Determinación del riesgo de metástasis distante en pacientes con cáncer de pulmón de células no pequeñas en estadio I-IIIA, tratados quirúrgicamente.

Un método de determinación del riesgo de metástasis distante en pacientes con cáncer de pulmón de células no pequeñas en estadio I-IIIA

, tratados quirúrgicamente, en donde el microARN se extrae de una muestra de tejido del tumor primario, retrotranscrito en ADN complementario mediante transcripción inversa, la cantidad de al menos dos microARN incluyendo hsa-miR-10b de la Tabla 1, se examina con el uso del método de PCR cuantitativa y el valor de expresión de cada microARN se refiere a los correspondientes valores de expresión de referencia de microARN en un modelo de predicción de reincidencia de la enfermedad en el cual ciertos valores de expresión se correlacionan con el alto o bajo riesgo de metástasis distante como en la Tabla 1.**Tabla**

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/PL2010/000064.

Solicitante: Gdanski Uniwersytet Medyczny.

Nacionalidad solicitante: Polonia.

Dirección: Marii Sklodowskiej-Curie 3a 80-210 Gdansk POLONIA.

Inventor/es: SKRZYPSKI,MARCIN, JASSEM,JACEK.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > PROCESOS DE MEDIDA, INVESTIGACION O ANALISIS EN LOS... > Procesos de medida, investigación o análisis en... > C12Q1/68 (en los que intervienen ácidos nucleicos)

PDF original: ES-2544882_T3.pdf

 

google+ twitter facebook

Fragmento de la descripción:

Determinación del riesgo de metástasis distante en pacientes con cáncer de pulmón de células no pequeñas en estadio I-IIIA, tratados quirúrgicamente.

Campo de la invención y la esencia La presente invención se encuentra dentro del área general de la genética médica y en los campos de la biotecnología y la oncología. Más específicamente, se refiere al método de determinación del riesgo de metástasis distante y la determinación del pronóstico en los pacientes con cáncer de pulmón de células no pequeñas, tratados quirúrgicamente (NSCLC) en estadio I-IIIA. El riesgo de recaída y el pronóstico se establecen relacionando la expresión de los microARN en la muestra de tejido del tumor primario con los valores de expresión de referencia de los microARN enumerados (en un modelo de predicción de reincidencia distante) . En este modelo, las expresiones de microARN particulares se correlacionan bien con el alto o bajo riesgo de metástasis distante y por lo tanto con el pronóstico del paciente.

Antecedentes El cáncer de pulmón es la causa más común de mortalidad por cáncer, tanto en hombres como en mujeres. Anualmente, existen 20, 000 nuevos casos en Polonia, el 80% de los cuales son diagnosticados con NSCLC. En Polonia y en varios otros países de Europa, el cáncer de pulmón de células escamosas es el tipo histológico más frecuente entre los pacientes tratados quirúrgicamente.

En las primeras etapas, la cirugía (lobectomía o neumonectomía) es el tratamiento de elección, sin embargo, incluso en este grupo los resultados del tratamiento no son satisfactorios, con aproximadamente sólo el 50% de los pacientes que sobreviven 5 años.

El patrón más común de fracaso del tratamiento después de la cirugía es la diseminación del tumor. Un número de ensayos clínicos prospectivos mostró que la adición de quimioterapia mejora en promedio la supervivencia global de los pacientes en aproximadamente un 5%. En números absolutos, este beneficio sólo en Polonia se traduce en 150 pacientes salvados adicionalmente cada año. Sin embargo, para lograr este aumento 3, 000 pacientes deben recibir quimioterapia postoperatoria, mientras que sólo el 50% de ellos desarrollará reincidencia de la enfermedad.

