Cepas de Lactobacillus plantarum como probióticos con efecto inmunomodulador especifico.

Una cepa de Lactobacillus plantarum depositada en la Colección Española de Cultivos Tipo (CECT) con el número de acceso CECT 7315

Tipo: Patente Internacional (Tratado de Cooperación de Patentes). Resumen de patente/invención. Número de Solicitud: PCT/EP2008/065950.

Solicitante: CARINSA. Creaciones Aromáticas Industriales, S.A.

Nacionalidad solicitante: España.

Inventor/es: MARTINEZ CHAMORRO,Vanesa, CUÑÉ CASTELLANA,JORDI, ESPADALER MAZO,JORDI, LÓPEZ GONZÁLEZ,QUIRO, GASULL,MIQUEL ÀNGEL, CABRÉ GELADA,EDUARD, MAÑÉ ALMERO,JOSEP, CALVO TORRAS,MARÍA DE LOS ÁNGELES, BONACHERA SIERRA,MIQUEL ÀNGEL, AUDIVERT BRUGUÉ,SERGI.

Fecha de Publicación: .

Clasificación Internacional de Patentes:

  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > MICROORGANISMOS O ENZIMAS; COMPOSICIONES QUE LOS... > Microorganismos, p.ej. protozoos; Composiciones que... > C12N1/20 (Bacterias; Sus medios de cultivo)
  • SECCION C — QUIMICA; METALURGIA > BIOQUIMICA; CERVEZA; BEBIDAS ALCOHOLICAS; VINO; VINAGRE;... > SISTEMA DE INDEXACION ASOCIADO A LAS SUBCLASES C12C... > Microorganismos > C12R1/25 (Lactobacillus plantarum)
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > CIENCIAS MEDICAS O VETERINARIAS; HIGIENE > PREPARACIONES DE USO MEDICO, DENTAL O PARA EL ASEO... > Preparaciones medicinales que contienen sustancias... > A61K35/74 (Bacterias (uso terapéutico de una proteína de la bacteria A61K 38/00))
  • SECCION A — NECESIDADES CORRIENTES DE LA VIDA > ALIMENTOS O PRODUCTOS ALIMENTICIOS; SU TRATAMIENTO,... > ALIMENTOS, PRODUCTOS ALIMENTICIOS O BEBIDAS NO ALCOHOLICAS... > Alimentos o productos alimenticios; Su preparación... > A23L1/30 (que contienen aditivos (A23L 1/308 tiene prioridad))
google+ twitter facebookPin it
Ilustración 1 de Cepas de Lactobacillus plantarum como probióticos con efecto inmunomodulador especifico.
Ilustración 2 de Cepas de Lactobacillus plantarum como probióticos con efecto inmunomodulador especifico.
Ilustración 3 de Cepas de Lactobacillus plantarum como probióticos con efecto inmunomodulador especifico.
Ilustración 4 de Cepas de Lactobacillus plantarum como probióticos con efecto inmunomodulador especifico.
Ilustración 5 de Cepas de Lactobacillus plantarum como probióticos con efecto inmunomodulador especifico.
Cepas de Lactobacillus plantarum como probióticos con efecto inmunomodulador especifico.

Texto extraído del PDF original:

DESCRIPCIÓN

Cepas de Lactobacillus plantarum como probióticos con efecto inmunomodulador específico La presente invención se refiere a los campos de la medicina, microbiología y tecnología de alimentos y, particularmente, a nuevas cepas de Lactobacillus plantarum para uso como probióticos para beneficiar la salud humana.

Estado de la técnica

Ciertas deficiencias en el funcionamiento del sistema inmunitario pueden ser consecuencia de edad avanzada, estrés, enfermedades infecciosas (por ejemplo, síndrome de inmunodeficiencia adquirida) y malnutrición. En muchos países occidentales, los ancianos representan una proporción de la población cada vez mayor y para la que el gasto sanitario es desproporcionadamente elevado. Muchos de los problemas sanitarios con los que se enfrentan los ancianos están representados por un mayor riesgo de morbilidad dependiente de la edad, debido a una mayor susceptibilidad a enfermedades infecciosas y no infecciosas. Se sabe que el sistema de defensa inmunitario en particular es afectado adversamente por el proceso de envejecimiento, y existen pruebas sólidas de que un sistema inmunitario que funciona deficientemente puede contribuir a una menor resistencia a las enfermedades y a una reducción de la esperanza de vida de los ancianos. La inmunosenescencia se caracteriza particularmente por una función sub-óptima del sistema inmunitario celular. En la mayoría de los cambios relacionados con la edad bien caracterizados están implicados los linfocitos tímicos (T), incluyendo una disminución en el número de los linfocitos T CD3+ maduros en la circulación periférica, una disminución en el conjunto de linfocitos T vírgenes (CD45RA+), una predisposición a la expresión del fenotipo de linfocitos T adyuvantes de tipo 2 y una baja capacidad de los linfocitos T de sangre periférica de proliferar y secretar interleuquina 2 o contribuir a repuestas eficaces in vivo de hipersensibilidad de tipo retardado. La inmunosenescencia también puede ser expresada por cambios en la función o en las proporciones de leucocitos que contribuyen a la inmunidad innata, tales como fagocitos y linfocitos asesinos naturales (NK). Hasta el 70% de sujetos mayores de 70 años tienen bajas respuestas de citotoxicidad mediadas por linfocitos NK contra células tumorales K562 en comparación con el 40% de los adultos jóvenes. Una disminución en la función innata de los linfocitos inmunitarios se considera generalmente un factor que contribuye a la disminución de la inmunidad en los ancianos. Además, debido a que tanto los linfocitos NK como los fagocitos (particularmente monocitos) secretan muchas citoquinas inmunorreguladoras, su función potencialmente disminuida en los individuos ancianos puede tener efectos importantes posteriores sobre episodios inmunitarios en el sistema inmunitario integrado, tales como activación y diferenciación de linfocitos (véase H.S. Gill et al., “Dietary probiotic

supplementation enhances natural killer cell activity in the elderly: an investigation of age-related immunological changes”, Journal of Clinical Immunology 2001, vol. 21, pp. 264-271). Por consiguiente, son muy deseables intervenciones que puedan combatir la inmunosenescencia restaurando la función inmunitaria celular.

Los hallazgos de que estas deficiencias inmunológicas podrían solucionarse modulando el sistema inmunitario han estimulado una búsqueda de agentes y/o productos naturales y químicos con propiedades inmunomoduladoras.

Desafortunadamente, el uso de muchos productos inmunoestimuladores disponibles actualmente está asociado con efectos secundarios perjudiciales (véase A.K. Nussler and A.W. Thomson, “Immunomodulatory agents in the laboratory and clinicParasitology 1992, vol. 105, S5-S23). El desarrollo de productos alimentarios naturales con propiedades inmunopotenciadoras, que estén exentos de efectos secundarios, proporcionaría por tanto un efecto beneficioso significativo a grupos de población con la función inmunitaria deteriorada. Por lo tanto, un medio atractivo de restaurar la función inmunitaria es la intervención en la dieta. Investigaciones previas en ancianos demostraron que el suplemento de la dieta con micronutrientes (por ejemplo, vitaminas A, C y E; -caroteno) mejoraba algunos aspectos de la inmunidad celular, incluyendo la proporción de subseries de linfocitos T circulantes y la actividad in vitro de linfocitos NK de la sangre. Otro régimen dietético que podría proporcionar un efecto beneficioso a los ancianos es el suplemento probiótico con cepas inmunoestimuladoras de bacterias de ácido láctico (LAB).

Los probióticos son microorganismos no patógenos vivos que se encuentran normalmente en el tracto gastrointestinal y que, cuando se administran en cantidades adecuadas, ejercen efectos beneficiosos sobre la salud. Las condiciones específicas para las que se usan los probióticos incluyen aumento de la resistencia a infecciones, prevención y tratamiento de diarrea asociada con antibióticos y otras enfermedades diarreicas, profilaxis de infecciones del tracto genitourinario, aumento de la función inmunitaria, disminución de los niveles del colesterol y lípidos, aumento de la resistencia a la colonización por microbiota perjudicial y diversos trastornos inmunitarios incluyendo dermatitis atópica y alergias alimentarías. Se ha demostrado que ciertas cepas de bacterias de ácido láctico bien definidas son potentes potenciadores de la inmunidad y ofrecen efectos clínicos beneficiosos a grupos definidos. Por ejemplo, la cepa GG de Lactobacillus rhamnosus se ha usado satisfactoriamente como inmunomodulador dietético en asistencia pediátrica. Por el contrario, sin embargo, no está bien establecida la capacidad de ciertas cepas definidas de bacterias probióticas de ácido láctico para modular la inmunidad en ancianos (H. Gill et al., “Enhancement of immunity in the elderly by dietary supplementation with the probiotic Bifidobacterium lactis HN019”, Am. J. Clin. Nutr. 2001, vol. 74, pp. 833-9).

Estos hallazgos han activado el interés en encontrar nuevas cepas de lactobacilos y bifidobacterias que sean capaces de mejorar la inmunidad. Por lo tanto, es deseable proporcionar nuevos agentes con propiedades probióticas para mejorar la salud, incluyendo la salud geriátrica.

Sumario de la invención

Los inventores proporcionan dos nuevas cepas de Lactobacillus plantarum adecuadas como probióticos como resultado de estudios exhaustivos de diferentes cepas bacterianas aisladas de heces y saliva de seres humanos alimentados con una dieta vegetal. Las cepas de la invención se depositaron con fecha 18-09-2007 en la Colección Española de Cultivos Tipo (CECT) con los números de acceso CECT 7315 y 7316.

Las cepas CECT 7315 y 7316 fueron las procedentes de muestras de heces que crecieron en un medio MRS complementado con HCl al 0,05% p/v, 100 g/L de novobiocina (Sigma), 5 g/mL de nistatina, 5 g/mL de ciclohexamida (Sigma), 1 mg/L de ampicilina y 10 g/mL de vancomicina, y se incubaron a 30ºC en condiciones anaerobias y a pH 6,4. La tinción de Gram mostró una clara tinción Gram+, así como morfología de bacilos, sin formación de esporas.

Existe una diversidad de cepas de Lactobacillus plantarum en estudio y comercializadas actualmente como probióticos (véase, M.C. de Vries et al., “Lactobacillus plantarum-survival, functional and potencial probiotic properties in the human intestinal tract”, International Dairy Journal 2006, vol. 16, Pp. 1018-1028). Sin embargo, es importante indicar que existe una gran variación en la capacidad de mejorar la función inmunitaria y hasta la fecha solamente se han identificado unas cuantas cepas con efectos potenciadores de la inmunidad bien establecidos. Se ha encontrado que la presencia de propiedades inmunomoduladoras de probióticos y el patrón de inmunomodulación dependen de la especie bacteriana implicada, la cepa individual, el uso de bacterias viables o muertas y la dosis de bacterias.

