétalo de la flor, se expresó el gen de la enzima flavonoide 3', 5'hidroxilasa que es requerido para sintetizar delfinidina para producir delfinidina, permitió la creación de flores de color azul que no están presentes en la naturaleza (Tanaka 2006) .

Sin embargo, en Japón, la investigación y el desarrollo, el cultivo, la distribución, etc. de tales plantas recombinantes de genes creados artificialmente son necesarios para cumplir con las regulaciones establecidas en la "Ley sobre la Conservación y Uso Sostenible de la Diversidad Biológica a través de las Regulaciones sobre el Uso de Organismos Vivos Modificados" (Protocolo de Cartagena) . En otros países también, el cultivo en campos, etc. de las plantas recombinantes de genes ha sido regulado basándose en leyes similares. En concreto, para las plantas cuyos pólenes son fértiles y para las que existen una multitud de plantas susceptibles de cruzamiento estrechamente relacionadas que existen en Japón, es obligatoria la evaluación de la capacidad de cruzamiento, o de la posibilidad de proliferación de genes de una planta recombinante con respecto a una especie silvestre estrechamente relacionada.

En el caso de las rosas para las que se producen a una multitud de especies estrechamente relacionadas en Japón y que son de varias flores y fructíferas, las cantidades que se deben analizar para determinar la presencia de cruzamiento entre especies cultivadas y silvestres se convierten en enormes, y de este modo se está buscando el establecimiento de tecnologías analíticas simples y precisas. Hasta ahora, se ha informado sobre la que utiliza microsatélites como marcador molecular (Debener 2003, 2006) . Además, el análisis también se puede llevar a cabo con un método de identificación basado en la determinación de la ploidía por medio de citometría de flujo. Sin embargo, cualquiera de los métodos anteriores tenía el problema de que carecían de precisión, versatilidad y/o simplicidad. Además, dado que las rosas cultivadas hoy en día fueron creadas mediante cruzamiento artificial de aproximadamente 8 especies silvestres, no fue fácil obtener marcadores de ADN que pudieran distinguir las especies cultivadas de las especies silvestres.

De acuerdo con la presente invención, el gen KSN, un gen diana, es un gen implicado en la floración perpetua de las rosas obtenidas a partir de Rosa chinensis spontanea, y el gen se creó insertando un transposón aproximadamente 9 kb en el gen KSN de una rosa de floración estacional. Se ha informado de que la inserción de un transposón sirve para inhibir la expresión de dicho gen, lo que condujo a la desregulación del control de la antogénesis en el ápice del brote, lo que dio como resultado la naturaleza de floración perpetua (Iwata et al., Publicación de Patente Japonesa No Examinada (Kokai) Núm. 2006-149202) .

Ya se ha dilucidado que las rosas de las especies cultivadas contienen, en la configuración homóloga, dicho gen que tiene un transposón insertado en el mismo. Por otro lado, las rosas de la especie silvestre tienen, en la configuración homóloga, un gen KSN que, en principio, no contiene un transposón.

Según se utiliza en la presente memoria, la Rosa chinensis es una de las especies silvestres que se convirtieron en un antepasado de las rosas cultivadas y una rosa de floración estacional R. chinensis spontanea es un linaje mutante de la misma y una rosa de floración perpetua.

Documento de Patente 1: Publicación de Patente Japonesa No Examinada (Kokai) Núm. 2006-149202.

Descripción de la invención Se ha informado sobre métodos para determinar la presencia de cruzamiento con rosas cultivadas en rosas silvestres, pero carecen de la versatilidad. Otros métodos pueden ser concebibles, pero carecen de simplicidad y precisión. Por lo tanto, existe la necesidad de un método que pueda resolver estos problemas y pueda determinar si las rosas silvestres se cruzan con las rosas cultivadas para que las plantas sean fructíferas y para las cuales se produce una multitud de especies silvestres estrechamente relacionadas.

En los casos en que se va a determinar un número enorme de plantas individuales para determinar la presencia de cruzamiento con el fin de examinar la posibilidad de proliferación de genes de plantas recombinantes, se requiere específicamente un método que permita una fácil determinación de si una rosa silvestre se cruza con una rosa transformante como planta parental polinífera. Por lo tanto, la presente invención tiene como objetivo proporcionar un método que permita determinar fácilmente si una rosa silvestre de interés se cruza con el polen de una rosa transformante.

Después de una investigación intensiva y exhaustiva con el fin de alcanzar el objetivo anterior, los autores de la presente invención han concebido la idea de que en una rosa silvestre, solo se puede detectar un gen KSN que contiene un transposón cuando la rosa silvestre se cruza con una rosa cultivada, y han descubierto que utilizando un gen KSN que contiene un transposón como indicador, se puede lograr el objetivo anterior, y de ese modo han completado la presente invención.

De este modo, la presente invención proporciona un método para determinar si una rosa silvestre de interés se cruza o no con una rosa cultivada, comprendiendo dicho método las etapas de: examinar si un gen KSN que contiene un transposón (indicador) está contenido o no en la rosa de interés; y determinar que la rosa de interés está cruzada con una rosa cultivada cuando el individuo tiene el gen KSN que contiene el transposón.