En la actualidad, el único criterio de selección aprobado para el tratamiento adyuvante es el estadio de la enfermedad evaluado patológicamente. Los estudios prospectivos aleatorizados han demostrado el beneficio de la quimioterapia adyuvante en pacientes con NSCLC en estadio II y III. Sin embargo, si se examinan estos grupos, resulta que alrededor del 40% del estadio II y el 25% en estadio III de los pacientes no son recurrentes y por lo tanto no necesitan ningún tipo de tratamiento postoperatorio.

Por otro lado, el riesgo de metástasis distante en pacientes en estadio I, que actualmente no reciben quimioterapia adyuvante es tan alto como el 30%. Por lo tanto, esta categoría de pacientes aparentemente incluye subgrupos de pacientes con alto riesgo de recaída que podrían beneficiarse de la quimioterapia postoperatoria. Sin embargo, los métodos disponibles actualmente no permiten la identificación de estos subgrupos. De hecho, la evolución de los pacientes tratados quirúrgicamente es difícil de predecir basándose en las variables clínicas y patológicas, tales como estadio, el tipo histológico, el sexo o la edad. Los pacientes con exactamente las mismas características pueden variar en relación con el riesgo de metástasis y el pronóstico.

Los resultados de la investigación sobre marcadores moleculares sugieren que la evaluación de la transcripción puede constituir un buen marcador de pronóstico en el cáncer de pulmón. Los perfiles de expresión génica (evaluación de la abundancia de ARNm) se relacionó con el riesgo individual de diseminación de la enfermedad (Bhattacharjee et al. "Classification of human lung carcinomas by mRNA expression profiling reveals distinct adenocarcinoma subclasses". Proc Natl Acad Sci USA 2001; 98: 13790-13795) .

Parece que el uso de la transcripción inversa y la reacción en cadena de la polimerasa cuantitativa (RT-PCR) es la técnica más apropiada para el pronóstico basado en el análisis de la expresión génica en tejido tumoral.

Endoh et al., en una publicación titulada "Prognostic model of pulmonar y adenocarcinoma by expression profiling of eight genes as determined by quantitative real-time reverse transcriptase polymerase chain reaction" (J Clin Oncol 2004; 22: 811-819) describe una técnica que permite la cuantificación de la expresión génica en las células cancerosas. Los resultados de numerosos estudios basados en esta técnica pueden en última instancia conducir a la modificación de la clasificación histológica de cáncer de pulmón, así como proporcionar nuevos criterios moleculares para refinar el estadio de esta neoplasia.

Anteriormente presentamos el método para evaluar el riesgo de recaída distante y el pronóstico en pacientes con cáncer de pulmón de células escamosas mediante la evaluación de la expresión génica con RT-PCR (Skrzypski et al. "Three-gene expression signature predicts survival in early-stage squamous cell carcinoma of the lung". Clin Cancer Res 2008; 14: 4794-4799) .

Simultáneamente a los estudios sobre el papel de pronóstico de la expresión génica (evaluación del ARNm) , en los últimos años una nueva clase de moléculas: microARN ha atraído la atención como un potencial marcador de pronóstico.

Estas moléculas son importantes en muchos procesos celulares, tales como la embriogénesis, proliferación y diferenciación de las células, la apoptosis y la oncogénesis (revisado por Earspn et al. "MicroRNAs in development and disease". Clin. Genetics 2008; 74: 296-306) .

Los microARN son cadenas cortas de ARN (19-23 nucleótidos) que regulan la expresión génica a través de la inhibición de la traducción del ARNm. Este efecto está mediado por el enlace entre microARN y secuencias diana en las moléculas de ARNm en las regiones UTR. Dada la permisividad en el enlace entre estas moléculas, lo que permite la complementariedad imperfecta, un microARN puede controlar la expresión de cientos o miles de moléculas de ARNm y por lo tanto los genes.

El potencial de pronóstico de la evaluación de la expresión de microARN en tumores primarios ha sido investigado en muchos tipos de cáncer, incluyendo el cáncer de pulmón. En una publicación por Yu et al. "MicroRNA signature predicts survival and relapse in lung cancer" (Cancer Cell 2008; 13: 48-57) , los autores identificaron un perfil que consiste en 5 microARN, que es altamente predictivo de pronóstico en pacientes con NSCLC en estadios I-IIIA.