Como se ilustra más adelante, los resultados de un estudio clínico con seres humanos ancianos sanos demuestra que el suplemento con las dos cepas de la invención es eficaz para potenciar tanto la inmunidad natural como la adquirida en los seres humanos.

Particularmente, los linfocitos CD4+ y CD8+ mostraron un aumento significativo en la actividad como se indica por la expresión de CD25. Los linfocitos B (CD19+) y las linfocitos asesinos naturales (CD59+) mostraron un aumento significativo en número y se estimularon también las células presentadoras de antígenos (HLA-DR+). Además se observó una disminución significativa en la liberación de citoquinas proinflamatorias (TGF-). Este resultado, junto con la recuperación de la inmunidad celular, puede indicar que la regulación inmunitaria se desplaza desde una inmunidad no específica (citoquinas) hacia una inmunidad más específica (celular). Además, las cepas han demostrado que son particularmente útiles como probióticos en la industria alimentaría. Se ha demostrado que las cepas: - tienen una eficacia de crecimiento adecuada para ser producidas a escala industrial y ser económicamente viables; - son capaces de fermentar leche para formar yogur y ninguna presenta olores desagradables; - sobreviven en las condiciones del medio gastrointestinal de los mamíferos (lisozima, medio ácido, sales biliares y peróxido de oxígeno); - se adhieren al epitelio intestinal, lo que permite que las cepas permanezcan al menos de forma transitoria en el tracto intestinal y ejerzan sus efectos probióticos; muestran una mejor capacidad de adhesión en comparación otras cepas comerciales; - no tienen efectos negativos sobre el comportamiento y el bienestar de los animales en un estudio de toxicidad aguda realizado con ratas; - son seguras ya que no conducen a un aumento en la translocación de bacterias lácticas ni facilitan la translocación enterobacteriana; - son beneficiosas para el equilibrio de la microbiota intestinal debido a su capacidad de inhibir el crecimiento de cepas patógenas; y - secretan uno o más factores solubles responsable de la actividad antibacteriana.

De esta forma, en un aspecto, la presente invención se refiere a una cepa de Lactobacillus plantarum depositada en la Colección Española de Cultivos Tipo (CECT) con el número de acceso CECT 7315.

En un segundo aspecto, la presente invención se refiere a una cepa de Lactobacillus plantarum depositada en la Colección Española de Cultivos Tipo (CECT) con el número de acceso CECT 7316.

En un tercer aspecto, la presente invención se refiere a un cultivo bacteriano que comprende la cepa 7315 o la cepa 7316 o una de sus mezclas.

Como se ilustra más adelante de una forma no restringida, se ha encontrado que las cepas de Lactobacillus plantarum de la presente invención son útiles en la industria alimentaría y, en particular, como probióticos.

Por tanto, en un cuarto aspecto, la presente invención se refiere a un producto que comprende una cantidad eficaz de la cepa 7315 o de la cepa 7316 o de una de sus mezclas.

En un quinto aspecto, la presente invención se refiere a un producto comestible que comprende una cantidad nutricionalmente eficaz de la cepa 7315 o de la cepa 7316 o de una de sus mezclas, junto con cantidades apropiadas de otros ingredientes comestibles.

En un sexto aspecto, la presente invención se refiere a una composición farmacéutica que comprende una cantidad terapéuticamente eficaz de la cepa 7315 o de la cepa 7316 o de una de sus mezclas, junto con cantidades apropiadas de excipientes y/o vehículos farmacéuticos aceptables.

En un séptimo aspecto, la presente invención se refiere al uso de las cepas de la invención o una de sus mezclas para la fabricación de un producto comestible.

En un octavo aspecto, la presente invención se refiere al uso de las cepas de la invención o una de sus mezclas para la fabricación de un medicamento para potenciar el sistema inmunitario de un animal, incluyendo un ser humano. La invención puede formularse alternativamente como un método para potenciar el sistema inmunitario de un animal incluyendo un ser humano, que comprende administrar a dicho animal que lo necesite una cantidad eficaz de la cepa 7315 o de la cepa 7316 o de una de sus mezclas. El uso de las cepas de la invención puede ser beneficioso en el sentido de que pueden ser usadas profilácticamente en un individuo normal sano, para prevenir el comienzo de un estado inmunitario que funciona deficientemente o antes de que se haya desarrollado una enfermedad. La administración de las cepas de la invención también puede ser beneficiosa en el tratamiento terapéutico de estados que presenten una desregulación del sistema inmunitario (por ejemplo, inmunosenescencia) algunas veces asociada con una enfermedad. Las cepas pueden administrarse como un tratamiento o como complemento de otro tratamiento.

En un noveno aspecto, la presente invención se refiere a un proceso para la preparación de un producto comestible, que comprende cultivar la cepa 7315 o la cepa 7316 o una de sus mezclas, en un medio adecuado (por ejemplo, leche, proteína de suero, medio técnico). Las bacterias pueden añadirse a un producto alimentario durante su proceso de fabricación, o a un producto terminado. Podrían añadirse cantidades apropiadas de otros ingredientes comestibles.

Estos y otros objetos de la presente invención se describirán adicionalmente en el apartado de la descripción detallada que se proporciona a continuación y no pretenden limitar la presente invención. A menos que se definan de otra manera, todos los términos técnicos y científicos usados en esta memoria tienen el mismo significado que entienden comúnmente los expertos en la técnica a la que pertenece esta invención. En la práctica de la presente invención pueden usarse métodos y materiales similares o equivalentes a los descritos en esta memoria. A lo largo de la descripción y las reivindicaciones, la palabra “comprende” y sus variaciones no pretenden excluir otras características técnicas, aditivos, componentes o etapas. Otros objetos, ventajas y características de la invención serán evidentes para los expertos en la técnica tras el examen de la descripción o pueden aprenderse por la práctica de la invención.

Breve descripción de los dibujos

La FIG. 1 muestra las curvas de crecimiento de F35 (FIG. 1A) y F47 (FIG. 1B). Se representa el log de ufc/mL frente a T (tiempo, en horas).

La FIG. 2 muestra la clasificación filogenética de las cepas F35 y F47 basándose en su secuencia de 16S, con respecto a las cepas de Lactobacillus más caracterizadas genéticamente.

La FIG. 3 muestra los patrones de macro-restricción genómica con enzimas Sfi-I (superior) y Sma-I (inferior). M, marcador; 1: 299v; 2. F35; 3; F47. (*) significa bandas que son diferentes entre patrones.

La FIG. 4 muestra el porcentaje de adhesión de las cepas F35 y F47 frente a dos cepas comerciales de Lactobacillus reuteri y Lactobacillus rhamnosus.

La FIG. 5 muestra los resultados de la regulación del tránsito intestinal en el estudio clínico. La parte oscura del gráfico corresponde a los individuos con 0-3,5 defecaciones/semana y la parte sin color con 3,5-7 defecaciones/semana. S significa semana. La FIG. 5A corresponde al grupo de placebo (n = 15). Desde el punto basal hasta 24 semanas no había diferencias estadísticamente significativas. La FIG. 5B corresponde a grupos que recibieron los probióticos, y p<0,05.

Descripción detallada de realizaciones particulares

En los apartados que se presentan a continuación se describe una caracterización detallada de las cepas de la invención, sus propiedades y productos derivados de ellas.

Como se usa en la técnica, el término “probiótico” se refiera a bacterias en el contexto de suplementos dietéticos. Generalmente, el término probiótico se refiere a bacterias o levaduras potencialmente beneficiosas, siendo las bacterias de ácido láctico los microbios más comunes usados. La expresión “cantidad eficaz”, como se usa en esta memoria, significa una cantidad de un ingrediente activo suficientemente elevada para proporcionar el efecto beneficioso deseado, pero suficientemente baja para evitar efectos secundarios graves dentro del alcance del juicio médico. La expresión “farmacéuticamente aceptable”, como se usa en esta memoria, se refiere a compuestos, materiales, composiciones y/o formas de dosificación que, dentro del alcance de un criterio médico razonable, son adecuadas para uso en contacto con los tejidos de un sujeto (por ejemplo, un ser humano) sin que se produzca una toxicidad, irritación, respuesta alérgica excesivas u otro problema o complicación, en relación con una relación beneficio/riesgo razonable. Cada vehículo, excipiente, etc., también debe ser “aceptable” en el sentido de ser compatible con los demás ingredientes de la formulación. Pueden encontrarse vehículos, excipientes, etc.

adecuados en textos farmacéuticos convencionales, por ejemplo, Remington’s Pharmaceutical Sciences, 18th edition, Mack Publishing Company, Easton, Pa., 1990.

El uso de las cepas de la invención es particularmente en forma de células viables. Esto significa la administración de las bacterias vivas que permite que tenga lugar la actividad probiótica en el tracto gastrointestinal del individuo. Sin embargo, como resultado del proceso de preparación (por ejemplo, una fermentación para formar un producto lácteo), el cultivo o parte del cultivo puede estar en forma de células no viables. Como se demuestra más adelante, las cepas de la invención secretan uno o más factores solubles responsables de la actividad antibacteriana.

A este respecto, una realización de la presente invención es un producto que comprende una cantidad eficaz de la cepa 7315 o de la cepa 7316 o de una de sus mezclas. El producto podría estar en una forma adecuada para administración, tal como píldoras, cápsulas, microcápsulas, gránulos, suspensiones, jarabes o polvos liofilizados para ser administrado directamente. Dependiendo de la forma, las cepas pueden estar como una bacteria purificada, como un cultivo bacteriano, como parte de un cultivo bacteriano, como un cultivo bacteriano que se ha tratado posteriormente, y solas o junto con vehículos o ingredientes adecuados. También se pueden añadir prebióticos. Este producto puede administrarse al sujeto como un aditivo.

En otras realizaciones, las cepas de la invención se pueden usar para la preparación de una diversidad de productos comestibles, tales como productos lácteos, un yogur, una cuajada, un queso (por ejemplo, quark, cremoso, procesado, blando y duro), una leche fermentada, una leche en polvo, un producto fermentado a base de leche, un helado, un producto fermentado a base en cereales, un polvo a base leche, una bebida, un aliño y una comida para mascotas. Son ejemplos de otros productos comestibles productos cárnicos (por ejemplo, pasta de hígado, salchichas de Frankfurt y salami o productos de carne para untar), chocolate para untar, rellenos (por ejemplo trufa, crema) y coberturas frías para pastelería, chocolate, dulces (por ejemplo, caramelo, toffe o fondans), artículos horneados (tartas, pasteles), salsas y sopas, zumos de frutas y cremas para café. Sin embargo, la expresión “producto comestible” se usa en esta memoria en su significado más amplio, incluyendo cualquier tipo de producto, en cualquier forma de presentación, que pueda ser ingerido por un animal. Incluye tanto productos listos para comer como productos a los que se añade el producto de la invención como suplemento o como componente constituyente del producto. Son productos comestibles particularmente interesantes suplementos dietéticos y fórmulas para niños. Los suplementos dietéticos pretenden suministrar nutrientes (vitaminas, minerales, ácidos grasos o aminoácidos) que están ausentes o no se consumen en una cantidad suficiente en la dieta de una persona (niños, mujeres embarazadas, ancianos, etc.). También se podrían incluir despojos para piensos.