Normalmente, en el cruzamiento de una rosa cultivada con una especie silvestre en un estudio para evaluar el efecto de las plantas transgénicas en la diversidad biológica, la dispersión de pólenes de especies cultivadas que da como resultado el cruzamiento con especies silvestres en las proximidades presenta problemas. Así, en el método de la presente invención, típicamente la planta parental semillera es una rosa silvestre y la planta parental polinífera es una rosa cultivada. Asimismo, típicamente la rosa cultivada anterior es una rosa transformante que tiene un gen introducido en la misma, en la que el gen puede ser un gen relacionado con el color tal como el gen de la enzima flavonoide 3',... [Seguir leyendo]

 


Reivindicaciones:

1. Un método para determinar si una rosa silvestre de interés está cruzada o no con una rosa cultivada, comprendiendo dicho método la investigación de la presencia de un gen KSN que contiene un transposón indicador,

en donde se determina que la rosa silvestre de interés no está cruzada con una rosa cultivada cuando no está presente un gen KSN que contiene un transposón indicador en dicha rosa silvestre de interés; o en donde se determina que la rosa silvestre de interés está cruzada con una rosa cultivada cuando está presente un gen KSN que contiene un transposón indicador en dicha rosa silvestre de interés.

2. El método de acuerdo con la reivindicación 1, en donde la planta parental semillera es una rosa silvestre y la planta parental polinífera es una rosa cultivada.

3. El método de acuerdo con la reivindicación 1 o 2, en donde dicha rosa cultivada es una rosa que tiene un gen insertado en la misma.

4. El método de acuerdo con la reivindicación 3, en donde dicho gen es un gen relacionado con el color de la flor.

5. El método de acuerdo con la reivindicación 4, en donde el gen relacionado con el color de la flor es el gen de la enzima flavonoide 3', 5'-hidroxilasa derivada del pensamiento de la familia Violaceae.

6. El método de acuerdo con una cualquiera de las reivindicaciones 1 a 5, en donde la detección de dicho gen indicador se lleva a cabo a través de hibridación de ácidos nucleicos de dicho gen.

7. El método de acuerdo con una cualquiera de las reivindicaciones 1 a 5, en donde dicha detección se lleva a cabo a través de la amplificación específica mediante PCR.

8. El método de acuerdo con la reivindicación 7, en donde dicha PCR se lleva a cabo a través de un cebador directo: CATATTATGGCATAGGGTGTGGC (SEC ID NO: 3) y un cebador inverso: TGTAATCTGTAGGAGATCCCATGC (SEQ ID NO: 4) .

9. El método de acuerdo con una cualquiera de las reivindicaciones 1 a 8, en donde dicha rosa silvestre es una planta de rosa que tiene, en la configuración homóloga, un gen KSN que no contiene un transposón.

10. El método de acuerdo con una cualquiera de las reivindicaciones 1 a 9, en donde dicha rosa silvestre es NOIBARA (R. multiflora Thunb. ex Murray) , TERIHANOIBARA (R. wichuraiana Crep.) , Hamanasu (R. rugosa Thunb. ex Murray) , OOTAKANEBARA (R. acicularis Lindl.) , KARAFUTOIBARA (R. marretii Lev.) , OOFUJIIBARA, AZUMAIBARA, YAMATERIHANOIBARA (R. luciae Franch. et Rochebr.) , YAMAIBARA (R. sambucina Koidz.) , KAKAYANBARA, YAEYAMANOIBARA (R. bracteata Wendl.) , NANIWAIBARA (R. laevigata Michx.) , SANSHOUBARA (R. roxburghii Tratt. var. hirtula (Regel) Rehd. et Wils.) , TAKANEBARA (R. acicularis var. nipponensis (Crép.) Koehne.) , TSUKUSHIIBARA (R. multiflora var. adenochaeta (Koidz.) Makino) , MORIIBARA (R. luciae var. hakonensis Franch. et Sav.) , FUJIIBARA (R. luciae var. fujisanensis Makino) , YABUIBARA, NIOIIBARA

(R. luciae var. onoei (Makino) Momiyama) , MIYAKOIBARA (R. luciae var. paniculgera (Makino) Momiyama) .

11. El método de acuerdo con una cualquiera de las reivindicaciones 1 a 10, en donde dicha rosa cultivada es una planta de rosa que tiene, en la configuración homóloga, un gen KSN que tiene un transposón insertado en el mismo.

12. El método de acuerdo con una cualquiera de las reivindicaciones 1 a 11, en donde dicha rosa cultivada es híbrido de té, floribunda o miniatura.

13. El uso de un par de cebadores para amplificar un gen KSN que contiene un transposón indicador en un método para determinar si una rosa silvestre de interés se cruzó o no con una rosa cultivada de acuerdo con cualquiera de las reivindicaciones 1 a 12, comprendiendo dicho par un cebador que tiene una secuencia de bases idéntica o sustancialmente homóloga a la región de la secuencia de bases mostrada en el SEC ID NO: 1 y un cebador que tiene una secuencia de bases idéntica o sustancialmente homóloga a la región de la secuencia de bases mostrada en el SEQ ID NO: 2.

14. El uso del par de cebadores de acuerdo con la reivindicación 13 que comprende un cebador directo: CATATTATGGCATAGGGTGTGGC (SEC ID NO: 3) y un cebador inverso: TGTAATCTGTAGGAGATCCCATGC (SEQ ID NO: 4) .