En la actualidad, se conocen algunos métodos moleculares para establecer el pronóstico en pacientes con NSCLC en estadio I-IIIA que se sometieron a tratamiento quirúrgico. Estos métodos, en principio, incluyen: (i) obtener una muestra de tejido del tumor primario, (ii) aislamiento del ARN, (iii) transcripción inversa del microARN o ARNm en ADNc, y (iv) establecimiento de la cantidad de microARN o ARNm en el tumor primario. Por último, el valor de la expresión de ARNm o microARN se refirió a los valores de expresión de referencia en un modelo de predicción de reincidencia de la enfermedad, por lo que ciertos valores de expresión se correlacionan con un alto y con un cierto bajo riesgo de reincidencia.

En este documento, se presenta un método que permite la determinación del riesgo de metástasis distante y el pronóstico temprano de NSCLC (estadio I-IIIA) . Este método se basa en la evaluación de la expresión en el tejido de tumor primario de varios micro-ARN (enumerados a continuación) . NSCLC particular demuestra la expresión diferencial de los microARN... [Seguir leyendo]

 


Reivindicaciones:

1. Un método de determinación del riesgo de metástasis distante en pacientes con cáncer de pulmón de células no pequeñas en estadio I-IIIA, tratados quirúrgicamente, en donde el microARN se extrae de una muestra de tejido del tumor primario, retrotranscrito en ADN complementario mediante transcripción inversa, la cantidad de al menos dos microARN incluyendo hsa-miR-10b de la Tabla 1, se examina con el uso del método de PCR cuantitativa y el valor de expresión de cada microARN se refiere a los correspondientes valores de expresión de referencia de microARN en un modelo de predicción de reincidencia de la enfermedad en el cual ciertos valores de expresión se correlacionan con el alto o bajo riesgo de metástasis distante como en la Tabla 1.

Tabla 1

2. Un método de la reivindicación 1, en donde el riesgo de metástasis distante se establece por medio de las puntuaciones de riesgo (RS) , que se calculan en base a los niveles de expresión en el tumor primario de al menos dos microARN enumerados en la Tabla 1, en donde:

Nombre de MicroARN Secuencia de microARN MARCADOR: Nivel de expresión de microARN que indica un alto riesgo de metástasis distante

hsa-miR-10b UACCCUGUAGAACCGAAUUUGU BAJO

hsa-miR-192* CUGCCAAUUCCAUAGGUCACAG ALTO

hsa-miR-222 AGCUACAUCUGGCUACUGGGU BAJO

hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU BAJO

hsa-miR-101* CAGUUAUCACAGUGCUGAUGCU BAJO

** (Ver fórmula) **

donde la expresión 'microARN N' (por ejemplo, microARN 192 *, etc.) -indica valor de riesgo parcial, y en donde el valor RS se calcula sumando los valores parciales de riesgo incurridos de la expresión de cada microARN que constituye una puntuación de riesgo dado, y en donde los valores parciales de riesgo se obtienen de acuerdo con el modelo de predicción de la reincidencia, en el cual un valor de alto riesgo se expresa como valor numérico "1", y un valor de bajo riesgo se expresa preferentemente en forma de valor numérico, preferiblemente "0".

3. Un método de las reivindicaciones 1-2, en donde se utiliza, todo el kit que comprende un conjunto de cebadores de los cuales al menos uno se hibrida con un fragmento del microARN examinado, que permite llevar a cabo la transcripción inversa y la reacción de PCR cuantitativa y preferiblemente comprende reactivos tales como soluciones reguladoras, enzimas y, posiblemente, otros reactivos para realizar la transcripción inversa y le reacción de PCR cuantitativa.