En una realización particular de la invención, el producto comestible comprende una mezcla de las cepas 7315 y 7316 en una relación 50:50. En estos productos, la cepa o cepas están presentes en una cantidad desde aproximadamente 105 ufc/g hasta aproximadamente 1012 ufc/g y preferiblemente en una cantidad desde aproximadamente 107 ufc/g hasta aproximadamente 1012 ufc/g, de acuerdo con la legislación actual. Para los fines de la presente invención, la abreviatura “ufc” designará una “unidad formadora de colonias” que se define como el número de células bacterianas revelado por recuentos microbiológicos en placas de agar-agar.

Las cepas de la invención se producen cultivando las bacterias en un medio adecuado y en condiciones adecuadas. Las cepas se pueden cultivar solas para formar un cultivo puro, como un cultivo mixto junto con otros microorganismos o cultivando bacterias de diferentes tipos por separado y después combinándolas en las proporciones deseadas. Después del cultivo, se recupera la suspensión celular y se usa como tal o se trata de la manera deseada, por ejemplo, por concentración o liofilización.

La presente invención también proporciona composiciones farmacéuticas que comprenden las cepas de la invención. A este respecto, la composición farmacéutica se puede preparar para ser administrada por vía oral en forma de comprimidos, píldoras, cápsulas, microcápsulas, gránulos, suspensiones, jarabes, polvos liofilizados, preparaciones líquidas etc., estando la cantidad de bacterias que se han de incorporar en dichas composiciones en el intervalo desde aproximadamente 105 ufc/g hasta aproximadamente 1012 ufc/g del producto, y preferiblemente en una cantidad desde aproximadamente 107 ufc/g hasta aproximadamente 1012 ufc/g. Basándose en el objetivo deseado, el experto en la técnica seleccionará los excipientes y/o vehículos apropiados. En una realización particular de la invención, la composición farmacéutica comprende una mezcla de las cepas 7315 y 7316 en una relación 50:50. Aunque se prefiere la administración oral, son posibles otras formas, tales como inyectables, rectales o tópicas.

En general, las composiciones pueden comprender las cepas de la invención como agentes probióticos individuales, combinaciones de dichos probióticos o combinaciones con otros agentes terapéuticos/nutracéuticos dependiendo del estado.

Los siguientes apartados describen la caracterización de las cepas de la invención, sus características probióticas específicas y sus efectos fisiológicos sobre los sistemas gastrointestinal e inmunitario. Como se usa más adelante, la cepa F35 corresponde a Lactobacillus plantarum CECT 7315 y la cepa F47 a L. plantarum CECT 7316.

1. Aislamiento de microorganismos

Las fuentes de microorganismos fueron torundas y heces de niños con edades de 0 a 5 años. Las muestras se disolvieron en tampón PBS a pH 7,4, se recogieron partes alícuotas y se cultivaron en diferentes medios para incubación en diferentes condiciones. El tiempo de incubación dependía de la velocidad de crecimiento de la cepa y normalmente era de 24 horas a 7 días. El aislamiento de las cepas individuales se realizó con el mismo medio de selección, y después se realizaron ensayos de tinción de Gram y exámenes microscópicos para su caracterización inicial.

Las cepas seleccionadas F35 y F47 fueron las procedentes de muestras de heces que crecieron en un medio MRS suplementado con HCl al 0,05% p/v, 100 g/L de novobiocina (Sigma), 5 g/mL de nistatina, 5 g/mL de ciclohexamida (Sigma), 1 mg/L de ampicilina, 10 g/mL de vancomicina y se incubaron a 30ºC en condiciones anaerobias y a un pH de 6,4. La tinción de Gram demostró una clara tinción Gram+, así como morfología de bacilos, sin formación de esporas. Después, las cepas aisladas y cultivadas se conservaron por liofilización.

2. Parámetros de crecimiento y producción de biomasa.

Se evaluaron la eficacia de crecimiento, la producción de compuestos de azufre volátiles (VSC), la producción de ácidos grasos de cadena corta (SCFA) y la viabilidad económica global de las cepas.

Las cepas seleccionadas se incubaron en las condiciones de selección iniciales. Se controló la densidad de unidades formadoras de colonias (ufc/mL) hasta la saturación y se comparó con patrones de McFarland (Biomerieux) usando un espectrofotómetro (Cecil CE 303). Se tomaron muestras a intervalos de 60 minutos y se sembraron 100 L de cultivo (x2) sobre placas de MRS o TSA en cada punto de tiempo. También se evaluaron el rendimiento, la velocidad de crecimiento, el peso seco y el consumo de nutrientes en cada punto de tiempo. El rendimiento se calculó de acuerdo con la ecuación y = (Xt - X0)/(St - S0) donde y es rendimiento, X0 es la concentración inicial, Xt es la concentración en cada punto de tiempo, S0 es la concentración inicial de nutrientes y St es la concentración de nutrientes en cada punto de tiempo.

La velocidad de crecimiento se calculó de acuerdo con la siguiente ecuación  = máx * (S/KS+ S) donde la constante de saturación es KS = 697 mg/mL y máx = 0,46 h-1.

Para calcular el peso seco, se centrifugó 1 mL de cultivo a 10000 rpm durante 5 minutos, se desechó el líquido sobrenadante, se secó al aire a 25ºC durante 72 horas y se pesó en una balanza de precisión. El consumo de nutrientes se evaluó por colorimetría indirecta. Por liberación de calorías se analizó el contenido de azúcares en los líquidos sobrenadantes obtenidos por centrifugación de muestras de medio de cultivo a 10000 rpm durante 5 minutos.

Como se muestra en la FIG. 1, las cepas tienen una eficacia de crecimiento adecuada para ser producidas industrialmente y son económicamente viables (es decir, tienen un tiempo de producción mínimo y un rendimiento máximo). El valor de máx fue 0,4425 h-1 tanto para la cepa F35 como para la cepa F47.

3. Ensayo de fermentación de leche.

El objetivo de este ensayo fue determinar si F35 y F47 podían fermentar leche y si producían sustancias de olor desagradable (VSC o SCFA). Se pasteurizó un litro de leche desnatada no enriquecida y en partes alícuotas de 100 mL se inocularon 108 ufc de cada cepa individual F35 y F47, y se incubaron a 37ºC durante 24 horas (x3). Después se estimaron la coagulación y el olor a simple vista y por medio del olfato. Los resultados demostraron que las dos cepas pueden fermentar leche para formar yogur y ninguna presentaba olores desagradables.

Se vigiló el pH durante la fermentación dando como resultado una disminución hasta un valor pH de 5,8 para F35 y de 5,4 para F47 en la fase estacionaria. Esto se debe al efecto tampón producido por la leche y la producción de biomasa.

4. Caracterización taxonómica de las cepas

Se recogieron bacterias de cepas seleccionadas, se lavaron y se pre-trataron con tampón de pre-lisis (480 L de EDTA 50 mM, pH 8,0; 120 L de lisozima a 10 mg/mL) por nueva puesta en suspensión e incubación a 37ºC durante 60 minutos. El ADN se extrajo usando un kit de purificación de ADN genómico Wizard (Promega). Después de centrifugación de las bacterias pre-tratadas a 14000 g durante 2 minutos para retirar el líquido sobrenadante, se siguió el protocolo de Promega. En resumen, las bacterias se volvieron a poner en suspensión en solución de lisis de núcleos y se incubaron a 80ºC durante 5 minutos y después se enfriaron hasta la temperatura ambiente. Se incubaron lisados celulares en solución de RNasa a 37ºC durante 60 minutos y se precipitaron proteínas añadiendo la solución de precipitación de proteínas y agitando con vórtice a alta velocidad. Las muestras se enfriaron y centrifugaron a 15000 g durante 3 minutos. Los líquidos sobrenadantes que contenían el ADN se transfirieron a tubos de microcentrífuga limpios de 1,5 mL y se mezclaron con 600 L de isopropanol por inversión. El ADN se recogió por centrifugación a 15000 g durante 2 minutos y el líquido sobrenadante se separó cuidadosamente por vertido. Se lavaron muestras de ADN con 600 L de etanol al 70% invirtiendo suavemente el tubo varias veces. El etanol se retiró por aspiración, después de una centrifugación a 15000 g durante 2 minutos. Finalmente, el sedimento de ADN se volvió a poner suspensión en 100 l de solución de rehidratación incubando a 65ºC durante 1 hora. Las muestras se conservaron a 2-8ºC.

4.1 Identificación genética de género y especie

El ARNr de 16S se amplificó por PCR usando los cebadores universales Eub27f y Eub1492r, que producen un fragmento de secuencia casi completa de 16S (más de 1000 nucleótidos) (TABLA 1). Después, el ADN obtenido se lavó usando el kit Quiaquick (Quiagene).

TABLA 1. Cebadores usados para amplificar y secuenciar el gen de 16S.

Etapa Cebador Orientación Secuencia 5’ → 3’ Eub27f directa GAGTTTGATCCTGGCTCAG (SEQ ID NO: 1) Amplificación Eub1492r inversa TACGGYTACCTTGTTACGACTT (SEQ ID NO: 2) 27f directa AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 3) 357f directa CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCC Secuenciación GCCCCCCTACGGGAGGCAGCAG (SEQ ID NO: 4) 907r inversa CCGTCAATTCCTTTGAGTTT (SEQ ID NO: 5) 1492r inversa GGTTACCTTGTTACGACTT (SEQ ID NO: 6) Se realizaron cuatro reacciones de secuenciación consecutivas para cada muestra en un Genetic Analyzer 3130 (Applied Biosystems) usando el kit BigDye v.3.1, usando los cebadores mostrados en la TABLA 1. La recogida de los datos y los cromatogramas se construyeron usando el programa informatico DNA Sequence Analysis v.5.2 (Applied Biosystems) y se comprobaron por análisis visual con Chromas (Technelysium Pty Ltd.) y BioEdit (Ibis Biosciences).

La identificación del género se realizó usando la herramienta Ribosomal Database Project (RDP) (Q. Wang et al., “Naive Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy”, Appl. Environ. Microbiol. 2007, vol. 73, pp. 5261-7). La identificación de las especies se realizó por comparación de la secuencia obtenida con secuencias de 16S de organismos conocidos de ambas base de datos RefSeq (http://www.ncbi.nlm.nih.gov/RefSeq/) por medio de un BLASTN, y de Ribosomal Database Project (http://rdp.cme.msu. edu/, J.R. Cole et al, “The Ribosomal Database Project (RDP-II): introducing myRDP space and quality control ed public data” Nucl. Acids Res. 2007, vol. 35, pp. 169-72).

La herramienta RDP identificó que ambas cepas F35 y F47 pertenecían al género Lactobacillus. Los resultados demostraron que F35 y F47 presentan una identidad del 98% y del 99%, respectivamente, con 16S de la cepa WCFS1 de L. plantarum (FIG. 2).

4.2. Genotipificación de cepas

La caracterización se realizó por digestión genómica y electroforesis en gel con campo pulsado. Las cepas F35 y F47 se sometieron a un protocolo descrito previamente (A.M. Rodas et al., “Polyphasic study of wine Lactobacillus

Strains: taxonomic implications”, Int. J. Syst. Evol. Microbiol. 2005, vol. 55, pp., 197-207). Las cepas se cultivaron en placas de agar-agar con MRS y se incubaron a 37ºC con 5% de CO2 durante 18 horas. Después se recogieron y lavaron 3 veces en 8 mL de PET (Tris 10 mM, pH 7,6, NaCl 1 M) y después se centrifugaron a 6000 rpm durante 10 minutos. Los sedimentos se volvieron a poner en suspensión en 700 L de tampón de lisis (Tris 6 mM, NaCl 1 M, EDTA 0,1 M, SLS al 0,5%, ácido desoxicólico al 0,2%; 1 mg/mL de lisozima; 40 U/mL de mutanolisina; 20 g/mL de RNasa). A las células puestas de nuevo en suspensión se les añadió un volumen igual de agarosa de bajo punto de fusión al 1,6% (FMC BioProducts, Rockland, ME, USA) y se permitió la solidificación a 4ºC durante 1 hora. Se transfirieron insertos a 2 mL de tampón de lisis II (EDTA 0,5 M, pH 9,2, N-lauril-sarcosina al 1% y 1 mg/mL de pronasa) y se incubaron a 50ºC durante 48 horas. Después, los insertos se lavaron a temperatura ambiente con tampón TE (Tris 10 mM, EDTA 1 mM pH 8,0). La digestión del ADN total fue realizada por las enzimas de restricción Sfi-I y Sma-I (Roche Diagnostics).

Se realizó una electroforesis de campo pulsado usando el aparato CHEF DRIII (BioRad Laboratories). Se cargaron insertos en un gel de agarosa al 1% (agarosa SeaKem ME, FMC BioProducts, ME, USA). La TABLA 2 describe las condiciones de electroforesis para cada enzima. Los marcadores de PM de ADN fueron el marcador Lambda ladder PFG y el marcador Low Range PFG (New England Biolabs). Después de la electroforesis, los geles se tiñeron con bromuro de etidio y UV usando el sistema GelDoc (BioRad).

TABLA 2. Condiciones de electroforesis para este estudio Enzima Bloque Pulso inicial (segundos) Pulso final (segundos) Tiempo (horas) Sfi-I 1 2 2 6 Sma-I 1 0,5 16 Los resultados obtenidos con las dos enzimas Sfi-I y Sma-I fueron similares. Como se muestra en la FIG. 3, el patrón obtenido para la cepa L. plantarum 299v es muy diferente de los patrones mostrados por las cepas F35 y F47. Estos patrones difieren en la posición de una banda en el caso de Sfi-I (figura superior), mientras que con la enzima Sma-I (figura inferior) la cepa F47 muestra una banda adicional. En la bibliografía se ha descrito que a diferencia de otros Lactobacillus, la especie L. plantarum presenta una alta heterogeneidad genética (I. Sánchez et al., “Polyphasic study of the genetic diversity of lactobacilli associated with ‘Almagro’ eggplants spontaneous fermentation, based on combined numerical analysis of randomly amplified polymorphic DNA and pulsed-field gel electrophoresis patterns”

Journal of Applied Microbiology 2004, vol. 97, pp. 446-58). Las cepas F35 y F47 parecen estar muy relacionadas genéticamente, de forma que pueden proceder del mismo origen clónico (F.C. Tenover et al., “Interpreting chromosomal DNA restrictions patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing” J. Clin. Microbiol. 1995, vol. 33, pp. 2233-9).

5. Resistencia al medio gastrointestinal

Para evaluar la resistencia de las cepas F35 y F47 a las condiciones del medio gastrointestinal de los mamíferos, se realizaron ensayos específicos para cuantificar la supervivencia después del tratamiento con lisozima, medio ácido, sales biliares y peróxido de oxígeno.

5.1. Tolerancia a lisozima: En una placa de 96 pocillos se pusieron partes alícuotas de 20 L de cada cultivo de cepa bacteriana, y después se añadieron 200 L de lisozima (Sigma) a 100, 200 o 300 g/mL en medio MRS. Las placas se incubaron a 37ºC, con 5% de CO2 durante 1 hora. El crecimiento bacteriano se cuantificó midiendo la densidad óptica a 620 nm en un lector de ELISA. Los resultados se expresan frente al control, que es el crecimiento máximo de cada una de las cepas en un caldo MRS (TABLA 3).

TABLA 3 Lisozima (g/mL) Valor medio Valor medio C+ Desviación típica Desviación típica C+ F35 100 0,35 0,25 0,02 0,02 200 0,32 0,24 0,01 0,01 300 0,38 0,28 0,01 0,02 F47 100 0,16 0,20 0,01 0,01 200 0,18 0,21 0,01 0,01 300 0,19 0,20 0,02 0,02

5.2. Tolerancia a medio ácido: En una placa de 96 pocillos se pusieron partes alícuotas de 20 l de cada cultivo de cepa, y después se pusieron sobre pocillos que contenían bacterias partes alícuotas de 200 l de medio TBS o MRS ajustado al valor de pH deseado con HCl (Panreac). Después, las placas se mantuvieron a 42ºC durante 2 horas y se leyeron en un espectrofotómetro a 620 nm. Los resultados se expresan frente al control, que es el crecimiento máximo de cada una de las cepas en un caldo MRS (TABLA 4).

TABLA 4 pH Valor medio Valor medio C+ Desviación típica Desviación típica C+ F35 2 0,1976 0,428 0,02 0,018 2,5 0,2547 0,277 0,022 0,031 3 0,2498 0,366 0,019 0,018 3,5 0,2494 0,472 0,017 0,015 4 0,263 0,404 0,019 0,017 4,5 0,285 0,345 0,02 0,025 0,2783 0,266 0,0278 0,026 5,5 0,18 0,173 0,017 0,021 6 0,3465 0,355 0,0201 0,018 F47 2 0,1392 0,2324 0,019 0,017 2,5 0,2748 0,3506 0,025 0,024 3 0,205 0,27 0,017 0,016 3,5 0,157 0,207 0,026 0,024 4 0,1963 0,2406 0,011 0,015 4,5 0,2477 0,286 0,09 0,05 0,31 0,373 0,017 0,016 5,5 0,308 0,337 0,015 0,014 6 0,2929 0,282 0,017 0,014

5.3. Tolerancia a sales biliares: En una placa de 96 pocillos se pusieron partes alícuotas de 20 L de cultivo de cada cepa bacteriana. A los pocillos se añadieron 200 L de dilución de sales biliares. Se ensayaron cuatro condiciones y tres concentraciones diferentes (0,3%; 0,5% y 1%, en p/v, pH 3 y 0,3% p/v, pH no ajustado). Las placas se mantuvieron a 37ºC, con 5% de CO2 durante 3 horas y se leyeron a 620 nm (TABLA 5).

TABLA 5 Sales biliares -pH Valor medio Valor medio C+ Desviación típica Desviación típica C+ F35 0,3% sin pH 0,217 0,4001 0,017 0,015 0,3% pH 2 0,2214 0,4009 0,018 0,017 0,5% pH 3 0,3154 0,4099 0,02 0,019 1% pH 3 0,2997 0,4099 0,022 0,025 F47 0,3% sin pH 0,525 0,41 0,02 0,017 0,3% pH 2 0,7728 0,419 0,017 0,022 0,5% pH 3 0,7224 0,42 0,019 0,025 1% pH 3 0,756 0,4194 0,022 0,026

5.4. Tolerancia a peróxido de oxígeno: En una placa de 96 pocillos se pusieron partes alícuotas de 20 L de cultivo de cada cepa. A los pocillos se añadieron 200 L de diluciones de H2O2 (0,8823, 0,5882, 0,2941 mM) y las placas se incubaron 30 minutos a 37ºC y después se leyeron a 620 nm (TABLA 6).

TABLA 6 Dilución de H2O2 Valor medio Valor medio C+ Desviación típica Desviación típica C+ (mM) F35 0,8823 0,32 0,3021 0,016 0,014 0,5882 0,332 0,3024 0,018 0,018 0,2941 0,311 0,301 0,016 0,015 F47 0,8823 0,272 0,31 0,022 0,02 0,5882 0,3424 0,32 0,016 0,018 0,2941 0,286 0,33 0,021 0,023 Un resultado de más de 40% de crecimiento con respecto al control se considera positivo. Considerando agentes en la boca que tienen una actividad bactericida (peróxido de oxígeno y lisozima), no se observó ninguna falta de viabilidad de estas cepas, incluso en concentraciones de los agentes bactericidas mayores que las condiciones fisiológicas (0,8823 mM/mL de lisozima y 10 g/mL de peróxido de oxígeno). Con respecto a los parámetros del estómago (pH), sólo hubo una falta de viabilidad del 5% a pH 2 (condiciones muy estrictas, no fisiológicas). No hubo falta de viabilidad en el ensayo con sales biliares, incluso en el momento del vaciado del estómago cuando la capacidad detergente de las sales biliares se combina con un pH ácido.

6. Adhesión al intestino

Se obtuvo moco lavando un intestino con PBS a pH 7,4, gelatina al 0,01% e inhibidor de proteasas (Complete®, Sigma). Se raspó la mucosa y se depositó en un recipiente con tampón HEPES 10 mM-sal de Hank a pH 7,4 y los mismos inhibidores. El moco se lavó después por centrifugación a 13000 rpm durante 10 minutos con el mismo tampón. Se recuperaron los líquidos sobrenadantes y el contenido de moco se evaluó por el protocolo de Bradford.

Las capacidades de adhesión de F35 y F47 se compararon con la adhesión de dos cepas comerciales. Se pusieron inóculos de 150 L de cultivos de una noche de cultivos axénicos de cada uno de los microorganismos en medio MRS complementado con timidina marcada con tritio (5 L en 3 mL de MRS) y se contó la concentración de microorganismos en una cámara Neubauer. Las preparaciones se centrifugaron después y los sedimentos se volvieron a poner en suspensión en PBS para obtener las ufc/mL deseadas. La señal de tritio incorporada en los microorganismos se calcula a partir de la señal de tritio inicial (los L de timina marcada con tritio añadidos al medio) y la señal del líquido sobrenadante. A partir de las ufc totales del cultivo, la relación entre este número (señal incorporada en la biomasa) y el número total de microorganismos en el cultivo da como resultado el valor de desintegraciones por minuto/ufc (dpm/ufc) (señal/bacteria).

Para realizar el ensayo se consideró que el moco no tenía puntos ilimitados para la adhesión de microorganismos y que en una zona limitada, tal como un pocillo de una placa, la adición de una concentración inadecuada de ufc puede dar como resultado una super- o infra-evaluación de la capacidad de unión. De esta manera, en un pre- ensayo, se evaluó el porcentaje de adhesión de diferentes concentraciones para encontrar la concentración adecuada que se ha de usar en el ensayo. Se observó una disminución en el porcentaje de adhesión desde una concentración de 1x108 ufc/mL, de forma que para el ensayo se eligió esta concentración.

24 horas antes del ensayo, se incubó en pocillos de una placa para ELISA 1 mL de la solución de moco de 0,5 mg/mL. Después se añadieron a los pocillos las preparaciones de microorganismos y, después de una incubación durante 60 minutos a 37ºC, se retiraron los líquidos sobrenadantes de cada pocillo, se lavaron los pocillos con medio MEM Alfa (Gibco) y se rasparon para despegar los moco-microorganismos de los pocillos. El % de adhesión se calcula contando la señal de tritio en un lector de centelleo de la preparación de moco en el pocillo y el valor de dpm/ufc como se ha obtenido anteriormente. El resultado es el número de bacterias adheridas por unidad de área de moco. La FIG. 4 muestra que 3,06 x 106 y 3,25 x 106 ufc de las cepas F35 y F47, respectivamente se pueden unir a 2 cm2 de moco intestinal. En comparación con otras cepas comerciales, F35 y F47 mostraron doble capacidad de adhesión.

7. Ensayos de toxicidad

Se administraron las cepas F35 y F47 a 5 x 1010 ufc/kg en PBS a dieciocho ratas Wistar de 9 semanas (machos y hembras) durante dos días consecutivos a una dosis total de 1011 ufc/kg. Los animales se alimentaron con pienso (Teklacd 2014) y agua ad libitum. La administración se realizó después de comer con el estómago lleno y con ayuda de un tubo orogástrico. Cada dos días se determinaron el comportamiento y el bienestar de los animales asignando valores a los parámetros como se detalla en la TABLA 7. La puntuación total resulta de la suma de los valores obtenidos en cada parámetro: peso + comportamiento + respuesta a estímulos. Durante el estudio no se detectó ningún efecto negativo sobre el comportamiento y bienestar de los animales.

TABLA 7. Evaluación del comportamiento y bienestar de los animales. El valor 0 es normal; un valor de 7 indica una morbilidad intolerable y sacrificio del animal para evitarle un sufrimiento innecesario.

Parámetro Valor Normal Pérdida < 10% 1 Peso Pérdida 10%-20%; posible cambio en heces 2 Pérdida > 20% 3 Normal Piel dañada 1 Comportamiento Piel dañada y secreción ocular 2 Postura anormal 3 Automutilación o manifestaciones de dolor 3 Normal Respuesta a estímulo Agresiva 3 Comatosa 3 Los animales se sacrificaron el día 7 por inhalación de CO2. Se realizó una autopsia completa para encontrar lesiones macroscópicas en los órganos. Se tomaron muestras de los ganglios linfáticos mesentéricos para analizar la translocación bacteriana. Se homogeneizaron aproximadamente 5 mg de cada muestra en 1 mL de PBS con gelatina al 0,01%. Se cultivaron 100 L de este homogeneizado en placas McConkey o placas MRS. Se contaron las colonias después de incubación a 37ºC durante 48 horas. Los resultados se presentan en la TABLA 8. Se observaron unas cuantas colonias lácticas en placas MRS de animales de control o alimentados con F35 o F47. Estos corresponden a una translocación basal normal de bacterias de ácido láctico (J.S. Zhou et al,, “Acute oral toxicity and bacterial translocation studies on potentially probiotic strains of lactic acid bacteria”, Food Chem. Toxicol.

2000, vol. 38, pp. 153-61).

TABLA 8. Translocación bacteriana a los ganglios linfáticos mesentéricos de animales alimentados. Los números indican el número de animales con crecimiento bacteriano positivo y el número máximo de ufc por miligramo de tejido.

Translocación máxima Enterobacterias Bacterias de ácido Grupo Sexo observada [ufc/mg] láctico [ufc/mg] [ufc/mg] Machos 0/3 2/3 2 Control Hembras 0/3 2/3 2 Machos 0/3 1/3 2 F35 Hembras 0/3 2/3 4 Macho 0/3 1/3 4 F47 Hembras 0/3 0/3 En conclusión, los resultados demuestran que la administración oral de las cepas F35 y F47 es segura, puesto que no conduce a un aumento en la translocación de bacterias lácticas ni facilita la translocación enterobacteriana. Todos los animales mostraron una evolución similar en el peso corporal a lo largo del estudio. No se observaron diferencias significativas en el consumo de pienso y agua. No se detectó ningún síntoma clínico ni la alteración del bienestar de los animales. Durante el examen histopatológico no se detectaron lesiones macroscópicas en órganos y cavidades.

8. Propiedades antibacterianas

Para evaluar si las cepas F35 y F47 presentaban actividades antibacterianas, se realizó un protocolo de Campbell usando placas de agar-agar sembradas con patógenos bacterianos en medio Oxoid. Los patógenos usados en este estudio se seleccionaron entre los presentes comúnmente en el tracto gastrointestinal humano (véase la TABLA 9).

Se impregnaron uniformemente las placas y se cultivaron hasta confluencia a las temperaturas apropiadas en una incubadora con 5% de CO2. Después se colocó una sección cilíndrica de una placa de agar-agar con F35 o F47 confluentes sembradas uniformemente sobre la placa con patógeno y se incubó durante una noche a 37ºC.

Al día siguiente se midieron las zonas de inhibición poniendo la placa de agar-agar sobre una regla plana. Después se calculó la actividad inhibidora del crecimiento restando el diámetro del cilindro (DC) del diámetro de la zona de inhibición (DZI) y dividiendo esta diferencia por dos siguiendo la fórmula: inhibición del crecimiento (IC) = (DZI-DC)/2.

TABLA 9. Valores de inhibición del crecimiento de acuerdo con la fórmula representada anteriormente.

F35 F47

Salmonella enterica Enteritidis CECT 4155 1 1

Salmonella enterica Typhimurium CECT 4594 0,5 1

Bacillus subtilis CECT 35 1,5 0,5

Clostridium botulinum CECT 4611 1 0,5

Yersinia enterocolitic NCTC 10460 2 2,5

Listeria monocytogenes CECT 4031 T 0,5 Las cepas F35 y F47 inhibieron el crecimiento de las cepas patógenas mostradas en la TABLA 9. De esta manera, se benefician del equilibrio de la microbiota intestinal debido a su capacidad de inhibir el crecimiento de cepas patógenas.

9. Ensayo de secreción de agentes antibacterianos

Para analizar si era secretado al medio un factor antibacteriano de F35 y F47, se cultivó una mezcla 1:1 de las dos cepas en placas MRS y se incubaron durante 18 horas a 37ºC y con 5% de CO2. Después se recogieron las bacterias y se sedimentaron a 6000 rpm durante 15 minutos. El líquido sobrenadante se filtró por un filtro de 0,22 m (Millipore) y el sedimento se lavó dos veces y se volvió a poner en suspensión en HEPES (Sigma). Se sembraron placas McConkey con cada cepa patógena (Salmonella enterica CETC 4155, Salmonella typhimurium CETC 4594 o Escherichia coli entero-haemorragica (H7:O157, aislado silvestre)) y se perforaron pocillos cilíndricos de 5 mm de diámetro en las placas con una pipeta Pasteur. Los pocillos se rellenaron después con 60 L de cada mezcla puesta de nuevo en suspensión de cepas o líquido sobrenadante y las placas se incubaron a 37ºC durante 24 horas. Al día siguiente, se calculó el diámetro de las zonas de inhibición como se ha indicado anteriormente. Los resultados, mostrados a continuación en la TABLA 10, indican que la inhibición del crecimiento se debe a uno o más factores solubles secretados por estas dos cepas.

TABLA 10. Valores de inhibición del crecimiento para líquido sobrenadante frente a células de las cepas F35 y F47.

Fracción

S. enterica CECT 4155

S. enterica CECT 4594

E. coli EHEC Células enteras 0,0 ± 0,0 0,0 ± 0,0 0,0 ± 0,0 Líquido sobrenadante 2,0 ± 0,0 1,6 ± 0,5 1,4 ± 0,2

10. Inmunomodulación en seres humanos

El objeto de este ensayo clínico fue describir los efectos inmunomoduladores de las cepas F35 y F47 en seres humanos. El estudio era un estudio aleatorio, doble ciego y controlado con placebo. Sesenta individuos sanos con edades de 65 a 70 años elegidos según un criterio de exclusión estricto consistente en: cualquier enfermedad aguda grave en el mes previo al ensayo; cualquier enfermedad neoplásica avanzada; intolerancia a productos lácteos; trastornos para tragar que impiden la ingesta de la preparación del estudio; complementación dietética (vitaminas/oligoelementos) en el mes previo al ensayo; no poder asistir a las citas de monitorización. Se mezclaron cepas de L. plantarum F35 y F45 1:1 antes de la dosificación. Hubo tres grupos: Dosis baja (n=20): 5 x 108 ufc/día en 20 g de leche desnatada en polvo.

Dosis alta (n=20): 5 x 109 ufc/día en 20 g de leche desnatada en polvo.

Placebo (n=20): 20 g de leche desnatada en polvo (placebo/vehículo).

Los individuos recibieron uno de tres tratamientos aleatoriamente durante 12 semanas y se monitorizaron durante 12 semanas más. Cada dosis se empaquetó en un sobre sellado que se había de disolver en 200 mL de agua u otra bebida fría. En las citas de monitorización se recogieron, entre otros los siguientes datos: examen físico; historial clínico (enfermedades crónicas, cirugía, defecaciones/semana); hábitos de automedicación; altura, peso, índice de corporal (Body Mass Index = BMI); cuestionario de calidad de vida (SF-36), análisis de sangre habitual (hemograma, recuento de leucocitos, ensayo de coagulación; glicemia, colesterol, triglicéridos, urea, creatinina, ionograma, bilirrubina, proteína C-reactiva) y ensayos inmunológicos.

Ensayos inmunológicos: Se recogieron los siguientes datos: poblaciones de leucocitos (linfocitos T totales (CD3+), linfocitos T CD4+, linfocitos T CD8+, linfocitos T activados (CD25+), linfocitos B (CD19+), linfocitos NK (CD56+) y APC (HLA-DR+)) y citoquinas: IL-1, IL-10 y TGF-.

Anticuerpos: CD3 anti-humano de ratón conjugado con PECy5, CD25 anti-humano de ratón conjugado con PE, CD8 anti-humano de ratón conjugado con APC, CD4 anti-humano de ratón conjugado con FITC, CD3 anti-humano de ratón conjugado con FITC, CD19 anti-humano de ratón conjugado con APC, CD56/16 anti-humano conjugado con PE, HLA-DR anti-humano de ratón conjugado con PECy5.

Reactivos y kits: Solución tampón FACSlysing (x10) y BDTM CBA Flex Sets: IL-1 humana e IL-10 humana proporcionadas por BD Bioscience (San Diego, CA, USA); ELISA para TGF-1 humano proporcionado por Bionova Científica, S.L. (Madrid, España). Todos los experimentos se realizaron a temperatura ambiente.

Caracterización fenotípica por citometría de flujo: Después de filtrar los anticuerpos marcados con fluorocromos por citometría, se procesaron simultáneamente dos tubos cada uno con 50 L de sangre total: tubo 1 con 2 L de CD25 PEanti-humano, 4 L de CD4 FITC anti-humano, 5 L de CD8 APC anti-humano y 2 L de CD3 PECy5 anti- humano, y tubo 2 con 2 L de CD56/16 PE anti-humano, 2 L de CD3 FITC anti-humano y 2 L de CD19 APC anti- humano. Después de incubación durante 15 minutos en la oscuridad se añadieron 2 mL de solución tampón FACSlysing, y se dejaron 7 minutos en la oscuridad para producir la lisis de los eritrocitos. Después, se centrifugó (1500 rpm, 10 minutos) y los sedimentos se lavaron dos veces con PBS (1500 rpm, 10 minutos). El sedimento se volvió a poner en suspensión con PBS y se analizó por FACScalibur. Los valores obtenidos por citometría expresan el porcentaje de cada marcador fenotípico por cada 10000 células CD3+.

Análisis de IL-10 e IL-1 plasmáticas por citometría de flujo: Se analizó con el Kit Human Soluble Protein Master Buffer (BD Cytometric Bead Array) siguiendo las instrucciones del fabricante. En resumen, se incubaron 50 L de plasma obtenido por procedimientos habituales durante 1 hora con 50 L de una mezcla que contenía perlas recubiertas con anticuerpos anti-IL-10 y perlas recubiertas con anticuerpos anti-IL-1. Después se añadieron durante 2 horas 50 L de una solución que contenía anticuerpos específicos marcados con PE contra otros epítopos de citoquinas. Después, la muestra se lavó y se volvió a poner en suspensión para el análisis por FACScalibur. El análisis citométrico de las citoquinas se basó en la detección de PE junto con el tamaño diferente de cada perla. Los resultados se normalizaron con una curva patrón de IL-10 e IL-1 proporcionada por el fabricante (pg/mL).

Análisis de TGF-1 por ELISA: Se usó un ELISA de tipo sándwich siguiendo las instrucciones del fabricante. En resumen, se diluyó 1:50 plasma procedente de muestras de sangre para después ser acidificado con HCl 1N y neutralizado con NaOH 1N (1 hora). Con este procedimiento se activó el TGF-1. Se prepararon diluciones a partir de 600 pg/mL de TFG-1 para dibujar una curva patrón. Después, se depositaron dos veces 100 L de patrones y de cada muestra en una placa de 96 pocillos y se incubaron durante una noche a 4ºC. Posteriormente se incubaron 100 L de anticuerpo monoclonal anti-TGF-1 de ratón durante 2 horas en un agitador y después se incubaron 100 L de anticuerpo IgG de ratón marcado con biotina durante 45 minutos con agitación. Después de lavados consecutivos, se distribuyeron en cada pocillo 100 L de una solución de estreptavidina-peroxidasa y se incubaron durante 45 minutos con agitación. A continuación se realizaron 3 lavados y se añadieron 100 L de solución con sustrato de peroxidasa (TMB). Quince minutos después se añadió la solución de detención y se realizó la medición de absorbancia (450 nm). Los valores de concentración de las muestras se obtuvieron por extrapolación de la absorbancia en el gráfico lineal de la curva patrón.

Se realizó un estudio estadístico con el programa informático SPSSv12 (USA). Se realizaron comparaciones entre intragrupo con el ensayo con signos de Wilcoxon y comparaciones intergrupo con el ensayo de Kruskal-Wallis.

TABLA 11. Análisis de modulación del sistema inmunitario tras la ingestión de la mezcla F35/F47. Los grupos son los indicados anteriormente. Los datos se expresan como valores de la mediana e intervalo intercuartil entre paréntesis. (*) significa valores estadísticamente significativos (p<0,05).

Tiempo 1ª Semana.

Semana 12. Final del Semana 24.

tratamiento Eliminación por Grupo Comienzo lavado Placebo 67,8 61,0 64,3 (51,9-73,5) (59,6-71,8) (56,2-69,0) Dosis baja 71,1 67,7 64,7 CD3+ (56,5-73,1) (56,6-75,6) (58,6-73,3) Dosis alta 66,8 71,6 65,5 (59,1-75,6) (58,0-76,4) (59,5-70,1) Placebo 23,8 26,7 23,3 (20-28,19) (18,8-31,5) (19,0-29,2) Dosis baja 17,7 22,8 18,2 CD3+CD25+ (13,2-23,3) (15,1-34,4) (15,0-32,6) Dosis alta 21,6 24,3 19,4 (16,0-25,3) (15,1-28,2) (14,5-23,5) Placebo 37,7 34,1 37,5* (32,3-45,0) (27,8-43,3) (32,6-40,4) Dosis baja 37,5 36,1 36,1 CD4+ (27,4-46,8) (30,1-44,9) (30,8-45,2) Dosis alta 33,9 30,9 28,0 (22,9-38,8) (26,3-37,8) (24,9-38,4) Placebo 13,9 14,2 15,3 (10,3-22,4) (13,3-26,4) (12,4-22,3) Dosis baja 12,2 17,0* 14,3 CD4+CD25+ (8,9-18) (11,1-22,2) (10,2-21,9) Dosis alta 11,6 15,4 14,5 (10,6-20,2) (11,0-21,3) (9,8-20,1) Placebo 21,3 18,5 21,7 (12,2-26,3) (12,9-26,2) (13,2-28,4) Dosis baja 20,6 19,1 19,4 CD8+ (13,3-28,4) (12,3-30,4) (12,9-30,1) Dosis alta 22,2 24,4 24,5 (17,7-36,4) (21,7-36,9) (20,9-37,7) Placebo 3,3 3,2 3,1 (1,6-3,8) (2,2-4,5) (2,5-4,1) Dosis baja 3,4 3,7 3,9 CD8+CD25+ (2,2-5,9) (2,6-6,3) (2,3-4,9) Dosis alta 2,9 3,8* 3,6 (2,1-4,6) (1,9-6,0) (2,4-5,0) Placebo 6,3 6,4 6,4 (6,0-8,3) (6,2-10,7) (5,9-10,4) Dosis baja 5,9 6,8* 7,6 CD19+ (4,9-8,4) (6,2-9,1) (5,4-11,9) Dosis alta 6,7 6,8 6,7 (4,9-7,5) (4,8-7,9) (4,5-9,9) Placebo 19,1 18,4 18,4 CD56+ (10,3-33,6) (14,3-27,1) (15,5-26,9) Tiempo 1ª Semana.

Semana 12. Final del Semana 24.

tratamiento Eliminación por Grupo Comienzo lavado Dosis baja 17,2 19,5 15,2 (11,4-25,5) (11,4-27,9) (14,4-26,9) Dosis alta 16,4 19,8* 18,0 (10,4-24,4) (10,4-32,8) (12,5-23,5) Placebo 6,8 6,1 7,3 (6,3-8,3) (5,8-7,4) (5,9-8,6) Dosis baja 6,5 7,5* 7,5 HLA-DR+ (6,2-9,3) (6,9-9,2) (5,4-9,7) Dosis alta 6,1 6,3 6,0 (5,6-7,1) (5,6-7,0) (5,0-6,9) Placebo 16,5 14,1 10,2 (5,2-23,0) (3,8-19,1) (6,6-17,2) Dosis baja 25,9 12,5* 8,2 TGF- (15,7-31,2) (7,2-22,6) (6,9-15,3) Dosis alta 24,0 10,2* 8,4 (10,4-30,1) (5,8-16,7) (6,4-12,9) De acuerdo con estos datos, el tratamiento con una mezcla de las cepas F35 y F47 da como resultado una activación global del sistema inmunitario. Particularmente, las células CD4+ y las células CD8+ mostraron un aumento significativo de la actividad como se indica por la expresión de CD25. Los linfocitos B (CD19+) y los linfocitos asesinos naturales (CD56+) mostraron un aumento significativo en número y también se estimularon las células presentadoras de antígenos (HLA-DR+). Además, se observó una disminución significativa en la liberación de citoquinas pro-inflamatorias (TGF-). Este resultado, junto con la recuperación de la inmunidad celular, puede indicar que la regulación inmunitaria se desplaza desde un nivel más inespecífico (citoquinas) a un nivel más específico (celular). Los niveles de citoquinas IL-1 e IL-10 no fueron detectables en ningún grupo, puesto que estaban sanos los sujetos bajo estudio.

Se controlaron las defecaciones/semana durante el estudio clínico para evaluar la regulación del tránsito intestinal por la administración de la preparación. Los resultados (FIG. 5) demuestran que los sujetos complementados con la preparación tienen una mayor frecuencia en sus hábitos de defecación, lo que indica que las cepas de la invención tienen un efecto regulador del tránsito intestinal.

Considerados conjuntamente, estos datos demuestran que se regula la inmunidad sistémica debido a la interacción intestinal con una mezcla de cepas de Lactobacillus plantarum (F35 y F47), deteniendo la vía de señalización inmunitaria inflamatoria.

11. Evaluación in vitro de la capacidad de inmunomodulación de la producción de citoquinas de un probiótico en un modelo de mucosa intestinal

Como se explicará más adelante, los inventores descubrieron sorprendentemente un grupo de cepas de Lactobacillus plantarum que podían antagonizar la capacidad inflamatoria de algunas bacterias patógenas encontradas normalmente en el intestino. Estas cepas objeto de la invención comparten una actividad inmunomoduladora mejorada con respecto a otras cepas bacterianas relacionadas. La inmunomodulación se traduce en una inducción mejorada común del patrón de citoquinas de las células de la mucosa intestinal. Las dos cepas F35 y F47 promueven una disminución del TNF- y un aumento de los niveles IL-10. Este efecto se consigue usando las cepas en una forma viable, que es la forma que se ha de aplicar cuando se administran como probióticos a seres humanos. En el sentido de la invención, “forma viable” significa que las bacterias se usan vivas sin ningún tratamiento previo. Además, esta modulación común del patrón de citoquinas es mejor que la modulación observada por otro Lactobacillus plantarum ensayado en formas no viables.

Ciertos miembros de la microflora comensal intestinal están en contacto permanente con tejido linfoide asociado al Intestino (abreviadamente GALT por la expresión inglesa Gut Associated Lymphoid Tissue). Dependiendo de la composición de la microflora, hay un patrón de producción de citoquinas por el sistema inmunitario. Esta producción de citoquinas es desarrollad por los receptores de tipo Toll (abreviadamente TLR por sus iniciales en inglés Toll Like Receptors) de las células dendríticas, cuando reconocen estructuras de superficie específicas de las bacterias. En concreto, los receptores TLR más importantes en esta función son TLR-2 y TLR-4. Estos receptores reconocen moléculas, estructuras o residuos muy conservados a lo largo de los diferentes taxones microbianos, que se expresan en la superficie de los mismos y actúan como ligandos para TLR. Cuando TLR-2 y TLR-4 interaccionan con ciertos antígenos bacterianos, empiezan la producción de marcadores inflamatorios. En caso de que, como consecuencia de la composición de la microbiota, la producción de citoquinas sea excesiva, es posible que aparezcan lesiones en los tejidos como resultado de la inflamación y problemas inmunológicos. Estas lesiones llevan asociadas consecuencias importantes, incluyendo una menor eficacia de la respuesta del sistema inmunitario y una mayor tendencia a desarrollar enfermedades autoinmunitarias.

Se sabe que las bacterias Gram negativas muestran en su superficie celular la molécula LPS (lipopolisácarido). El LPS es una endotoxina reconocida por el sistema inmunitario como un riesgo potencial. Cuando el LPS interacciona con el TLR-2 y TLR-4, induce la producción de marcadores inflamatorios. En una composición de microflora comensal normal, los inventores encontramos microorganismos Gram-negativos; por consiguiente, existe contacto entre el sistema inmunitario asociado al tracto gastrointestinal y el lipopolisácarido (LPS).

El suplemento de probióticos puede cambiar esta situación para favorecer una mayor presencia de bacterias Gram- positivas (agrupadas en el grupo de bacterias de ácido láctico), con mejor estado ecológico o con propiedades antagonistas contra algunos microorganismos Gram-negativos, reduciendo de esta manera la presencia de LPS en la mucosa intestinal. Sin embargo, la configuración molecular y estructural de la superficie celular de algunos microorganismos probióticos, muestra la capacidad de modular per se la producción de moléculas de comunicación entre las células del sistema inmunitario (citoquinas) que se desplazan a un patrón más equilibrado entre la señalización pro/anti-inflamatoria (sin reducir el número de bacterias Gram-negativas).

Los receptores TLR-2 y TLR-4 se expresan comúnmente en la mucosa intestinal in vivo. Sin embargo, la mayoría de las líneas celulares usadas como modelo de mucosa intestinal, tales como HT-29 o Caco-2, no tienen la capacidad de producir citoquinas con o sin presencia de elementos de inducción. Por esta razón, los inventores seleccionaron una línea celular apropiada para desarrollar los ensayos in vitro que se muestran más adelante.

El modelo seleccionado es la línea celular de monocitos THP-1, debido a su sensibilidad a componentes bacterianos tales como LPS (como inductor de la respuesta inflamatoria), y a su susceptibilidad para modular su producción de citoquinas cuando hay moléculas en el medio adecuadas para la inducción de la producción de un patrón de citoquinas anti-inflamatorias.

Se propuso la hipótesis de que un probiótico (mezcla de F35 y F47, ahora denominado Lp 3547) tendría la capacidad de regular la producción de TNF- (respuesta inflamatoria), en un cultivo de THP-1 inducido con LPS, mostrando mejores resultados que Lactobacillus plantarum 299V (denominado 299V para los fines de la invención).

De hecho, los inventores querían evaluar si el efecto de las dos cepas juntas sería más fuerte que el efecto de cada cepa por separado y que el efecto de las cepas de la técnica anterior. En los siguientes experimentos con células probióticas Lp 3547 y THP-1, se usa como inductor LPS. Una razón de elegir el LPS es la alta reactividad que muestran las células contra esta molécula, de forma que proporciona una manera más sencilla de realizar las lecturas experimentales. La otra razón importante es que el LPS representa un elemento real de microbiota intestinal, porque como se ha indicado anteriormente en el intestino podemos encontrar bacterias Gram-negativas (con LPS).

La elección de Lactobacillus plantarum 299V como control del experimento se debió a su notoriedad como probiótico en el grupo taxonómico de Lactobacillus plantarum, el mismo al que pertenecen las cepas F35 y F47, así como el probiótico Lp 3547 que se ha de analizar..

La serie de experimentos se diseñó con la intención de obtener información útil, para la siguiente hipótesis: a) el probiótico Lp 3547 tiene una mayor capacidad de inmunomodulación que Lactobacillus plantarum 299V, en relación con la regulación de la expresión del perfil de citoquinas (relación entre citoquinas antiinflamatorias y proinflamatorias); y b) el efecto de las cepas integradas en el probiótico Lp 3547 (F35 y F47) muestra un mayor efecto que el efecto de las dos cepas por separado.

La primera etapa del experimento fue el crecimiento de células THP-1 obtenidas en ATCC (American Type Culture Collection). Se cultivaron en medio DMEM, hasta el momento óptimo para la realización del estudio de inmunomodulación. Las células se cultivaron en placas ELISA de 24 pocillos hasta una concentración final de aproximadamente 106 monocitos/pocillo.

Estas células, al principio del experimento, se estimulan con LPS diluido en 500 microlitros de medio DMEM hasta una concentración final de 10 ng/mL, durante 2,5 horas. Después de este tiempo, los pocillos se lavan tres veces con 0,5 mL de PBS. La siguiente etapa consiste en poner las células THP-1 en contacto con microorganismos probióticos. Las cepas probióticas se han cultivado previamente durante una noche (F35, F47 y L299V) en medio MRS a 37ºC con una atmósfera con 5% de CO2. Después de la incubación, se valora la concentración de microorganismos/mL usando la cámara de recuento de Neubauer, para calcular la dilución necesaria para obtener una relación ufc/monocitos de 25:1 (2,5 x 107), en 500 microlitros de DMEM, en los pocillos de ELISA con células THP-1. Cada dilución de F35, F47 y L299V se genera con medio DMEM complementado con gentamicina (50 microgramos/mL), ampicilina (10 microgramos/mL) y cloranfenicol (12 microgramos/mL) (abreviadamente G.A.C.). El argumento para usar estos antibióticos es evitar la proliferación de microorganismos que podrían alterar la homogeneidad de la relación 25:1. Estaba establecido que estos antibióticos eran inocuos para las células THP-1 y solo bacteriostáticos para las cepas L. plantarum F35 y F47 y L. plantarum 299V. El tiempo de coincubación de células THP-1 con probióticos es 24 horas, tomándose muestras de cada coincubación a las 6 horas y al final del experimento. Los tiempos estimados más adecuados para recoger las muestras del líquido sobrenadante y evaluar la producción de TNF- e IL-10, son 6 y 24 horas después de la adición de las cepas probióticas. La elección no es aleatoria, sino que es producto de un trabajo previo que estudió los tiempos en los que las diferencias y los valores de concentración de las interleuquinas son más evidentes (datos no mostrados). El líquido sobrenadante así obtenido se usa para detectar TNF- e IL-10 con un kit comercial que requiere un análisis por citometría de flujo, como el que se usa en el apartado 10 anterior, y realizar las etapas habituales bien conocidas por los expertos en la técnica.

Para la interpretación de los resultados obtenidos, se calculó la pendiente entre los valores obtenidos a las 6 y 24 horas, calculando posteriormente la pendiente normalizada. La pendiente normalizada se calcula con la siguiente fórmula: PN = ((1 – valor de IL a 24 h/valor de IL a 6 h)/24) x 100; donde PN es la pendiente normalizada, y el valor de IL es la concentración de la interleuquina 10 o de TNF- a las 6 o 24 horas. La razón de la selección de este método es obtener un valor estándar que permita una comparación transversal entre los experimentos (Tabla 13), puesto que es más interesante la evolución de la concentración de citoquinas que el valor absoluto de las mismas (pg/mL). En los valores obtenidos a las 6 horas, las células THP-1 están aún bajo inducción de LPS; entonces se eleva la concentración de TNF- y se disminuye la de IL-10. Es a las 24 horas cuando es posible observar la inversión del perfil de producción de citoquinas (disminución de TNF- y aumento de IL-10).

En la TABLA 12 se muestra esquemáticamente el diseño experimental de cada ensayo. Los ensayos, Exp. 1, Exp. 2, Exp. 3, Exp. 4 y Exp. 5, tienen el objetivo de atribuir la detección de citoquinas a su producción por células THP-1, y asegurar que los valores obtenidos no son un resultado de reacciones cruzadas con otros elementos integrales del experimento. El Exp. 6 representa los valores basales de la producción de citoquinas sin inductor ni probióticos (control negativo). El Exp. 7 representa el valor de producción de citoquinas por THP-1 cuando son inducidas por LPS (control positivo). El resto de ensayos (Exp. 8 – Exp. 13) corresponde a la evaluación de la modulación del perfil de citoquinas por las cepas probióticas ensayadas. Todos los valores mostrados son valores medios de duplicados en cada réplica realizada.

TABLA 12. Representación esquemática de los elementos experimentales usados en cada ensayo.

Componente THP1 G.A.C LPS Cepa 1 Cepa 2 Experimento Exp. 1 X X Exp. 2 X X L299V Exp. 3 X X F35 Exp. 4 X X F47 Exp. 5 X X F35 F47 Exp. 6 X Exp. 7 X X Exp. 8 X X X Exp. 9 X X X F35 Exp. 10 X X X F47 Exp. 11 X X X F35 F47 Exp. 12 X X X F35 F299V Exp. 13 X X X F47 F299V Exp. 14 X X X F299V

Análisis de IL-10 y TNF- en diferentes experimentos:

Con los resultados obtenidos en los 5 primeros experimentos, se demostró que no existen interacciones cruzadas en los métodos de evaluación con otros elementos usados en la experimentación, es decir, sólo pudieron determinarse variaciones de TNF- e IL-10 debido a la presencia de THP-1. La pendiente normalizada entre los valores obtenidos a las 6 y 24 horas fue nula para los experimentos 1-5 (sin THP), por tanto puede deducirse que no hay reacciones cruzadas.

En la TABLA 13 se muestran los valores de IL-10 y TNF- obtenidos para los experimentos 6 a 14 (Exp. 6 - Exp.

14).

TABLA 13. Análisis de la capacidad de inmunomodulación de diferentes probióticos y sus mezclas.

Exp.

24 horas 6 horas (24-6 horas) Pendiente Pendiente normalizada IL-10 TNF- IL-10 TNF- IL-10 TNF- IL-10 TNF- IL-10 TNF- (pg/mL) (pg/mL) (pg/mL) (pg/mL) (pg/mL) (pg/mL) (pg/mL) (pg/mL) (pg/mL) (pg/mL) Exp. 6 0,945 1,730 0,805 1,675 0,14 0,05 0,01 0,002 0,72 0,14 Exp. 7 1,045 1,830 0,915 1,675 0,13 0,16 0,01 0,01 0,59 0,39 Exp. 8 33,055 5613,53 18,02 5980,46 15,04 -366,03 0,63 -15,29 3,48 -0,26 Exp. 9 234,505 2042,395 27,755 3701,56 206,75 -1650,17 8,61 -69,13 31,04 -1,87 Exp.

283,70 2380,045 31,365 3927,345 252,34 -1547,30 10,51 -64,47 33,52 -1,64 Exp.

348,28 1054,155 28,11 3820,925 320,17 -2766,77 13,34 -115,28 47,46 -3,02 11 Exp.

423,94 3411,85 45,475 4605,655 378,47 -1193,81 15,77 -49,74 34,68 -1,08 12 Exp.

270,805 3175,83 32,25 4420,09 238,56 -1244,26 9,94 -51,84 30,82 -1,17 13 Exp.

232,93 4111,85 37,925 4693,815 195,01 -581,06 8,13 -24,25 21,42 -0,52 14 Antes de proceder a la interpretación de los resultados de los Exp. 6 a Exp. 14, es necesario subrayar los valores obtenidos en los experimentos 6, 7 y 8. En los dos primeros, es posible observar que la producción de IL-10 y TNF- es baja en células THP-1 sin LPS ni cepas probióticas (con o sin presencia de antibiótico; Exp. 6 – Exp. 7). Éste es un hecho importante para la interpretación de las pendientes normalizadas calculadas en los experimentos, puesto que el medio o la alta producción de interleuquinas por células THP-1 de una manera intrínseca podrían ocultar los valores experimentales obtenidos.

Los valores obtenidos en el experimento 8 (Exp. 8), en relación con el valor negativo obtenido en la pendiente normalizada de la producción de TNF-, se atribuyen al fenómeno negativo de retroalimentación, muy común en los sistemas biológicos. Es decir, la producción elevada de interleuquinas proinflamatorias por células THP-1 las conduce a una autorregulación de la producción de TNF-. Sin embargo, es necesario subrayar que, a pesar de una disminución de la concentración de la producción de TNF- a las 24 horas, los valores a las 6 y 24 horas en este Exp. 8 son los más elevados de todas las series experimentales. En este Exp. 8 el valor para IL-10 es menor que los obtenidos cuando las células THP-1 son inducidas por LPS y en presencia de cepas probióticas. De una forma neta, puede deducirse que la inducción con LPS conduce a una respuesta inflamatoria en células THP-1.

Basándose en estas primeras premisas, es posible comprender que el experimento 11 (Exp. 11) es el experimento en el que se observa una mayor inducción de la producción de IL-10 (entre las 6 y 24 horas) y una mayor disminución de la producción de TNF-. En el Exp. 11 las células se pusieron en contacto con el probiótico Lp 3547 (F35 + F47), después de una inducción de THP-1 con LPS.

Cuando se observan los valores obtenidos en los experimentos con las cepas F35 y F47 añadidas de forma independiente, los resultados demuestran que existe una función cooperativa cuando las dos cepas permanecen juntas (probiótico Lp 3547), puesto que los valores, cuando se añaden de forma individual, a pesar de ser buenos, no alcanzan los valores obtenidos cuando se usan conjuntamente. Esta función cooperativa no se detecta cuando cada una de ellas (F35 o F47) está en contacto con células THP-1 y con Lactobacillus plantarum 299V (Exp. 12 y Exp. 13). Aunque los valores obtenidos en los experimentos 12 (Exp. 12) y 13 (Exp. 13) son interesantes, son mucho menores que los obtenidos en el experimento 11 (Exp. 11).

Los valores obtenidos en el experimento 14, que corresponden al efecto de la cepa L299V cuando se usa individualmente, refuerzan la idea de la superioridad de inmunomodulación de las cepas F35 y F47 (Exp. 9 y Exp.

10) individualmente y, especialmente cuando se usan juntas (Exp. 11) en la forma probiótica Lp 3547. De hecho, por los resultados de la TABLA 13 se deduce claramente que el efecto de las dos cepas de Lactobacillus plantarum (F35 y F47) juntas (Lp 3547) es mayor que el efecto obtenido por cada cepa independientemente, o cuando se combina con Lactobacillus plantarum 299V, o cuando sólo se añade al medio L299V. Por consiguiente, puede concluirse que el uso de las dos cepas juntas implica una sinergia en la respuesta de las células THP-1 a la inducción con LPS.

La reducción observada en la respuesta inflamatoria inducida por la presencia de LPS y otras toxinas a nivel intestinal tiene un efecto directo a nivel sistémico. El efecto sobre el nivel sistémico evita desregulaciones inmunológicas, o la prosecución de un estado inflamatorio a largo plazo, que normalmente conduce a estados inflamatorios crónicos con implicación en enfermedades graves, tales como reacciones autoinmunitarias o lesiones intestinales, tales como el síndrome de Crohn.

Ha de ponerse énfasis en que los efectos descritos se han demostrado usando las cepas en una forma viable y sin ninguna alteración (tratamiento con ultrasonidos, purificación de fracciones, etc.). Esta forma viable imita la manera en la que el probiótico se administraría a un mamífero, incluyendo seres humanos. Éste es un hecho importante, puesto que podemos encontrar estudios con Lactobacillus plantarum 299V en los que la capacidad de esta cepa para provocar inmunomodulación por medio de la disminución de la expresión TNF- se ensaya con extractos de L299V, obteniéndose los extractos por un tratamiento con ultrasonidos de un sedimento bacteriano. Esto representa una situación irreal, ya que aunque es perfectamente aceptable que hay una pérdida de porcentaje de viabilidad de microorganismos durante el paso por el tracto gastrointestinal, esta pérdida no implica una ruptura de la célula ni una disgregación como la que se produce por un proceso de tratamiento con ultrasonidos.

Por lo tanto, los experimentos con la forma viable de las cepas mostradas en este apartado 11 representan un modelo más adecuado para estudiar el efecto de las mismas, y permitir la extrapolación al patrón de administración real en mamíferos, incluyendo seres humanos.

Listado de secuencias <110> CARINSA. Creaciones Aromáticas Industriales SA.

<120> Cepas de Lactobacillus plantarum como probióticos con efecto inmunomodulador específico <130> P1049PC00 <150> EP 07121817.6 <151> 29-11-2007 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 19 <212> ADN <213> Artificial <220> <223> Eub27f, cebador directo para amplificación del gen 16S <400> 1 gagtttgatc ctggctcag 19 <210> 2 <211> 22 <212> DNA <213> Artificial <220> <223> Eub1492r, cebador inverso para amplificación del gen 16S <400> 2 tacggytacc ttgttacgac tt 22 <210> 3 <211> 20 <212> ADN <213> Artificial <220> <223> cebador directo 27f para la secuenciación del gen 16S <400> 3 agagtttgat cctggctcag 20 <210> 4 <211> 57 <212> ADN <213> Artificial <220> <223> cebador directo 357f para la secuenciación del gen 16S <400> 4 cgcccgccgc gccccgcgcc cggcccgccg cccccgcccc cctacgggag gcagcag 57 <210> > 5 <211> 20 <212> ADN <213> Artificial <220> <223> cebador inverso 907r para la secuenciación del gen 16S <400> 5 ccgtcaattc ctttgagttt 20 <210> 6 <211> 19 <212> ADN <213> Artificial <220> <223> cebador inverso 1492r para la secuenciación del gen 16S <400> 6 ggttaccttg ttacgactt 19

REIVINDICACIONES 1. Una cepa de Lactobacillus plantarum depositada en la Colección Española de Cultivos Tipo (CECT) con el número de acceso CECT 7315.

2. Una cepa de Lactobacillus plantarum depositada en la Colección Española de Cultivos Tipo (CECT) con el número de acceso CECT 7316.

3. Un cultivo bacteriano que comprende la cepa de acuerdo con la reivindicación 1 o la cepa de acuerdo la reivindicación 2 o una de sus mezclas.

4. Un producto que comprende una cantidad eficaz de la cepa definida en la reivindicación 1 o de la cepa definida en la reivindicación 2 o de una de sus mezclas.

5. Un producto comestible que comprende una cantidad eficaz de la cepa definida en la reivindicación 1 o de la cepa definida en la reivindicación 2 o de una de sus mezclas, junto con cantidades apropiadas de otros ingredientes comestibles.

6. El producto comestible de acuerdo con la reivindicación 5, que se selecciona del grupo que consiste en un producto lácteo, un yogur, una cuajada, un queso, una leche fermentada, una leche en polvo, un producto fermentado basado en leche, un helado, un producto basado en cereales fermentado, un polvo basado en leche, una bebida, un aliño, una comida para mascotas, un suplemento dietético y una fórmula para niños.

7. Una composición farmacéutica que comprende una cantidad terapéuticamente eficaz de la cepa definida en la reivindicación 1 o de la cepa definida en la reivindicación 2 o de una de sus mezclas, junto con cantidades apropiadas de excipientes y/o vehículos farmacéuticos aceptables.

8. La cepa definida en cualquiera de las reivindicaciones 1-2, para uso en la industria alimentaria.

9. La cepa definida en cualquiera de las reivindicaciones 1-2, para uso como probiótico.

10. Una mezcla de las cepas definidas en las reivindicaciones 1 y 2, para uso en la industria alimentaria.

11. Una mezcla de las cepas definidas en las reivindicaciones 1 y 2, para uso como probiótico.

12. Uso de la cepa definida en cualquiera de las reivindicaciones 1-2, para la fabricación de un producto comestible.

13. Uso de una mezcla de las cepas definidas en las reivindicaciones 1 y 2, para la fabricación de un producto comestible.

14. Una cepa como la definida en cualquiera de las reivindicaciones 1-2, para uso como medicamento para potenciar el sistema inmunitario de un animal, incluyendo un ser humano.

15. Una mezcla de las cepas definidas en cualquiera de las reivindicaciones 1 y 2, para uso como medicamento para potenciar el sistema inmunitario de un animal, incluyendo un ser humano.

16. Un procedimiento para la preparación de un producto comestible, que comprende cultivar la cepa definida en la reivindicación 1 o la cepa definida en la reivindicación 2 o una de sus mezclas, en un medio adecuado.